>Feature sequence001 1635 631 gene locus_tag LOCUS_00010 1635 631 CDS product chlorohydrolase/aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906237.1 protein_id gnl|my_center|LOCUS_00010 2627 1704 gene locus_tag LOCUS_00020 2627 1704 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085362.1 protein_id gnl|my_center|LOCUS_00020 3820 2615 gene locus_tag LOCUS_00030 3820 2615 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_00030 3994 4725 gene locus_tag LOCUS_00040 3994 4725 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HKT5 protein_id gnl|my_center|LOCUS_00040 5360 4722 gene locus_tag LOCUS_00050 5360 4722 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727611.1 protein_id gnl|my_center|LOCUS_00050 5466 6953 gene locus_tag LOCUS_00060 gene proA 5466 6953 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R115 protein_id gnl|my_center|LOCUS_00060 8341 6950 gene locus_tag LOCUS_00070 8341 6950 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731301.1 protein_id gnl|my_center|LOCUS_00070 9201 8362 gene locus_tag LOCUS_00080 gene panC 9201 8362 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0G6 protein_id gnl|my_center|LOCUS_00080 10022 9207 gene locus_tag LOCUS_00090 gene panB 10022 9207 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIG6 protein_id gnl|my_center|LOCUS_00090 11519 10092 gene locus_tag LOCUS_00100 gene pnbA 11519 10092 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37967 protein_id gnl|my_center|LOCUS_00100 11559 12188 gene locus_tag LOCUS_00110 11559 12188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12706 12185 gene locus_tag LOCUS_00120 12706 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13064 12717 gene locus_tag LOCUS_00130 13064 12717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13307 14002 gene locus_tag LOCUS_00140 13307 14002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14040 14726 gene locus_tag LOCUS_00150 14040 14726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14765 15859 gene locus_tag LOCUS_00160 14765 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092054.1 protein_id gnl|my_center|LOCUS_00160 17323 15929 gene locus_tag LOCUS_00170 17323 15929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17611 18333 gene locus_tag LOCUS_00180 gene bdhA 17611 18333 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084310.1 protein_id gnl|my_center|LOCUS_00180 19460 18330 gene locus_tag LOCUS_00190 19460 18330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_00190 19552 20397 gene locus_tag LOCUS_00200 19552 20397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21202 20399 gene locus_tag LOCUS_00210 21202 20399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21180 21911 gene locus_tag LOCUS_00220 21180 21911 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085736.1 protein_id gnl|my_center|LOCUS_00220 21920 22447 gene locus_tag LOCUS_00230 21920 22447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23367 22444 gene locus_tag LOCUS_00240 23367 22444 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A316 protein_id gnl|my_center|LOCUS_00240 24059 23364 gene locus_tag LOCUS_00250 24059 23364 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338973.1 protein_id gnl|my_center|LOCUS_00250 24162 25523 gene locus_tag LOCUS_00260 24162 25523 CDS product inosine 5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027797.1 protein_id gnl|my_center|LOCUS_00260 25526 26170 gene locus_tag LOCUS_00270 gene cmk 25526 26170 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q49885 protein_id gnl|my_center|LOCUS_00270 26163 26852 gene locus_tag LOCUS_00280 26163 26852 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776485.1 protein_id gnl|my_center|LOCUS_00280 28091 26856 gene locus_tag LOCUS_00290 gene apeB 28091 26856 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XA76 protein_id gnl|my_center|LOCUS_00290 28758 28084 gene locus_tag LOCUS_00300 28758 28084 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_00300 28719 29489 gene locus_tag LOCUS_00310 28719 29489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 29773 29474 gene locus_tag LOCUS_00320 29773 29474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 29869 30390 gene locus_tag LOCUS_00330 gene mobA 29869 30390 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q835J2 protein_id gnl|my_center|LOCUS_00330 30393 30722 gene locus_tag LOCUS_00340 30393 30722 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162435.1 protein_id gnl|my_center|LOCUS_00340 30706 31890 gene locus_tag LOCUS_00350 gene rnd 30706 31890 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZV4 protein_id gnl|my_center|LOCUS_00350 31982 32176 gene locus_tag LOCUS_00360 31982 32176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 32210 34033 gene locus_tag LOCUS_00370 32210 34033 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_00370 34815 34048 gene locus_tag LOCUS_00380 34815 34048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8H2 protein_id gnl|my_center|LOCUS_00380 34871 35056 gene locus_tag LOCUS_00390 34871 35056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 36078 35053 gene locus_tag LOCUS_00400 36078 35053 CDS product Rossman fold protein, TIGR00730 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122653.1 protein_id gnl|my_center|LOCUS_00400 37186 36083 gene locus_tag LOCUS_00410 gene tal1 37186 36083 CDS product transaldolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O88018 protein_id gnl|my_center|LOCUS_00410 39075 37183 gene locus_tag LOCUS_00420 39075 37183 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227715.1 protein_id gnl|my_center|LOCUS_00420 40222 39140 gene locus_tag LOCUS_00430 40222 39140 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSH9 protein_id gnl|my_center|LOCUS_00430 41005 40244 gene locus_tag LOCUS_00440 41005 40244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 41067 41687 gene locus_tag LOCUS_00450 41067 41687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 41720 42493 gene locus_tag LOCUS_00460 41720 42493 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228494.1 protein_id gnl|my_center|LOCUS_00460 42554 44713 gene locus_tag LOCUS_00470 42554 44713 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226412.1 protein_id gnl|my_center|LOCUS_00470 44697 46118 gene locus_tag LOCUS_00480 44697 46118 CDS product peptidase S13 (D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701272.1 protein_id gnl|my_center|LOCUS_00480 46166 46507 gene locus_tag LOCUS_00490 46166 46507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 46510 46719 gene locus_tag LOCUS_00500 46510 46719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 46922 47698 gene locus_tag LOCUS_00510 46922 47698 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_00510 47940 47695 gene locus_tag LOCUS_00520 47940 47695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 48122 48718 gene locus_tag LOCUS_00530 48122 48718 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHX1 protein_id gnl|my_center|LOCUS_00530 49393 48722 gene locus_tag LOCUS_00540 49393 48722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 49517 49822 gene locus_tag LOCUS_00550 49517 49822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 50091 50576 gene locus_tag LOCUS_00560 50091 50576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00560 50579 53134 gene locus_tag LOCUS_00570 50579 53134 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_00570 53131 53730 gene locus_tag LOCUS_00580 53131 53730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 53748 54743 gene locus_tag LOCUS_00590 53748 54743 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_00590 54740 55942 gene locus_tag LOCUS_00600 54740 55942 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228841.1 protein_id gnl|my_center|LOCUS_00600 55988 57595 gene locus_tag LOCUS_00610 55988 57595 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_00610 57710 58162 gene locus_tag LOCUS_00620 57710 58162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 58167 58346 gene locus_tag LOCUS_00630 58167 58346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 58339 58758 gene locus_tag LOCUS_00640 58339 58758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 59537 58755 gene locus_tag LOCUS_00650 59537 58755 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730375.1 protein_id gnl|my_center|LOCUS_00650 61071 59581 gene locus_tag LOCUS_00660 61071 59581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 61135 61653 gene locus_tag LOCUS_00670 61135 61653 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_00670 61676 62464 gene locus_tag LOCUS_00680 61676 62464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 62774 62469 gene locus_tag LOCUS_00690 62774 62469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 63909 62854 gene locus_tag LOCUS_00700 63909 62854 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798984.1 protein_id gnl|my_center|LOCUS_00700 64079 64318 gene locus_tag LOCUS_00710 64079 64318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 64412 65662 gene locus_tag LOCUS_00720 64412 65662 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_00720 65900 68779 gene locus_tag LOCUS_00730 gene gcvP 65900 68779 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0E3 protein_id gnl|my_center|LOCUS_00730 68776 69195 gene locus_tag LOCUS_00740 68776 69195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 70219 69167 gene locus_tag LOCUS_00750 gene gcvT 70219 69167 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFJ5 protein_id gnl|my_center|LOCUS_00750 70674 70222 gene locus_tag LOCUS_00760 70674 70222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 71260 70769 gene locus_tag LOCUS_00770 71260 70769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_00770 72078 71263 gene locus_tag LOCUS_00780 72078 71263 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226818.1 protein_id gnl|my_center|LOCUS_00780 72566 72075 gene locus_tag LOCUS_00790 72566 72075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 72956 72579 gene locus_tag LOCUS_00800 gene gcvH 72956 72579 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH47 protein_id gnl|my_center|LOCUS_00800 73570 72974 gene locus_tag LOCUS_00810 73570 72974 CDS product putative phosphatidylglycerophosphate synthase PgsA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703133.1 protein_id gnl|my_center|LOCUS_00810 73595 74407 gene locus_tag LOCUS_00820 gene fabG 73595 74407 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893580.1 protein_id gnl|my_center|LOCUS_00820 74404 74805 gene locus_tag LOCUS_00830 74404 74805 CDS product putative HIT-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WML3 protein_id gnl|my_center|LOCUS_00830 75521 74802 gene locus_tag LOCUS_00840 gene yoqW 75521 74802 CDS product putative SOS response-associated peptidase YoqW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31916 protein_id gnl|my_center|LOCUS_00840 >Feature sequence002 386 916 gene locus_tag LOCUS_00850 386 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 913 2697 gene locus_tag LOCUS_00860 gene mmgC 913 2697 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 protein_id gnl|my_center|LOCUS_00860 3077 2694 gene locus_tag LOCUS_00870 3077 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_00870 3135 4541 gene locus_tag LOCUS_00880 gene gltX 3135 4541 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86528 protein_id gnl|my_center|LOCUS_00880 4550 5167 gene locus_tag LOCUS_00890 4550 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 5216 5290 gene locus_tag LOCUS_t00010 5216 5290 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5292 6122 gene locus_tag LOCUS_00900 5292 6122 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090003.1 protein_id gnl|my_center|LOCUS_00900 6131 7336 gene locus_tag LOCUS_00910 6131 7336 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727996.1 protein_id gnl|my_center|LOCUS_00910 8050 7505 gene locus_tag LOCUS_00920 8050 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 8157 8232 gene locus_tag LOCUS_t00020 8157 8232 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8254 9045 gene locus_tag LOCUS_00930 8254 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 9141 10640 gene locus_tag LOCUS_00940 9141 10640 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083814.1 protein_id gnl|my_center|LOCUS_00940 10781 11602 gene locus_tag LOCUS_00950 gene uppP2 10781 11602 CDS product undecaprenyl-diphosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE2 protein_id gnl|my_center|LOCUS_00950 11631 12989 gene locus_tag LOCUS_00960 11631 12989 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969771.1 protein_id gnl|my_center|LOCUS_00960 13922 12993 gene locus_tag LOCUS_00970 gene ssuD 13922 12993 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_00970 14666 13935 gene locus_tag LOCUS_00980 14666 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 15153 14677 gene locus_tag LOCUS_00990 15153 14677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 15171 15956 gene locus_tag LOCUS_01000 gene cobB2 15171 15956 CDS product NAD-dependent protein deacetylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJM9 protein_id gnl|my_center|LOCUS_01000 15975 17141 gene locus_tag LOCUS_01010 15975 17141 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_01010 17152 18300 gene locus_tag LOCUS_01020 17152 18300 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706818.1 protein_id gnl|my_center|LOCUS_01020 18311 20059 gene locus_tag LOCUS_01030 18311 20059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 22454 20049 gene locus_tag LOCUS_01040 22454 20049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 23362 22466 gene locus_tag LOCUS_01050 23362 22466 CDS product conserved hypthetical membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704126.1 protein_id gnl|my_center|LOCUS_01050 24212 23379 gene locus_tag LOCUS_01060 24212 23379 CDS product putative aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703644.1 protein_id gnl|my_center|LOCUS_01060 24175 24639 gene locus_tag LOCUS_01070 24175 24639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 24691 26274 gene locus_tag LOCUS_01080 24691 26274 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_01080 26283 26966 gene locus_tag LOCUS_01090 26283 26966 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808764.1 protein_id gnl|my_center|LOCUS_01090 29210 27117 gene locus_tag LOCUS_01100 29210 27117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 29878 29324 gene locus_tag LOCUS_01110 29878 29324 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214810.1 protein_id gnl|my_center|LOCUS_01110 30798 29878 gene locus_tag LOCUS_01120 gene dapD 30798 29878 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AQ99 protein_id gnl|my_center|LOCUS_01120 32303 30798 gene locus_tag LOCUS_01130 gene lysS 32303 30798 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q839A8 protein_id gnl|my_center|LOCUS_01130 32481 33713 gene locus_tag LOCUS_01140 32481 33713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 33719 35086 gene locus_tag LOCUS_01150 33719 35086 CDS product putative dihydrolipoamide dehydrogenase LpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704384.1 protein_id gnl|my_center|LOCUS_01150 36856 35087 gene locus_tag LOCUS_01160 36856 35087 CDS product acetyl-/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222846.1 protein_id gnl|my_center|LOCUS_01160 36867 37616 gene locus_tag LOCUS_01170 gene birA 36867 37616 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222884.1 protein_id gnl|my_center|LOCUS_01170 37705 38640 gene locus_tag LOCUS_01180 37705 38640 CDS product LytTR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222915.1 protein_id gnl|my_center|LOCUS_01180 40505 38637 gene locus_tag LOCUS_01190 40505 38637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 40855 41727 gene locus_tag LOCUS_01200 gene mca 40855 41727 CDS product mycothiol S-conjugate amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DI54 protein_id gnl|my_center|LOCUS_01200 42563 41724 gene locus_tag LOCUS_01210 42563 41724 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WD3 protein_id gnl|my_center|LOCUS_01210 43079 42573 gene locus_tag LOCUS_01220 43079 42573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 44281 43094 gene locus_tag LOCUS_01230 gene atoB 44281 43094 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225687.1 protein_id gnl|my_center|LOCUS_01230 44416 45117 gene locus_tag LOCUS_01240 44416 45117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 45153 46043 gene locus_tag LOCUS_01250 45153 46043 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226732.1 protein_id gnl|my_center|LOCUS_01250 46060 46791 gene locus_tag LOCUS_01260 46060 46791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228486.1 protein_id gnl|my_center|LOCUS_01260 47842 46817 gene locus_tag LOCUS_01270 47842 46817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 48695 47877 gene locus_tag LOCUS_01280 48695 47877 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893143.1 protein_id gnl|my_center|LOCUS_01280 48842 49012 gene locus_tag LOCUS_01290 48842 49012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 50432 48975 gene locus_tag LOCUS_01300 50432 48975 CDS product putative diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKB3 protein_id gnl|my_center|LOCUS_01300 50963 50445 gene locus_tag LOCUS_01310 50963 50445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 51838 50960 gene locus_tag LOCUS_01320 51838 50960 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257914.1 protein_id gnl|my_center|LOCUS_01320 52947 51835 gene locus_tag LOCUS_01330 52947 51835 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_01330 53843 52944 gene locus_tag LOCUS_01340 53843 52944 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111019.1 protein_id gnl|my_center|LOCUS_01340 53942 55111 gene locus_tag LOCUS_01350 53942 55111 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_01350 55118 56305 gene locus_tag LOCUS_01360 55118 56305 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730847.1 protein_id gnl|my_center|LOCUS_01360 56347 57444 gene locus_tag LOCUS_01370 56347 57444 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812034.1 protein_id gnl|my_center|LOCUS_01370 57441 58220 gene locus_tag LOCUS_01380 57441 58220 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797003.1 protein_id gnl|my_center|LOCUS_01380 58224 59078 gene locus_tag LOCUS_01390 58224 59078 CDS product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 protein_id gnl|my_center|LOCUS_01390 >Feature sequence003 448 1701 gene locus_tag LOCUS_01400 448 1701 CDS product linalool 8-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_01400 2026 1676 gene locus_tag LOCUS_01410 2026 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 2923 2114 gene locus_tag LOCUS_01420 2923 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 3034 3696 gene locus_tag LOCUS_01430 3034 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 6038 3705 gene locus_tag LOCUS_01440 6038 3705 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118806.1 protein_id gnl|my_center|LOCUS_01440 7741 6038 gene locus_tag LOCUS_01450 7741 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 10703 7869 gene locus_tag LOCUS_01460 gene nrdJ 10703 7869 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69981 protein_id gnl|my_center|LOCUS_01460 13446 11125 gene locus_tag LOCUS_01470 13446 11125 CDS product molybdopterin-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230850.1 protein_id gnl|my_center|LOCUS_01470 13478 14038 gene locus_tag LOCUS_01480 13478 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_01480 14483 14025 gene locus_tag LOCUS_01490 gene nrdR 14483 14025 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCZ3 protein_id gnl|my_center|LOCUS_01490 14899 14555 gene locus_tag LOCUS_01500 14899 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 15135 14941 gene locus_tag LOCUS_01510 15135 14941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 15077 15706 gene locus_tag LOCUS_01520 gene lexA 15077 15706 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q49848 protein_id gnl|my_center|LOCUS_01520 16827 15709 gene locus_tag LOCUS_01530 16827 15709 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_01530 18147 16834 gene locus_tag LOCUS_01540 gene hflX 18147 16834 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33230 protein_id gnl|my_center|LOCUS_01540 18959 18144 gene locus_tag LOCUS_01550 gene dapF 18959 18144 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM2 protein_id gnl|my_center|LOCUS_01550 19876 18959 gene locus_tag LOCUS_01560 gene miaA 19876 18959 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CY49 protein_id gnl|my_center|LOCUS_01560 21257 19881 gene locus_tag LOCUS_01570 gene miaB 21257 19881 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD05 protein_id gnl|my_center|LOCUS_01570 22456 21404 gene locus_tag LOCUS_01580 gene recA 22456 21404 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9REV6 protein_id gnl|my_center|LOCUS_01580 23033 22638 gene locus_tag LOCUS_01590 23033 22638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 24423 23050 gene locus_tag LOCUS_01600 24423 23050 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_01600 24548 24624 gene locus_tag LOCUS_t00030 24548 24624 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 24716 24791 gene locus_tag LOCUS_t00040 24716 24791 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 24810 25097 gene locus_tag LOCUS_01610 24810 25097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 25451 25098 gene locus_tag LOCUS_01620 25451 25098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 26627 25461 gene locus_tag LOCUS_01630 26627 25461 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224485.1 protein_id gnl|my_center|LOCUS_01630 26629 27369 gene locus_tag LOCUS_01640 26629 27369 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9K4 protein_id gnl|my_center|LOCUS_01640 27842 27378 gene locus_tag LOCUS_01650 27842 27378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 27862 28122 gene locus_tag LOCUS_01660 27862 28122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 28204 28443 gene locus_tag LOCUS_01670 28204 28443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 28729 28445 gene locus_tag LOCUS_01680 28729 28445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 29097 28786 gene locus_tag LOCUS_01690 29097 28786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105898.1 protein_id gnl|my_center|LOCUS_01690 29479 29132 gene locus_tag LOCUS_01700 gene rplS 29479 29132 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2Q6 protein_id gnl|my_center|LOCUS_01700 30281 29529 gene locus_tag LOCUS_01710 gene trmD 30281 29529 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV4 protein_id gnl|my_center|LOCUS_01710 30821 30297 gene locus_tag LOCUS_01720 gene rimM 30821 30297 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MB75 protein_id gnl|my_center|LOCUS_01720 31105 30827 gene locus_tag LOCUS_01730 31105 30827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 31379 31110 gene locus_tag LOCUS_01740 31379 31110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 32902 31460 gene locus_tag LOCUS_01750 gene ffh 32902 31460 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66845 protein_id gnl|my_center|LOCUS_01750 34327 32945 gene locus_tag LOCUS_01760 34327 32945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 35498 34371 gene locus_tag LOCUS_01770 35498 34371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 38989 35507 gene locus_tag LOCUS_01780 gene smc 38989 35507 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDK3 protein_id gnl|my_center|LOCUS_01780 39886 39038 gene locus_tag LOCUS_01790 39886 39038 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_01790 40586 39879 gene locus_tag LOCUS_01800 gene rnc 40586 39879 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBQ7 protein_id gnl|my_center|LOCUS_01800 40865 40596 gene locus_tag LOCUS_01810 40865 40596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 41917 40889 gene locus_tag LOCUS_01820 41917 40889 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_01820 42650 42132 gene locus_tag LOCUS_01830 42650 42132 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223688.1 protein_id gnl|my_center|LOCUS_01830 43256 42663 gene locus_tag LOCUS_01840 43256 42663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 43744 43256 gene locus_tag LOCUS_01850 gene coaD 43744 43256 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QV16 protein_id gnl|my_center|LOCUS_01850 44358 43741 gene locus_tag LOCUS_01860 44358 43741 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223682.1 protein_id gnl|my_center|LOCUS_01860 44305 44490 gene locus_tag LOCUS_01870 44305 44490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 45300 44494 gene locus_tag LOCUS_01880 45300 44494 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_01880 47477 45342 gene locus_tag LOCUS_01890 gene recG 47477 45342 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL48 protein_id gnl|my_center|LOCUS_01890 <48115 47470 gene locus_tag LOCUS_01900 <48115 47470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000623903.1:DAK2 domain-containing protein >Feature sequence004 1621 1028 gene locus_tag LOCUS_01910 1621 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 1764 4646 gene locus_tag LOCUS_01920 1764 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 4741 5289 gene locus_tag LOCUS_01930 4741 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 5298 5831 gene locus_tag LOCUS_01940 5298 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 5859 6752 gene locus_tag LOCUS_01950 5859 6752 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731476.1 protein_id gnl|my_center|LOCUS_01950 7104 6754 gene locus_tag LOCUS_01960 7104 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 7143 8708 gene locus_tag LOCUS_01970 gene guaA 7143 8708 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGP2 protein_id gnl|my_center|LOCUS_01970 8793 9893 gene locus_tag LOCUS_01980 8793 9893 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224088.1 protein_id gnl|my_center|LOCUS_01980 9915 10931 gene locus_tag LOCUS_01990 9915 10931 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_01990 10934 11671 gene locus_tag LOCUS_02000 10934 11671 CDS product putative dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704240.1 protein_id gnl|my_center|LOCUS_02000 12442 11672 gene locus_tag LOCUS_02010 12442 11672 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228934.1 protein_id gnl|my_center|LOCUS_02010 13167 12439 gene locus_tag LOCUS_02020 13167 12439 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L016 protein_id gnl|my_center|LOCUS_02020 13205 13399 gene locus_tag LOCUS_02030 13205 13399 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085690.1 protein_id gnl|my_center|LOCUS_02030 13402 14634 gene locus_tag LOCUS_02040 13402 14634 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_02040 14683 16950 gene locus_tag LOCUS_02050 14683 16950 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KY67 protein_id gnl|my_center|LOCUS_02050 16990 17418 gene locus_tag LOCUS_02060 16990 17418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 17922 17419 gene locus_tag LOCUS_02070 17922 17419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 17980 18381 gene locus_tag LOCUS_02080 17980 18381 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_02080 18385 19530 gene locus_tag LOCUS_02090 gene sucC 18385 19530 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R3M4 protein_id gnl|my_center|LOCUS_02090 19542 20441 gene locus_tag LOCUS_02100 gene sucD 19542 20441 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P677 protein_id gnl|my_center|LOCUS_02100 20442 21950 gene locus_tag LOCUS_02110 gene purH 20442 21950 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU9 protein_id gnl|my_center|LOCUS_02110 21971 22831 gene locus_tag LOCUS_02120 gene metF 21971 22831 CDS product 5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67422 protein_id gnl|my_center|LOCUS_02120 22844 24778 gene locus_tag LOCUS_02130 22844 24778 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814302.1 protein_id gnl|my_center|LOCUS_02130 24842 25828 gene locus_tag LOCUS_02140 gene mdh 24842 25828 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXI8 protein_id gnl|my_center|LOCUS_02140 25828 26541 gene locus_tag LOCUS_02150 25828 26541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816329.1 protein_id gnl|my_center|LOCUS_02150 26538 27029 gene locus_tag LOCUS_02160 26538 27029 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227996.1 protein_id gnl|my_center|LOCUS_02160 27423 27034 gene locus_tag LOCUS_02170 27423 27034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 29623 27500 gene locus_tag LOCUS_02180 gene hppA1 29623 27500 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_02180 29854 30633 gene locus_tag LOCUS_02190 29854 30633 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_02190 30665 32617 gene locus_tag LOCUS_02200 gene sdhA 30665 32617 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050920.1 protein_id gnl|my_center|LOCUS_02200 32614 33390 gene locus_tag LOCUS_02210 32614 33390 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_02210 33440 34864 gene locus_tag LOCUS_02220 33440 34864 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730585.1 protein_id gnl|my_center|LOCUS_02220 35419 34868 gene locus_tag LOCUS_02230 35419 34868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 >Feature sequence005 78 1430 gene locus_tag LOCUS_02240 gene hemL 78 1430 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MAS4 protein_id gnl|my_center|LOCUS_02240 1427 2026 gene locus_tag LOCUS_02250 1427 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 2839 2027 gene locus_tag LOCUS_02260 2839 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 3170 3646 gene locus_tag LOCUS_02270 3170 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 3653 4066 gene locus_tag LOCUS_02280 3653 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 4078 4860 gene locus_tag LOCUS_02290 4078 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 4876 5604 gene locus_tag LOCUS_02300 4876 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 5669 6514 gene locus_tag LOCUS_02310 5669 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 6517 7581 gene locus_tag LOCUS_02320 6517 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 7581 8396 gene locus_tag LOCUS_02330 7581 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 8400 8849 gene locus_tag LOCUS_02340 gene nuoA 8400 8849 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWD0 protein_id gnl|my_center|LOCUS_02340 8849 9430 gene locus_tag LOCUS_02350 gene nuoB 8849 9430 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYI7 protein_id gnl|my_center|LOCUS_02350 9433 9936 gene locus_tag LOCUS_02360 9433 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 9933 11261 gene locus_tag LOCUS_02370 gene nuoD 9933 11261 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVN5 protein_id gnl|my_center|LOCUS_02370 11261 11875 gene locus_tag LOCUS_02380 11261 11875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 11872 13269 gene locus_tag LOCUS_02390 11872 13269 CDS product NADH-quinone oxidoreductase, F subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702874.1 protein_id gnl|my_center|LOCUS_02390 13266 15632 gene locus_tag LOCUS_02400 gene nuoG 13266 15632 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYJ0 protein_id gnl|my_center|LOCUS_02400 15629 16858 gene locus_tag LOCUS_02410 gene nuoH 15629 16858 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAR1 protein_id gnl|my_center|LOCUS_02410 16858 17511 gene locus_tag LOCUS_02420 16858 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 17511 18050 gene locus_tag LOCUS_02430 17511 18050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 18047 18373 gene locus_tag LOCUS_02440 gene nuoK1 18047 18373 CDS product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G98 protein_id gnl|my_center|LOCUS_02440 18379 20289 gene locus_tag LOCUS_02450 gene nuoL-1 18379 20289 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_02450 20289 21839 gene locus_tag LOCUS_02460 gene nuoM-1 20289 21839 CDS product NADH:ubiquinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_02460 21839 23332 gene locus_tag LOCUS_02470 gene nuoN 21839 23332 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAR7 protein_id gnl|my_center|LOCUS_02470 24023 23334 gene locus_tag LOCUS_02480 24023 23334 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731464.1 protein_id gnl|my_center|LOCUS_02480 25231 24020 gene locus_tag LOCUS_02490 25231 24020 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259722.1 protein_id gnl|my_center|LOCUS_02490 25252 25953 gene locus_tag LOCUS_02500 25252 25953 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 protein_id gnl|my_center|LOCUS_02500 26013 26381 gene locus_tag LOCUS_02510 gene ndhC 26013 26381 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NML7 protein_id gnl|my_center|LOCUS_02510 26398 26952 gene locus_tag LOCUS_02520 26398 26952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 26936 27589 gene locus_tag LOCUS_02530 26936 27589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 27586 28758 gene locus_tag LOCUS_02540 gene nuoD1 27586 28758 CDS product NADH-quinone oxidoreductase subunit D 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X853 protein_id gnl|my_center|LOCUS_02540 28758 29819 gene locus_tag LOCUS_02550 gene nuoH 28758 29819 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAY9 protein_id gnl|my_center|LOCUS_02550 29819 30310 gene locus_tag LOCUS_02560 gene nuoI2 29819 30310 CDS product NADH-quinone oxidoreductase subunit I 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2V8 protein_id gnl|my_center|LOCUS_02560 30310 30822 gene locus_tag LOCUS_02570 30310 30822 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_02570 30825 31124 gene locus_tag LOCUS_02580 gene ndhE 30825 31124 CDS product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMW3 protein_id gnl|my_center|LOCUS_02580 >Feature sequence006 44 448 gene locus_tag LOCUS_02590 44 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 453 1778 gene locus_tag LOCUS_02600 gene argG 453 1778 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D7Y5 protein_id gnl|my_center|LOCUS_02600 2866 1718 gene locus_tag LOCUS_02610 2866 1718 CDS product glutamate carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225315.1 protein_id gnl|my_center|LOCUS_02610 3999 2887 gene locus_tag LOCUS_02620 gene menC 3999 2887 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2S6 protein_id gnl|my_center|LOCUS_02620 4102 4016 gene locus_tag LOCUS_t00050 4102 4016 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4487 4113 gene locus_tag LOCUS_02630 4487 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 4562 5497 gene locus_tag LOCUS_02640 4562 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 6131 5499 gene locus_tag LOCUS_02650 6131 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 7332 6277 gene locus_tag LOCUS_02660 7332 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 7705 7388 gene locus_tag LOCUS_02670 7705 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 8073 7834 gene locus_tag LOCUS_02680 8073 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 8177 10138 gene locus_tag LOCUS_02690 8177 10138 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803998.1 protein_id gnl|my_center|LOCUS_02690 10534 10142 gene locus_tag LOCUS_02700 10534 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 11021 10527 gene locus_tag LOCUS_02710 gene mmyF 11021 10527 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_02710 11884 11045 gene locus_tag LOCUS_02720 11884 11045 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_02720 11971 12849 gene locus_tag LOCUS_02730 11971 12849 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728075.1 protein_id gnl|my_center|LOCUS_02730 13699 12836 gene locus_tag LOCUS_02740 13699 12836 CDS product (Fe-S)-cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257325.1 protein_id gnl|my_center|LOCUS_02740 14202 13687 gene locus_tag LOCUS_02750 14202 13687 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_02750 15406 14213 gene locus_tag LOCUS_02760 15406 14213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 16448 15399 gene locus_tag LOCUS_02770 16448 15399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 16528 18129 gene locus_tag LOCUS_02780 gene caiA 16528 18129 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274139.1 protein_id gnl|my_center|LOCUS_02780 18810 18130 gene locus_tag LOCUS_02790 18810 18130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 19234 18821 gene locus_tag LOCUS_02800 19234 18821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02800 19419 19225 gene locus_tag LOCUS_02810 19419 19225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 19511 20560 gene locus_tag LOCUS_02820 gene citE 19511 20560 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222030.1 protein_id gnl|my_center|LOCUS_02820 20586 21452 gene locus_tag LOCUS_02830 gene citE 20586 21452 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_02830 22081 21494 gene locus_tag LOCUS_02840 22081 21494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 22385 22068 gene locus_tag LOCUS_02850 22385 22068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 23118 22450 gene locus_tag LOCUS_02860 23118 22450 CDS product putative carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67802 protein_id gnl|my_center|LOCUS_02860 23971 23165 gene locus_tag LOCUS_02870 23971 23165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 24034 24504 gene locus_tag LOCUS_02880 24034 24504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 24497 26989 gene locus_tag LOCUS_02890 gene hrpB 24497 26989 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_02890 27024 28664 gene locus_tag LOCUS_02900 27024 28664 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBN4 protein_id gnl|my_center|LOCUS_02900 29741 28665 gene locus_tag LOCUS_02910 29741 28665 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838029.1 protein_id gnl|my_center|LOCUS_02910 30605 29787 gene locus_tag LOCUS_02920 30605 29787 CDS product putative enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701069.1 protein_id gnl|my_center|LOCUS_02920 <31239 30608 gene locus_tag LOCUS_02930 <31239 30608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224861.1:LLM class F420-dependent oxidoreductase >Feature sequence007 2579 1599 gene locus_tag LOCUS_02940 gene terC 2579 1599 CDS product tellurium resistance protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225050.1 protein_id gnl|my_center|LOCUS_02940 5237 2598 gene locus_tag LOCUS_02950 gene ppdK 5237 2598 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546740.1 protein_id gnl|my_center|LOCUS_02950 5369 6331 gene locus_tag LOCUS_02960 5369 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 7075 6305 gene locus_tag LOCUS_02970 7075 6305 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037285.1 protein_id gnl|my_center|LOCUS_02970 8601 7072 gene locus_tag LOCUS_02980 8601 7072 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028114.1 protein_id gnl|my_center|LOCUS_02980 8987 8598 gene locus_tag LOCUS_02990 gene hisI 8987 8598 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3T1 protein_id gnl|my_center|LOCUS_02990 9013 9642 gene locus_tag LOCUS_03000 9013 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112747.1 protein_id gnl|my_center|LOCUS_03000 10416 9643 gene locus_tag LOCUS_03010 gene hisF 10416 9643 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q92 protein_id gnl|my_center|LOCUS_03010 11123 10413 gene locus_tag LOCUS_03020 gene hisA 11123 10413 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WD26 protein_id gnl|my_center|LOCUS_03020 11746 11120 gene locus_tag LOCUS_03030 gene hisH 11746 11120 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S299 protein_id gnl|my_center|LOCUS_03030 12360 11743 gene locus_tag LOCUS_03040 gene hisB 12360 11743 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGV9 protein_id gnl|my_center|LOCUS_03040 13460 12393 gene locus_tag LOCUS_03050 gene hisC 13460 12393 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16246 protein_id gnl|my_center|LOCUS_03050 13681 13490 gene locus_tag LOCUS_03060 13681 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 14368 13706 gene locus_tag LOCUS_03070 gene nth 14368 13706 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NTL4 protein_id gnl|my_center|LOCUS_03070 14419 15315 gene locus_tag LOCUS_03080 gene mshD 14419 15315 CDS product mycothiol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZV0 protein_id gnl|my_center|LOCUS_03080 15319 16374 gene locus_tag LOCUS_03090 gene rlmN 15319 16374 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFY6 protein_id gnl|my_center|LOCUS_03090 16703 16362 gene locus_tag LOCUS_03100 16703 16362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 17653 16700 gene locus_tag LOCUS_03110 17653 16700 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728130.1 protein_id gnl|my_center|LOCUS_03110 17784 18491 gene locus_tag LOCUS_03120 17784 18491 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805182.1 protein_id gnl|my_center|LOCUS_03120 18904 18479 gene locus_tag LOCUS_03130 18904 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 19353 18910 gene locus_tag LOCUS_03140 19353 18910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 20047 19427 gene locus_tag LOCUS_03150 20047 19427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 20951 20028 gene locus_tag LOCUS_03160 20951 20028 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861134.1 protein_id gnl|my_center|LOCUS_03160 22999 20969 gene locus_tag LOCUS_03170 22999 20969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 24240 23005 gene locus_tag LOCUS_03180 24240 23005 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257556.1 protein_id gnl|my_center|LOCUS_03180 25493 24321 gene locus_tag LOCUS_03190 gene potA 25493 24321 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXF4 protein_id gnl|my_center|LOCUS_03190 25518 26900 gene locus_tag LOCUS_03200 gene argD 25518 26900 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226084.1 protein_id gnl|my_center|LOCUS_03200 28334 26907 gene locus_tag LOCUS_03210 28334 26907 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_03210 28410 29531 gene locus_tag LOCUS_03220 gene ald 28410 29531 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA67 protein_id gnl|my_center|LOCUS_03220 29541 30761 gene locus_tag LOCUS_03230 29541 30761 CDS product cytochrome P450 hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729646.1 protein_id gnl|my_center|LOCUS_03230 >Feature sequence008 54 665 gene locus_tag LOCUS_03240 54 665 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230062.1 protein_id gnl|my_center|LOCUS_03240 1106 666 gene locus_tag LOCUS_03250 1106 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 2096 1110 gene locus_tag LOCUS_03260 2096 1110 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_03260 2934 2155 gene locus_tag LOCUS_03270 2934 2155 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027093.1 protein_id gnl|my_center|LOCUS_03270 2990 4150 gene locus_tag LOCUS_03280 2990 4150 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_03280 4147 5202 gene locus_tag LOCUS_03290 gene mnmA 4147 5202 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFH2 protein_id gnl|my_center|LOCUS_03290 6043 5192 gene locus_tag LOCUS_03300 6043 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 6159 7202 gene locus_tag LOCUS_03310 6159 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546406.1 protein_id gnl|my_center|LOCUS_03310 7239 9296 gene locus_tag LOCUS_03320 gene ligA 7239 9296 CDS product DNA ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUW7 protein_id gnl|my_center|LOCUS_03320 9772 9293 gene locus_tag LOCUS_03330 9772 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 9841 11934 gene locus_tag LOCUS_03340 9841 11934 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921992.1 protein_id gnl|my_center|LOCUS_03340 11981 12871 gene locus_tag LOCUS_03350 11981 12871 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701133.1 protein_id gnl|my_center|LOCUS_03350 12895 14409 gene locus_tag LOCUS_03360 12895 14409 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_03360 14813 14406 gene locus_tag LOCUS_03370 14813 14406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 14895 16466 gene locus_tag LOCUS_03380 14895 16466 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z564 protein_id gnl|my_center|LOCUS_03380 17281 16472 gene locus_tag LOCUS_03390 gene pyrF 17281 16472 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MAW1 protein_id gnl|my_center|LOCUS_03390 17475 17284 gene locus_tag LOCUS_03400 17475 17284 CDS product 2(4Fe-4S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546194.1 protein_id gnl|my_center|LOCUS_03400 19212 17521 gene locus_tag LOCUS_03410 gene leuA 19212 17521 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CB76 protein_id gnl|my_center|LOCUS_03410 19610 19458 gene locus_tag LOCUS_03420 19610 19458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 19884 21074 gene locus_tag LOCUS_03430 19884 21074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 21151 21624 gene locus_tag LOCUS_03440 21151 21624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 22226 21639 gene locus_tag LOCUS_03450 gene leuD 22226 21639 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86535 protein_id gnl|my_center|LOCUS_03450 23626 22223 gene locus_tag LOCUS_03460 gene leuC 23626 22223 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUY9 protein_id gnl|my_center|LOCUS_03460 23653 24324 gene locus_tag LOCUS_03470 23653 24324 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415115.1 protein_id gnl|my_center|LOCUS_03470 24362 24862 gene locus_tag LOCUS_03480 24362 24862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 24921 25895 gene locus_tag LOCUS_03490 gene nadA 24921 25895 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MBY3 protein_id gnl|my_center|LOCUS_03490 25882 27519 gene locus_tag LOCUS_03500 gene nadB 25882 27519 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8N8 protein_id gnl|my_center|LOCUS_03500 27519 28439 gene locus_tag LOCUS_03510 27519 28439 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975452.1 protein_id gnl|my_center|LOCUS_03510 29815 28436 gene locus_tag LOCUS_03520 29815 28436 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704045.1 protein_id gnl|my_center|LOCUS_03520 <30618 29812 gene locus_tag LOCUS_03530 <30618 29812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224379.1:hydrolase/acyltransferase >Feature sequence009 <1 2752 gene locus_tag LOCUS_03540 <1 2752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028725.1:integral membrane regulatory protein 2749 4212 gene locus_tag LOCUS_03550 2749 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 4212 4661 gene locus_tag LOCUS_03560 4212 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 6577 4658 gene locus_tag LOCUS_03570 gene ftsH 6577 4658 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJQ4 protein_id gnl|my_center|LOCUS_03570 6689 6889 gene locus_tag LOCUS_03580 6689 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 6904 7605 gene locus_tag LOCUS_03590 6904 7605 CDS product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886082.1 protein_id gnl|my_center|LOCUS_03590 7612 10083 gene locus_tag LOCUS_03600 7612 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 10083 11450 gene locus_tag LOCUS_03610 gene manB 10083 11450 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_03610 11469 11705 gene locus_tag LOCUS_03620 11469 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 11798 13246 gene locus_tag LOCUS_03630 gene ahcY 11798 13246 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZM1 protein_id gnl|my_center|LOCUS_03630 13951 13301 gene locus_tag LOCUS_03640 13951 13301 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 protein_id gnl|my_center|LOCUS_03640 13950 14477 gene locus_tag LOCUS_03650 13950 14477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 15128 14478 gene locus_tag LOCUS_03660 15128 14478 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081157.1 protein_id gnl|my_center|LOCUS_03660 15209 17992 gene locus_tag LOCUS_03670 gene secA1 15209 17992 CDS product protein translocase subunit SecA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71533 protein_id gnl|my_center|LOCUS_03670 18020 19120 gene locus_tag LOCUS_03680 gene prfB 18020 19120 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53915 protein_id gnl|my_center|LOCUS_03680 19185 19862 gene locus_tag LOCUS_03690 gene ftsE 19185 19862 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082104.1 protein_id gnl|my_center|LOCUS_03690 19859 20764 gene locus_tag LOCUS_03700 gene ftsX 19859 20764 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7B4 protein_id gnl|my_center|LOCUS_03700 20807 21667 gene locus_tag LOCUS_03710 20807 21667 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_03710 21671 22075 gene locus_tag LOCUS_03720 21671 22075 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896076.1 protein_id gnl|my_center|LOCUS_03720 22894 22076 gene locus_tag LOCUS_03730 22894 22076 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109300.1 protein_id gnl|my_center|LOCUS_03730 23858 22908 gene locus_tag LOCUS_03740 gene menB 23858 22908 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHD8 protein_id gnl|my_center|LOCUS_03740 23852 24373 gene locus_tag LOCUS_03750 23852 24373 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919410.1 protein_id gnl|my_center|LOCUS_03750 26203 24374 gene locus_tag LOCUS_03760 26203 24374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 26451 26807 gene locus_tag LOCUS_03770 26451 26807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 26821 27711 gene locus_tag LOCUS_03780 26821 27711 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940938.1 protein_id gnl|my_center|LOCUS_03780 27758 29203 gene locus_tag LOCUS_03790 27758 29203 CDS product putative acid-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703051.1 protein_id gnl|my_center|LOCUS_03790 30077 29193 gene locus_tag LOCUS_03800 30077 29193 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727077.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence010 754 113 gene locus_tag LOCUS_03810 754 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412664.1 protein_id gnl|my_center|LOCUS_03810 3705 757 gene locus_tag LOCUS_03820 3705 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 4866 3709 gene locus_tag LOCUS_03830 4866 3709 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460395.1 protein_id gnl|my_center|LOCUS_03830 5426 4863 gene locus_tag LOCUS_03840 5426 4863 CDS product ribosome maturation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_03840 5558 7321 gene locus_tag LOCUS_03850 gene proS 5558 7321 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZ25 protein_id gnl|my_center|LOCUS_03850 7325 8356 gene locus_tag LOCUS_03860 7325 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 9564 8353 gene locus_tag LOCUS_03870 gene ispG 9564 8353 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NP12 protein_id gnl|my_center|LOCUS_03870 10841 9594 gene locus_tag LOCUS_03880 gene rip1 10841 9594 CDS product zinc metalloprotease Rip1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CBU4 protein_id gnl|my_center|LOCUS_03880 11980 10838 gene locus_tag LOCUS_03890 gene dxr 11980 10838 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H0 protein_id gnl|my_center|LOCUS_03890 13227 11971 gene locus_tag LOCUS_03900 13227 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 13833 13276 gene locus_tag LOCUS_03910 gene frr 13833 13276 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0T5 protein_id gnl|my_center|LOCUS_03910 14555 13830 gene locus_tag LOCUS_03920 gene pyrH 14555 13830 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q831V1 protein_id gnl|my_center|LOCUS_03920 15345 14557 gene locus_tag LOCUS_03930 gene tsf 15345 14557 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31213 protein_id gnl|my_center|LOCUS_03930 16208 15348 gene locus_tag LOCUS_03940 gene rpsB 16208 15348 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2R1 protein_id gnl|my_center|LOCUS_03940 17591 16839 gene locus_tag LOCUS_03950 gene whiG 17591 16839 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17211 protein_id gnl|my_center|LOCUS_03950 18904 17588 gene locus_tag LOCUS_03960 18904 17588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 20032 18929 gene locus_tag LOCUS_03970 20032 18929 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_03970 21540 20035 gene locus_tag LOCUS_03980 21540 20035 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_03980 21624 22061 gene locus_tag LOCUS_03990 21624 22061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 22640 22068 gene locus_tag LOCUS_04000 gene clpP2 22640 22068 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NN01 protein_id gnl|my_center|LOCUS_04000 22633 23241 gene locus_tag LOCUS_04010 22633 23241 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R248 protein_id gnl|my_center|LOCUS_04010 24524 23238 gene locus_tag LOCUS_04020 24524 23238 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902360.1 protein_id gnl|my_center|LOCUS_04020 26072 24531 gene locus_tag LOCUS_04030 26072 24531 CDS product pyridoxal-5'-phosphate-dependent protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_04030 26136 26210 gene locus_tag LOCUS_t00060 26136 26210 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26212 27225 gene locus_tag LOCUS_04040 26212 27225 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929812.1 protein_id gnl|my_center|LOCUS_04040 27804 27211 gene locus_tag LOCUS_04050 gene rdgB 27804 27211 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3D3 protein_id gnl|my_center|LOCUS_04050 28574 27813 gene locus_tag LOCUS_04060 gene rph 28574 27813 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5T5 protein_id gnl|my_center|LOCUS_04060 29427 28606 gene locus_tag LOCUS_04070 gene murI 29427 28606 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7ME08 protein_id gnl|my_center|LOCUS_04070 >Feature sequence011 917 597 gene locus_tag LOCUS_04080 917 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 1990 914 gene locus_tag LOCUS_04090 1990 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 2341 2003 gene locus_tag LOCUS_04100 2341 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3760 2360 gene locus_tag LOCUS_04110 3760 2360 CDS product putative FeS assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703482.1 protein_id gnl|my_center|LOCUS_04110 3869 4966 gene locus_tag LOCUS_04120 gene ychF 3869 4966 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03CJ4 protein_id gnl|my_center|LOCUS_04120 4987 5349 gene locus_tag LOCUS_04130 4987 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 5336 6196 gene locus_tag LOCUS_04140 gene rsmI 5336 6196 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR7 protein_id gnl|my_center|LOCUS_04140 6193 6963 gene locus_tag LOCUS_04150 6193 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704723.1 protein_id gnl|my_center|LOCUS_04150 7763 6960 gene locus_tag LOCUS_04160 7763 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030273.1 protein_id gnl|my_center|LOCUS_04160 7838 9346 gene locus_tag LOCUS_04170 gene metG 7838 9346 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5Y7 protein_id gnl|my_center|LOCUS_04170 9343 10119 gene locus_tag LOCUS_04180 gene tatD 9343 10119 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899122.1 protein_id gnl|my_center|LOCUS_04180 10124 10630 gene locus_tag LOCUS_04190 10124 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 10627 11457 gene locus_tag LOCUS_04200 gene rsmA 10627 11457 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3R5 protein_id gnl|my_center|LOCUS_04200 11454 12182 gene locus_tag LOCUS_04210 gene ispE 11454 12182 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T924 protein_id gnl|my_center|LOCUS_04210 12318 12106 gene locus_tag LOCUS_04220 12318 12106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 12375 12446 gene locus_tag LOCUS_t00070 12375 12446 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12487 13263 gene locus_tag LOCUS_04230 12487 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 13334 14326 gene locus_tag LOCUS_04240 gene prs 13334 14326 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MC73 protein_id gnl|my_center|LOCUS_04240 14410 15048 gene locus_tag LOCUS_04250 gene rplY 14410 15048 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMC2 protein_id gnl|my_center|LOCUS_04250 15117 15689 gene locus_tag LOCUS_04260 gene pth 15117 15689 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHN7 protein_id gnl|my_center|LOCUS_04260 15686 19117 gene locus_tag LOCUS_04270 gene mfd 15686 19117 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G5I7 protein_id gnl|my_center|LOCUS_04270 19127 20038 gene locus_tag LOCUS_04280 19127 20038 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814873.1 protein_id gnl|my_center|LOCUS_04280 20038 21483 gene locus_tag LOCUS_04290 20038 21483 CDS product MazG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001256016.1 protein_id gnl|my_center|LOCUS_04290 21494 22774 gene locus_tag LOCUS_04300 gene eno 21494 22774 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RR60 protein_id gnl|my_center|LOCUS_04300 22830 23327 gene locus_tag LOCUS_04310 22830 23327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 23418 25703 gene locus_tag LOCUS_04320 gene cutL 23418 25703 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_04320 25746 26204 gene locus_tag LOCUS_04330 25746 26204 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_04330 26218 27042 gene locus_tag LOCUS_04340 gene cutM 26218 27042 CDS product carbon-monoxide dehydrogenase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_04340 27362 27069 gene locus_tag LOCUS_04350 27362 27069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 27749 27372 gene locus_tag LOCUS_04360 27749 27372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence012 806 24 gene locus_tag LOCUS_04370 806 24 CDS product glutamate formiminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836511.1 protein_id gnl|my_center|LOCUS_04370 854 1027 gene locus_tag LOCUS_04380 854 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 1323 1033 gene locus_tag LOCUS_04390 1323 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 1611 1877 gene locus_tag LOCUS_04400 1611 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 1983 4058 gene locus_tag LOCUS_04410 gene ppk 1983 4058 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65769 protein_id gnl|my_center|LOCUS_04410 4164 4901 gene locus_tag LOCUS_04420 4164 4901 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MI25 protein_id gnl|my_center|LOCUS_04420 4923 6041 gene locus_tag LOCUS_04430 4923 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6058 6783 gene locus_tag LOCUS_04440 6058 6783 CDS product sensory transduction protein RegX3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704775.1 protein_id gnl|my_center|LOCUS_04440 6793 8028 gene locus_tag LOCUS_04450 6793 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 9154 7976 gene locus_tag LOCUS_04460 9154 7976 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_04460 9988 9191 gene locus_tag LOCUS_04470 9988 9191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 10074 10556 gene locus_tag LOCUS_04480 10074 10556 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_04480 10553 10762 gene locus_tag LOCUS_04490 10553 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 10796 11800 gene locus_tag LOCUS_04500 10796 11800 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976188.1 protein_id gnl|my_center|LOCUS_04500 12977 11781 gene locus_tag LOCUS_04510 12977 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031788.1 protein_id gnl|my_center|LOCUS_04510 13841 12981 gene locus_tag LOCUS_04520 gene tesB 13841 12981 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_04520 13864 14508 gene locus_tag LOCUS_04530 13864 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_04530 15581 14505 gene locus_tag LOCUS_04540 15581 14505 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_04540 16315 15578 gene locus_tag LOCUS_04550 16315 15578 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 protein_id gnl|my_center|LOCUS_04550 17603 16317 gene locus_tag LOCUS_04560 17603 16317 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_04560 19055 17616 gene locus_tag LOCUS_04570 gene lnt 19055 17616 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EX26 protein_id gnl|my_center|LOCUS_04570 19576 19052 gene locus_tag LOCUS_04580 19576 19052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 20927 19536 gene locus_tag LOCUS_04590 gene hemY 20927 19536 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228080.1 protein_id gnl|my_center|LOCUS_04590 21853 20924 gene locus_tag LOCUS_04600 gene hemH2 21853 20924 CDS product ferrochelatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81GN7 protein_id gnl|my_center|LOCUS_04600 22887 21850 gene locus_tag LOCUS_04610 gene hemE 22887 21850 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4L8 protein_id gnl|my_center|LOCUS_04610 23838 22924 gene locus_tag LOCUS_04620 23838 22924 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223903.1 protein_id gnl|my_center|LOCUS_04620 23913 24233 gene locus_tag LOCUS_04630 23913 24233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 24255 25013 gene locus_tag LOCUS_04640 24255 25013 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_04640 25010 25852 gene locus_tag LOCUS_04650 25010 25852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 25845 26648 gene locus_tag LOCUS_04660 25845 26648 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893601.1 protein_id gnl|my_center|LOCUS_04660 26696 27007 gene locus_tag LOCUS_04670 gene gatC 26696 27007 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDV3 protein_id gnl|my_center|LOCUS_04670 >Feature sequence013 <1 553 gene locus_tag LOCUS_04680 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9ADG3:phosphoadenosine phosphosulfate reductase 580 1515 gene locus_tag LOCUS_04690 gene cysD 580 1515 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R242 protein_id gnl|my_center|LOCUS_04690 1515 2783 gene locus_tag LOCUS_04700 1515 2783 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADG6 protein_id gnl|my_center|LOCUS_04700 2832 3263 gene locus_tag LOCUS_04710 2832 3263 CDS product putative phenylacetic acid degradation-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701717.1 protein_id gnl|my_center|LOCUS_04710 3273 4169 gene locus_tag LOCUS_04720 3273 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 4828 4166 gene locus_tag LOCUS_04730 gene nucS 4828 4166 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4C3 protein_id gnl|my_center|LOCUS_04730 6446 4851 gene locus_tag LOCUS_04740 6446 4851 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545510.1 protein_id gnl|my_center|LOCUS_04740 6539 7684 gene locus_tag LOCUS_04750 6539 7684 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_04750 7689 8054 gene locus_tag LOCUS_04760 7689 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 8866 8051 gene locus_tag LOCUS_04770 gene paaG 8866 8051 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225677.1 protein_id gnl|my_center|LOCUS_04770 9648 8863 gene locus_tag LOCUS_04780 9648 8863 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_04780 9956 9645 gene locus_tag LOCUS_04790 9956 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 11637 9961 gene locus_tag LOCUS_04800 11637 9961 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_04800 11745 12512 gene locus_tag LOCUS_04810 11745 12512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_04810 12951 12577 gene locus_tag LOCUS_04820 12951 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 13080 16754 gene locus_tag LOCUS_04830 gene kgd 13080 16754 CDS product alpha-ketoglutarate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_04830 17419 16751 gene locus_tag LOCUS_04840 17419 16751 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918133.1 protein_id gnl|my_center|LOCUS_04840 17440 18519 gene locus_tag LOCUS_04850 17440 18519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 18568 19344 gene locus_tag LOCUS_04860 18568 19344 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_04860 19341 20042 gene locus_tag LOCUS_04870 19341 20042 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 protein_id gnl|my_center|LOCUS_04870 21888 20020 gene locus_tag LOCUS_04880 21888 20020 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTT0 protein_id gnl|my_center|LOCUS_04880 22108 22587 gene locus_tag LOCUS_04890 22108 22587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 22604 23518 gene locus_tag LOCUS_04900 22604 23518 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_04900 23552 24703 gene locus_tag LOCUS_04910 23552 24703 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_04910 24704 25501 gene locus_tag LOCUS_04920 24704 25501 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_04920 25498 26061 gene locus_tag LOCUS_04930 25498 26061 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919832.1 protein_id gnl|my_center|LOCUS_04930 26076 26450 gene locus_tag LOCUS_04940 26076 26450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 >Feature sequence014 1761 799 gene locus_tag LOCUS_04950 1761 799 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_04950 2564 1788 gene locus_tag LOCUS_04960 gene fixA 2564 1788 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_04960 2769 3587 gene locus_tag LOCUS_04970 2769 3587 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229709.1 protein_id gnl|my_center|LOCUS_04970 4288 3590 gene locus_tag LOCUS_04980 4288 3590 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887187.1 protein_id gnl|my_center|LOCUS_04980 4457 4756 gene locus_tag LOCUS_04990 4457 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 6260 4758 gene locus_tag LOCUS_05000 6260 4758 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_05000 6554 6318 gene locus_tag LOCUS_05010 6554 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704258.1 protein_id gnl|my_center|LOCUS_05010 7849 6629 gene locus_tag LOCUS_05020 gene mrp 7849 6629 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX37 protein_id gnl|my_center|LOCUS_05020 7826 8557 gene locus_tag LOCUS_05030 7826 8557 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907825.1 protein_id gnl|my_center|LOCUS_05030 9215 8565 gene locus_tag LOCUS_05040 9215 8565 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887361.1 protein_id gnl|my_center|LOCUS_05040 9208 9675 gene locus_tag LOCUS_05050 9208 9675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 10391 9678 gene locus_tag LOCUS_05060 10391 9678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 10876 10391 gene locus_tag LOCUS_05070 10876 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 11430 10873 gene locus_tag LOCUS_05080 11430 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 13394 11427 gene locus_tag LOCUS_05090 13394 11427 CDS product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_05090 13861 13373 gene locus_tag LOCUS_05100 13861 13373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 13986 13852 gene locus_tag LOCUS_05110 13986 13852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 14726 13992 gene locus_tag LOCUS_05120 14726 13992 CDS product cytochrome c-type biogenesis heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886993.1 protein_id gnl|my_center|LOCUS_05120 15481 14783 gene locus_tag LOCUS_05130 15481 14783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 16113 15478 gene locus_tag LOCUS_05140 16113 15478 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887051.1 protein_id gnl|my_center|LOCUS_05140 16172 17032 gene locus_tag LOCUS_05150 16172 17032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 17074 17343 gene locus_tag LOCUS_05160 17074 17343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 17353 17940 gene locus_tag LOCUS_05170 17353 17940 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223021.1 protein_id gnl|my_center|LOCUS_05170 17988 18650 gene locus_tag LOCUS_05180 17988 18650 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257014.1 protein_id gnl|my_center|LOCUS_05180 18817 18656 gene locus_tag LOCUS_05190 18817 18656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 18768 19103 gene locus_tag LOCUS_05200 18768 19103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 21224 19107 gene locus_tag LOCUS_05210 21224 19107 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXS5 protein_id gnl|my_center|LOCUS_05210 21391 22218 gene locus_tag LOCUS_05220 21391 22218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 22265 22828 gene locus_tag LOCUS_05230 22265 22828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 23680 22841 gene locus_tag LOCUS_05240 23680 22841 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726700.1 protein_id gnl|my_center|LOCUS_05240 24311 23691 gene locus_tag LOCUS_05250 gene nfuA 24311 23691 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z9 protein_id gnl|my_center|LOCUS_05250 25148 24360 gene locus_tag LOCUS_05260 25148 24360 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_05260 >Feature sequence015 <1 981 gene locus_tag LOCUS_05270 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RK84:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase 978 2036 gene locus_tag LOCUS_05280 gene mraY 978 2036 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MP34 protein_id gnl|my_center|LOCUS_05280 2038 3384 gene locus_tag LOCUS_05290 gene murD 2038 3384 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2W9 protein_id gnl|my_center|LOCUS_05290 3384 4580 gene locus_tag LOCUS_05300 3384 4580 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_05300 4584 5714 gene locus_tag LOCUS_05310 gene murG 4584 5714 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBG5 protein_id gnl|my_center|LOCUS_05310 5714 7120 gene locus_tag LOCUS_05320 gene murC 5714 7120 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU8 protein_id gnl|my_center|LOCUS_05320 7117 8133 gene locus_tag LOCUS_05330 gene murB 7117 8133 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18579 protein_id gnl|my_center|LOCUS_05330 8130 9263 gene locus_tag LOCUS_05340 8130 9263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 9362 10465 gene locus_tag LOCUS_05350 gene ftsZ 9362 10465 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45500 protein_id gnl|my_center|LOCUS_05350 10476 11129 gene locus_tag LOCUS_05360 10476 11129 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391381.1 protein_id gnl|my_center|LOCUS_05360 11173 11706 gene locus_tag LOCUS_05370 gene sepF 11173 11706 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q836V4 protein_id gnl|my_center|LOCUS_05370 11716 11958 gene locus_tag LOCUS_05380 11716 11958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 11985 15080 gene locus_tag LOCUS_05390 gene ileS 11985 15080 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D3M4 protein_id gnl|my_center|LOCUS_05390 15146 16054 gene locus_tag LOCUS_05400 15146 16054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 16071 16559 gene locus_tag LOCUS_05410 16071 16559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 16534 17484 gene locus_tag LOCUS_05420 gene rluD 16534 17484 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WE71 protein_id gnl|my_center|LOCUS_05420 18067 17495 gene locus_tag LOCUS_05430 18067 17495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 18085 19086 gene locus_tag LOCUS_05440 18085 19086 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_05440 19212 22721 gene locus_tag LOCUS_05450 gene dnaE 19212 22721 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63978 protein_id gnl|my_center|LOCUS_05450 22822 23481 gene locus_tag LOCUS_05460 22822 23481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 23519 24085 gene locus_tag LOCUS_05470 23519 24085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 <25907 24063 gene locus_tag LOCUS_05480 <25907 24063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257128.1:thioredoxin domain-containing protein >Feature sequence016 51 908 gene locus_tag LOCUS_05490 gene nadK 51 908 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH6 protein_id gnl|my_center|LOCUS_05490 908 2533 gene locus_tag LOCUS_05500 gene recN 908 2533 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BH7 protein_id gnl|my_center|LOCUS_05500 2605 4245 gene locus_tag LOCUS_05510 gene pyrG 2605 4245 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFU8 protein_id gnl|my_center|LOCUS_05510 4254 4820 gene locus_tag LOCUS_05520 4254 4820 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804982.1 protein_id gnl|my_center|LOCUS_05520 4824 5759 gene locus_tag LOCUS_05530 gene xerD 4824 5759 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAP1 protein_id gnl|my_center|LOCUS_05530 5756 6196 gene locus_tag LOCUS_05540 5756 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 6993 6193 gene locus_tag LOCUS_05550 gene trpS 6993 6193 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q49901 protein_id gnl|my_center|LOCUS_05550 7054 7209 gene locus_tag LOCUS_05560 7054 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 7196 8038 gene locus_tag LOCUS_05570 7196 8038 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027965.1 protein_id gnl|my_center|LOCUS_05570 8028 8633 gene locus_tag LOCUS_05580 8028 8633 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S231 protein_id gnl|my_center|LOCUS_05580 8633 9451 gene locus_tag LOCUS_05590 8633 9451 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_05590 9448 10524 gene locus_tag LOCUS_05600 9448 10524 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_05600 10521 11807 gene locus_tag LOCUS_05610 10521 11807 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 protein_id gnl|my_center|LOCUS_05610 11811 12440 gene locus_tag LOCUS_05620 11811 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 12437 13306 gene locus_tag LOCUS_05630 12437 13306 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NLQ9 protein_id gnl|my_center|LOCUS_05630 13359 14738 gene locus_tag LOCUS_05640 13359 14738 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_05640 14735 15499 gene locus_tag LOCUS_05650 gene dprE2 14735 15499 CDS product NAD-dependent decaprenylphosphoryl-D-2-keto erythropentose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGS9 protein_id gnl|my_center|LOCUS_05650 16583 15504 gene locus_tag LOCUS_05660 16583 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 16806 17606 gene locus_tag LOCUS_05670 16806 17606 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701582.1 protein_id gnl|my_center|LOCUS_05670 17678 18172 gene locus_tag LOCUS_05680 17678 18172 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230535.1 protein_id gnl|my_center|LOCUS_05680 19732 18176 gene locus_tag LOCUS_05690 19732 18176 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_05690 19767 20543 gene locus_tag LOCUS_05700 19767 20543 CDS product creatinine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223881.1 protein_id gnl|my_center|LOCUS_05700 21751 20594 gene locus_tag LOCUS_05710 21751 20594 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223883.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence017 691 1386 gene locus_tag LOCUS_05720 691 1386 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_05720 1458 2108 gene locus_tag LOCUS_05730 gene menH 1458 2108 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q838J8 protein_id gnl|my_center|LOCUS_05730 2930 2094 gene locus_tag LOCUS_05740 gene menA 2930 2094 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NT62 protein_id gnl|my_center|LOCUS_05740 3034 4152 gene locus_tag LOCUS_05750 3034 4152 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727383.1 protein_id gnl|my_center|LOCUS_05750 4898 4149 gene locus_tag LOCUS_05760 4898 4149 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_05760 6216 4933 gene locus_tag LOCUS_05770 6216 4933 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_05770 6806 6213 gene locus_tag LOCUS_05780 gene ybeY 6806 6213 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MN42 protein_id gnl|my_center|LOCUS_05780 7794 6799 gene locus_tag LOCUS_05790 7794 6799 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_05790 7912 10185 gene locus_tag LOCUS_05800 7912 10185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 12224 10182 gene locus_tag LOCUS_05810 12224 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 12298 13035 gene locus_tag LOCUS_05820 12298 13035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 13059 14003 gene locus_tag LOCUS_05830 13059 14003 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027915.1 protein_id gnl|my_center|LOCUS_05830 14181 15962 gene locus_tag LOCUS_05840 14181 15962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 16225 17994 gene locus_tag LOCUS_05850 16225 17994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 18088 19047 gene locus_tag LOCUS_05860 18088 19047 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222019.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence018 <1 1115 gene locus_tag LOCUS_05870 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383579.1:threonine synthase 1605 1120 gene locus_tag LOCUS_05880 1605 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 1793 1605 gene locus_tag LOCUS_05890 1793 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 1962 3791 gene locus_tag LOCUS_05900 1962 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 3835 4062 gene locus_tag LOCUS_05910 gene rpmE 3835 4062 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R215 protein_id gnl|my_center|LOCUS_05910 4106 5101 gene locus_tag LOCUS_05920 4106 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 5128 5802 gene locus_tag LOCUS_05930 5128 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 5833 6897 gene locus_tag LOCUS_05940 gene prfA 5833 6897 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9V1 protein_id gnl|my_center|LOCUS_05940 6890 7771 gene locus_tag LOCUS_05950 gene prmC 6890 7771 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC99 protein_id gnl|my_center|LOCUS_05950 9828 7768 gene locus_tag LOCUS_05960 9828 7768 CDS product dipeptidyl-peptidase 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224556.1 protein_id gnl|my_center|LOCUS_05960 11300 9825 gene locus_tag LOCUS_05970 11300 9825 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729200.1 protein_id gnl|my_center|LOCUS_05970 11349 11804 gene locus_tag LOCUS_05980 gene rpiB 11349 11804 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_05980 11804 13060 gene locus_tag LOCUS_05990 gene glyA 11804 13060 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CR5 protein_id gnl|my_center|LOCUS_05990 13104 14222 gene locus_tag LOCUS_06000 13104 14222 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775946.1 protein_id gnl|my_center|LOCUS_06000 14323 14586 gene locus_tag LOCUS_06010 14323 14586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 14583 15059 gene locus_tag LOCUS_06020 14583 15059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 15071 15829 gene locus_tag LOCUS_06030 gene atpB 15071 15829 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDS8 protein_id gnl|my_center|LOCUS_06030 15877 16149 gene locus_tag LOCUS_06040 15877 16149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 16209 16856 gene locus_tag LOCUS_06050 16209 16856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 16853 17410 gene locus_tag LOCUS_06060 16853 17410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 17407 17934 gene locus_tag LOCUS_06070 17407 17934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06070 >Feature sequence019 1900 203 gene locus_tag LOCUS_06080 1900 203 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225847.1 protein_id gnl|my_center|LOCUS_06080 1930 2526 gene locus_tag LOCUS_06090 1930 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 2554 3051 gene locus_tag LOCUS_06100 gene tpx 2554 3051 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTK2 protein_id gnl|my_center|LOCUS_06100 3810 3052 gene locus_tag LOCUS_06110 gene dapB 3810 3052 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVR3 protein_id gnl|my_center|LOCUS_06110 6336 3838 gene locus_tag LOCUS_06120 gene pnp 6336 3838 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVQ5 protein_id gnl|my_center|LOCUS_06120 6729 6472 gene locus_tag LOCUS_06130 gene rpsO 6729 6472 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJM0 protein_id gnl|my_center|LOCUS_06130 6881 7447 gene locus_tag LOCUS_06140 gene ribE 6881 7447 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WK35 protein_id gnl|my_center|LOCUS_06140 7450 8229 gene locus_tag LOCUS_06150 7450 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 8347 10755 gene locus_tag LOCUS_06160 gene fbiC 8347 10755 CDS product FO synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730333.1 protein_id gnl|my_center|LOCUS_06160 11692 10739 gene locus_tag LOCUS_06170 11692 10739 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z530 protein_id gnl|my_center|LOCUS_06170 12576 11704 gene locus_tag LOCUS_06180 gene truB 12576 11704 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBA9 protein_id gnl|my_center|LOCUS_06180 12927 12580 gene locus_tag LOCUS_06190 12927 12580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 13028 15892 gene locus_tag LOCUS_06200 gene leuS 13028 15892 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DLD3 protein_id gnl|my_center|LOCUS_06200 15910 16353 gene locus_tag LOCUS_06210 gene mgsA 15910 16353 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E059 protein_id gnl|my_center|LOCUS_06210 16427 16954 gene locus_tag LOCUS_06220 16427 16954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 >Feature sequence020 1003 2550 gene locus_tag LOCUS_06230 1003 2550 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029960.1 protein_id gnl|my_center|LOCUS_06230 2550 3236 gene locus_tag LOCUS_06240 2550 3236 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974037.1 protein_id gnl|my_center|LOCUS_06240 3946 3242 gene locus_tag LOCUS_06250 3946 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014087.1 protein_id gnl|my_center|LOCUS_06250 4481 3948 gene locus_tag LOCUS_06260 4481 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226500.1 protein_id gnl|my_center|LOCUS_06260 5167 4505 gene locus_tag LOCUS_06270 5167 4505 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600286.1 protein_id gnl|my_center|LOCUS_06270 5151 5858 gene locus_tag LOCUS_06280 5151 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WM53 protein_id gnl|my_center|LOCUS_06280 5901 6200 gene locus_tag LOCUS_06290 5901 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 6200 6619 gene locus_tag LOCUS_06300 6200 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 7545 6631 gene locus_tag LOCUS_06310 7545 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 8748 7549 gene locus_tag LOCUS_06320 8748 7549 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_06320 9103 8765 gene locus_tag LOCUS_06330 gene glnB 9103 8765 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005992714.1 protein_id gnl|my_center|LOCUS_06330 10390 9143 gene locus_tag LOCUS_06340 gene amtB 10390 9143 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0Q9 protein_id gnl|my_center|LOCUS_06340 11809 10538 gene locus_tag LOCUS_06350 11809 10538 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYN3 protein_id gnl|my_center|LOCUS_06350 12137 11799 gene locus_tag LOCUS_06360 gene glnK 12137 11799 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_06360 <14887 12302 gene locus_tag LOCUS_06370 <14887 12302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173522.1:sodium:proton antiporter >Feature sequence021 2251 1094 gene locus_tag LOCUS_06380 2251 1094 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975609.1 protein_id gnl|my_center|LOCUS_06380 2456 2295 gene locus_tag LOCUS_06390 2456 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 2947 3729 gene locus_tag LOCUS_06400 2947 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 4601 4008 gene locus_tag LOCUS_06410 gene cysC 4601 4008 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HLD2 protein_id gnl|my_center|LOCUS_06410 5854 4601 gene locus_tag LOCUS_06420 5854 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06420 6738 5854 gene locus_tag LOCUS_06430 gene cysD 6738 5854 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R242 protein_id gnl|my_center|LOCUS_06430 7970 6894 gene locus_tag LOCUS_06440 7970 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 9003 7957 gene locus_tag LOCUS_06450 9003 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 10505 9003 gene locus_tag LOCUS_06460 10505 9003 CDS product amino acid adenylation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225537.1 protein_id gnl|my_center|LOCUS_06460 10744 10502 gene locus_tag LOCUS_06470 10744 10502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 11591 10731 gene locus_tag LOCUS_06480 11591 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 12073 14256 gene locus_tag LOCUS_06490 12073 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 >Feature sequence022 2417 618 gene locus_tag LOCUS_06500 gene ftsI 2417 618 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_06500 2443 2739 gene locus_tag LOCUS_06510 2443 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 3139 2672 gene locus_tag LOCUS_06520 3139 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 4092 3142 gene locus_tag LOCUS_06530 gene rsmH 4092 3142 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK87 protein_id gnl|my_center|LOCUS_06530 3982 4254 gene locus_tag LOCUS_06540 3982 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 4694 4278 gene locus_tag LOCUS_06550 gene mraZ 4694 4278 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAF5 protein_id gnl|my_center|LOCUS_06550 5462 4773 gene locus_tag LOCUS_06560 5462 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 5978 5481 gene locus_tag LOCUS_06570 5978 5481 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730016.1 protein_id gnl|my_center|LOCUS_06570 6289 5978 gene locus_tag LOCUS_06580 6289 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 6626 6297 gene locus_tag LOCUS_06590 6626 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 7972 6683 gene locus_tag LOCUS_06600 gene dinB 7972 6683 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKE5 protein_id gnl|my_center|LOCUS_06600 7996 8259 gene locus_tag LOCUS_06610 7996 8259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 8256 9062 gene locus_tag LOCUS_06620 8256 9062 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894144.1 protein_id gnl|my_center|LOCUS_06620 9059 10522 gene locus_tag LOCUS_06630 gene glpK2 9059 10522 CDS product glycerol kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1E4 protein_id gnl|my_center|LOCUS_06630 11366 10506 gene locus_tag LOCUS_06640 gene glk 11366 10506 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224324.1 protein_id gnl|my_center|LOCUS_06640 11797 11363 gene locus_tag LOCUS_06650 11797 11363 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_06650 12302 11802 gene locus_tag LOCUS_06660 12302 11802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 13420 12299 gene locus_tag LOCUS_06670 13420 12299 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028156.1 protein_id gnl|my_center|LOCUS_06670 14376 13417 gene locus_tag LOCUS_06680 14376 13417 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence023 925 158 gene locus_tag LOCUS_06690 925 158 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D7T0 protein_id gnl|my_center|LOCUS_06690 973 1650 gene locus_tag LOCUS_06700 973 1650 CDS product F420-dependent NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871024.1 protein_id gnl|my_center|LOCUS_06700 1653 2798 gene locus_tag LOCUS_06710 gene cysS 1653 2798 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG64 protein_id gnl|my_center|LOCUS_06710 2844 3602 gene locus_tag LOCUS_06720 2844 3602 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028150.1 protein_id gnl|my_center|LOCUS_06720 3648 5633 gene locus_tag LOCUS_06730 gene thrS 3648 5633 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L278 protein_id gnl|my_center|LOCUS_06730 5623 6135 gene locus_tag LOCUS_06740 5623 6135 CDS product diadenosine polyphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907733.1 protein_id gnl|my_center|LOCUS_06740 6132 6638 gene locus_tag LOCUS_06750 6132 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 6648 7352 gene locus_tag LOCUS_06760 6648 7352 CDS product CDP-diacylglycerol--inositol 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728701.1 protein_id gnl|my_center|LOCUS_06760 7345 8280 gene locus_tag LOCUS_06770 7345 8280 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_06770 8584 8267 gene locus_tag LOCUS_06780 8584 8267 CDS product putative transcriptional regulator, ArsR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705584.1 protein_id gnl|my_center|LOCUS_06780 8674 9117 gene locus_tag LOCUS_06790 8674 9117 CDS product cadmium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727472.1 protein_id gnl|my_center|LOCUS_06790 9117 9776 gene locus_tag LOCUS_06800 9117 9776 CDS product glycerol uptake transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888242.1 protein_id gnl|my_center|LOCUS_06800 9773 10159 gene locus_tag LOCUS_06810 9773 10159 CDS product putative arsenate reductase or tyrosine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703303.1 protein_id gnl|my_center|LOCUS_06810 11064 10150 gene locus_tag LOCUS_06820 gene hmd 11064 10150 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_06820 11167 12249 gene locus_tag LOCUS_06830 11167 12249 CDS product putative phosphatidylinositol alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703627.1 protein_id gnl|my_center|LOCUS_06830 12283 13101 gene locus_tag LOCUS_06840 12283 13101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence024 1215 217 gene locus_tag LOCUS_06850 1215 217 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_06850 2006 1212 gene locus_tag LOCUS_06860 gene tpiA 2006 1212 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z520 protein_id gnl|my_center|LOCUS_06860 3111 1996 gene locus_tag LOCUS_06870 3111 1996 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462175.1 protein_id gnl|my_center|LOCUS_06870 4119 3121 gene locus_tag LOCUS_06880 gene gapA 4119 3121 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4Z2 protein_id gnl|my_center|LOCUS_06880 4581 4225 gene locus_tag LOCUS_06890 4581 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06890 5078 4578 gene locus_tag LOCUS_06900 5078 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06900 5827 5102 gene locus_tag LOCUS_06910 5827 5102 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919712.1 protein_id gnl|my_center|LOCUS_06910 7711 5837 gene locus_tag LOCUS_06920 gene uvrC 7711 5837 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4X3 protein_id gnl|my_center|LOCUS_06920 10698 7714 gene locus_tag LOCUS_06930 gene uvrA 10698 7714 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z507 protein_id gnl|my_center|LOCUS_06930 12740 10719 gene locus_tag LOCUS_06940 gene uvrB 12740 10719 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CK11 protein_id gnl|my_center|LOCUS_06940 13396 12764 gene locus_tag LOCUS_06950 13396 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence025 492 64 gene locus_tag LOCUS_06960 492 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 1563 514 gene locus_tag LOCUS_06970 1563 514 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_06970 2462 1560 gene locus_tag LOCUS_06980 2462 1560 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442783.1 protein_id gnl|my_center|LOCUS_06980 2845 2459 gene locus_tag LOCUS_06990 2845 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 4071 2845 gene locus_tag LOCUS_07000 gene lldD 4071 2845 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223998.1 protein_id gnl|my_center|LOCUS_07000 4173 5870 gene locus_tag LOCUS_07010 gene fhs 4173 5870 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIW3 protein_id gnl|my_center|LOCUS_07010 6813 5872 gene locus_tag LOCUS_07020 6813 5872 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728397.1 protein_id gnl|my_center|LOCUS_07020 6831 9176 gene locus_tag LOCUS_07030 6831 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 9204 9686 gene locus_tag LOCUS_07040 9204 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 9691 10266 gene locus_tag LOCUS_07050 9691 10266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 11424 10654 gene locus_tag LOCUS_07060 11424 10654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 12002 11439 gene locus_tag LOCUS_07070 12002 11439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 <13486 12047 gene locus_tag LOCUS_07080 <13486 12047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q749I1:glycerol kinase >Feature sequence026 1992 688 gene locus_tag LOCUS_07090 1992 688 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADB4 protein_id gnl|my_center|LOCUS_07090 3478 2207 gene locus_tag LOCUS_07100 gene lysA 3478 2207 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIR2 protein_id gnl|my_center|LOCUS_07100 5211 3475 gene locus_tag LOCUS_07110 gene argS 5211 3475 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CGG9 protein_id gnl|my_center|LOCUS_07110 5301 5376 gene locus_tag LOCUS_t00080 5301 5376 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6522 5461 gene locus_tag LOCUS_07120 6522 5461 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_07120 7179 6610 gene locus_tag LOCUS_07130 7179 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 7849 7220 gene locus_tag LOCUS_07140 7849 7220 CDS product aromatic compound degradation protein PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229221.1 protein_id gnl|my_center|LOCUS_07140 8310 7849 gene locus_tag LOCUS_07150 8310 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_07150 8401 9060 gene locus_tag LOCUS_07160 8401 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 9414 9064 gene locus_tag LOCUS_07170 9414 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 9951 9424 gene locus_tag LOCUS_07180 gene ogt 9951 9424 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4X4 protein_id gnl|my_center|LOCUS_07180 10066 11529 gene locus_tag LOCUS_07190 10066 11529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 12767 11532 gene locus_tag LOCUS_07200 gene fadE17 12767 11532 CDS product putative acyl-CoA dehydrogenase FadE17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95280 protein_id gnl|my_center|LOCUS_07200 >Feature sequence027 <1 1299 gene locus_tag LOCUS_07210 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RHW1:aspartate--tRNA(Asp/Asn) ligase 1302 2471 gene locus_tag LOCUS_07220 1302 2471 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894402.1 protein_id gnl|my_center|LOCUS_07220 2808 5441 gene locus_tag LOCUS_07230 gene alaS 2808 5441 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9X0 protein_id gnl|my_center|LOCUS_07230 5445 5873 gene locus_tag LOCUS_07240 5445 5873 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHZ7 protein_id gnl|my_center|LOCUS_07240 5837 7045 gene locus_tag LOCUS_07250 5837 7045 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933876.1 protein_id gnl|my_center|LOCUS_07250 7042 7872 gene locus_tag LOCUS_07260 7042 7872 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024467.1 protein_id gnl|my_center|LOCUS_07260 7883 9049 gene locus_tag LOCUS_07270 gene aroC 7883 9049 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXQ4 protein_id gnl|my_center|LOCUS_07270 9085 9609 gene locus_tag LOCUS_07280 gene aroK 9085 9609 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH7 protein_id gnl|my_center|LOCUS_07280 9596 10636 gene locus_tag LOCUS_07290 gene rifG 9596 10636 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWY6 protein_id gnl|my_center|LOCUS_07290 10639 11181 gene locus_tag LOCUS_07300 10639 11181 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX72 protein_id gnl|my_center|LOCUS_07300 11183 11626 gene locus_tag LOCUS_07310 gene aroQ2 11183 11626 CDS product 3-dehydroquinate dehydratase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6P3 protein_id gnl|my_center|LOCUS_07310 11626 12714 gene locus_tag LOCUS_07320 11626 12714 CDS product putative cytoplasmic peptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703571.1 protein_id gnl|my_center|LOCUS_07320 12687 13250 gene locus_tag LOCUS_07330 gene efp 12687 13250 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXQ9 protein_id gnl|my_center|LOCUS_07330 >Feature sequence028 1940 1194 gene locus_tag LOCUS_07340 1940 1194 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404618.1 protein_id gnl|my_center|LOCUS_07340 4628 1947 gene locus_tag LOCUS_07350 gene polA 4628 1947 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNU5 protein_id gnl|my_center|LOCUS_07350 5223 4648 gene locus_tag LOCUS_07360 gene nasT 5223 4648 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_07360 5513 5220 gene locus_tag LOCUS_07370 5513 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 5623 5539 gene locus_tag LOCUS_t00090 5623 5539 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5714 6889 gene locus_tag LOCUS_07380 gene fabD 5714 6889 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71019 protein_id gnl|my_center|LOCUS_07380 6913 7863 gene locus_tag LOCUS_07390 gene fabH 6913 7863 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHA3 protein_id gnl|my_center|LOCUS_07390 7860 8564 gene locus_tag LOCUS_07400 7860 8564 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_07400 8651 8887 gene locus_tag LOCUS_07410 gene acpP 8651 8887 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5N7 protein_id gnl|my_center|LOCUS_07410 8906 10090 gene locus_tag LOCUS_07420 8906 10090 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJX3 protein_id gnl|my_center|LOCUS_07420 10636 10091 gene locus_tag LOCUS_07430 10636 10091 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224738.1 protein_id gnl|my_center|LOCUS_07430 11078 10650 gene locus_tag LOCUS_07440 gene fabZ 11078 10650 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLY7 protein_id gnl|my_center|LOCUS_07440 11524 11075 gene locus_tag LOCUS_07450 11524 11075 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257872.1 protein_id gnl|my_center|LOCUS_07450 11815 11546 gene locus_tag LOCUS_07460 11815 11546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 12639 11860 gene locus_tag LOCUS_07470 gene trpA 12639 11860 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68816 protein_id gnl|my_center|LOCUS_07470 >Feature sequence029 1289 828 gene locus_tag LOCUS_07480 1289 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 2509 1298 gene locus_tag LOCUS_07490 gene mshA 2509 1298 CDS product D-inositol 3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NTA6 protein_id gnl|my_center|LOCUS_07490 2914 2555 gene locus_tag LOCUS_07500 2914 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3404 2919 gene locus_tag LOCUS_07510 3404 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 3643 3404 gene locus_tag LOCUS_07520 3643 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4698 3685 gene locus_tag LOCUS_07530 gene selD 4698 3685 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ4 protein_id gnl|my_center|LOCUS_07530 4834 6024 gene locus_tag LOCUS_07540 gene selA 4834 6024 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIF3 protein_id gnl|my_center|LOCUS_07540 6028 7728 gene locus_tag LOCUS_07550 6028 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 7824 7729 gene locus_tag LOCUS_t00100 7824 7729 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7847 9292 gene locus_tag LOCUS_07560 7847 9292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 9306 9590 gene locus_tag LOCUS_07570 9306 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 9612 9836 gene locus_tag LOCUS_07580 9612 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 9888 10466 gene locus_tag LOCUS_07590 9888 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 10471 11640 gene locus_tag LOCUS_07600 10471 11640 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641027.1 protein_id gnl|my_center|LOCUS_07600 <13058 11619 gene locus_tag LOCUS_07610 <13058 11619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038206.1:NAD+ synthase >Feature sequence030 4274 3417 gene locus_tag LOCUS_07620 gene htdY 4274 3417 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 protein_id gnl|my_center|LOCUS_07620 5227 4295 gene locus_tag LOCUS_07630 5227 4295 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_07630 5319 6521 gene locus_tag LOCUS_07640 5319 6521 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893677.1 protein_id gnl|my_center|LOCUS_07640 6544 7506 gene locus_tag LOCUS_07650 6544 7506 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_07650 7549 8745 gene locus_tag LOCUS_07660 7549 8745 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117066.1 protein_id gnl|my_center|LOCUS_07660 9877 8711 gene locus_tag LOCUS_07670 9877 8711 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028803.1 protein_id gnl|my_center|LOCUS_07670 10932 9880 gene locus_tag LOCUS_07680 10932 9880 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731394.1 protein_id gnl|my_center|LOCUS_07680 11039 11926 gene locus_tag LOCUS_07690 11039 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence031 1323 682 gene locus_tag LOCUS_07700 1323 682 CDS product 16S RNA G1207 methylase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804681.1 protein_id gnl|my_center|LOCUS_07700 1310 1876 gene locus_tag LOCUS_07710 gene def 1310 1876 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5I4 protein_id gnl|my_center|LOCUS_07710 1879 2763 gene locus_tag LOCUS_07720 gene fmt 1879 2763 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIL6 protein_id gnl|my_center|LOCUS_07720 2816 3688 gene locus_tag LOCUS_07730 gene hisG1 2816 3688 CDS product ATP phosphoribosyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60804 protein_id gnl|my_center|LOCUS_07730 3692 3913 gene locus_tag LOCUS_07740 3692 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 4247 3897 gene locus_tag LOCUS_07750 4247 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 4617 5060 gene locus_tag LOCUS_07760 4617 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 5073 5270 gene locus_tag LOCUS_07770 gene rpmI 5073 5270 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D9W9 protein_id gnl|my_center|LOCUS_07770 5303 5659 gene locus_tag LOCUS_07780 gene rplT 5303 5659 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DDU8 protein_id gnl|my_center|LOCUS_07780 5800 6423 gene locus_tag LOCUS_07790 gene spoU 5800 6423 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227846.1 protein_id gnl|my_center|LOCUS_07790 6469 7506 gene locus_tag LOCUS_07800 gene pheS 6469 7506 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D00 protein_id gnl|my_center|LOCUS_07800 7503 9851 gene locus_tag LOCUS_07810 gene pheT 7503 9851 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ9 protein_id gnl|my_center|LOCUS_07810 10396 9848 gene locus_tag LOCUS_07820 10396 9848 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1U6 protein_id gnl|my_center|LOCUS_07820 10419 11438 gene locus_tag LOCUS_07830 gene argC 10419 11438 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748X6 protein_id gnl|my_center|LOCUS_07830 11435 12298 gene locus_tag LOCUS_07840 gene argB 11435 12298 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59303 protein_id gnl|my_center|LOCUS_07840 >Feature sequence032 336 1037 gene locus_tag LOCUS_07850 336 1037 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639954.1 protein_id gnl|my_center|LOCUS_07850 1034 1606 gene locus_tag LOCUS_07860 1034 1606 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110452.1 protein_id gnl|my_center|LOCUS_07860 2392 1607 gene locus_tag LOCUS_07870 2392 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 2516 3184 gene locus_tag LOCUS_07880 2516 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 3291 3216 gene locus_tag LOCUS_t00110 3291 3216 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3903 3325 gene locus_tag LOCUS_07890 3903 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 3996 3905 gene locus_tag LOCUS_t00120 3996 3905 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4175 5332 gene locus_tag LOCUS_07900 4175 5332 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393451.1 protein_id gnl|my_center|LOCUS_07900 5341 6903 gene locus_tag LOCUS_07910 5341 6903 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_07910 6903 8000 gene locus_tag LOCUS_07920 6903 8000 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_07920 7997 8935 gene locus_tag LOCUS_07930 7997 8935 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_07930 9032 8946 gene locus_tag LOCUS_t00130 9032 8946 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10011 9064 gene locus_tag LOCUS_07940 10011 9064 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_07940 10773 10060 gene locus_tag LOCUS_07950 10773 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 11339 10776 gene locus_tag LOCUS_07960 11339 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence033 <1 644 gene locus_tag LOCUS_07970 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919107.1:glucose-fructose oxidoreductase 2038 641 gene locus_tag LOCUS_07980 2038 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_07980 2764 2069 gene locus_tag LOCUS_07990 2764 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 3254 4162 gene locus_tag LOCUS_08000 3254 4162 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_08000 4159 4812 gene locus_tag LOCUS_08010 4159 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 5855 4809 gene locus_tag LOCUS_08020 5855 4809 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_08020 6112 5852 gene locus_tag LOCUS_08030 6112 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 7296 6112 gene locus_tag LOCUS_08040 gene xseA 7296 6112 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_08040 9158 7302 gene locus_tag LOCUS_08050 9158 7302 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_08050 9321 10718 gene locus_tag LOCUS_08060 9321 10718 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030100.1 protein_id gnl|my_center|LOCUS_08060 10831 10744 gene locus_tag LOCUS_t00140 10831 10744 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <11754 10877 gene locus_tag LOCUS_08070 <11754 10877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003900743.1:MFS transporter >Feature sequence034 465 199 gene locus_tag LOCUS_08080 gene rpmA 465 199 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCJ5 protein_id gnl|my_center|LOCUS_08080 783 472 gene locus_tag LOCUS_08090 gene rplU 783 472 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NN50 protein_id gnl|my_center|LOCUS_08090 2540 861 gene locus_tag LOCUS_08100 2540 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 3819 2647 gene locus_tag LOCUS_08110 3819 2647 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_08110 5984 3819 gene locus_tag LOCUS_08120 5984 3819 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_08120 6505 5984 gene locus_tag LOCUS_08130 6505 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 7626 6502 gene locus_tag LOCUS_08140 7626 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 8677 7637 gene locus_tag LOCUS_08150 8677 7637 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976188.1 protein_id gnl|my_center|LOCUS_08150 9151 8741 gene locus_tag LOCUS_08160 gene ndk 9151 8741 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50589 protein_id gnl|my_center|LOCUS_08160 10498 9203 gene locus_tag LOCUS_08170 10498 9203 CDS product dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_08170 <11397 10505 gene locus_tag LOCUS_08180 <11397 10505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9F316:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence035 231 1199 gene locus_tag LOCUS_08190 231 1199 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919443.1 protein_id gnl|my_center|LOCUS_08190 1214 2263 gene locus_tag LOCUS_08200 1214 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2299 2703 gene locus_tag LOCUS_08210 2299 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 4316 2700 gene locus_tag LOCUS_08220 gene ycnJ 4316 2700 CDS product copper transport protein YcnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0SP95 protein_id gnl|my_center|LOCUS_08220 4978 4313 gene locus_tag LOCUS_08230 4978 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 5797 5015 gene locus_tag LOCUS_08240 5797 5015 CDS product cobalamin/Fe3+-siderophore ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856445.1 protein_id gnl|my_center|LOCUS_08240 6843 5794 gene locus_tag LOCUS_08250 6843 5794 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 protein_id gnl|my_center|LOCUS_08250 7749 6853 gene locus_tag LOCUS_08260 7749 6853 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_08260 9243 8035 gene locus_tag LOCUS_08270 9243 8035 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0L5 protein_id gnl|my_center|LOCUS_08270 9262 10389 gene locus_tag LOCUS_08280 gene serC 9262 10389 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJ64 protein_id gnl|my_center|LOCUS_08280 >Feature sequence036 921 592 gene locus_tag LOCUS_08290 921 592 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2L8 protein_id gnl|my_center|LOCUS_08290 1484 963 gene locus_tag LOCUS_08300 gene mogA 1484 963 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879970.1 protein_id gnl|my_center|LOCUS_08300 2431 1487 gene locus_tag LOCUS_08310 gene trxB 2431 1487 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ75 protein_id gnl|my_center|LOCUS_08310 2758 2432 gene locus_tag LOCUS_08320 2758 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 3400 2798 gene locus_tag LOCUS_08330 3400 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 3993 3397 gene locus_tag LOCUS_08340 gene algU 3993 3397 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIP2 protein_id gnl|my_center|LOCUS_08340 5712 4018 gene locus_tag LOCUS_08350 5712 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 6603 5764 gene locus_tag LOCUS_08360 6603 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_08360 8580 6607 gene locus_tag LOCUS_08370 8580 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 9341 8577 gene locus_tag LOCUS_08380 9341 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 9540 10904 gene locus_tag LOCUS_08390 9540 10904 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence037 327 1163 gene locus_tag LOCUS_08400 327 1163 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_08400 1230 1664 gene locus_tag LOCUS_08410 1230 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 1930 1601 gene locus_tag LOCUS_08420 1930 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_08420 2194 2484 gene locus_tag LOCUS_08430 2194 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2481 2984 gene locus_tag LOCUS_08440 2481 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 6235 2981 gene locus_tag LOCUS_08450 gene dnaE 6235 2981 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX54 protein_id gnl|my_center|LOCUS_08450 6844 6299 gene locus_tag LOCUS_08460 6844 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 8332 6869 gene locus_tag LOCUS_08470 8332 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222726.1 protein_id gnl|my_center|LOCUS_08470 8976 8329 gene locus_tag LOCUS_08480 8976 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222725.1 protein_id gnl|my_center|LOCUS_08480 9488 9033 gene locus_tag LOCUS_08490 9488 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 9601 10842 gene locus_tag LOCUS_08500 gene acd 9601 10842 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225726.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence038 3 290 gene locus_tag LOCUS_08510 3 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 1107 283 gene locus_tag LOCUS_08520 1107 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1184 2662 gene locus_tag LOCUS_08530 1184 2662 CDS product apocarotenoid-15,15'-oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730653.1 protein_id gnl|my_center|LOCUS_08530 2730 3323 gene locus_tag LOCUS_08540 gene cysG 2730 3323 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 protein_id gnl|my_center|LOCUS_08540 3320 4060 gene locus_tag LOCUS_08550 3320 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4062 4313 gene locus_tag LOCUS_08560 4062 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 4316 6103 gene locus_tag LOCUS_08570 4316 6103 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_08570 6133 6981 gene locus_tag LOCUS_08580 gene galT 6133 6981 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DIK1 protein_id gnl|my_center|LOCUS_08580 6981 7967 gene locus_tag LOCUS_08590 gene galK 6981 7967 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQH8 protein_id gnl|my_center|LOCUS_08590 <9996 7964 gene locus_tag LOCUS_08600 <9996 7964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RKF8:beta-galactosidase >Feature sequence039 62 982 gene locus_tag LOCUS_08610 gene dhmA 62 982 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A919 protein_id gnl|my_center|LOCUS_08610 1061 2386 gene locus_tag LOCUS_08620 1061 2386 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_08620 2393 2749 gene locus_tag LOCUS_08630 2393 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 4462 2750 gene locus_tag LOCUS_08640 gene ilvD 4462 2750 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MKW9 protein_id gnl|my_center|LOCUS_08640 5287 4484 gene locus_tag LOCUS_08650 5287 4484 CDS product iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097186.1 protein_id gnl|my_center|LOCUS_08650 6627 5371 gene locus_tag LOCUS_08660 6627 5371 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893439.1 protein_id gnl|my_center|LOCUS_08660 8131 6662 gene locus_tag LOCUS_08670 gene gatB 8131 6662 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZH0 protein_id gnl|my_center|LOCUS_08670 9567 8128 gene locus_tag LOCUS_08680 gene gatA 9567 8128 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKF0 protein_id gnl|my_center|LOCUS_08680 >Feature sequence040 440 694 gene locus_tag LOCUS_08690 gene rpsT 440 694 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3DA79 protein_id gnl|my_center|LOCUS_08690 1694 705 gene locus_tag LOCUS_08700 1694 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3229 1721 gene locus_tag LOCUS_08710 3229 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 3165 3572 gene locus_tag LOCUS_08720 3165 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 4289 3573 gene locus_tag LOCUS_08730 4289 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 5032 4328 gene locus_tag LOCUS_08740 5032 4328 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709674.1 protein_id gnl|my_center|LOCUS_08740 5062 6093 gene locus_tag LOCUS_08750 5062 6093 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_08750 6090 6989 gene locus_tag LOCUS_08760 6090 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859825.1 protein_id gnl|my_center|LOCUS_08760 6992 8011 gene locus_tag LOCUS_08770 6992 8011 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_08770 9051 8008 gene locus_tag LOCUS_08780 9051 8008 CDS product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710075.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence041 1227 292 gene locus_tag LOCUS_08790 1227 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 2078 1230 gene locus_tag LOCUS_08800 gene pcaD 2078 1230 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_08800 3051 2080 gene locus_tag LOCUS_08810 3051 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 3596 3087 gene locus_tag LOCUS_08820 3596 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 4513 3761 gene locus_tag LOCUS_08830 4513 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 4705 4523 gene locus_tag LOCUS_08840 4705 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 4965 4726 gene locus_tag LOCUS_08850 4965 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 5582 4992 gene locus_tag LOCUS_08860 gene sigR 5582 4992 CDS product ECF RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKG9 protein_id gnl|my_center|LOCUS_08860 6110 5601 gene locus_tag LOCUS_08870 6110 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 6131 6835 gene locus_tag LOCUS_08880 6131 6835 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020781.1 protein_id gnl|my_center|LOCUS_08880 6832 8223 gene locus_tag LOCUS_08890 6832 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 8130 8366 gene locus_tag LOCUS_08900 8130 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 9334 8363 gene locus_tag LOCUS_08910 9334 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence042 862 3621 gene locus_tag LOCUS_08920 862 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 4023 3817 gene locus_tag LOCUS_08930 4023 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 7103 6831 gene locus_tag LOCUS_08940 7103 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 7551 7751 gene locus_tag LOCUS_08950 7551 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence043 2014 536 gene locus_tag LOCUS_08960 2014 536 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729741.1 protein_id gnl|my_center|LOCUS_08960 3693 2017 gene locus_tag LOCUS_08970 gene glpA 3693 2017 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D6F1 protein_id gnl|my_center|LOCUS_08970 3809 4231 gene locus_tag LOCUS_08980 gene perR 3809 4231 CDS product peroxide-responsive repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CNQ7 protein_id gnl|my_center|LOCUS_08980 4255 4671 gene locus_tag LOCUS_08990 4255 4671 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_08990 4777 6090 gene locus_tag LOCUS_09000 4777 6090 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_09000 6105 6716 gene locus_tag LOCUS_09010 6105 6716 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980453.1 protein_id gnl|my_center|LOCUS_09010 6827 7066 gene locus_tag LOCUS_09020 6827 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 7078 8142 gene locus_tag LOCUS_09030 gene trpD 7078 8142 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MP01 protein_id gnl|my_center|LOCUS_09030 >Feature sequence044 <1 783 gene locus_tag LOCUS_09040 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MLW0:ATP synthase subunit alpha 789 1682 gene locus_tag LOCUS_09050 gene atpG 789 1682 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4D4 protein_id gnl|my_center|LOCUS_09050 1710 3140 gene locus_tag LOCUS_09060 gene atpD 1710 3140 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DH77 protein_id gnl|my_center|LOCUS_09060 3140 3559 gene locus_tag LOCUS_09070 gene atpC 3140 3559 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRA2 protein_id gnl|my_center|LOCUS_09070 5215 3593 gene locus_tag LOCUS_09080 5215 3593 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730889.1 protein_id gnl|my_center|LOCUS_09080 6290 5292 gene locus_tag LOCUS_09090 gene glpX 6290 5292 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHU9 protein_id gnl|my_center|LOCUS_09090 6396 8090 gene locus_tag LOCUS_09100 6396 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence045 315 773 gene locus_tag LOCUS_09110 315 773 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_09110 1703 786 gene locus_tag LOCUS_09120 1703 786 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897127.1 protein_id gnl|my_center|LOCUS_09120 1796 3436 gene locus_tag LOCUS_09130 1796 3436 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728248.1 protein_id gnl|my_center|LOCUS_09130 4671 3433 gene locus_tag LOCUS_09140 gene caiA 4671 3433 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 protein_id gnl|my_center|LOCUS_09140 4852 5505 gene locus_tag LOCUS_09150 gene menG 4852 5505 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB34 protein_id gnl|my_center|LOCUS_09150 5502 6725 gene locus_tag LOCUS_09160 5502 6725 CDS product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002070.1 protein_id gnl|my_center|LOCUS_09160 <7687 6715 gene locus_tag LOCUS_09170 <7687 6715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WB45:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase >Feature sequence046 137 538 gene locus_tag LOCUS_09180 gene mceE 137 538 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_09180 554 1204 gene locus_tag LOCUS_09190 554 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1229 1966 gene locus_tag LOCUS_09200 1229 1966 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460169.1 protein_id gnl|my_center|LOCUS_09200 2929 1967 gene locus_tag LOCUS_09210 2929 1967 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726658.1 protein_id gnl|my_center|LOCUS_09210 3043 3939 gene locus_tag LOCUS_09220 3043 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 4305 3940 gene locus_tag LOCUS_09230 4305 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 5072 4305 gene locus_tag LOCUS_09240 5072 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5646 5065 gene locus_tag LOCUS_09250 5646 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948220.1 protein_id gnl|my_center|LOCUS_09250 5891 5978 gene locus_tag LOCUS_t00150 5891 5978 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5939 6442 gene locus_tag LOCUS_09260 5939 6442 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815124.1 protein_id gnl|my_center|LOCUS_09260 7130 6477 gene locus_tag LOCUS_09270 7130 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence047 1456 1779 gene locus_tag LOCUS_09280 1456 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2495 1929 gene locus_tag LOCUS_09290 2495 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence048 <1 770 gene locus_tag LOCUS_09300 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704367.1:putative luciferase-like protein 2514 757 gene locus_tag LOCUS_09310 2514 757 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_09310 2533 3183 gene locus_tag LOCUS_09320 2533 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3355 4320 gene locus_tag LOCUS_09330 3355 4320 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865348.1 protein_id gnl|my_center|LOCUS_09330 4388 6370 gene locus_tag LOCUS_09340 gene kup1 4388 6370 CDS product putative potassium transport system protein kup 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AK4 protein_id gnl|my_center|LOCUS_09340 7003 6353 gene locus_tag LOCUS_09350 7003 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence049 25 3348 gene locus_tag LOCUS_09360 25 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 5176 3776 gene locus_tag LOCUS_09370 5176 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 7005 5320 gene locus_tag LOCUS_09380 7005 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence050 1 624 gene locus_tag LOCUS_09390 1 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 621 1193 gene locus_tag LOCUS_09400 621 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704925.1 protein_id gnl|my_center|LOCUS_09400 2338 1190 gene locus_tag LOCUS_09410 2338 1190 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529692.1 protein_id gnl|my_center|LOCUS_09410 2471 3784 gene locus_tag LOCUS_09420 gene murA 2471 3784 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DH73 protein_id gnl|my_center|LOCUS_09420 3926 3759 gene locus_tag LOCUS_09430 3926 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 3925 4158 gene locus_tag LOCUS_09440 3925 4158 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_09440 4159 5121 gene locus_tag LOCUS_09450 4159 5121 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_09450 5123 5902 gene locus_tag LOCUS_09460 5123 5902 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_09460 5906 6610 gene locus_tag LOCUS_09470 5906 6610 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973261.1 protein_id gnl|my_center|LOCUS_09470 6607 6909 gene locus_tag LOCUS_09480 6607 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence051 4174 2441 gene locus_tag LOCUS_09490 4174 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 5892 4189 gene locus_tag LOCUS_09500 5892 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence052 2011 68 gene locus_tag LOCUS_09510 gene dxs 2011 68 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCU7 protein_id gnl|my_center|LOCUS_09510 2010 2840 gene locus_tag LOCUS_09520 2010 2840 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_09520 2892 3389 gene locus_tag LOCUS_09530 2892 3389 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403827.1 protein_id gnl|my_center|LOCUS_09530 3449 3928 gene locus_tag LOCUS_09540 3449 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403820.1 protein_id gnl|my_center|LOCUS_09540 4862 3936 gene locus_tag LOCUS_09550 4862 3936 CDS product inositol phosphorylceramide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028214.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence053 1 345 gene locus_tag LOCUS_09560 1 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 378 1970 gene locus_tag LOCUS_09570 378 1970 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_09570 2710 1967 gene locus_tag LOCUS_09580 2710 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2956 4383 gene locus_tag LOCUS_09590 2956 4383 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_09590 4611 4393 gene locus_tag LOCUS_09600 4611 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4929 4687 gene locus_tag LOCUS_09610 4929 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 5701 4934 gene locus_tag LOCUS_09620 5701 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09620 >Feature sequence054 1204 224 gene locus_tag LOCUS_09630 gene hemB 1204 224 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54919 protein_id gnl|my_center|LOCUS_09630 1993 1253 gene locus_tag LOCUS_09640 1993 1253 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887432.1 protein_id gnl|my_center|LOCUS_09640 2883 1999 gene locus_tag LOCUS_09650 gene hemC 2883 1999 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AV0 protein_id gnl|my_center|LOCUS_09650 4151 2892 gene locus_tag LOCUS_09660 gene hemA 4151 2892 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16618 protein_id gnl|my_center|LOCUS_09660 4847 4158 gene locus_tag LOCUS_09670 gene rex 4847 4158 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WX14 protein_id gnl|my_center|LOCUS_09670 4916 5665 gene locus_tag LOCUS_09680 4916 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 6008 5631 gene locus_tag LOCUS_09690 6008 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence055 <1 1216 gene locus_tag LOCUS_09700 <1 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D4W9:riboflavin biosynthesis protein RibBA 1213 1695 gene locus_tag LOCUS_09710 gene ribH 1213 1695 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE53 protein_id gnl|my_center|LOCUS_09710 1755 2189 gene locus_tag LOCUS_09720 1755 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2877 2191 gene locus_tag LOCUS_09730 2877 2191 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918295.1 protein_id gnl|my_center|LOCUS_09730 3044 2874 gene locus_tag LOCUS_09740 3044 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3366 3010 gene locus_tag LOCUS_09750 3366 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 5110 3479 gene locus_tag LOCUS_09760 gene groL2 5110 3479 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXU5 protein_id gnl|my_center|LOCUS_09760 5412 5119 gene locus_tag LOCUS_09770 gene groS 5412 5119 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MG61 protein_id gnl|my_center|LOCUS_09770 5702 5532 gene locus_tag LOCUS_09780 5702 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09780 >Feature sequence056 <1 875 gene locus_tag LOCUS_09790 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416081.1:long-chain-fatty-acid--CoA ligase FadD13 2443 911 gene locus_tag LOCUS_09800 2443 911 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_09800 4321 2564 gene locus_tag LOCUS_09810 4321 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 4867 4463 gene locus_tag LOCUS_09820 4867 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4906 5649 gene locus_tag LOCUS_09830 gene pcs 4906 5649 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXE9 protein_id gnl|my_center|LOCUS_09830 >Feature sequence057 1127 774 gene locus_tag LOCUS_09840 1127 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228853.1 protein_id gnl|my_center|LOCUS_09840 1564 1160 gene locus_tag LOCUS_09850 1564 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1962 1561 gene locus_tag LOCUS_09860 1962 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 2153 1959 gene locus_tag LOCUS_09870 2153 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 2878 2189 gene locus_tag LOCUS_09880 2878 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 3591 2875 gene locus_tag LOCUS_09890 3591 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 4871 3582 gene locus_tag LOCUS_09900 4871 3582 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029708.1 protein_id gnl|my_center|LOCUS_09900 5404 4868 gene locus_tag LOCUS_09910 5404 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence058 961 557 gene locus_tag LOCUS_09920 961 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1598 1005 gene locus_tag LOCUS_09930 1598 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 2909 1608 gene locus_tag LOCUS_09940 2909 1608 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462315.1 protein_id gnl|my_center|LOCUS_09940 4177 2909 gene locus_tag LOCUS_09950 gene purA 4177 2909 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG43 protein_id gnl|my_center|LOCUS_09950 4306 5598 gene locus_tag LOCUS_09960 gene hisD 4306 5598 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UMM7 protein_id gnl|my_center|LOCUS_09960 >Feature sequence059 519 91 gene locus_tag LOCUS_09970 519 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 585 1481 gene locus_tag LOCUS_09980 585 1481 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028189.1 protein_id gnl|my_center|LOCUS_09980 1478 2734 gene locus_tag LOCUS_09990 1478 2734 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_09990 2713 3171 gene locus_tag LOCUS_10000 2713 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705064.1 protein_id gnl|my_center|LOCUS_10000 4577 3168 gene locus_tag LOCUS_10010 gene hydA 4577 3168 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895004.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence060 <1 599 gene locus_tag LOCUS_10020 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731196.1:ATP-binding protein 621 2009 gene locus_tag LOCUS_10030 621 2009 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529683.1 protein_id gnl|my_center|LOCUS_10030 4451 2010 gene locus_tag LOCUS_10040 4451 2010 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256961.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence061 230 1231 gene locus_tag LOCUS_10050 gene queA 230 1231 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H7W8 protein_id gnl|my_center|LOCUS_10050 1243 2340 gene locus_tag LOCUS_10060 gene tgt-2 1243 2340 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X3 protein_id gnl|my_center|LOCUS_10060 2386 2730 gene locus_tag LOCUS_10070 2386 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 2734 4257 gene locus_tag LOCUS_10080 2734 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 4257 5375 gene locus_tag LOCUS_10090 gene secF 4257 5375 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53956 protein_id gnl|my_center|LOCUS_10090 >Feature sequence062 3853 2993 gene locus_tag LOCUS_10100 3853 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4564 4406 gene locus_tag LOCUS_10110 4564 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4922 4707 gene locus_tag LOCUS_10120 4922 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence063 187 101 gene locus_tag LOCUS_t00160 187 101 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 466 230 gene locus_tag LOCUS_10130 gene secG 466 230 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115170.1 protein_id gnl|my_center|LOCUS_10130 1499 498 gene locus_tag LOCUS_10140 1499 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 2512 1496 gene locus_tag LOCUS_10150 2512 1496 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_10150 3504 2515 gene locus_tag LOCUS_10160 gene oppB 3504 2515 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004124746.1 protein_id gnl|my_center|LOCUS_10160 <5233 3594 gene locus_tag LOCUS_10170 <5233 3594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973521.1:peptide ABC transporter substrate-binding protein >Feature sequence064 298 1335 gene locus_tag LOCUS_10180 gene ispH 298 1335 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULU1 protein_id gnl|my_center|LOCUS_10180 1425 1742 gene locus_tag LOCUS_10190 1425 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 2955 1753 gene locus_tag LOCUS_10200 2955 1753 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_10200 3069 4625 gene locus_tag LOCUS_10210 3069 4625 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090531.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence065 <1 1320 gene locus_tag LOCUS_10220 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230152.1:deoxyribodipyrimidine photo-lyase 1333 2337 gene locus_tag LOCUS_10230 gene hrcA 1333 2337 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDD6 protein_id gnl|my_center|LOCUS_10230 2334 3449 gene locus_tag LOCUS_10240 gene dnaJ 2334 3449 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ECV6 protein_id gnl|my_center|LOCUS_10240 3505 4029 gene locus_tag LOCUS_10250 3505 4029 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_10250 4039 5100 gene locus_tag LOCUS_10260 4039 5100 CDS product putative oxygen-independent coproporphyrinogen III oxidase HemN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702402.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence066 347 934 gene locus_tag LOCUS_10270 347 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1036 2046 gene locus_tag LOCUS_10280 1036 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2077 2421 gene locus_tag LOCUS_10290 2077 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2974 2507 gene locus_tag LOCUS_10300 2974 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 3823 3197 gene locus_tag LOCUS_10310 3823 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 <5169 3816 gene locus_tag LOCUS_10320 <5169 3816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030361.1:iron ABC transporter permease >Feature sequence067 322 395 gene locus_tag LOCUS_t00170 322 395 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 452 1288 gene locus_tag LOCUS_10330 452 1288 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027715.1 protein_id gnl|my_center|LOCUS_10330 2617 1289 gene locus_tag LOCUS_10340 2617 1289 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272198.1 protein_id gnl|my_center|LOCUS_10340 3720 2620 gene locus_tag LOCUS_10350 3720 2620 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064952.1 protein_id gnl|my_center|LOCUS_10350 3824 5041 gene locus_tag LOCUS_10360 gene icd 3824 5041 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWG2 protein_id gnl|my_center|LOCUS_10360 >Feature sequence068 631 4650 gene locus_tag LOCUS_10370 631 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence069 965 339 gene locus_tag LOCUS_10380 gene clpP 965 339 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZF9 protein_id gnl|my_center|LOCUS_10380 2461 962 gene locus_tag LOCUS_10390 gene tig 2461 962 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DE09 protein_id gnl|my_center|LOCUS_10390 2460 2729 gene locus_tag LOCUS_10400 2460 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2760 2835 gene locus_tag LOCUS_t00180 2760 2835 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2868 3263 gene locus_tag LOCUS_10410 2868 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence070 2227 803 gene locus_tag LOCUS_10420 2227 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4232 2502 gene locus_tag LOCUS_10430 4232 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence071 1794 583 gene locus_tag LOCUS_10440 1794 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3969 1849 gene locus_tag LOCUS_10450 3969 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence072 906 613 gene locus_tag LOCUS_10460 906 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 974 1843 gene locus_tag LOCUS_10470 gene galU 974 1843 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9ULY4 protein_id gnl|my_center|LOCUS_10470 2403 1840 gene locus_tag LOCUS_10480 2403 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 2473 3723 gene locus_tag LOCUS_10490 2473 3723 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_10490 3755 4753 gene locus_tag LOCUS_10500 gene moaA 3755 4753 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJ09 protein_id gnl|my_center|LOCUS_10500 >Feature sequence073 1342 947 gene locus_tag LOCUS_10510 1342 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1470 2762 gene locus_tag LOCUS_10520 1470 2762 CDS product FAD-linked oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_10520 <4881 2766 gene locus_tag LOCUS_10530 <4881 2766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226424.1:carbon-monoxide dehydrogenase large subunit >Feature sequence074 <1 556 gene locus_tag LOCUS_10540 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MCD8:dihydroorotase 553 1641 gene locus_tag LOCUS_10550 gene carA 553 1641 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGA2 protein_id gnl|my_center|LOCUS_10550 >Feature sequence075 >Feature sequence076 4377 3805 gene locus_tag LOCUS_10560 4377 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence077 <1 838 gene locus_tag LOCUS_10570 <1 838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227727.1:branched chain amino acid aminotransferase 967 1686 gene locus_tag LOCUS_10580 967 1686 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_10580 1766 1954 gene locus_tag LOCUS_10590 1766 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 2076 2837 gene locus_tag LOCUS_10600 gene hetN 2076 2837 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence078 1337 1480 gene locus_tag LOCUS_10610 1337 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1565 2176 gene locus_tag LOCUS_10620 1565 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 3169 2177 gene locus_tag LOCUS_10630 3169 2177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_10630 4143 3169 gene locus_tag LOCUS_10640 4143 3169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence079 >Feature sequence080 >Feature sequence081 2418 1318 gene locus_tag LOCUS_10650 2418 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence082 991 3066 gene locus_tag LOCUS_10660 991 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 3087 4043 gene locus_tag LOCUS_10670 3087 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence083 1531 224 gene locus_tag LOCUS_10680 gene glyS 1531 224 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBH4 protein_id gnl|my_center|LOCUS_10680 2262 1543 gene locus_tag LOCUS_10690 gene recO 2262 1543 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0S5 protein_id gnl|my_center|LOCUS_10690 2879 2259 gene locus_tag LOCUS_10700 2879 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 2958 3647 gene locus_tag LOCUS_10710 2958 3647 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence084 236 658 gene locus_tag LOCUS_10720 236 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 762 1076 gene locus_tag LOCUS_10730 762 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1101 1919 gene locus_tag LOCUS_10740 1101 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2173 2511 gene locus_tag LOCUS_10750 2173 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3179 3964 gene locus_tag LOCUS_10760 3179 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence085 >Feature sequence086 1393 158 gene locus_tag LOCUS_10770 1393 158 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_10770 1521 2054 gene locus_tag LOCUS_10780 1521 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 2834 2055 gene locus_tag LOCUS_10790 2834 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702890.1 protein_id gnl|my_center|LOCUS_10790 <3928 2879 gene locus_tag LOCUS_10800 <3928 2879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226841.1:LLM class F420-dependent oxidoreductase >Feature sequence087 1405 461 gene locus_tag LOCUS_10810 1405 461 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_10810 1459 1740 gene locus_tag LOCUS_10820 1459 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1743 3599 gene locus_tag LOCUS_10830 1743 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 3602 3916 gene locus_tag LOCUS_10840 gene clpS 3602 3916 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2G5 protein_id gnl|my_center|LOCUS_10840 >Feature sequence088 1971 3440 gene locus_tag LOCUS_10850 1971 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence089 976 1902 gene locus_tag LOCUS_10860 976 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 2480 3745 gene locus_tag LOCUS_10870 2480 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence090 9 1307 gene locus_tag LOCUS_10880 9 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence091 561 1220 gene locus_tag LOCUS_10890 561 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1230 1718 gene locus_tag LOCUS_10900 gene ppa 1230 1718 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R597 protein_id gnl|my_center|LOCUS_10900 1872 2204 gene locus_tag LOCUS_10910 1872 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2538 2275 gene locus_tag LOCUS_10920 2538 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 3004 2564 gene locus_tag LOCUS_10930 3004 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 3453 3022 gene locus_tag LOCUS_10940 3453 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence092 >Feature sequence093 433 146 gene locus_tag LOCUS_10950 433 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 490 2382 gene locus_tag LOCUS_10960 490 2382 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_10960 2379 2885 gene locus_tag LOCUS_10970 2379 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence094 1811 603 gene locus_tag LOCUS_10980 gene hisS 1811 603 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q833I1 protein_id gnl|my_center|LOCUS_10980 <3661 1892 gene locus_tag LOCUS_10990 <3661 1892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P52560:GTP pyrophosphokinase >Feature sequence095 174 644 gene locus_tag LOCUS_11000 174 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 703 1788 gene locus_tag LOCUS_11010 703 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3555 2254 gene locus_tag LOCUS_11020 3555 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence096 35 226 gene locus_tag LOCUS_11030 35 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 434 1720 gene locus_tag LOCUS_11040 434 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1771 2589 gene locus_tag LOCUS_11050 1771 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence097 >Feature sequence098 414 3395 gene locus_tag LOCUS_11060 414 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence099 543 2039 gene locus_tag LOCUS_11070 543 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence100 1564 1944 gene locus_tag LOCUS_11080 1564 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2902 2696 gene locus_tag LOCUS_11090 2902 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 3385 3158 gene locus_tag LOCUS_11100 3385 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence101 >Feature sequence102 1871 642 gene locus_tag LOCUS_11110 1871 642 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225186.1 protein_id gnl|my_center|LOCUS_11110 3058 1907 gene locus_tag LOCUS_11120 3058 1907 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268699.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence103 1474 155 gene locus_tag LOCUS_11130 1474 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2447 1599 gene locus_tag LOCUS_11140 2447 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 3285 2413 gene locus_tag LOCUS_11150 3285 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence104 >Feature sequence105 <1 1140 gene locus_tag LOCUS_11160 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962593.1:4-hydroxybutyrate CoA-transferase 1164 1376 gene locus_tag LOCUS_11170 1164 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2255 1353 gene locus_tag LOCUS_11180 2255 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2309 2689 gene locus_tag LOCUS_11190 2309 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 <3449 2690 gene locus_tag LOCUS_11200 <3449 2690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8NLF0:UPF0176 protein Cgl2992/cg3319 >Feature sequence106 314 451 gene locus_tag LOCUS_11210 314 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1263 1466 gene locus_tag LOCUS_11220 1263 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 2012 2185 gene locus_tag LOCUS_11230 2012 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2339 2869 gene locus_tag LOCUS_11240 2339 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 3002 3241 gene locus_tag LOCUS_11250 3002 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence107 582 2372 gene locus_tag LOCUS_11260 582 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence108 1658 3139 gene locus_tag LOCUS_11270 1658 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence109 <1 717 gene locus_tag LOCUS_11280 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IWW7:pyrroline-5-carboxylate reductase 882 1781 gene locus_tag LOCUS_11290 882 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence110 86 1243 gene locus_tag LOCUS_11300 86 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence111 753 1448 gene locus_tag LOCUS_11310 753 1448 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878743.1 protein_id gnl|my_center|LOCUS_11310 1467 2714 gene locus_tag LOCUS_11320 1467 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 <3302 2734 gene locus_tag LOCUS_11330 <3302 2734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400489.1:alpha/beta hydrolase >Feature sequence112 1817 930 gene locus_tag LOCUS_11340 1817 930 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_11340 2269 1895 gene locus_tag LOCUS_11350 2269 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence113 1074 592 gene locus_tag LOCUS_11360 1074 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1712 1449 gene locus_tag LOCUS_11370 1712 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 2651 2286 gene locus_tag LOCUS_11380 2651 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence114 189 404 gene locus_tag LOCUS_11390 189 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 815 940 gene locus_tag LOCUS_11400 815 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1275 1409 gene locus_tag LOCUS_11410 1275 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1686 1519 gene locus_tag LOCUS_11420 1686 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2033 1683 gene locus_tag LOCUS_11430 2033 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence115 1813 2958 gene locus_tag LOCUS_11440 1813 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence116 1678 1457 gene locus_tag LOCUS_11450 1678 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1883 1689 gene locus_tag LOCUS_11460 gene rpmB1 1883 1689 CDS product 50S ribosomal protein L28-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBR5 protein_id gnl|my_center|LOCUS_11460 >Feature sequence117 924 100 gene locus_tag LOCUS_11470 924 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence118 2362 1169 gene locus_tag LOCUS_11480 gene metK 2362 1169 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4V4 protein_id gnl|my_center|LOCUS_11480 <3177 2376 gene locus_tag LOCUS_11490 <3177 2376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224625.1:phosphopantothenoylcysteine decarboxylase >Feature sequence119 75 1412 gene locus_tag LOCUS_11500 75 1412 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_11500 1419 2147 gene locus_tag LOCUS_11510 1419 2147 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888864.1 protein_id gnl|my_center|LOCUS_11510 <3170 2144 gene locus_tag LOCUS_11520 <3170 2144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085689.1:cytochrome P450 >Feature sequence120 2824 1781 gene locus_tag LOCUS_11530 2824 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence121 >Feature sequence122 3023 1788 gene locus_tag LOCUS_11540 3023 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence123 >Feature sequence124 <1 655 gene locus_tag LOCUS_11550 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9L288:putative transcriptional regulatory protein 655 1107 gene locus_tag LOCUS_11560 gene bcp-2 655 1107 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933657.1 protein_id gnl|my_center|LOCUS_11560 1149 1694 gene locus_tag LOCUS_11570 gene ruvC 1149 1694 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAF2 protein_id gnl|my_center|LOCUS_11570 1691 2284 gene locus_tag LOCUS_11580 gene ruvA 1691 2284 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E87 protein_id gnl|my_center|LOCUS_11580 >Feature sequence125 1598 2230 gene locus_tag LOCUS_11590 1598 2230 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390358.1 protein_id gnl|my_center|LOCUS_11590 <3099 2227 gene locus_tag LOCUS_11600 <3099 2227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932972.1:ABC transporter ATP-binding protein >Feature sequence126 243 626 gene locus_tag LOCUS_11610 243 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1414 2379 gene locus_tag LOCUS_11620 1414 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence127 2574 985 gene locus_tag LOCUS_11630 gene prfC 2574 985 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QS18 protein_id gnl|my_center|LOCUS_11630 >Feature sequence128 242 1510 gene locus_tag LOCUS_11640 242 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1663 2208 gene locus_tag LOCUS_11650 gene pyrR 1663 2208 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDU6 protein_id gnl|my_center|LOCUS_11650 >Feature sequence129 601 819 gene locus_tag LOCUS_11660 601 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 834 1193 gene locus_tag LOCUS_11670 834 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1346 1609 gene locus_tag LOCUS_11680 1346 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence130 2509 2381 gene locus_tag LOCUS_11690 2509 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence131 3005 1812 gene locus_tag LOCUS_11700 3005 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence132 279 1496 gene locus_tag LOCUS_11710 279 1496 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_11710 2146 1493 gene locus_tag LOCUS_11720 2146 1493 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 protein_id gnl|my_center|LOCUS_11720 2228 2986 gene locus_tag LOCUS_11730 2228 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296133.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence133 1085 2983 gene locus_tag LOCUS_11740 1085 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence134 1586 627 gene locus_tag LOCUS_11750 1586 627 CDS product LPPG--FO 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_11750 1688 2674 gene locus_tag LOCUS_11760 gene gmd 1688 2674 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVJ1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence135 295 1488 gene locus_tag LOCUS_11770 295 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1496 2713 gene locus_tag LOCUS_11780 gene codA 1496 2713 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223886.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence136 1013 597 gene locus_tag LOCUS_11790 1013 597 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_11790 2019 1126 gene locus_tag LOCUS_11800 2019 1126 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence137 1008 175 gene locus_tag LOCUS_11810 1008 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1574 1047 gene locus_tag LOCUS_11820 gene greA 1574 1047 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADK2 protein_id gnl|my_center|LOCUS_11820 1458 2561 gene locus_tag LOCUS_11830 gene leuB 1458 2561 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94631 protein_id gnl|my_center|LOCUS_11830 >Feature sequence138 250 1089 gene locus_tag LOCUS_11840 gene era 250 1089 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNK9 protein_id gnl|my_center|LOCUS_11840 <2901 1097 gene locus_tag LOCUS_11850 <2901 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730185.1:helicase >Feature sequence139 24 1031 gene locus_tag LOCUS_11860 24 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence140 1173 1331 gene locus_tag LOCUS_11870 1173 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 2363 2671 gene locus_tag LOCUS_11880 2363 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence141 2587 866 gene locus_tag LOCUS_11890 2587 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 2867 2634 gene locus_tag LOCUS_11900 2867 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence142 2762 456 gene locus_tag LOCUS_11910 2762 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence143 2434 1664 gene locus_tag LOCUS_11920 gene paaG 2434 1664 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229505.1 protein_id gnl|my_center|LOCUS_11920 2548 2473 gene locus_tag LOCUS_t00190 2548 2473 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence144 833 696 gene locus_tag LOCUS_11930 833 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1655 1410 gene locus_tag LOCUS_11940 1655 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2692 1994 gene locus_tag LOCUS_11950 2692 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence145 466 1827 gene locus_tag LOCUS_11960 466 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence146 >Feature sequence147 <1 1062 gene locus_tag LOCUS_11970 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533220.1:cytochrome c oxidase subunit II >Feature sequence148 <2821 1978 gene locus_tag LOCUS_11980 <2821 1978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001700791.1:putative penicillin-binding protein PbpA >Feature sequence149 1677 2687 gene locus_tag LOCUS_11990 1677 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence150 9 716 gene locus_tag LOCUS_12000 9 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence151 240 2756 gene locus_tag LOCUS_12010 240 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence152 312 446 gene locus_tag LOCUS_12020 312 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1053 1265 gene locus_tag LOCUS_12030 1053 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence153 1223 24 gene locus_tag LOCUS_12040 1223 24 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_12040 <2784 1223 gene locus_tag LOCUS_12050 <2784 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MD99:elongation factor 4 >Feature sequence154 1007 1201 gene locus_tag LOCUS_12060 1007 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1198 1527 gene locus_tag LOCUS_12070 1198 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2029 2271 gene locus_tag LOCUS_12080 2029 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2301 2777 gene locus_tag LOCUS_12090 2301 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence155 1930 233 gene locus_tag LOCUS_12100 1930 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence156 777 178 gene locus_tag LOCUS_12110 777 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2507 1779 gene locus_tag LOCUS_12120 2507 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence157 1725 148 gene locus_tag LOCUS_12130 1725 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence158 >Feature sequence159 1014 1400 gene locus_tag LOCUS_12140 1014 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence160 1547 894 gene locus_tag LOCUS_12150 gene trpF 1547 894 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56320 protein_id gnl|my_center|LOCUS_12150 2367 1576 gene locus_tag LOCUS_12160 gene trpC1 2367 1576 CDS product indole-3-glycerol phosphate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68814 protein_id gnl|my_center|LOCUS_12160 >Feature sequence161 1228 206 gene locus_tag LOCUS_12170 1228 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2460 1231 gene locus_tag LOCUS_12180 gene rifK 2460 1231 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence162 >Feature sequence163 890 273 gene locus_tag LOCUS_12190 890 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1403 1095 gene locus_tag LOCUS_12200 1403 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1940 1686 gene locus_tag LOCUS_12210 1940 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 2482 1946 gene locus_tag LOCUS_12220 2482 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence164 642 1997 gene locus_tag LOCUS_12230 642 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence165 <1 1135 gene locus_tag LOCUS_12240 <1 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NN66:acetylornithine aminotransferase 1132 2022 gene locus_tag LOCUS_12250 gene arcB 1132 2022 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB17 protein_id gnl|my_center|LOCUS_12250 2019 2531 gene locus_tag LOCUS_12260 gene argR 2019 2531 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MB01 protein_id gnl|my_center|LOCUS_12260 >Feature sequence166 309 965 gene locus_tag LOCUS_12270 309 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1278 1616 gene locus_tag LOCUS_12280 1278 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 2274 2525 gene locus_tag LOCUS_12290 2274 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence167 >Feature sequence168 1903 1340 gene locus_tag LOCUS_12300 1903 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2081 1920 gene locus_tag LOCUS_12310 2081 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence169 >Feature sequence170 >Feature sequence171 >Feature sequence172 304 149 gene locus_tag LOCUS_12320 304 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 486 1451 gene locus_tag LOCUS_12330 486 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence173 728 153 gene locus_tag LOCUS_12340 gene maf 728 153 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q82ZA4 protein_id gnl|my_center|LOCUS_12340 764 1066 gene locus_tag LOCUS_12350 764 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 2199 1063 gene locus_tag LOCUS_12360 2199 1063 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKF6 protein_id gnl|my_center|LOCUS_12360 2597 2196 gene locus_tag LOCUS_12370 2597 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence174 343 570 gene locus_tag LOCUS_12380 343 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 768 1001 gene locus_tag LOCUS_12390 768 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence175 621 773 gene locus_tag LOCUS_12400 621 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 907 1197 gene locus_tag LOCUS_12410 907 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1245 1817 gene locus_tag LOCUS_12420 1245 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence176 120 665 gene locus_tag LOCUS_12430 120 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2275 1376 gene locus_tag LOCUS_12440 2275 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence177 429 82 gene locus_tag LOCUS_12450 429 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence178 >Feature sequence179 29 1429 gene locus_tag LOCUS_12460 29 1429 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818T2 protein_id gnl|my_center|LOCUS_12460 >Feature sequence180 >Feature sequence181 >Feature sequence182 1069 1905 gene locus_tag LOCUS_12470 1069 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence183 2252 249 gene locus_tag LOCUS_12480 2252 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence184 >Feature sequence185 >Feature sequence186 512 285 gene locus_tag LOCUS_12490 512 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1002 547 gene locus_tag LOCUS_12500 1002 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2362 2102 gene locus_tag LOCUS_12510 2362 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence187 >Feature sequence188 1643 1461 gene locus_tag LOCUS_12520 1643 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 2241 2369 gene locus_tag LOCUS_12530 2241 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence189 398 1564 gene locus_tag LOCUS_12540 398 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 <2395 1548 gene locus_tag LOCUS_12550 <2395 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000842681.1:glycosyl transferase >Feature sequence190 >Feature sequence191 >Feature sequence192 >Feature sequence193 312 55 gene locus_tag LOCUS_12560 312 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence194 1434 940 gene locus_tag LOCUS_12570 1434 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2057 1875 gene locus_tag LOCUS_12580 2057 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence195 253 32 gene locus_tag LOCUS_12590 253 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence196 1740 1435 gene locus_tag LOCUS_12600 1740 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence197 510 434 gene locus_tag LOCUS_t00200 510 434 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 791 549 gene locus_tag LOCUS_12610 791 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 2119 794 gene locus_tag LOCUS_12620 2119 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence198 >Feature sequence199 859 2169 gene locus_tag LOCUS_12630 859 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence200 467 766 gene locus_tag LOCUS_12640 467 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1118 1390 gene locus_tag LOCUS_12650 1118 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence201 373 125 gene locus_tag LOCUS_12660 373 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence202 549 962 gene locus_tag LOCUS_12670 549 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1155 1502 gene locus_tag LOCUS_12680 1155 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1627 1803 gene locus_tag LOCUS_12690 1627 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence203 459 836 gene locus_tag LOCUS_12700 459 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence204 >Feature sequence205 1071 436 gene locus_tag LOCUS_12710 1071 436 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229387.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence206 116 409 gene locus_tag LOCUS_12720 116 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 878 1102 gene locus_tag LOCUS_12730 878 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence207 >Feature sequence208 260 87 gene locus_tag LOCUS_12740 260 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1186 878 gene locus_tag LOCUS_12750 1186 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 2102 1389 gene locus_tag LOCUS_12760 2102 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence209 >Feature sequence210 257 505 gene locus_tag LOCUS_12770 257 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 483 806 gene locus_tag LOCUS_12780 483 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 842 1432 gene locus_tag LOCUS_12790 842 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence211 >Feature sequence212 >Feature sequence213 403 1260 gene locus_tag LOCUS_12800 403 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1757 2101 gene locus_tag LOCUS_12810 1757 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence214 753 1034 gene locus_tag LOCUS_12820 753 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1955 1149 gene locus_tag LOCUS_12830 1955 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence215 1927 236 gene locus_tag LOCUS_12840 1927 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence216 >Feature sequence217 >Feature sequence218 911 573 gene locus_tag LOCUS_12850 911 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1279 908 gene locus_tag LOCUS_12860 1279 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1445 1822 gene locus_tag LOCUS_12870 1445 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence219 315 136 gene locus_tag LOCUS_12880 315 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence220 381 61 gene locus_tag LOCUS_12890 381 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence221 385 1410 gene locus_tag LOCUS_12900 gene gap3 385 1410 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA88 protein_id gnl|my_center|LOCUS_12900 >Feature sequence222 >Feature sequence223 1728 1991 gene locus_tag LOCUS_12910 1728 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence224 1573 1716 gene locus_tag LOCUS_12920 1573 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1797 1949 gene locus_tag LOCUS_12930 1797 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence225 1010 1192 gene locus_tag LOCUS_12940 1010 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence226 1218 895 gene locus_tag LOCUS_12950 1218 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence227 >Feature sequence228 365 670 gene locus_tag LOCUS_12960 365 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence229 237 1436 gene locus_tag LOCUS_12970 237 1436 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence230 757 1869 gene locus_tag LOCUS_12980 757 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence231 >Feature sequence232 >Feature sequence233 >Feature sequence234 112 456 gene locus_tag LOCUS_12990 112 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1292 1771 gene locus_tag LOCUS_13000 1292 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence235 >Feature sequence236 1689 931 gene locus_tag LOCUS_13010 1689 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence237 >Feature sequence238 1605 1072 gene locus_tag LOCUS_13020 1605 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1866 1615 gene locus_tag LOCUS_13030 1866 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence239 1373 1131 gene locus_tag LOCUS_13040 1373 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence240 >Feature sequence241 622 843 gene locus_tag LOCUS_13050 622 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence242 284 460 gene locus_tag LOCUS_13060 284 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1618 1770 gene locus_tag LOCUS_13070 1618 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1921 1742 gene locus_tag LOCUS_13080 1921 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence243 >Feature sequence244 1220 123 gene locus_tag LOCUS_13090 1220 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence245 >Feature sequence246 418 1236 gene locus_tag LOCUS_13100 418 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence247 >Feature sequence248 >Feature sequence249 643 305 gene locus_tag LOCUS_13110 643 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence250 673 545 gene locus_tag LOCUS_13120 673 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1411 1914 gene locus_tag LOCUS_13130 1411 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence251 221 1381 gene locus_tag LOCUS_13140 221 1381 CDS product putative ABC transporter/extracellular ligand-binding receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703360.1 protein_id gnl|my_center|LOCUS_13140 >Feature sequence252 373 300 gene locus_tag LOCUS_t00210 373 300 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence253 >Feature sequence254 150 1904 gene locus_tag LOCUS_13150 150 1904 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994617.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence255 >Feature sequence256 1235 1441 gene locus_tag LOCUS_13160 1235 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1584 1736 gene locus_tag LOCUS_13170 1584 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence257 >Feature sequence258 220 38 gene locus_tag LOCUS_13180 220 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 690 232 gene locus_tag LOCUS_13190 690 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 887 738 gene locus_tag LOCUS_13200 887 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence259 998 1378 gene locus_tag LOCUS_13210 998 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence260 >Feature sequence261 >Feature sequence262 >Feature sequence263 >Feature sequence264 237 926 gene locus_tag LOCUS_13220 237 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence265 >Feature sequence266 >Feature sequence267 1322 1669 gene locus_tag LOCUS_13230 1322 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence268 626 498 gene locus_tag LOCUS_13240 626 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence269 1385 798 gene locus_tag LOCUS_13250 1385 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence270 >Feature sequence271 756 181 gene locus_tag LOCUS_13260 756 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence272 1419 1730 gene locus_tag LOCUS_13270 1419 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence273 >Feature sequence274 >Feature sequence275 628 782 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cagagctactctgtagccgg >Feature sequence276 761 1414 gene locus_tag LOCUS_13280 761 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence277 >Feature sequence278 1486 188 gene locus_tag LOCUS_13290 1486 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence279 1746 1671 gene locus_tag LOCUS_t00220 1746 1671 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence280 >Feature sequence281 >Feature sequence282 >Feature sequence283 >Feature sequence284 >Feature sequence285 >Feature sequence286 >Feature sequence287 1169 378 gene locus_tag LOCUS_13300 1169 378 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1D0 protein_id gnl|my_center|LOCUS_13300 >Feature sequence288 >Feature sequence289 >Feature sequence290 >Feature sequence291 1481 1164 gene locus_tag LOCUS_13310 1481 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence292 >Feature sequence293 198 701 gene locus_tag LOCUS_13320 198 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence294 >Feature sequence295 >Feature sequence296 1499 900 gene locus_tag LOCUS_13330 1499 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence297 >Feature sequence298 114 257 gene locus_tag LOCUS_13340 114 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence299 >Feature sequence300 829 683 gene locus_tag LOCUS_13350 829 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 997 857 gene locus_tag LOCUS_13360 997 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1174 1016 gene locus_tag LOCUS_13370 1174 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence301 697 1650 gene locus_tag LOCUS_13380 697 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence302 >Feature sequence303 >Feature sequence304 142 297 gene locus_tag LOCUS_13390 142 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1592 354 gene locus_tag LOCUS_13400 1592 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence305 >Feature sequence306 648 223 gene locus_tag LOCUS_13410 648 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence307 <1 702 gene locus_tag LOCUS_13420 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P80866:vegetative protein 296 699 950 gene locus_tag LOCUS_13430 699 950 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZF4 protein_id gnl|my_center|LOCUS_13430 >Feature sequence308 >Feature sequence309 >Feature sequence310 640 308 gene locus_tag LOCUS_13440 640 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228769.1 protein_id gnl|my_center|LOCUS_13440 686 895 gene locus_tag LOCUS_13450 686 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975334.1 protein_id gnl|my_center|LOCUS_13450 1458 910 gene locus_tag LOCUS_13460 1458 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence311 312 1034 gene locus_tag LOCUS_13470 312 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1082 1240 gene locus_tag LOCUS_13480 1082 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence312 >Feature sequence313 <1676 342 gene locus_tag LOCUS_13490 <1676 342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066164.1:catalase-peroxidase >Feature sequence314 >Feature sequence315 1082 765 gene locus_tag LOCUS_13500 1082 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence316 >Feature sequence317 3 557 gene locus_tag LOCUS_13510 3 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 597 929 gene locus_tag LOCUS_13520 597 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence318 <1661 651 gene locus_tag LOCUS_13530 <1661 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973100.1:DEAD/DEAH box helicase >Feature sequence319 >Feature sequence320 >Feature sequence321 >Feature sequence322 >Feature sequence323 >Feature sequence324 814 1065 gene locus_tag LOCUS_13540 814 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence325 >Feature sequence326 1516 95 gene locus_tag LOCUS_13550 1516 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence327 834 43 gene locus_tag LOCUS_13560 834 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence328 >Feature sequence329 >Feature sequence330 950 1417 gene locus_tag LOCUS_13570 950 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence331 >Feature sequence332 >Feature sequence333 >Feature sequence334 >Feature sequence335 >Feature sequence336 >Feature sequence337 >Feature sequence338 495 1406 gene locus_tag LOCUS_13580 495 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142342.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence339 196 597 gene locus_tag LOCUS_13590 196 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence340 >Feature sequence341 >Feature sequence342 587 1525 gene locus_tag LOCUS_13600 587 1525 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400489.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence343 >Feature sequence344 >Feature sequence345 >Feature sequence346 >Feature sequence347 >Feature sequence348 81 836 gene locus_tag LOCUS_13610 gene ssuB 81 836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223885.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence349 >Feature sequence350 93 302 gene locus_tag LOCUS_13620 93 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975334.1 protein_id gnl|my_center|LOCUS_13620 889 308 gene locus_tag LOCUS_13630 889 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1427 879 gene locus_tag LOCUS_13640 1427 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence351 141 794 gene locus_tag LOCUS_13650 141 794 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 protein_id gnl|my_center|LOCUS_13650 <1550 791 gene locus_tag LOCUS_13660 <1550 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582847.1:beta-glucosidase >Feature sequence352 >Feature sequence353 84 446 gene locus_tag LOCUS_13670 84 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence354 471 1199 gene locus_tag LOCUS_13680 471 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence355 >Feature sequence356 160 1203 gene locus_tag LOCUS_13690 160 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence357 >Feature sequence358 >Feature sequence359 1329 1186 gene locus_tag LOCUS_13700 1329 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence360 78 1100 gene locus_tag LOCUS_13710 78 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence361 >Feature sequence362 1216 1097 gene locus_tag LOCUS_13720 1216 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence363 >Feature sequence364 >Feature sequence365 >Feature sequence366 >Feature sequence367 >Feature sequence368 1461 685 gene locus_tag LOCUS_13730 1461 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence369 1501 146 gene locus_tag LOCUS_13740 1501 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence370 >Feature sequence371 1338 766 gene locus_tag LOCUS_13750 1338 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence372 975 1355 gene locus_tag LOCUS_13760 975 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence373 1 222 gene locus_tag LOCUS_13770 1 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 750 523 gene locus_tag LOCUS_13780 750 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1097 1231 gene locus_tag LOCUS_13790 1097 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence374 >Feature sequence375 592 861 gene locus_tag LOCUS_13800 592 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence376 545 775 gene locus_tag LOCUS_13810 545 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence377 559 1326 gene locus_tag LOCUS_13820 559 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence378 >Feature sequence379 >Feature sequence380 750 1232 gene locus_tag LOCUS_13830 750 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence381 327 488 gene locus_tag LOCUS_13840 327 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence382 >Feature sequence383 >Feature sequence384 >Feature sequence385 386 562 gene locus_tag LOCUS_13850 386 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence386 >Feature sequence387 >Feature sequence388 >Feature sequence389 1110 109 gene locus_tag LOCUS_13860 1110 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence390 <1 942 gene locus_tag LOCUS_13870 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728794.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase >Feature sequence391 >Feature sequence392 1374 1099 gene locus_tag LOCUS_13880 1374 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence393 >Feature sequence394 1431 877 gene locus_tag LOCUS_13890 1431 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence395 >Feature sequence396 >Feature sequence397 >Feature sequence398 392 568 gene locus_tag LOCUS_13900 392 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence399 >Feature sequence400 >Feature sequence401 >Feature sequence402 >Feature sequence403 423 274 gene locus_tag LOCUS_13910 423 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence404 >Feature sequence405 >Feature sequence406 400 1026 gene locus_tag LOCUS_13920 400 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1215 1060 gene locus_tag LOCUS_13930 1215 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence407 >Feature sequence408 >Feature sequence409 >Feature sequence410 >Feature sequence411 374 982 gene locus_tag LOCUS_13940 374 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence412 187 1179 gene locus_tag LOCUS_13950 187 1179 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030360.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence413 >Feature sequence414 >Feature sequence415 1173 610 gene locus_tag LOCUS_13960 1173 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence416 >Feature sequence417 >Feature sequence418 >Feature sequence419 963 220 gene locus_tag LOCUS_13970 963 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence420 >Feature sequence421 >Feature sequence422 45 827 gene locus_tag LOCUS_13980 45 827 CDS product glutamate formiminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_13980 1095 817 gene locus_tag LOCUS_13990 1095 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence423 >Feature sequence424 921 679 gene locus_tag LOCUS_14000 921 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence425 745 131 gene locus_tag LOCUS_14010 745 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence426 >Feature sequence427 >Feature sequence428 >Feature sequence429 >Feature sequence430 >Feature sequence431 446 886 gene locus_tag LOCUS_14020 446 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence432 127 1275 gene locus_tag LOCUS_14030 127 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence433 921 1310 gene locus_tag LOCUS_14040 921 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 >Feature sequence434 >Feature sequence435 >Feature sequence436 451 314 gene locus_tag LOCUS_14050 451 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1196 843 gene locus_tag LOCUS_14060 1196 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence437 >Feature sequence438 889 365 gene locus_tag LOCUS_14070 889 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence439 >Feature sequence440 >Feature sequence441 >Feature sequence442 >Feature sequence443 >Feature sequence444 >Feature sequence445 1105 701 gene locus_tag LOCUS_14080 1105 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1313 1149 gene locus_tag LOCUS_14090 1313 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence446 >Feature sequence447 >Feature sequence448 >Feature sequence449 >Feature sequence450 646 203 gene locus_tag LOCUS_14100 646 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence451 1041 517 gene locus_tag LOCUS_14110 1041 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence452 231 1157 gene locus_tag LOCUS_14120 231 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence453 >Feature sequence454 176 418 gene locus_tag LOCUS_14130 176 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1048 863 gene locus_tag LOCUS_14140 1048 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence455 775 563 gene locus_tag LOCUS_14150 775 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence456 >Feature sequence457 >Feature sequence458 337 1050 gene locus_tag LOCUS_14160 337 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence459 >Feature sequence460 >Feature sequence461 212 1012 gene locus_tag LOCUS_14170 212 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence462 >Feature sequence463 >Feature sequence464 >Feature sequence465 >Feature sequence466 >Feature sequence467 592 197 gene locus_tag LOCUS_14180 592 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1113 1271 gene locus_tag LOCUS_14190 1113 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence468 >Feature sequence469 936 139 gene locus_tag LOCUS_14200 gene parA 936 139 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806879.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence470 >Feature sequence471 >Feature sequence472 288 677 gene locus_tag LOCUS_14210 288 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 924 1145 gene locus_tag LOCUS_14220 924 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence473 96 902 gene locus_tag LOCUS_14230 96 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence474 >Feature sequence475 656 471 gene locus_tag LOCUS_14240 656 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence476 >Feature sequence477 1056 526 gene locus_tag LOCUS_14250 1056 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence478 >Feature sequence479 >Feature sequence480 868 793 gene locus_tag LOCUS_t00230 868 793 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence481 >Feature sequence482 261 142 gene locus_tag LOCUS_14260 261 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence483 >Feature sequence484 <1250 719 gene locus_tag LOCUS_14270 <1250 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JNR7:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence485 >Feature sequence486 >Feature sequence487 304 1191 gene locus_tag LOCUS_14280 304 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence488 888 1172 gene locus_tag LOCUS_14290 888 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence489 190 35 gene locus_tag LOCUS_14300 190 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence490 >Feature sequence491 >Feature sequence492 443 321 gene locus_tag LOCUS_14310 443 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1080 811 gene locus_tag LOCUS_14320 1080 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence493 >Feature sequence494 517 383 gene locus_tag LOCUS_14330 517 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 627 508 gene locus_tag LOCUS_14340 627 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence495 >Feature sequence496 760 353 gene locus_tag LOCUS_14350 760 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence497 >Feature sequence498 >Feature sequence499 >Feature sequence500 465 893 gene locus_tag LOCUS_14360 465 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence501 784 984 gene locus_tag LOCUS_14370 784 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence502 >Feature sequence503 >Feature sequence504 >Feature sequence505 >Feature sequence506 >Feature sequence507 >Feature sequence508 <1 897 gene locus_tag LOCUS_14380 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030375.1:ABC transporter substrate-binding protein 898 1140 gene locus_tag LOCUS_14390 898 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14390 >Feature sequence509 >Feature sequence510 >Feature sequence511 1002 163 gene locus_tag LOCUS_14400 1002 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence512 >Feature sequence513 673 825 gene locus_tag LOCUS_14410 673 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence514 >Feature sequence515 767 1039 gene locus_tag LOCUS_14420 767 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence516 >Feature sequence517 >Feature sequence518 648 160 gene locus_tag LOCUS_14430 gene coxS 648 160 CDS product carbon-monoxide dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223812.1 protein_id gnl|my_center|LOCUS_14430 <1199 645 gene locus_tag LOCUS_14440 <1199 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223811.1:carbon-monoxide dehydrogenase medium subunit >Feature sequence519 >Feature sequence520 >Feature sequence521 901 509 gene locus_tag LOCUS_14450 901 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence522 359 1141 gene locus_tag LOCUS_14460 359 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence523 1083 472 gene locus_tag LOCUS_14470 1083 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence524 188 54 gene locus_tag LOCUS_14480 188 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 443 273 gene locus_tag LOCUS_14490 443 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1119 778 gene locus_tag LOCUS_14500 1119 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence525 >Feature sequence526 <1191 683 gene locus_tag LOCUS_14510 <1191 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WPK3:carbamoyl-phosphate synthase large chain >Feature sequence527 >Feature sequence528 >Feature sequence529 476 745 gene locus_tag LOCUS_14520 476 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence530 >Feature sequence531 618 743 gene locus_tag LOCUS_14530 618 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence532 >Feature sequence533 >Feature sequence534 562 401 gene locus_tag LOCUS_14540 562 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence535 841 218 gene locus_tag LOCUS_14550 841 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence536 >Feature sequence537 >Feature sequence538 >Feature sequence539 >Feature sequence540 >Feature sequence541 >Feature sequence542 >Feature sequence543 281 433 gene locus_tag LOCUS_14560 281 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 587 1114 gene locus_tag LOCUS_14570 587 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence544 141 374 gene locus_tag LOCUS_14580 141 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence545 >Feature sequence546 >Feature sequence547 470 339 gene locus_tag LOCUS_14590 470 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 719 558 gene locus_tag LOCUS_14600 719 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence548 >Feature sequence549 >Feature sequence550 >Feature sequence551 >Feature sequence552 2 145 gene locus_tag LOCUS_14610 2 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence553 >Feature sequence554 >Feature sequence555 144 851 gene locus_tag LOCUS_14620 144 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence556 >Feature sequence557 558 728 gene locus_tag LOCUS_14630 558 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 788 1000 gene locus_tag LOCUS_14640 788 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence558 >Feature sequence559 664 125 gene locus_tag LOCUS_14650 664 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence560 1028 120 gene locus_tag LOCUS_14660 1028 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence561 >Feature sequence562 >Feature sequence563 >Feature sequence564 >Feature sequence565 >Feature sequence566 696 511 gene locus_tag LOCUS_14670 696 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence567 >Feature sequence568 >Feature sequence569 >Feature sequence570 >Feature sequence571 >Feature sequence572 >Feature sequence573 >Feature sequence574 >Feature sequence575 >Feature sequence576 >Feature sequence577 >Feature sequence578 173 403 gene locus_tag LOCUS_14680 173 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence579 108 641 gene locus_tag LOCUS_14690 108 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence580 >Feature sequence581 173 21 gene locus_tag LOCUS_14700 173 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence582 >Feature sequence583 >Feature sequence584 >Feature sequence585 >Feature sequence586 >Feature sequence587 >Feature sequence588 >Feature sequence589 >Feature sequence590 <1100 137 gene locus_tag LOCUS_14710 <1100 137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085722.1:cyclohexanone monooxygenase >Feature sequence591 10 609 gene locus_tag LOCUS_14720 10 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1016 723 gene locus_tag LOCUS_14730 1016 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence592 166 375 gene locus_tag LOCUS_14740 166 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence593 >Feature sequence594 >Feature sequence595 >Feature sequence596 >Feature sequence597 353 156 gene locus_tag LOCUS_14750 353 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 800 648 gene locus_tag LOCUS_14760 800 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence598 730 53 gene locus_tag LOCUS_14770 730 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence599 >Feature sequence600 >Feature sequence601 248 769 gene locus_tag LOCUS_14780 248 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence602 89 310 gene locus_tag LOCUS_14790 89 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 421 819 gene locus_tag LOCUS_14800 421 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence603 >Feature sequence604 454 296 gene locus_tag LOCUS_14810 454 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 905 759 gene locus_tag LOCUS_14820 905 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence605 >Feature sequence606 >Feature sequence607 >Feature sequence608 >Feature sequence609 >Feature sequence610 >Feature sequence611 858 133 gene locus_tag LOCUS_14830 858 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence612 574 56 gene locus_tag LOCUS_14840 574 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence613 >Feature sequence614 >Feature sequence615 967 170 gene locus_tag LOCUS_14850 967 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence616 >Feature sequence617 >Feature sequence618 2 247 gene locus_tag LOCUS_14860 2 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 274 612 gene locus_tag LOCUS_14870 274 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence619 >Feature sequence620 >Feature sequence621 >Feature sequence622 >Feature sequence623 601 326 gene locus_tag LOCUS_14880 601 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 855 664 gene locus_tag LOCUS_14890 855 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence624 >Feature sequence625 122 802 gene locus_tag LOCUS_14900 122 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence626 730 350 gene locus_tag LOCUS_14910 730 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence627 128 793 gene locus_tag LOCUS_14920 128 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence628 >Feature sequence629 444 214 gene locus_tag LOCUS_14930 444 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence630 >Feature sequence631 >Feature sequence632 >Feature sequence633 >Feature sequence634 897 631 gene locus_tag LOCUS_14940 897 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence635 890 273 gene locus_tag LOCUS_14950 890 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence636 >Feature sequence637 >Feature sequence638 >Feature sequence639 >Feature sequence640 >Feature sequence641 >Feature sequence642 381 530 gene locus_tag LOCUS_14960 381 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 882 1031 gene locus_tag LOCUS_14970 882 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence643 585 1034 gene locus_tag LOCUS_14980 585 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence644 >Feature sequence645 >Feature sequence646 754 635 gene locus_tag LOCUS_14990 754 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence647 <1 749 gene locus_tag LOCUS_15000 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230619.1:glycosyl transferase family 2 >Feature sequence648 >Feature sequence649 174 704 gene locus_tag LOCUS_15010 174 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence650 >Feature sequence651 >Feature sequence652 235 816 gene locus_tag LOCUS_15020 235 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence653 >Feature sequence654 >Feature sequence655 >Feature sequence656 >Feature sequence657 >Feature sequence658 294 91 gene locus_tag LOCUS_15030 294 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 936 592 gene locus_tag LOCUS_15040 936 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence659 356 177 gene locus_tag LOCUS_15050 356 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence660 >Feature sequence661 >Feature sequence662 452 81 gene locus_tag LOCUS_15060 452 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence663 928 344 gene locus_tag LOCUS_15070 gene pdxT 928 344 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCJ8 protein_id gnl|my_center|LOCUS_15070 >Feature sequence664 >Feature sequence665 148 1005 gene locus_tag LOCUS_15080 148 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence666 >Feature sequence667 >Feature sequence668 >Feature sequence669 >Feature sequence670 >Feature sequence671 >Feature sequence672 >Feature sequence673 >Feature sequence674 <1 518 gene locus_tag LOCUS_15090 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKH4:peptide methionine sulfoxide reductase MsrA >Feature sequence675 >Feature sequence676 >Feature sequence677 >Feature sequence678 >Feature sequence679 309 623 gene locus_tag LOCUS_15100 309 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence680 >Feature sequence681 >Feature sequence682 >Feature sequence683 >Feature sequence684 >Feature sequence685 >Feature sequence686 >Feature sequence687 816 607 gene locus_tag LOCUS_15110 816 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence688 286 92 gene locus_tag LOCUS_15120 286 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 640 314 gene locus_tag LOCUS_15130 640 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence689 >Feature sequence690 >Feature sequence691 >Feature sequence692 582 406 gene locus_tag LOCUS_15140 582 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence693 >Feature sequence694 >Feature sequence695 >Feature sequence696 >Feature sequence697 334 32 gene locus_tag LOCUS_15150 334 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence698