>Feature sequence001 <1 590 gene locus_tag LOCUS_00010 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A685:zinc metalloprotease 657 875 gene locus_tag LOCUS_00020 657 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 963 3014 gene locus_tag LOCUS_00030 gene paaN 963 3014 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709127.1 protein_id gnl|my_center|LOCUS_00030 3122 3853 gene locus_tag LOCUS_00040 3122 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5043 3856 gene locus_tag LOCUS_00050 gene hflX 5043 3856 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YK6 protein_id gnl|my_center|LOCUS_00050 5342 5043 gene locus_tag LOCUS_00060 5342 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5744 5397 gene locus_tag LOCUS_00070 5744 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7631 5835 gene locus_tag LOCUS_00080 gene lepA 7631 5835 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_00080 8739 7699 gene locus_tag LOCUS_00090 gene fjo30 8739 7699 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_00090 9260 8736 gene locus_tag LOCUS_00100 9260 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9913 10890 gene locus_tag LOCUS_00110 gene nrdB 9913 10890 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_00110 10914 13256 gene locus_tag LOCUS_00120 gene nrdA 10914 13256 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_00120 13344 14864 gene locus_tag LOCUS_00130 gene purH 13344 14864 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_00130 14940 15965 gene locus_tag LOCUS_00140 gene mreB 14940 15965 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_00140 16117 16839 gene locus_tag LOCUS_00150 16117 16839 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU1 protein_id gnl|my_center|LOCUS_00150 17434 19206 gene locus_tag LOCUS_00160 gene pbpA 17434 19206 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_00160 19208 20599 gene locus_tag LOCUS_00170 19208 20599 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766924.1 protein_id gnl|my_center|LOCUS_00170 20623 23145 gene locus_tag LOCUS_00180 20623 23145 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_00180 23149 23844 gene locus_tag LOCUS_00190 gene atoD 23149 23844 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_00190 23846 24502 gene locus_tag LOCUS_00200 gene atoA 23846 24502 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_00200 24508 25314 gene locus_tag LOCUS_00210 gene cysQ 24508 25314 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_00210 25314 26807 gene locus_tag LOCUS_00220 25314 26807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26797 28281 gene locus_tag LOCUS_00230 26797 28281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 28262 28498 gene locus_tag LOCUS_00240 28262 28498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 28501 29184 gene locus_tag LOCUS_00250 28501 29184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 29583 29230 gene locus_tag LOCUS_00260 29583 29230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 29940 32189 gene locus_tag LOCUS_00270 29940 32189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32201 32539 gene locus_tag LOCUS_00280 32201 32539 CDS product dksA/traR C4-type zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 protein_id gnl|my_center|LOCUS_00280 >Feature sequence002 591 803 gene locus_tag LOCUS_00290 591 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 821 1012 gene locus_tag LOCUS_00300 gene cspA 821 1012 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418660.1 protein_id gnl|my_center|LOCUS_00300 2427 1054 gene locus_tag LOCUS_00310 2427 1054 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_00310 2903 2451 gene locus_tag LOCUS_00320 gene dtd 2903 2451 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 protein_id gnl|my_center|LOCUS_00320 3847 2900 gene locus_tag LOCUS_00330 gene rsgA 3847 2900 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YJ1 protein_id gnl|my_center|LOCUS_00330 3908 4657 gene locus_tag LOCUS_00340 gene aroE 3908 4657 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_00340 6061 4664 gene locus_tag LOCUS_00350 gene lpdA1 6061 4664 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_00350 6196 6996 gene locus_tag LOCUS_00360 6196 6996 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887478.1 protein_id gnl|my_center|LOCUS_00360 7021 9687 gene locus_tag LOCUS_00370 7021 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 10417 9677 gene locus_tag LOCUS_00380 gene lptB 10417 9677 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_00380 12910 10430 gene locus_tag LOCUS_00390 12910 10430 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_00390 13675 12917 gene locus_tag LOCUS_00400 gene tatC 13675 12917 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_00400 13848 14162 gene locus_tag LOCUS_00410 13848 14162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 14539 14159 gene locus_tag LOCUS_00420 14539 14159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 14914 14546 gene locus_tag LOCUS_00430 14914 14546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 15309 14983 gene locus_tag LOCUS_00440 15309 14983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 15419 16438 gene locus_tag LOCUS_00450 gene pheS 15419 16438 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R71 protein_id gnl|my_center|LOCUS_00450 16438 16776 gene locus_tag LOCUS_00460 gene ytxJ 16438 16776 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985617.1 protein_id gnl|my_center|LOCUS_00460 16773 17906 gene locus_tag LOCUS_00470 16773 17906 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_00470 18759 17881 gene locus_tag LOCUS_00480 18759 17881 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_00480 18903 19520 gene locus_tag LOCUS_00490 18903 19520 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_00490 19647 20390 gene locus_tag LOCUS_00500 19647 20390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 20390 22606 gene locus_tag LOCUS_00510 20390 22606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 22606 23628 gene locus_tag LOCUS_00520 22606 23628 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_00520 23685 25811 gene locus_tag LOCUS_00530 23685 25811 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_00530 25834 26073 gene locus_tag LOCUS_00540 25834 26073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 26083 26967 gene locus_tag LOCUS_00550 26083 26967 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_00550 27020 28612 gene locus_tag LOCUS_00560 gene dagA 27020 28612 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_00560 28688 29509 gene locus_tag LOCUS_00570 28688 29509 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108917.1 protein_id gnl|my_center|LOCUS_00570 29670 30200 gene locus_tag LOCUS_00580 gene apt 29670 30200 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N62 protein_id gnl|my_center|LOCUS_00580 30225 31364 gene locus_tag LOCUS_00590 gene yngJ 30225 31364 CDS product putative acyl-CoA dehydrogenase YngJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34421 protein_id gnl|my_center|LOCUS_00590 >Feature sequence003 2727 3161 gene locus_tag LOCUS_00600 2727 3161 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_00600 3161 3766 gene locus_tag LOCUS_00610 3161 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 4885 3761 gene locus_tag LOCUS_00620 4885 3761 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_00620 7234 4898 gene locus_tag LOCUS_00630 7234 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 7890 7273 gene locus_tag LOCUS_00640 7890 7273 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_00640 8000 8611 gene locus_tag LOCUS_00650 gene udk 8000 8611 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FLG6 protein_id gnl|my_center|LOCUS_00650 9881 9381 gene locus_tag LOCUS_00660 9881 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 9865 12177 gene locus_tag LOCUS_00670 9865 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 13778 12174 gene locus_tag LOCUS_00680 13778 12174 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202279.1 protein_id gnl|my_center|LOCUS_00680 15254 13884 gene locus_tag LOCUS_00690 15254 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 15589 16575 gene locus_tag LOCUS_00700 15589 16575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 18035 17004 gene locus_tag LOCUS_00710 18035 17004 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_00710 18669 18025 gene locus_tag LOCUS_00720 18669 18025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 19097 18669 gene locus_tag LOCUS_00730 19097 18669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 19338 19090 gene locus_tag LOCUS_00740 19338 19090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 19903 19346 gene locus_tag LOCUS_00750 19903 19346 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_00750 20981 19887 gene locus_tag LOCUS_00760 20981 19887 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_00760 22187 21018 gene locus_tag LOCUS_00770 22187 21018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 24565 22301 gene locus_tag LOCUS_00780 24565 22301 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963021.1 protein_id gnl|my_center|LOCUS_00780 25097 24585 gene locus_tag LOCUS_00790 25097 24585 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405853.1 protein_id gnl|my_center|LOCUS_00790 25196 26062 gene locus_tag LOCUS_00800 25196 26062 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_00800 26515 26078 gene locus_tag LOCUS_00810 26515 26078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 26949 26527 gene locus_tag LOCUS_00820 26949 26527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 27072 28094 gene locus_tag LOCUS_00830 27072 28094 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_00830 28820 28098 gene locus_tag LOCUS_00840 gene yqjF 28820 28098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54543 protein_id gnl|my_center|LOCUS_00840 28952 30037 gene locus_tag LOCUS_00850 28952 30037 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940450.1 protein_id gnl|my_center|LOCUS_00850 30110 30358 gene locus_tag LOCUS_00860 30110 30358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 >Feature sequence004 54 1247 gene locus_tag LOCUS_00870 gene gcdH 54 1247 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_00870 3081 1249 gene locus_tag LOCUS_00880 3081 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 3614 3078 gene locus_tag LOCUS_00890 3614 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 4904 3627 gene locus_tag LOCUS_00900 gene serS 4904 3627 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_00900 5105 6676 gene locus_tag LOCUS_00910 gene rprX 5105 6676 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_00910 6673 7374 gene locus_tag LOCUS_00920 gene rprY 6673 7374 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_00920 7376 8815 gene locus_tag LOCUS_00930 7376 8815 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_00930 8880 9875 gene locus_tag LOCUS_00940 8880 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 9877 11316 gene locus_tag LOCUS_00950 9877 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 12541 11288 gene locus_tag LOCUS_00960 12541 11288 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_00960 13322 12525 gene locus_tag LOCUS_00970 13322 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 15051 13312 gene locus_tag LOCUS_00980 15051 13312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_00980 16054 15038 gene locus_tag LOCUS_00990 16054 15038 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_00990 16502 16062 gene locus_tag LOCUS_01000 gene dut 16502 16062 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_01000 16625 17488 gene locus_tag LOCUS_01010 gene cphB 16625 17488 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963249.1 protein_id gnl|my_center|LOCUS_01010 17495 18337 gene locus_tag LOCUS_01020 17495 18337 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963248.1 protein_id gnl|my_center|LOCUS_01020 19559 18330 gene locus_tag LOCUS_01030 19559 18330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966567.1 protein_id gnl|my_center|LOCUS_01030 <24682 19610 gene locus_tag LOCUS_01040 <24682 19610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence005 1835 543 gene locus_tag LOCUS_01050 1835 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 2434 1841 gene locus_tag LOCUS_01060 2434 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 4053 2461 gene locus_tag LOCUS_01070 gene prfC 4053 2461 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE72 protein_id gnl|my_center|LOCUS_01070 4494 4099 gene locus_tag LOCUS_01080 gene ndk 4494 4099 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_01080 4642 5160 gene locus_tag LOCUS_01090 4642 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 5288 9610 gene locus_tag LOCUS_01100 5288 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 9798 11135 gene locus_tag LOCUS_01110 9798 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 11290 11580 gene locus_tag LOCUS_01120 11290 11580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 11571 11768 gene locus_tag LOCUS_01130 11571 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 11776 14862 gene locus_tag LOCUS_01140 11776 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 17278 14864 gene locus_tag LOCUS_01150 17278 14864 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_01150 17886 17326 gene locus_tag LOCUS_01160 gene pabA 17886 17326 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_01160 17948 18325 gene locus_tag LOCUS_01170 gene yjgF 17948 18325 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_01170 18325 20280 gene locus_tag LOCUS_01180 18325 20280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 20340 21665 gene locus_tag LOCUS_01190 gene bfmBB 20340 21665 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_01190 >Feature sequence006 917 1630 gene locus_tag LOCUS_01200 917 1630 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_01200 1633 3315 gene locus_tag LOCUS_01210 1633 3315 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_01210 4304 3318 gene locus_tag LOCUS_01220 4304 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 5027 4305 gene locus_tag LOCUS_01230 gene comB 5027 4305 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97E82 protein_id gnl|my_center|LOCUS_01230 5852 5172 gene locus_tag LOCUS_01240 5852 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 7349 5964 gene locus_tag LOCUS_01250 7349 5964 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_01250 7837 7346 gene locus_tag LOCUS_01260 gene ribH 7837 7346 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_01260 8523 7849 gene locus_tag LOCUS_01270 8523 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 9236 8613 gene locus_tag LOCUS_01280 9236 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 9910 9233 gene locus_tag LOCUS_01290 9910 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 10124 12382 gene locus_tag LOCUS_01300 10124 12382 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404072.1 protein_id gnl|my_center|LOCUS_01300 12385 12822 gene locus_tag LOCUS_01310 12385 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 15107 12825 gene locus_tag LOCUS_01320 gene uvrD 15107 12825 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_01320 15293 15595 gene locus_tag LOCUS_01330 15293 15595 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_01330 15793 16176 gene locus_tag LOCUS_01340 15793 16176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 18580 16166 gene locus_tag LOCUS_01350 gene pheT 18580 16166 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T65 protein_id gnl|my_center|LOCUS_01350 19644 18634 gene locus_tag LOCUS_01360 gene murB 19644 18634 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_01360 19816 21405 gene locus_tag LOCUS_01370 19816 21405 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_01370 >Feature sequence007 2461 3588 gene locus_tag LOCUS_01380 2461 3588 CDS product methionine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704723.1 protein_id gnl|my_center|LOCUS_01380 3576 4352 gene locus_tag LOCUS_01390 3576 4352 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203148.1 protein_id gnl|my_center|LOCUS_01390 4398 6209 gene locus_tag LOCUS_01400 4398 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 6762 8144 gene locus_tag LOCUS_01410 6762 8144 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932175.1 protein_id gnl|my_center|LOCUS_01410 9480 8152 gene locus_tag LOCUS_01420 9480 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 9746 10636 gene locus_tag LOCUS_01430 gene yfcH 9746 10636 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261483.1 protein_id gnl|my_center|LOCUS_01430 10726 12045 gene locus_tag LOCUS_01440 10726 12045 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107715.1 protein_id gnl|my_center|LOCUS_01440 12920 12072 gene locus_tag LOCUS_01450 12920 12072 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_01450 13356 12922 gene locus_tag LOCUS_01460 13356 12922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 13934 13506 gene locus_tag LOCUS_01470 13934 13506 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_01470 14010 14957 gene locus_tag LOCUS_01480 14010 14957 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963746.1 protein_id gnl|my_center|LOCUS_01480 14950 16419 gene locus_tag LOCUS_01490 14950 16419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 16476 18782 gene locus_tag LOCUS_01500 16476 18782 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_01500 19177 18824 gene locus_tag LOCUS_01510 19177 18824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_01510 <21477 19226 gene locus_tag LOCUS_01520 <21477 19226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203679.1:glycosyl hydrolase >Feature sequence008 4720 8016 gene locus_tag LOCUS_01530 4720 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 8305 9291 gene locus_tag LOCUS_01540 8305 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 9662 9276 gene locus_tag LOCUS_01550 9662 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 10695 9649 gene locus_tag LOCUS_01560 gene menC 10695 9649 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_01560 12621 10696 gene locus_tag LOCUS_01570 gene wbpQ 12621 10696 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073062.1 protein_id gnl|my_center|LOCUS_01570 13959 12625 gene locus_tag LOCUS_01580 13959 12625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 14442 13969 gene locus_tag LOCUS_01590 gene rlmH 14442 13969 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_01590 14684 14439 gene locus_tag LOCUS_01600 14684 14439 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_01600 15753 14674 gene locus_tag LOCUS_01610 gene mrp 15753 14674 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 protein_id gnl|my_center|LOCUS_01610 16238 15750 gene locus_tag LOCUS_01620 16238 15750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 16354 16737 gene locus_tag LOCUS_01630 16354 16737 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_01630 17318 16734 gene locus_tag LOCUS_01640 gene ribE 17318 16734 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_01640 18823 17381 gene locus_tag LOCUS_01650 18823 17381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 <19845 18813 gene locus_tag LOCUS_01660 <19845 18813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW47:pyruvate kinase >Feature sequence009 <1 1851 gene locus_tag LOCUS_01670 <1 1851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962756.1:T9SS C-terminal target domain-containing protein 1858 2844 gene locus_tag LOCUS_01680 1858 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 2849 4339 gene locus_tag LOCUS_01690 2849 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 4448 5071 gene locus_tag LOCUS_01700 4448 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 5079 5441 gene locus_tag LOCUS_01710 gene rnpA 5079 5441 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 protein_id gnl|my_center|LOCUS_01710 5438 7081 gene locus_tag LOCUS_01720 5438 7081 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_01720 7192 8544 gene locus_tag LOCUS_01730 7192 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 8570 9469 gene locus_tag LOCUS_01740 gene gldA 8570 9469 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_01740 9471 10742 gene locus_tag LOCUS_01750 gene tyrS 9471 10742 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 protein_id gnl|my_center|LOCUS_01750 11822 10764 gene locus_tag LOCUS_01760 gene queA 11822 10764 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_01760 13382 11910 gene locus_tag LOCUS_01770 13382 11910 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203595.1 protein_id gnl|my_center|LOCUS_01770 14808 13573 gene locus_tag LOCUS_01780 14808 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964009.1 protein_id gnl|my_center|LOCUS_01780 16297 14864 gene locus_tag LOCUS_01790 16297 14864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964011.1 protein_id gnl|my_center|LOCUS_01790 16525 18408 gene locus_tag LOCUS_01800 gene yyaL 16525 18408 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_01800 <19207 18410 gene locus_tag LOCUS_01810 <19207 18410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962843.1:transketolase >Feature sequence010 516 130 gene locus_tag LOCUS_01820 gene rpsI 516 130 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU3 protein_id gnl|my_center|LOCUS_01820 977 522 gene locus_tag LOCUS_01830 gene rplM 977 522 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 protein_id gnl|my_center|LOCUS_01830 1840 1079 gene locus_tag LOCUS_01840 1840 1079 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_01840 2801 1842 gene locus_tag LOCUS_01850 2801 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 4282 2837 gene locus_tag LOCUS_01860 4282 2837 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268257.1 protein_id gnl|my_center|LOCUS_01860 4535 4284 gene locus_tag LOCUS_01870 gene purS 4535 4284 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD66 protein_id gnl|my_center|LOCUS_01870 5361 4525 gene locus_tag LOCUS_01880 5361 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 5485 6582 gene locus_tag LOCUS_01890 5485 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_01890 6579 11744 gene locus_tag LOCUS_01900 6579 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 12985 11765 gene locus_tag LOCUS_01910 12985 11765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 13905 12988 gene locus_tag LOCUS_01920 13905 12988 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_01920 14074 14328 gene locus_tag LOCUS_01930 gene rpmE 14074 14328 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_01930 15348 14374 gene locus_tag LOCUS_01940 15348 14374 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZW3 protein_id gnl|my_center|LOCUS_01940 15474 16148 gene locus_tag LOCUS_01950 gene citB 15474 16148 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_01950 18736 16145 gene locus_tag LOCUS_01960 18736 16145 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_01960 18862 18938 gene locus_tag LOCUS_t00010 18862 18938 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence011 1095 1508 gene locus_tag LOCUS_01970 1095 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 1505 1930 gene locus_tag LOCUS_01980 gene ybeY 1505 1930 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_01980 1984 3855 gene locus_tag LOCUS_01990 gene mnmG 1984 3855 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_01990 5054 3963 gene locus_tag LOCUS_02000 5054 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 5945 5076 gene locus_tag LOCUS_02010 5945 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 7427 5958 gene locus_tag LOCUS_02020 7427 5958 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_02020 10524 7432 gene locus_tag LOCUS_02030 10524 7432 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_02030 10672 11664 gene locus_tag LOCUS_02040 10672 11664 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_02040 12190 11735 gene locus_tag LOCUS_02050 12190 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 12351 12806 gene locus_tag LOCUS_02060 gene tadA 12351 12806 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_02060 13487 12795 gene locus_tag LOCUS_02070 13487 12795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 15865 13493 gene locus_tag LOCUS_02080 15865 13493 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765755.1 protein_id gnl|my_center|LOCUS_02080 16097 16561 gene locus_tag LOCUS_02090 16097 16561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 17019 16564 gene locus_tag LOCUS_02100 gene recX 17019 16564 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_02100 18569 17022 gene locus_tag LOCUS_02110 18569 17022 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_02110 >Feature sequence012 202 1116 gene locus_tag LOCUS_02120 gene ilvE2 202 1116 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_02120 1169 1834 gene locus_tag LOCUS_02130 1169 1834 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_02130 3377 1905 gene locus_tag LOCUS_02140 3377 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 4736 3543 gene locus_tag LOCUS_02150 4736 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 5497 4739 gene locus_tag LOCUS_02160 5497 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 6575 5484 gene locus_tag LOCUS_02170 gene rlmN 6575 5484 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_02170 7697 6582 gene locus_tag LOCUS_02180 gene dnaN 7697 6582 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_02180 8075 7767 gene locus_tag LOCUS_02190 8075 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 8144 8773 gene locus_tag LOCUS_02200 gene arsC 8144 8773 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_02200 9459 8770 gene locus_tag LOCUS_02210 9459 8770 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_02210 12649 9449 gene locus_tag LOCUS_02220 gene ccsBA 12649 9449 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_02220 13290 12808 gene locus_tag LOCUS_02230 13290 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 13508 14047 gene locus_tag LOCUS_02240 13508 14047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963161.1 protein_id gnl|my_center|LOCUS_02240 14073 16703 gene locus_tag LOCUS_02250 14073 16703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 16700 17107 gene locus_tag LOCUS_02260 16700 17107 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032646.1 protein_id gnl|my_center|LOCUS_02260 >Feature sequence013 219 1898 gene locus_tag LOCUS_02270 219 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 1904 2923 gene locus_tag LOCUS_02280 1904 2923 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921125.1 protein_id gnl|my_center|LOCUS_02280 3240 4370 gene locus_tag LOCUS_02290 3240 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 4367 4942 gene locus_tag LOCUS_02300 4367 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 5007 6548 gene locus_tag LOCUS_02310 gene pccB 5007 6548 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_02310 6560 7543 gene locus_tag LOCUS_02320 6560 7543 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66954 protein_id gnl|my_center|LOCUS_02320 7547 8242 gene locus_tag LOCUS_02330 gene lipB 7547 8242 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_02330 8254 9486 gene locus_tag LOCUS_02340 8254 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 9486 9893 gene locus_tag LOCUS_02350 9486 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 11019 9922 gene locus_tag LOCUS_02360 11019 9922 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810429.1 protein_id gnl|my_center|LOCUS_02360 13308 11074 gene locus_tag LOCUS_02370 13308 11074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 14884 13379 gene locus_tag LOCUS_02380 gene gpmI 14884 13379 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A287 protein_id gnl|my_center|LOCUS_02380 15770 14874 gene locus_tag LOCUS_02390 15770 14874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 16396 15794 gene locus_tag LOCUS_02400 16396 15794 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_02400 <18235 16402 gene locus_tag LOCUS_02410 <18235 16402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962469.1:membrane protein >Feature sequence014 1708 149 gene locus_tag LOCUS_02420 1708 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 1919 2482 gene locus_tag LOCUS_02430 1919 2482 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_02430 2501 2983 gene locus_tag LOCUS_02440 2501 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 3025 3480 gene locus_tag LOCUS_02450 3025 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 4979 3534 gene locus_tag LOCUS_02460 gene asnS 4979 3534 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_02460 5134 6090 gene locus_tag LOCUS_02470 5134 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 7291 6125 gene locus_tag LOCUS_02480 7291 6125 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019915.1 protein_id gnl|my_center|LOCUS_02480 7929 7351 gene locus_tag LOCUS_02490 gene pth 7929 7351 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_02490 8804 7923 gene locus_tag LOCUS_02500 8804 7923 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962664.1 protein_id gnl|my_center|LOCUS_02500 9508 8801 gene locus_tag LOCUS_02510 9508 8801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 10335 9508 gene locus_tag LOCUS_02520 10335 9508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 11073 10414 gene locus_tag LOCUS_02530 gene ypmQ 11073 10414 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_02530 11570 11070 gene locus_tag LOCUS_02540 11570 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 12114 11563 gene locus_tag LOCUS_02550 12114 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020439.1 protein_id gnl|my_center|LOCUS_02550 12453 12118 gene locus_tag LOCUS_02560 12453 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 13463 12519 gene locus_tag LOCUS_02570 13463 12519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 13689 13453 gene locus_tag LOCUS_02580 13689 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 13652 14584 gene locus_tag LOCUS_02590 13652 14584 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939052.1 protein_id gnl|my_center|LOCUS_02590 16109 14574 gene locus_tag LOCUS_02600 16109 14574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 16194 16463 gene locus_tag LOCUS_02610 16194 16463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 17249 16458 gene locus_tag LOCUS_02620 17249 16458 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_02620 >Feature sequence015 68 1756 gene locus_tag LOCUS_02630 68 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109083.1 protein_id gnl|my_center|LOCUS_02630 1749 2411 gene locus_tag LOCUS_02640 1749 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 2414 3763 gene locus_tag LOCUS_02650 2414 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 4762 3764 gene locus_tag LOCUS_02660 4762 3764 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_02660 6132 4750 gene locus_tag LOCUS_02670 6132 4750 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108638.1 protein_id gnl|my_center|LOCUS_02670 6599 6132 gene locus_tag LOCUS_02680 6599 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_02680 7145 6636 gene locus_tag LOCUS_02690 7145 6636 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_02690 7324 9504 gene locus_tag LOCUS_02700 7324 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 11304 9499 gene locus_tag LOCUS_02710 gene uvrC 11304 9499 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_02710 11360 12193 gene locus_tag LOCUS_02720 11360 12193 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_02720 12904 12176 gene locus_tag LOCUS_02730 gene pcrB 12904 12176 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_02730 13496 12906 gene locus_tag LOCUS_02740 13496 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 >Feature sequence016 <1 1157 gene locus_tag LOCUS_02750 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0Z9:urocanate hydratase 2216 2734 gene locus_tag LOCUS_02760 2216 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 2809 3807 gene locus_tag LOCUS_02770 2809 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038314.1 protein_id gnl|my_center|LOCUS_02770 6056 3804 gene locus_tag LOCUS_02780 6056 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 9529 6134 gene locus_tag LOCUS_02790 9529 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 10491 9673 gene locus_tag LOCUS_02800 10491 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 12108 10564 gene locus_tag LOCUS_02810 gene glyQS 12108 10564 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZB5 protein_id gnl|my_center|LOCUS_02810 12189 12935 gene locus_tag LOCUS_02820 12189 12935 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_02820 14191 13742 gene locus_tag LOCUS_02830 14191 13742 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096684.1 protein_id gnl|my_center|LOCUS_02830 <15963 14188 gene locus_tag LOCUS_02840 <15963 14188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964220.1:cell surface protein SprA >Feature sequence017 635 1225 gene locus_tag LOCUS_02850 635 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 1294 4020 gene locus_tag LOCUS_02860 1294 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 4023 4886 gene locus_tag LOCUS_02870 gene rfbA 4023 4886 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y2R7 protein_id gnl|my_center|LOCUS_02870 4886 5851 gene locus_tag LOCUS_02880 4886 5851 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_02880 5919 7700 gene locus_tag LOCUS_02890 5919 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 8526 7765 gene locus_tag LOCUS_02900 8526 7765 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_02900 8922 8536 gene locus_tag LOCUS_02910 8922 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 9107 9535 gene locus_tag LOCUS_02920 9107 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 10056 9532 gene locus_tag LOCUS_02930 gene haaO 10056 9532 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_02930 14095 10130 gene locus_tag LOCUS_02940 14095 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 >Feature sequence018 1136 189 gene locus_tag LOCUS_02950 gene ribF 1136 189 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_02950 1230 3332 gene locus_tag LOCUS_02960 gene dpp11 1230 3332 CDS product Asp/Glu-specific dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWM2 protein_id gnl|my_center|LOCUS_02960 3971 3594 gene locus_tag LOCUS_02970 3971 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 4184 5329 gene locus_tag LOCUS_02980 4184 5329 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_02980 5493 6584 gene locus_tag LOCUS_02990 5493 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 6688 7962 gene locus_tag LOCUS_03000 6688 7962 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_03000 7952 10408 gene locus_tag LOCUS_03010 gene fecA 7952 10408 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_03010 10638 11324 gene locus_tag LOCUS_03020 gene phoP 10638 11324 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_03020 11492 12676 gene locus_tag LOCUS_03030 11492 12676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence019 1529 441 gene locus_tag LOCUS_03040 1529 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 3930 1645 gene locus_tag LOCUS_03050 gene mur/alr 3930 1645 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_03050 4502 3927 gene locus_tag LOCUS_03060 gene tdk 4502 3927 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YL9 protein_id gnl|my_center|LOCUS_03060 4663 5952 gene locus_tag LOCUS_03070 4663 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 6309 5947 gene locus_tag LOCUS_03080 6309 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 6538 6290 gene locus_tag LOCUS_03090 6538 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 6941 6528 gene locus_tag LOCUS_03100 6941 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791781.1 protein_id gnl|my_center|LOCUS_03100 9586 6950 gene locus_tag LOCUS_03110 gene sprE 9586 6950 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_03110 10357 9647 gene locus_tag LOCUS_03120 10357 9647 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNC3 protein_id gnl|my_center|LOCUS_03120 11008 10403 gene locus_tag LOCUS_03130 gene engB 11008 10403 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_03130 11092 11967 gene locus_tag LOCUS_03140 11092 11967 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_03140 <14679 11982 gene locus_tag LOCUS_03150 <14679 11982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H244:leucine--tRNA ligase >Feature sequence020 928 1938 gene locus_tag LOCUS_03160 928 1938 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_03160 3663 1972 gene locus_tag LOCUS_03170 3663 1972 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868765.1 protein_id gnl|my_center|LOCUS_03170 6495 3664 gene locus_tag LOCUS_03180 6495 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 8739 6514 gene locus_tag LOCUS_03190 8739 6514 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963773.1 protein_id gnl|my_center|LOCUS_03190 9120 10508 gene locus_tag LOCUS_03200 9120 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_03200 10510 10965 gene locus_tag LOCUS_03210 10510 10965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 10966 13800 gene locus_tag LOCUS_03220 gene polA 10966 13800 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_03220 >Feature sequence021 87 932 gene locus_tag LOCUS_03230 gene accD 87 932 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_03230 1038 4520 gene locus_tag LOCUS_03240 1038 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 5541 4633 gene locus_tag LOCUS_03250 5541 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 6391 5576 gene locus_tag LOCUS_03260 6391 5576 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_03260 8273 6375 gene locus_tag LOCUS_03270 gene acsA 8273 6375 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_03270 8458 10803 gene locus_tag LOCUS_03280 8458 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 10857 11822 gene locus_tag LOCUS_03290 10857 11822 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_03290 11800 12342 gene locus_tag LOCUS_03300 gene gmhB 11800 12342 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAI7 protein_id gnl|my_center|LOCUS_03300 12339 13091 gene locus_tag LOCUS_03310 12339 13091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 13112 13792 gene locus_tag LOCUS_03320 13112 13792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 >Feature sequence022 1087 488 gene locus_tag LOCUS_03330 1087 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 1591 1100 gene locus_tag LOCUS_03340 1591 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 2331 1588 gene locus_tag LOCUS_03350 2331 1588 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_03350 3386 2331 gene locus_tag LOCUS_03360 gene rmlB 3386 2331 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_03360 4692 3388 gene locus_tag LOCUS_03370 gene wbpA 4692 3388 CDS product UDP-N-acetyl-d-glucosamine 6-dehydrogenase WbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_03370 5725 4685 gene locus_tag LOCUS_03380 5725 4685 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_03380 6300 5728 gene locus_tag LOCUS_03390 6300 5728 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_03390 7286 6300 gene locus_tag LOCUS_03400 7286 6300 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_03400 8604 7288 gene locus_tag LOCUS_03410 8604 7288 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405413.1 protein_id gnl|my_center|LOCUS_03410 9734 8601 gene locus_tag LOCUS_03420 gene porR 9734 8601 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_03420 9918 10637 gene locus_tag LOCUS_03430 9918 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 10637 11866 gene locus_tag LOCUS_03440 gene kdtA 10637 11866 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_03440 11965 12507 gene locus_tag LOCUS_03450 11965 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 <13914 12526 gene locus_tag LOCUS_03460 <13914 12526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962373.1:amidophosphoribosyltransferase >Feature sequence023 1788 706 gene locus_tag LOCUS_03470 gene prfB 1788 706 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_03470 1889 2266 gene locus_tag LOCUS_03480 gene gcvH 1889 2266 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_03480 2306 2974 gene locus_tag LOCUS_03490 2306 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 3788 2979 gene locus_tag LOCUS_03500 gene nucA 3788 2979 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_03500 5718 3769 gene locus_tag LOCUS_03510 gene gyrB 5718 3769 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX10 protein_id gnl|my_center|LOCUS_03510 6416 5844 gene locus_tag LOCUS_03520 gene bsaA 6416 5844 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH0 protein_id gnl|my_center|LOCUS_03520 6541 7341 gene locus_tag LOCUS_03530 6541 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 9959 7338 gene locus_tag LOCUS_03540 gene valS 9959 7338 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XH6 protein_id gnl|my_center|LOCUS_03540 10614 10003 gene locus_tag LOCUS_03550 10614 10003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 10613 11257 gene locus_tag LOCUS_03560 gene pyrE 10613 11257 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 protein_id gnl|my_center|LOCUS_03560 11261 11659 gene locus_tag LOCUS_03570 11261 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 12403 11654 gene locus_tag LOCUS_03580 gene birA 12403 11654 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_03580 >Feature sequence024 727 83 gene locus_tag LOCUS_03590 gene nth 727 83 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_03590 1555 728 gene locus_tag LOCUS_03600 1555 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 2573 1533 gene locus_tag LOCUS_03610 gene menE 2573 1533 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_03610 3112 2573 gene locus_tag LOCUS_03620 3112 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 4329 3214 gene locus_tag LOCUS_03630 4329 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 6539 4467 gene locus_tag LOCUS_03640 6539 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 7843 6557 gene locus_tag LOCUS_03650 7843 6557 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_03650 8008 9090 gene locus_tag LOCUS_03660 8008 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 9131 9976 gene locus_tag LOCUS_03670 9131 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 11384 10572 gene locus_tag LOCUS_03680 gene murQ 11384 10572 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZA1 protein_id gnl|my_center|LOCUS_03680 11875 11381 gene locus_tag LOCUS_03690 gene pyrR2 11875 11381 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence025 155 2305 gene locus_tag LOCUS_03700 155 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 2623 3048 gene locus_tag LOCUS_03710 2623 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 3056 3382 gene locus_tag LOCUS_03720 3056 3382 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_03720 3924 3388 gene locus_tag LOCUS_03730 3924 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03730 4369 3917 gene locus_tag LOCUS_03740 gene msrB 4369 3917 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1K0 protein_id gnl|my_center|LOCUS_03740 4487 5593 gene locus_tag LOCUS_03750 4487 5593 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190318.1 protein_id gnl|my_center|LOCUS_03750 6282 5590 gene locus_tag LOCUS_03760 6282 5590 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036538.1 protein_id gnl|my_center|LOCUS_03760 6831 6295 gene locus_tag LOCUS_03770 6831 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 6880 7221 gene locus_tag LOCUS_03780 6880 7221 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_03780 8380 7598 gene locus_tag LOCUS_03790 8380 7598 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_03790 9744 8383 gene locus_tag LOCUS_03800 9744 8383 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_03800 9852 12098 gene locus_tag LOCUS_03810 9852 12098 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107598.1 protein_id gnl|my_center|LOCUS_03810 >Feature sequence026 1276 4815 gene locus_tag LOCUS_03820 1276 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 7284 4873 gene locus_tag LOCUS_03830 7284 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 11153 7281 gene locus_tag LOCUS_03840 11153 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 11411 12022 gene locus_tag LOCUS_03850 11411 12022 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_03850 >Feature sequence027 197 586 gene locus_tag LOCUS_03860 197 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 1901 567 gene locus_tag LOCUS_03870 1901 567 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963526.1 protein_id gnl|my_center|LOCUS_03870 2953 1943 gene locus_tag LOCUS_03880 2953 1943 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_03880 4102 3203 gene locus_tag LOCUS_03890 4102 3203 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_03890 4966 4106 gene locus_tag LOCUS_03900 4966 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_03900 5122 5475 gene locus_tag LOCUS_03910 5122 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 5510 6514 gene locus_tag LOCUS_03920 gene gpsA 5510 6514 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_03920 6524 7804 gene locus_tag LOCUS_03930 gene lysC 6524 7804 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_03930 7870 8124 gene locus_tag LOCUS_03940 7870 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 8125 10071 gene locus_tag LOCUS_03950 gene feoB 8125 10071 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_03950 10309 10752 gene locus_tag LOCUS_03960 10309 10752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 10754 11152 gene locus_tag LOCUS_03970 10754 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 >Feature sequence028 444 791 gene locus_tag LOCUS_03980 444 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 791 1723 gene locus_tag LOCUS_03990 gene rnz 791 1723 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_03990 1907 1701 gene locus_tag LOCUS_04000 1907 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 2156 5398 gene locus_tag LOCUS_04010 2156 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 7850 5451 gene locus_tag LOCUS_04020 7850 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 9059 7983 gene locus_tag LOCUS_04030 9059 7983 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_04030 10189 9059 gene locus_tag LOCUS_04040 gene tgt 10189 9059 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_04040 10265 11410 gene locus_tag LOCUS_04050 10265 11410 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_04050 >Feature sequence029 486 830 gene locus_tag LOCUS_04060 486 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 1260 805 gene locus_tag LOCUS_04070 1260 805 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_04070 1398 3275 gene locus_tag LOCUS_04080 1398 3275 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_04080 3272 3676 gene locus_tag LOCUS_04090 3272 3676 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_04090 3733 4641 gene locus_tag LOCUS_04100 3733 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 5420 4638 gene locus_tag LOCUS_04110 5420 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_04110 5512 6480 gene locus_tag LOCUS_04120 gene ltaE 5512 6480 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_04120 6529 8799 gene locus_tag LOCUS_04130 6529 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 9218 8859 gene locus_tag LOCUS_04140 gene rplS 9218 8859 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_04140 9449 10261 gene locus_tag LOCUS_04150 gene parA 9449 10261 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_04150 >Feature sequence030 108 2003 gene locus_tag LOCUS_04160 gene argS 108 2003 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 protein_id gnl|my_center|LOCUS_04160 2000 2476 gene locus_tag LOCUS_04170 2000 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 4257 2473 gene locus_tag LOCUS_04180 4257 2473 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108131.1 protein_id gnl|my_center|LOCUS_04180 6381 4273 gene locus_tag LOCUS_04190 gene dsbD 6381 4273 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_04190 6823 6374 gene locus_tag LOCUS_04200 6823 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 7086 6826 gene locus_tag LOCUS_04210 7086 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 8182 7163 gene locus_tag LOCUS_04220 gene tsaD 8182 7163 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_04220 >Feature sequence031 222 55 gene locus_tag LOCUS_04230 222 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 766 215 gene locus_tag LOCUS_04240 766 215 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_04240 1482 763 gene locus_tag LOCUS_04250 1482 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 2395 1487 gene locus_tag LOCUS_04260 2395 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2494 3900 gene locus_tag LOCUS_04270 2494 3900 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_04270 3967 6267 gene locus_tag LOCUS_04280 3967 6267 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_04280 7982 6237 gene locus_tag LOCUS_04290 7982 6237 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057589.1 protein_id gnl|my_center|LOCUS_04290 9597 7975 gene locus_tag LOCUS_04300 9597 7975 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_04300 10188 9631 gene locus_tag LOCUS_04310 10188 9631 CDS product phospholipid N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962328.1 protein_id gnl|my_center|LOCUS_04310 <10757 10191 gene locus_tag LOCUS_04320 <10757 10191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MCD8:dihydroorotase >Feature sequence032 1131 364 gene locus_tag LOCUS_04330 gene sdhB 1131 364 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_04330 3154 1142 gene locus_tag LOCUS_04340 gene sdhA 3154 1142 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_04340 4044 3166 gene locus_tag LOCUS_04350 4044 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 5022 4123 gene locus_tag LOCUS_04360 5022 4123 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_04360 6234 5305 gene locus_tag LOCUS_04370 6234 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 6758 6231 gene locus_tag LOCUS_04380 6758 6231 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_04380 7607 6801 gene locus_tag LOCUS_04390 7607 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 7716 8921 gene locus_tag LOCUS_04400 7716 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 9695 8946 gene locus_tag LOCUS_04410 9695 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 10152 9697 gene locus_tag LOCUS_04420 10152 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_04420 >Feature sequence033 1067 420 gene locus_tag LOCUS_04430 gene pdxH 1067 420 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6Y3 protein_id gnl|my_center|LOCUS_04430 1605 1060 gene locus_tag LOCUS_04440 1605 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762440.1 protein_id gnl|my_center|LOCUS_04440 2144 1668 gene locus_tag LOCUS_04450 2144 1668 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_04450 2253 2852 gene locus_tag LOCUS_04460 2253 2852 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MN6 protein_id gnl|my_center|LOCUS_04460 2849 3805 gene locus_tag LOCUS_04470 2849 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 3802 4950 gene locus_tag LOCUS_04480 3802 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4971 7451 gene locus_tag LOCUS_04490 gene priA 4971 7451 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NH9 protein_id gnl|my_center|LOCUS_04490 8324 7452 gene locus_tag LOCUS_04500 gene rpoD 8324 7452 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_04500 10114 8435 gene locus_tag LOCUS_04510 10114 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 >Feature sequence034 488 868 gene locus_tag LOCUS_04520 488 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 865 2988 gene locus_tag LOCUS_04530 gene ftsI 865 2988 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_04530 2988 4451 gene locus_tag LOCUS_04540 gene murE 2988 4451 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_04540 4451 5692 gene locus_tag LOCUS_04550 gene mraY 4451 5692 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_04550 5692 7035 gene locus_tag LOCUS_04560 gene murD 5692 7035 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_04560 7037 7498 gene locus_tag LOCUS_04570 7037 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 7495 8670 gene locus_tag LOCUS_04580 7495 8670 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403335.1 protein_id gnl|my_center|LOCUS_04580 8800 9765 gene locus_tag LOCUS_04590 gene murG 8800 9765 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_04590 >Feature sequence035 <1 1547 gene locus_tag LOCUS_04600 <1 1547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A3X7:DNA topoisomerase 1 1584 2027 gene locus_tag LOCUS_04610 1584 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2027 3346 gene locus_tag LOCUS_04620 2027 3346 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_04620 3336 3926 gene locus_tag LOCUS_04630 gene gldD 3336 3926 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_04630 3911 4363 gene locus_tag LOCUS_04640 gene folK 3911 4363 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_04640 4487 6175 gene locus_tag LOCUS_04650 4487 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108507.1 protein_id gnl|my_center|LOCUS_04650 7152 6211 gene locus_tag LOCUS_04660 7152 6211 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_04660 7228 7896 gene locus_tag LOCUS_04670 gene clpP 7228 7896 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_04670 7897 9123 gene locus_tag LOCUS_04680 gene clpX 7897 9123 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A128 protein_id gnl|my_center|LOCUS_04680 9169 10146 gene locus_tag LOCUS_04690 gene pdhB 9169 10146 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_04690 >Feature sequence036 145 1230 gene locus_tag LOCUS_04700 gene vdh 145 1230 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_04700 1236 2186 gene locus_tag LOCUS_04710 gene nusB 1236 2186 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_04710 2183 2590 gene locus_tag LOCUS_04720 2183 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 2609 2887 gene locus_tag LOCUS_04730 2609 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 2931 3851 gene locus_tag LOCUS_04740 gene yrbG 2931 3851 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_04740 5660 3861 gene locus_tag LOCUS_04750 gene edd 5660 3861 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072452.1 protein_id gnl|my_center|LOCUS_04750 6328 5666 gene locus_tag LOCUS_04760 6328 5666 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266837.1 protein_id gnl|my_center|LOCUS_04760 7809 6325 gene locus_tag LOCUS_04770 gene zwf 7809 6325 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGK2 protein_id gnl|my_center|LOCUS_04770 8529 7957 gene locus_tag LOCUS_04780 8529 7957 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405918.1 protein_id gnl|my_center|LOCUS_04780 8777 8556 gene locus_tag LOCUS_04790 8777 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_04790 9410 8862 gene locus_tag LOCUS_04800 9410 8862 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_04800 <10281 9413 gene locus_tag LOCUS_04810 <10281 9413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259114.1:methionine gamma-lyase >Feature sequence037 <1 9725 gene locus_tag LOCUS_04820 <1 9725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence038 2272 1121 gene locus_tag LOCUS_04830 2272 1121 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_04830 2359 2706 gene locus_tag LOCUS_04840 2359 2706 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764143.1 protein_id gnl|my_center|LOCUS_04840 2730 3629 gene locus_tag LOCUS_04850 2730 3629 CDS product transporter RarD family, DMT superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003727.1 protein_id gnl|my_center|LOCUS_04850 3651 4562 gene locus_tag LOCUS_04860 3651 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_04860 4754 5629 gene locus_tag LOCUS_04870 gene era 4754 5629 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A136 protein_id gnl|my_center|LOCUS_04870 5641 6951 gene locus_tag LOCUS_04880 gene der 5641 6951 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_04880 8262 7045 gene locus_tag LOCUS_04890 8262 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 <9848 8487 gene locus_tag LOCUS_04900 <9848 8487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022746.1:cell surface protein >Feature sequence039 3180 2815 gene locus_tag LOCUS_04910 3180 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 5785 3377 gene locus_tag LOCUS_04920 5785 3377 CDS product lysyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404368.1 protein_id gnl|my_center|LOCUS_04920 5892 6578 gene locus_tag LOCUS_04930 5892 6578 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416112.1 protein_id gnl|my_center|LOCUS_04930 6588 8771 gene locus_tag LOCUS_04940 6588 8771 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_04940 8847 9146 gene locus_tag LOCUS_04950 8847 9146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 >Feature sequence040 6054 5479 gene locus_tag LOCUS_04960 gene ruvA 6054 5479 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_04960 8321 6057 gene locus_tag LOCUS_04970 gene maeB 8321 6057 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_04970 9646 8405 gene locus_tag LOCUS_04980 gene sucB 9646 8405 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_04980 >Feature sequence041 3644 1257 gene locus_tag LOCUS_04990 3644 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 4955 3648 gene locus_tag LOCUS_05000 4955 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 7802 5169 gene locus_tag LOCUS_05010 gene cphA 7802 5169 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963250.1 protein_id gnl|my_center|LOCUS_05010 9055 7886 gene locus_tag LOCUS_05020 gene phoR 9055 7886 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_05020 <9729 9229 gene locus_tag LOCUS_05030 <9729 9229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:cell envelope biogenesis protein OmpA >Feature sequence042 1415 675 gene locus_tag LOCUS_05040 gene actE 1415 675 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_05040 1970 1440 gene locus_tag LOCUS_05050 gene actD 1970 1440 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_05050 3370 1982 gene locus_tag LOCUS_05060 gene actC 3370 1982 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_05060 6653 3381 gene locus_tag LOCUS_05070 gene actB 6653 3381 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_05070 7983 6622 gene locus_tag LOCUS_05080 gene actA 7983 6622 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_05080 8192 8584 gene locus_tag LOCUS_05090 8192 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 9657 8581 gene locus_tag LOCUS_05100 gene thiL 9657 8581 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_05100 >Feature sequence043 <1 1808 gene locus_tag LOCUS_05110 <1 1808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64T09:UvrABC system protein B 1808 2101 gene locus_tag LOCUS_05120 gene ydzA 1808 2101 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_05120 2143 3030 gene locus_tag LOCUS_05130 2143 3030 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 protein_id gnl|my_center|LOCUS_05130 3136 3309 gene locus_tag LOCUS_05140 3136 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 6521 3306 gene locus_tag LOCUS_05150 6521 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_05150 <9643 6574 gene locus_tag LOCUS_05160 <9643 6574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962267.1:glycosyl hydrolase >Feature sequence044 241 1512 gene locus_tag LOCUS_05170 241 1512 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203189.1 protein_id gnl|my_center|LOCUS_05170 1516 2481 gene locus_tag LOCUS_05180 gene fmt 1516 2481 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H148 protein_id gnl|my_center|LOCUS_05180 4009 2468 gene locus_tag LOCUS_05190 4009 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 4449 3985 gene locus_tag LOCUS_05200 4449 3985 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_05200 4634 5185 gene locus_tag LOCUS_05210 4634 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 6131 5205 gene locus_tag LOCUS_05220 6131 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223913.1 protein_id gnl|my_center|LOCUS_05220 7497 6142 gene locus_tag LOCUS_05230 7497 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 8588 7509 gene locus_tag LOCUS_05240 8588 7509 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759349.1 protein_id gnl|my_center|LOCUS_05240 <9539 8598 gene locus_tag LOCUS_05250 <9539 8598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140878.1:RND transporter >Feature sequence045 227 901 gene locus_tag LOCUS_05260 227 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 940 2832 gene locus_tag LOCUS_05270 940 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2839 4167 gene locus_tag LOCUS_05280 2839 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 4747 4151 gene locus_tag LOCUS_05290 4747 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 5779 4778 gene locus_tag LOCUS_05300 5779 4778 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_05300 6851 5781 gene locus_tag LOCUS_05310 gene manC 6851 5781 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_05310 7476 6853 gene locus_tag LOCUS_05320 7476 6853 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_05320 7647 8294 gene locus_tag LOCUS_05330 7647 8294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_05330 8294 9061 gene locus_tag LOCUS_05340 8294 9061 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence046 605 1282 gene locus_tag LOCUS_05350 gene trmD 605 1282 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_05350 1356 2549 gene locus_tag LOCUS_05360 gene aspC1 1356 2549 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_05360 2550 3533 gene locus_tag LOCUS_05370 2550 3533 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_05370 3554 4282 gene locus_tag LOCUS_05380 gene menG 3554 4282 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A005 protein_id gnl|my_center|LOCUS_05380 4347 5030 gene locus_tag LOCUS_05390 4347 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 5030 6586 gene locus_tag LOCUS_05400 5030 6586 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_05400 6980 7891 gene locus_tag LOCUS_05410 6980 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 8007 9140 gene locus_tag LOCUS_05420 8007 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence047 <1 1107 gene locus_tag LOCUS_05430 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403246.1:acetyl-CoA carboxylase biotin carboxylase subunit 1172 2383 gene locus_tag LOCUS_05440 gene sucC 1172 2383 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_05440 2467 3372 gene locus_tag LOCUS_05450 gene waaF 2467 3372 CDS product heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926806.1 protein_id gnl|my_center|LOCUS_05450 6602 3381 gene locus_tag LOCUS_05460 6602 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 7979 6726 gene locus_tag LOCUS_05470 7979 6726 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_05470 <9059 7976 gene locus_tag LOCUS_05480 <9059 7976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766931.1:zinc protease >Feature sequence048 1279 422 gene locus_tag LOCUS_05490 gene mauG 1279 422 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_05490 1554 1399 gene locus_tag LOCUS_05500 1554 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 2501 1554 gene locus_tag LOCUS_05510 2501 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 3271 2498 gene locus_tag LOCUS_05520 3271 2498 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_05520 3382 5424 gene locus_tag LOCUS_05530 gene ptrB 3382 5424 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_05530 5387 6379 gene locus_tag LOCUS_05540 5387 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 7619 6381 gene locus_tag LOCUS_05550 7619 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 <8950 7619 gene locus_tag LOCUS_05560 <8950 7619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257240.1:aldehyde dehydrogenase >Feature sequence049 2822 1548 gene locus_tag LOCUS_05570 2822 1548 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402917.1 protein_id gnl|my_center|LOCUS_05570 3991 3230 gene locus_tag LOCUS_05580 3991 3230 CDS product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_05580 5057 4119 gene locus_tag LOCUS_05590 gene mvaK 5057 4119 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_05590 6129 5050 gene locus_tag LOCUS_05600 gene mvaD 6129 5050 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_05600 7118 6207 gene locus_tag LOCUS_05610 7118 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_05610 8464 7115 gene locus_tag LOCUS_05620 gene mvaA 8464 7115 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_05620 >Feature sequence050 636 184 gene locus_tag LOCUS_05630 636 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 1286 639 gene locus_tag LOCUS_05640 gene upp 1286 639 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_05640 1396 2688 gene locus_tag LOCUS_05650 gene yjhB 1396 2688 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_05650 3534 2692 gene locus_tag LOCUS_05660 3534 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 3683 3601 gene locus_tag LOCUS_t00020 3683 3601 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3785 5746 gene locus_tag LOCUS_05670 gene kup 3785 5746 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXA1 protein_id gnl|my_center|LOCUS_05670 5753 6607 gene locus_tag LOCUS_05680 5753 6607 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_05680 6608 7258 gene locus_tag LOCUS_05690 6608 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 7237 7662 gene locus_tag LOCUS_05700 7237 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 7705 8157 gene locus_tag LOCUS_05710 7705 8157 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence051 128 511 gene locus_tag LOCUS_05720 128 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 1804 521 gene locus_tag LOCUS_05730 gene aroA 1804 521 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97KM2 protein_id gnl|my_center|LOCUS_05730 2889 1801 gene locus_tag LOCUS_05740 2889 1801 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_05740 4529 3024 gene locus_tag LOCUS_05750 4529 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 5316 4585 gene locus_tag LOCUS_05760 5316 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_05760 6044 5313 gene locus_tag LOCUS_05770 6044 5313 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_05770 6118 6699 gene locus_tag LOCUS_05780 gene coaE 6118 6699 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X24 protein_id gnl|my_center|LOCUS_05780 7124 6696 gene locus_tag LOCUS_05790 7124 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 8613 7813 gene locus_tag LOCUS_05800 8613 7813 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225973.1 protein_id gnl|my_center|LOCUS_05800 >Feature sequence052 372 2525 gene locus_tag LOCUS_05810 gene pnp 372 2525 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_05810 2637 5651 gene locus_tag LOCUS_05820 2637 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence053 2585 1983 gene locus_tag LOCUS_05830 2585 1983 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 protein_id gnl|my_center|LOCUS_05830 4130 2607 gene locus_tag LOCUS_05840 4130 2607 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 protein_id gnl|my_center|LOCUS_05840 4524 4171 gene locus_tag LOCUS_05850 4524 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 5789 4599 gene locus_tag LOCUS_05860 gene kbl 5789 4599 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_05860 6350 5796 gene locus_tag LOCUS_05870 6350 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 7711 6419 gene locus_tag LOCUS_05880 gene gldN 7711 6419 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_05880 8477 7719 gene locus_tag LOCUS_05890 8477 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence054 <1 2705 gene locus_tag LOCUS_05900 <1 2705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071225.1:acriflavin resistance protein 2695 4032 gene locus_tag LOCUS_05910 2695 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 4940 4017 gene locus_tag LOCUS_05920 4940 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 5676 4924 gene locus_tag LOCUS_05930 5676 4924 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_05930 7151 5751 gene locus_tag LOCUS_05940 7151 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 <8453 7242 gene locus_tag LOCUS_05950 <8453 7242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142204.1:hydroxyglutarate oxidase >Feature sequence055 86 424 gene locus_tag LOCUS_05960 86 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 421 867 gene locus_tag LOCUS_05970 421 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 1747 857 gene locus_tag LOCUS_05980 1747 857 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_05980 1837 3144 gene locus_tag LOCUS_05990 1837 3144 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 protein_id gnl|my_center|LOCUS_05990 3147 4496 gene locus_tag LOCUS_06000 3147 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 4486 5877 gene locus_tag LOCUS_06010 4486 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence056 <1 834 gene locus_tag LOCUS_06020 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963220.1:phosphate starvation protein PhoH 838 1785 gene locus_tag LOCUS_06030 gene purC 838 1785 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_06030 1795 2610 gene locus_tag LOCUS_06040 gene panB 1795 2610 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_06040 2611 3687 gene locus_tag LOCUS_06050 2611 3687 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_06050 3684 4682 gene locus_tag LOCUS_06060 3684 4682 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311292.1 protein_id gnl|my_center|LOCUS_06060 4679 5383 gene locus_tag LOCUS_06070 4679 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 6436 5396 gene locus_tag LOCUS_06080 6436 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 7046 6456 gene locus_tag LOCUS_06090 7046 6456 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795339.1 protein_id gnl|my_center|LOCUS_06090 8093 7050 gene locus_tag LOCUS_06100 8093 7050 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202424.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence057 854 453 gene locus_tag LOCUS_06110 854 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 951 1517 gene locus_tag LOCUS_06120 gene phnA 951 1517 CDS product PhnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 protein_id gnl|my_center|LOCUS_06120 2233 1520 gene locus_tag LOCUS_06130 2233 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 3936 2338 gene locus_tag LOCUS_06140 3936 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 6664 4010 gene locus_tag LOCUS_06150 6664 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 7168 8058 gene locus_tag LOCUS_06160 gene ilvE 7168 8058 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962619.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence058 521 1096 gene locus_tag LOCUS_06170 521 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 1541 1200 gene locus_tag LOCUS_06180 1541 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 2461 1547 gene locus_tag LOCUS_06190 2461 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 2515 3093 gene locus_tag LOCUS_06200 gene ygfA 2515 3093 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_06200 3453 3094 gene locus_tag LOCUS_06210 3453 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3501 4115 gene locus_tag LOCUS_06220 gene rnhB 3501 4115 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_06220 4185 6344 gene locus_tag LOCUS_06230 4185 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence059 1891 656 gene locus_tag LOCUS_06240 1891 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 2025 2870 gene locus_tag LOCUS_06250 2025 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 2867 4939 gene locus_tag LOCUS_06260 2867 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_06260 5044 5610 gene locus_tag LOCUS_06270 5044 5610 CDS product ECF subfamily RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_06270 5616 5789 gene locus_tag LOCUS_06280 5616 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 5970 6803 gene locus_tag LOCUS_06290 5970 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 7008 7907 gene locus_tag LOCUS_06300 gene pyrD 7008 7907 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_06300 >Feature sequence060 985 1275 gene locus_tag LOCUS_06310 985 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 2434 1262 gene locus_tag LOCUS_06320 2434 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 3540 2431 gene locus_tag LOCUS_06330 gene lpxB 3540 2431 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_06330 4603 3830 gene locus_tag LOCUS_06340 gene surE 4603 3830 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_06340 4673 5431 gene locus_tag LOCUS_06350 4673 5431 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_06350 <8076 5433 gene locus_tag LOCUS_06360 <8076 5433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022746.1:cell surface protein >Feature sequence061 1228 56 gene locus_tag LOCUS_06370 1228 56 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_06370 1268 3550 gene locus_tag LOCUS_06380 1268 3550 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768894.1 protein_id gnl|my_center|LOCUS_06380 3591 4628 gene locus_tag LOCUS_06390 3591 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 6442 4625 gene locus_tag LOCUS_06400 6442 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 7217 6534 gene locus_tag LOCUS_06410 7217 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence062 812 57 gene locus_tag LOCUS_06420 812 57 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003604400.1 protein_id gnl|my_center|LOCUS_06420 1414 809 gene locus_tag LOCUS_06430 gene recR 1414 809 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_06430 1495 1953 gene locus_tag LOCUS_06440 gene smpB 1495 1953 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RD6 protein_id gnl|my_center|LOCUS_06440 2602 1964 gene locus_tag LOCUS_06450 2602 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 2784 3512 gene locus_tag LOCUS_06460 2784 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 3518 4045 gene locus_tag LOCUS_06470 gene rimM 3518 4045 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q833P4 protein_id gnl|my_center|LOCUS_06470 5233 4037 gene locus_tag LOCUS_06480 5233 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 5791 5447 gene locus_tag LOCUS_06490 5791 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 5887 6792 gene locus_tag LOCUS_06500 5887 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 7883 6789 gene locus_tag LOCUS_06510 7883 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence063 2873 4126 gene locus_tag LOCUS_06520 gene erg3 2873 4126 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162077.1 protein_id gnl|my_center|LOCUS_06520 4123 4779 gene locus_tag LOCUS_06530 4123 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_06530 5093 6640 gene locus_tag LOCUS_06540 5093 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence064 2956 743 gene locus_tag LOCUS_06550 2956 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 4378 3011 gene locus_tag LOCUS_06560 4378 3011 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114467.1 protein_id gnl|my_center|LOCUS_06560 5186 4371 gene locus_tag LOCUS_06570 5186 4371 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389055.1 protein_id gnl|my_center|LOCUS_06570 5617 5216 gene locus_tag LOCUS_06580 5617 5216 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_06580 5834 7264 gene locus_tag LOCUS_06590 gene dnaA 5834 7264 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_06590 >Feature sequence065 2367 640 gene locus_tag LOCUS_06600 2367 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 3077 2478 gene locus_tag LOCUS_06610 gene sodA 3077 2478 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_06610 3221 5119 gene locus_tag LOCUS_06620 3221 5119 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB57 protein_id gnl|my_center|LOCUS_06620 5721 5128 gene locus_tag LOCUS_06630 5721 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 6430 5768 gene locus_tag LOCUS_06640 6430 5768 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_06640 6558 6881 gene locus_tag LOCUS_06650 gene sufA 6558 6881 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence066 1940 114 gene locus_tag LOCUS_06660 1940 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_06660 2311 3489 gene locus_tag LOCUS_06670 2311 3489 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_06670 3577 4029 gene locus_tag LOCUS_06680 3577 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_06680 4051 5265 gene locus_tag LOCUS_06690 4051 5265 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108036.1 protein_id gnl|my_center|LOCUS_06690 6106 5282 gene locus_tag LOCUS_06700 6106 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 7293 7123 gene locus_tag LOCUS_06710 7293 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 >Feature sequence067 <1 1489 gene locus_tag LOCUS_06720 <1 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWT7:dihydroxy-acid dehydratase 1495 3231 gene locus_tag LOCUS_06730 gene ilvB 1495 3231 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_06730 3239 3763 gene locus_tag LOCUS_06740 gene ilvH 3239 3763 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_06740 3774 5249 gene locus_tag LOCUS_06750 gene ilvC 3774 5249 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ENF6 protein_id gnl|my_center|LOCUS_06750 5242 6489 gene locus_tag LOCUS_06760 gene ilvA 5242 6489 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT3 protein_id gnl|my_center|LOCUS_06760 <7789 6635 gene locus_tag LOCUS_06770 <7789 6635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525183.1:serine hydrolase >Feature sequence068 <1 1111 gene locus_tag LOCUS_06780 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964437.1:FAD-dependent oxidoreductase 1113 1589 gene locus_tag LOCUS_06790 1113 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2340 1579 gene locus_tag LOCUS_06800 2340 1579 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ8 protein_id gnl|my_center|LOCUS_06800 4728 2398 gene locus_tag LOCUS_06810 4728 2398 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_06810 4820 5473 gene locus_tag LOCUS_06820 gene sirR 4820 5473 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_06820 <7762 5543 gene locus_tag LOCUS_06830 <7762 5543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962693.1:protein translocase subunit SecDF >Feature sequence069 <1 720 gene locus_tag LOCUS_06840 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5NIA8:peptide chain release factor 1 717 1529 gene locus_tag LOCUS_06850 gene pyrF 717 1529 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW6 protein_id gnl|my_center|LOCUS_06850 1823 3508 gene locus_tag LOCUS_06860 1823 3508 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963474.1 protein_id gnl|my_center|LOCUS_06860 3528 4712 gene locus_tag LOCUS_06870 3528 4712 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056098.1 protein_id gnl|my_center|LOCUS_06870 4718 5797 gene locus_tag LOCUS_06880 4718 5797 CDS product glycosyl transferase group 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 protein_id gnl|my_center|LOCUS_06880 5797 6381 gene locus_tag LOCUS_06890 5797 6381 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 protein_id gnl|my_center|LOCUS_06890 6397 7254 gene locus_tag LOCUS_06900 gene yjjU 6397 7254 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207601.1 protein_id gnl|my_center|LOCUS_06900 7620 7261 gene locus_tag LOCUS_06910 gene folB 7620 7261 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence070 <1 840 gene locus_tag LOCUS_06920 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073037.1:periplasmic amidohydrolase 843 2111 gene locus_tag LOCUS_06930 843 2111 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 protein_id gnl|my_center|LOCUS_06930 2720 2130 gene locus_tag LOCUS_06940 gene miaE 2720 2130 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_06940 2833 4917 gene locus_tag LOCUS_06950 2833 4917 CDS product tungsten formylmethanofuran dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403352.1 protein_id gnl|my_center|LOCUS_06950 4921 5316 gene locus_tag LOCUS_06960 4921 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_06960 5392 6540 gene locus_tag LOCUS_06970 gene fjo29 5392 6540 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_06970 6659 7612 gene locus_tag LOCUS_06980 6659 7612 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_06980 >Feature sequence071 4306 509 gene locus_tag LOCUS_06990 4306 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 4529 7366 gene locus_tag LOCUS_07000 4529 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence072 590 84 gene locus_tag LOCUS_07010 590 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_07010 689 1450 gene locus_tag LOCUS_07020 689 1450 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202227.1 protein_id gnl|my_center|LOCUS_07020 1970 2521 gene locus_tag LOCUS_07030 1970 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 3453 3755 gene locus_tag LOCUS_07040 3453 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3758 3973 gene locus_tag LOCUS_07050 3758 3973 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_07050 7075 4301 gene locus_tag LOCUS_07060 7075 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 <7582 7072 gene locus_tag LOCUS_07070 <7582 7072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962522.1:multidrug transporter >Feature sequence073 194 706 gene locus_tag LOCUS_07080 194 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 793 1023 gene locus_tag LOCUS_07090 793 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 1438 1351 gene locus_tag LOCUS_t00030 1438 1351 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1593 2015 gene locus_tag LOCUS_07100 1593 2015 CDS product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A4 protein_id gnl|my_center|LOCUS_07100 2019 3002 gene locus_tag LOCUS_07110 2019 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 3014 4690 gene locus_tag LOCUS_07120 gene menD 3014 4690 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_07120 4683 5447 gene locus_tag LOCUS_07130 4683 5447 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404948.1 protein_id gnl|my_center|LOCUS_07130 5428 5973 gene locus_tag LOCUS_07140 5428 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 <7568 5970 gene locus_tag LOCUS_07150 <7568 5970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405046.1:TonB-dependent receptor >Feature sequence074 485 1834 gene locus_tag LOCUS_07160 gene ffh 485 1834 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 protein_id gnl|my_center|LOCUS_07160 1835 2776 gene locus_tag LOCUS_07170 1835 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2912 3484 gene locus_tag LOCUS_07180 2912 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 4501 3485 gene locus_tag LOCUS_07190 4501 3485 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_07190 5850 4672 gene locus_tag LOCUS_07200 5850 4672 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966332.1 protein_id gnl|my_center|LOCUS_07200 7177 5825 gene locus_tag LOCUS_07210 7177 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence075 1961 282 gene locus_tag LOCUS_07220 1961 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2621 1974 gene locus_tag LOCUS_07230 2621 1974 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_07230 2761 3120 gene locus_tag LOCUS_07240 2761 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 6093 3268 gene locus_tag LOCUS_07250 6093 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_07250 <7432 6106 gene locus_tag LOCUS_07260 <7432 6106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0H4:imidazolonepropionase >Feature sequence076 172 1197 gene locus_tag LOCUS_07270 172 1197 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_07270 1194 1916 gene locus_tag LOCUS_07280 1194 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 1916 2701 gene locus_tag LOCUS_07290 1916 2701 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_07290 2698 3720 gene locus_tag LOCUS_07300 gene ansA 2698 3720 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_07300 4574 3717 gene locus_tag LOCUS_07310 gene ftsE 4574 3717 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence077 <1 767 gene locus_tag LOCUS_07320 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109211.1:30S ribosomal protein S1 908 1357 gene locus_tag LOCUS_07330 gene fur 908 1357 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_07330 1354 1689 gene locus_tag LOCUS_07340 1354 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1696 2967 gene locus_tag LOCUS_07350 gene purA 1696 2967 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_07350 2967 4502 gene locus_tag LOCUS_07360 2967 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 protein_id gnl|my_center|LOCUS_07360 6745 4499 gene locus_tag LOCUS_07370 gene relA 6745 4499 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_07370 <7402 6746 gene locus_tag LOCUS_07380 <7402 6746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962840.1:fumarylacetoacetase >Feature sequence078 <1 1056 gene locus_tag LOCUS_07390 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964031.1:anhydro-N-acetylmuramic acid kinase 1136 2365 gene locus_tag LOCUS_07400 1136 2365 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_07400 2370 3722 gene locus_tag LOCUS_07410 2370 3722 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_07410 3751 4419 gene locus_tag LOCUS_07420 3751 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 4431 4841 gene locus_tag LOCUS_07430 4431 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 4848 5498 gene locus_tag LOCUS_07440 4848 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 5485 6702 gene locus_tag LOCUS_07450 gene folC 5485 6702 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_07450 6749 7297 gene locus_tag LOCUS_07460 gene pyrR1 6749 7297 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence079 1213 308 gene locus_tag LOCUS_07470 gene xerC 1213 308 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR6 protein_id gnl|my_center|LOCUS_07470 1217 1627 gene locus_tag LOCUS_07480 gene aroQ 1217 1627 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_07480 1730 2827 gene locus_tag LOCUS_07490 1730 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2856 3680 gene locus_tag LOCUS_07500 2856 3680 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_07500 4535 3687 gene locus_tag LOCUS_07510 4535 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937664.1 protein_id gnl|my_center|LOCUS_07510 4944 4657 gene locus_tag LOCUS_07520 4944 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 5270 6103 gene locus_tag LOCUS_07530 5270 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 >Feature sequence080 <1 517 gene locus_tag LOCUS_07540 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H128:carbamoyl-phosphate synthase (glutamine-hydrolyzing) 564 1535 gene locus_tag LOCUS_07550 564 1535 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_07550 1579 1953 gene locus_tag LOCUS_07560 1579 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 1950 3914 gene locus_tag LOCUS_07570 gene dnaG 1950 3914 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_07570 3914 5014 gene locus_tag LOCUS_07580 3914 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 5724 5011 gene locus_tag LOCUS_07590 gene pdxJ 5724 5011 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0V3 protein_id gnl|my_center|LOCUS_07590 5786 6448 gene locus_tag LOCUS_07600 5786 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 6451 7329 gene locus_tag LOCUS_07610 gene nadK 6451 7329 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence081 <1 532 gene locus_tag LOCUS_07620 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63J95:peptidyl-prolyl cis-trans isomerase 576 1508 gene locus_tag LOCUS_07630 576 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 1510 2286 gene locus_tag LOCUS_07640 1510 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 2297 2623 gene locus_tag LOCUS_07650 2297 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_07650 2624 3820 gene locus_tag LOCUS_07660 gene coaBC 2624 3820 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_07660 3813 4718 gene locus_tag LOCUS_07670 3813 4718 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_07670 4722 6362 gene locus_tag LOCUS_07680 gene recN 4722 6362 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_07680 >Feature sequence082 2688 13 gene locus_tag LOCUS_07690 2688 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2978 4516 gene locus_tag LOCUS_07700 2978 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 4639 6210 gene locus_tag LOCUS_07710 4639 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 6305 7042 gene locus_tag LOCUS_07720 6305 7042 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_07720 >Feature sequence083 175 4065 gene locus_tag LOCUS_07730 175 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 4466 4062 gene locus_tag LOCUS_07740 4466 4062 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_07740 5242 4463 gene locus_tag LOCUS_07750 5242 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 5982 7097 gene locus_tag LOCUS_07760 gene atpB 5982 7097 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence084 <1 2796 gene locus_tag LOCUS_07770 <1 2796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259627.1:hybrid sensor histidine kinase/response regulator 2793 3200 gene locus_tag LOCUS_07780 2793 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 3210 4559 gene locus_tag LOCUS_07790 3210 4559 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_07790 4552 4863 gene locus_tag LOCUS_07800 4552 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_07800 4871 5764 gene locus_tag LOCUS_07810 4871 5764 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_07810 6878 5757 gene locus_tag LOCUS_07820 6878 5757 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392195.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence085 893 180 gene locus_tag LOCUS_07830 893 180 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74SR9 protein_id gnl|my_center|LOCUS_07830 2366 894 gene locus_tag LOCUS_07840 gene proS 2366 894 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ6 protein_id gnl|my_center|LOCUS_07840 4300 2477 gene locus_tag LOCUS_07850 4300 2477 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963039.1 protein_id gnl|my_center|LOCUS_07850 6210 4306 gene locus_tag LOCUS_07860 gene bfmBA 6210 4306 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_07860 6871 6323 gene locus_tag LOCUS_07870 6871 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence086 189 1982 gene locus_tag LOCUS_07880 gene sppA 189 1982 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_07880 4441 1991 gene locus_tag LOCUS_07890 4441 1991 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_07890 4551 5252 gene locus_tag LOCUS_07900 gene cutC 4551 5252 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZG1 protein_id gnl|my_center|LOCUS_07900 6507 5257 gene locus_tag LOCUS_07910 6507 5257 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_07910 6709 6897 gene locus_tag LOCUS_07920 6709 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence087 <1 1379 gene locus_tag LOCUS_07930 <1 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962749.1:ABC transporter 1675 3513 gene locus_tag LOCUS_07940 1675 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 3683 5605 gene locus_tag LOCUS_07950 3683 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 6229 5606 gene locus_tag LOCUS_07960 gene ybbC 6229 5606 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence088 681 4328 gene locus_tag LOCUS_07970 681 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence089 <1 515 gene locus_tag LOCUS_07980 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223463.1:phenylacetate-CoA oxygenase subunit PaaA 517 807 gene locus_tag LOCUS_07990 gene paaB 517 807 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709132.1 protein_id gnl|my_center|LOCUS_07990 811 1569 gene locus_tag LOCUS_08000 811 1569 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969776.1 protein_id gnl|my_center|LOCUS_08000 1563 2048 gene locus_tag LOCUS_08010 gene paaD 1563 2048 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_08010 4389 2032 gene locus_tag LOCUS_08020 4389 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 4566 4829 gene locus_tag LOCUS_08030 4566 4829 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_08030 4830 5195 gene locus_tag LOCUS_08040 4830 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 5857 5192 gene locus_tag LOCUS_08050 5857 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 6080 6511 gene locus_tag LOCUS_08060 6080 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence090 194 1102 gene locus_tag LOCUS_08070 194 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107505.1 protein_id gnl|my_center|LOCUS_08070 1165 1932 gene locus_tag LOCUS_08080 1165 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 1932 2507 gene locus_tag LOCUS_08090 1932 2507 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_08090 3390 2497 gene locus_tag LOCUS_08100 gene hemF 3390 2497 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_08100 5090 3387 gene locus_tag LOCUS_08110 5090 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 6624 5092 gene locus_tag LOCUS_08120 gene guaA 6624 5092 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ7 protein_id gnl|my_center|LOCUS_08120 >Feature sequence091 98 1165 gene locus_tag LOCUS_08130 gene paaE 98 1165 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 protein_id gnl|my_center|LOCUS_08130 1169 2230 gene locus_tag LOCUS_08140 gene paaE 1169 2230 CDS product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_08140 2223 2912 gene locus_tag LOCUS_08150 2223 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 2966 3961 gene locus_tag LOCUS_08160 2966 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 3943 6186 gene locus_tag LOCUS_08170 3943 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 6583 6188 gene locus_tag LOCUS_08180 6583 6188 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence092 1628 2203 gene locus_tag LOCUS_08190 1628 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2392 3423 gene locus_tag LOCUS_08200 gene ribD 2392 3423 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_08200 3420 4286 gene locus_tag LOCUS_08210 3420 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44170 protein_id gnl|my_center|LOCUS_08210 4305 4955 gene locus_tag LOCUS_08220 4305 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_08220 6091 4952 gene locus_tag LOCUS_08230 gene ppiC 6091 4952 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_08230 6762 6109 gene locus_tag LOCUS_08240 6762 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence093 1669 596 gene locus_tag LOCUS_08250 gene smf 1669 596 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_08250 1739 4090 gene locus_tag LOCUS_08260 1739 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 4103 6478 gene locus_tag LOCUS_08270 4103 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence094 49 204 gene locus_tag LOCUS_08280 49 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 259 1209 gene locus_tag LOCUS_08290 gene ftsY 259 1209 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 protein_id gnl|my_center|LOCUS_08290 1610 1206 gene locus_tag LOCUS_08300 1610 1206 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_08300 1720 4059 gene locus_tag LOCUS_08310 1720 4059 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404901.1 protein_id gnl|my_center|LOCUS_08310 4063 5286 gene locus_tag LOCUS_08320 4063 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964016.1 protein_id gnl|my_center|LOCUS_08320 5283 5945 gene locus_tag LOCUS_08330 5283 5945 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_08330 <6732 5942 gene locus_tag LOCUS_08340 <6732 5942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796883.1:peptidase M16 >Feature sequence095 432 1445 gene locus_tag LOCUS_08350 432 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 1471 2829 gene locus_tag LOCUS_08360 gene mgtE 1471 2829 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_08360 2878 2963 gene locus_tag LOCUS_t00040 2878 2963 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3132 3950 gene locus_tag LOCUS_08370 3132 3950 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_08370 3970 4434 gene locus_tag LOCUS_08380 3970 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 4439 5191 gene locus_tag LOCUS_08390 4439 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 5196 5723 gene locus_tag LOCUS_08400 5196 5723 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence096 <1 1934 gene locus_tag LOCUS_08410 <1 1934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962910.1:organic solvent tolerance protein OstA 2881 1958 gene locus_tag LOCUS_08420 2881 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 3914 2973 gene locus_tag LOCUS_08430 3914 2973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_08430 5191 3911 gene locus_tag LOCUS_08440 5191 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 5645 5178 gene locus_tag LOCUS_08450 5645 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence097 422 1306 gene locus_tag LOCUS_08460 gene dapA 422 1306 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TM6 protein_id gnl|my_center|LOCUS_08460 1303 2040 gene locus_tag LOCUS_08470 1303 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 2670 2272 gene locus_tag LOCUS_08480 2670 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3323 2673 gene locus_tag LOCUS_08490 3323 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 3820 3344 gene locus_tag LOCUS_08500 3820 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 5267 4224 gene locus_tag LOCUS_08510 5267 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 5959 5264 gene locus_tag LOCUS_08520 5959 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence098 1310 60 gene locus_tag LOCUS_08530 1310 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 2251 1409 gene locus_tag LOCUS_08540 gene tktA 2251 1409 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_08540 2386 2760 gene locus_tag LOCUS_08550 2386 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 2757 5657 gene locus_tag LOCUS_08560 2757 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence099 227 1045 gene locus_tag LOCUS_08570 227 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 1782 1048 gene locus_tag LOCUS_08580 gene glpF 1782 1048 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189870.1 protein_id gnl|my_center|LOCUS_08580 3308 1779 gene locus_tag LOCUS_08590 gene glpA 3308 1779 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404213.1 protein_id gnl|my_center|LOCUS_08590 4785 3298 gene locus_tag LOCUS_08600 gene glpK2 4785 3298 CDS product glycerol kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1E4 protein_id gnl|my_center|LOCUS_08600 >Feature sequence100 1985 1821 gene locus_tag LOCUS_08610 1985 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2111 3220 gene locus_tag LOCUS_08620 gene recF 2111 3220 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_08620 3232 3543 gene locus_tag LOCUS_08630 3232 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_08630 6416 3540 gene locus_tag LOCUS_08640 6416 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125416.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence101 2098 2718 gene locus_tag LOCUS_08650 2098 2718 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_08650 4065 2722 gene locus_tag LOCUS_08660 gene gltP 4065 2722 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_08660 4195 5838 gene locus_tag LOCUS_08670 4195 5838 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence102 1974 1297 gene locus_tag LOCUS_08680 1974 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2561 1971 gene locus_tag LOCUS_08690 2561 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 2996 2628 gene locus_tag LOCUS_08700 2996 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 4073 3018 gene locus_tag LOCUS_08710 4073 3018 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_08710 5158 4097 gene locus_tag LOCUS_08720 5158 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 6047 5145 gene locus_tag LOCUS_08730 gene ctaB 6047 5145 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_08730 >Feature sequence103 4464 331 gene locus_tag LOCUS_08740 4464 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence104 1126 1737 gene locus_tag LOCUS_08750 gene ychE 1126 1737 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 protein_id gnl|my_center|LOCUS_08750 1862 2335 gene locus_tag LOCUS_08760 1862 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2427 3221 gene locus_tag LOCUS_08770 gene truA 2427 3221 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZY4 protein_id gnl|my_center|LOCUS_08770 3813 3298 gene locus_tag LOCUS_08780 3813 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 4355 6208 gene locus_tag LOCUS_08790 4355 6208 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861071.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence105 624 130 gene locus_tag LOCUS_08800 624 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1773 625 gene locus_tag LOCUS_08810 gene fjo17 1773 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_08810 2925 1807 gene locus_tag LOCUS_08820 2925 1807 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_08820 3041 3655 gene locus_tag LOCUS_08830 3041 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 4323 3652 gene locus_tag LOCUS_08840 gene rsmI 4323 3652 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 protein_id gnl|my_center|LOCUS_08840 5695 4340 gene locus_tag LOCUS_08850 gene radA 5695 4340 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_08850 6248 5712 gene locus_tag LOCUS_08860 6248 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence106 908 84 gene locus_tag LOCUS_08870 908 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1460 918 gene locus_tag LOCUS_08880 1460 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1378 2412 gene locus_tag LOCUS_08890 1378 2412 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_08890 2409 3272 gene locus_tag LOCUS_08900 2409 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_08900 3269 4216 gene locus_tag LOCUS_08910 3269 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 4213 5238 gene locus_tag LOCUS_08920 4213 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 5510 6301 gene locus_tag LOCUS_08930 5510 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence107 1753 629 gene locus_tag LOCUS_08940 1753 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1903 4140 gene locus_tag LOCUS_08950 1903 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403912.1 protein_id gnl|my_center|LOCUS_08950 4747 4142 gene locus_tag LOCUS_08960 4747 4142 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764144.1 protein_id gnl|my_center|LOCUS_08960 5580 4744 gene locus_tag LOCUS_08970 5580 4744 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107740.1 protein_id gnl|my_center|LOCUS_08970 <6309 5602 gene locus_tag LOCUS_08980 <6309 5602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962492.1:cell envelope biogenesis protein OmpA >Feature sequence108 <1 1206 gene locus_tag LOCUS_08990 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0L3:inosine-5'-monophosphate dehydrogenase 1224 3197 gene locus_tag LOCUS_09000 1224 3197 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_09000 3190 4548 gene locus_tag LOCUS_09010 3190 4548 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW8 protein_id gnl|my_center|LOCUS_09010 4553 5506 gene locus_tag LOCUS_09020 4553 5506 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_09020 6285 5512 gene locus_tag LOCUS_09030 6285 5512 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_09030 >Feature sequence109 2190 352 gene locus_tag LOCUS_09040 2190 352 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_09040 5637 2383 gene locus_tag LOCUS_09050 5637 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence110 2292 1873 gene locus_tag LOCUS_09060 2292 1873 CDS product PduO protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727730.1 protein_id gnl|my_center|LOCUS_09060 2384 2806 gene locus_tag LOCUS_09070 2384 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 4129 2861 gene locus_tag LOCUS_09080 gene tilS 4129 2861 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_09080 5312 4113 gene locus_tag LOCUS_09090 gene pabB 5312 4113 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence111 819 1796 gene locus_tag LOCUS_09100 819 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2504 3034 gene locus_tag LOCUS_09110 2504 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3104 4057 gene locus_tag LOCUS_09120 gene accA 3104 4057 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_09120 4077 6173 gene locus_tag LOCUS_09130 gene recG 4077 6173 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence112 >Feature sequence113 <1 821 gene locus_tag LOCUS_09140 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000094315.1:ATPase/protein kinase 2051 822 gene locus_tag LOCUS_09150 2051 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 4377 2044 gene locus_tag LOCUS_09160 4377 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 4536 4886 gene locus_tag LOCUS_09170 4536 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_09170 5119 5928 gene locus_tag LOCUS_09180 5119 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence114 1492 908 gene locus_tag LOCUS_09190 1492 908 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T9 protein_id gnl|my_center|LOCUS_09190 1568 2449 gene locus_tag LOCUS_09200 1568 2449 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107314.1 protein_id gnl|my_center|LOCUS_09200 2449 3813 gene locus_tag LOCUS_09210 gene hisS 2449 3813 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H160 protein_id gnl|my_center|LOCUS_09210 5836 3827 gene locus_tag LOCUS_09220 5836 3827 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122114.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence115 1189 32 gene locus_tag LOCUS_09230 gene hppD 1189 32 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_09230 2369 1212 gene locus_tag LOCUS_09240 gene hmgA 2369 1212 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_09240 2432 3436 gene locus_tag LOCUS_09250 gene ltd 2432 3436 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_09250 3548 4060 gene locus_tag LOCUS_09260 3548 4060 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784022.1 protein_id gnl|my_center|LOCUS_09260 4064 5533 gene locus_tag LOCUS_09270 gene crtI 4064 5533 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence116 63 566 gene locus_tag LOCUS_09280 63 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 573 2243 gene locus_tag LOCUS_09290 573 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2246 3172 gene locus_tag LOCUS_09300 2246 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 3353 4702 gene locus_tag LOCUS_09310 3353 4702 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_09310 <6071 5350 gene locus_tag LOCUS_09320 <6071 5350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879249.1:lysophospholipase >Feature sequence117 526 3219 gene locus_tag LOCUS_09330 526 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 3223 3978 gene locus_tag LOCUS_09340 3223 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_09340 3985 4851 gene locus_tag LOCUS_09350 gene udp 3985 4851 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_09350 5273 4848 gene locus_tag LOCUS_09360 5273 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 <6058 5386 gene locus_tag LOCUS_09370 <6058 5386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A681:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence118 183 620 gene locus_tag LOCUS_09380 183 620 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_09380 613 2199 gene locus_tag LOCUS_09390 613 2199 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764456.1 protein_id gnl|my_center|LOCUS_09390 2780 2181 gene locus_tag LOCUS_09400 2780 2181 CDS product SOUL heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022600.1 protein_id gnl|my_center|LOCUS_09400 3377 2784 gene locus_tag LOCUS_09410 gene msrA 3377 2784 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_09410 4993 4106 gene locus_tag LOCUS_09420 4993 4106 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_09420 <6016 4965 gene locus_tag LOCUS_09430 <6016 4965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963545.1:xenobiotic ABC transporter ATP-binding protein >Feature sequence119 1850 369 gene locus_tag LOCUS_09440 1850 369 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_09440 1980 2801 gene locus_tag LOCUS_09450 gene dapF 1980 2801 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_09450 2779 3285 gene locus_tag LOCUS_09460 2779 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3278 3772 gene locus_tag LOCUS_09470 3278 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 3769 4842 gene locus_tag LOCUS_09480 3769 4842 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_09480 4848 5846 gene locus_tag LOCUS_09490 4848 5846 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265797.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence120 137 1516 gene locus_tag LOCUS_09500 137 1516 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_09500 1513 2289 gene locus_tag LOCUS_09510 gene phnP 1513 2289 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_09510 2358 3179 gene locus_tag LOCUS_09520 2358 3179 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_09520 3179 4090 gene locus_tag LOCUS_09530 3179 4090 CDS product hemolysin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763724.1 protein_id gnl|my_center|LOCUS_09530 4671 4087 gene locus_tag LOCUS_09540 4671 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 5296 4676 gene locus_tag LOCUS_09550 5296 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence121 <1 546 gene locus_tag LOCUS_09560 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010993299.1:nitroreductase 747 1328 gene locus_tag LOCUS_09570 747 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1490 2932 gene locus_tag LOCUS_09580 1490 2932 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_09580 5832 3274 gene locus_tag LOCUS_09590 gene clpA 5832 3274 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence122 2488 1502 gene locus_tag LOCUS_09600 gene fbp 2488 1502 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP35 protein_id gnl|my_center|LOCUS_09600 3364 2543 gene locus_tag LOCUS_09610 3364 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3460 4980 gene locus_tag LOCUS_09620 3460 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence123 535 1581 gene locus_tag LOCUS_09630 535 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1586 2779 gene locus_tag LOCUS_09640 gene pepC 1586 2779 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_09640 2890 3891 gene locus_tag LOCUS_09650 gene gapA1 2890 3891 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963588.1 protein_id gnl|my_center|LOCUS_09650 4041 4376 gene locus_tag LOCUS_09660 4041 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 5614 4421 gene locus_tag LOCUS_09670 gene pgk 5614 4421 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_09670 >Feature sequence124 1503 820 gene locus_tag LOCUS_09680 1503 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1757 1557 gene locus_tag LOCUS_09690 1757 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2033 3904 gene locus_tag LOCUS_09700 2033 3904 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_09700 3949 4266 gene locus_tag LOCUS_09710 3949 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 4267 4941 gene locus_tag LOCUS_09720 4267 4941 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence125 4762 941 gene locus_tag LOCUS_09730 gene porU 4762 941 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence126 1565 813 gene locus_tag LOCUS_09740 1565 813 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_09740 2622 1567 gene locus_tag LOCUS_09750 2622 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 4108 2624 gene locus_tag LOCUS_09760 4108 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 5510 4110 gene locus_tag LOCUS_09770 gene gatA 5510 4110 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R679 protein_id gnl|my_center|LOCUS_09770 5714 5517 gene locus_tag LOCUS_09780 5714 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence127 167 1627 gene locus_tag LOCUS_09790 167 1627 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_09790 1632 2003 gene locus_tag LOCUS_09800 1632 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2819 2010 gene locus_tag LOCUS_09810 2819 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_09810 3698 2919 gene locus_tag LOCUS_09820 3698 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461285.1 protein_id gnl|my_center|LOCUS_09820 4570 3701 gene locus_tag LOCUS_09830 4570 3701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_09830 5308 4646 gene locus_tag LOCUS_09840 5308 4646 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998217.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence128 373 936 gene locus_tag LOCUS_09850 373 936 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786942.1 protein_id gnl|my_center|LOCUS_09850 940 1872 gene locus_tag LOCUS_09860 gene htpX 940 1872 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64V41 protein_id gnl|my_center|LOCUS_09860 1880 2833 gene locus_tag LOCUS_09870 1880 2833 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_09870 3429 2830 gene locus_tag LOCUS_09880 3429 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 4529 3459 gene locus_tag LOCUS_09890 4529 3459 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_09890 >Feature sequence129 181 588 gene locus_tag LOCUS_09900 181 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 650 1138 gene locus_tag LOCUS_09910 650 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1146 1781 gene locus_tag LOCUS_09920 gene bioD 1146 1781 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_09920 1798 3060 gene locus_tag LOCUS_09930 gene bioA 1798 3060 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_09930 3099 3683 gene locus_tag LOCUS_09940 gene tpm 3099 3683 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_09940 4549 3686 gene locus_tag LOCUS_09950 4549 3686 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_09950 4617 5375 gene locus_tag LOCUS_09960 4617 5375 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787639.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence130 2061 2819 gene locus_tag LOCUS_09970 2061 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2886 3677 gene locus_tag LOCUS_09980 2886 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence131 <1 2220 gene locus_tag LOCUS_09990 <1 2220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXM8:DNA gyrase subunit A 2275 3387 gene locus_tag LOCUS_10000 2275 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 3584 5515 gene locus_tag LOCUS_10010 3584 5515 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence132 <1 1641 gene locus_tag LOCUS_10020 <1 1641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962850.1:collagen-binding protein 1682 2590 gene locus_tag LOCUS_10030 1682 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 3087 2587 gene locus_tag LOCUS_10040 3087 2587 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948450.1 protein_id gnl|my_center|LOCUS_10040 3799 3053 gene locus_tag LOCUS_10050 3799 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 4185 3796 gene locus_tag LOCUS_10060 4185 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4760 4170 gene locus_tag LOCUS_10070 4760 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 5315 4794 gene locus_tag LOCUS_10080 5315 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 5399 5475 gene locus_tag LOCUS_t00050 5399 5475 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence133 1515 817 gene locus_tag LOCUS_10090 1515 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 4100 1590 gene locus_tag LOCUS_10100 4100 1590 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence134 3530 630 gene locus_tag LOCUS_10110 gene parC 3530 630 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_10110 5413 3536 gene locus_tag LOCUS_10120 gene parE 5413 3536 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_10120 >Feature sequence135 1544 57 gene locus_tag LOCUS_10130 1544 57 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_10130 1619 4384 gene locus_tag LOCUS_10140 1619 4384 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6Y6 protein_id gnl|my_center|LOCUS_10140 4413 5108 gene locus_tag LOCUS_10150 gene cmk 4413 5108 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A626 protein_id gnl|my_center|LOCUS_10150 >Feature sequence136 <1 1213 gene locus_tag LOCUS_10160 <1 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933414.1:receptor 1210 2181 gene locus_tag LOCUS_10170 1210 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 2178 3449 gene locus_tag LOCUS_10180 2178 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3451 3939 gene locus_tag LOCUS_10190 3451 3939 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202123.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence137 1388 204 gene locus_tag LOCUS_10200 1388 204 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_10200 2257 3150 gene locus_tag LOCUS_10210 2257 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 <5285 3147 gene locus_tag LOCUS_10220 <5285 3147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0Y3:alanine--tRNA ligase >Feature sequence138 496 1173 gene locus_tag LOCUS_10230 496 1173 CDS product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 protein_id gnl|my_center|LOCUS_10230 1239 2261 gene locus_tag LOCUS_10240 gene ruvB 1239 2261 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_10240 2262 3194 gene locus_tag LOCUS_10250 gene queG 2262 3194 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_10250 3271 3480 gene locus_tag LOCUS_10260 3271 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 3483 4853 gene locus_tag LOCUS_10270 gene kmo 3483 4853 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_10270 >Feature sequence139 4204 1424 gene locus_tag LOCUS_10280 4204 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 5031 4570 gene locus_tag LOCUS_10290 5031 4570 CDS product TspO/MBR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence140 1186 470 gene locus_tag LOCUS_10300 1186 470 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_10300 4039 1187 gene locus_tag LOCUS_10310 gene gcvP 4039 1187 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_10310 5080 4115 gene locus_tag LOCUS_10320 5080 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence141 1620 220 gene locus_tag LOCUS_10330 gene glcD 1620 220 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_10330 1707 2915 gene locus_tag LOCUS_10340 gene catF 1707 2915 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206899.1 protein_id gnl|my_center|LOCUS_10340 2915 4531 gene locus_tag LOCUS_10350 2915 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence142 79 270 gene locus_tag LOCUS_10360 gene rpmF 79 270 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_10360 286 1221 gene locus_tag LOCUS_10370 gene plsX 286 1221 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Y4 protein_id gnl|my_center|LOCUS_10370 1222 2208 gene locus_tag LOCUS_10380 gene fabH 1222 2208 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV1 protein_id gnl|my_center|LOCUS_10380 2233 2721 gene locus_tag LOCUS_10390 gene accB 2233 2721 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_10390 2737 4071 gene locus_tag LOCUS_10400 gene accC 2737 4071 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_10400 4152 4691 gene locus_tag LOCUS_10410 4152 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence143 214 3846 gene locus_tag LOCUS_10420 214 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4409 5167 gene locus_tag LOCUS_10430 4409 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence144 1341 226 gene locus_tag LOCUS_10440 1341 226 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_10440 1936 1343 gene locus_tag LOCUS_10450 1936 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 2021 2899 gene locus_tag LOCUS_10460 gene folD 2021 2899 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7B8 protein_id gnl|my_center|LOCUS_10460 2889 3104 gene locus_tag LOCUS_10470 2889 3104 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420479.1 protein_id gnl|my_center|LOCUS_10470 3146 3976 gene locus_tag LOCUS_10480 3146 3976 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 protein_id gnl|my_center|LOCUS_10480 5130 4051 gene locus_tag LOCUS_10490 5130 4051 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence145 7 267 gene locus_tag LOCUS_10500 7 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 271 1647 gene locus_tag LOCUS_10510 271 1647 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_10510 1933 1694 gene locus_tag LOCUS_10520 1933 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2628 1966 gene locus_tag LOCUS_10530 gene psd 2628 1966 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_10530 3473 2640 gene locus_tag LOCUS_10540 3473 2640 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YA2 protein_id gnl|my_center|LOCUS_10540 3663 3451 gene locus_tag LOCUS_10550 3663 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 <5181 3668 gene locus_tag LOCUS_10560 <5181 3668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX85:ATP-dependent zinc metalloprotease FtsH >Feature sequence146 324 1577 gene locus_tag LOCUS_10570 324 1577 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765517.1 protein_id gnl|my_center|LOCUS_10570 1589 3046 gene locus_tag LOCUS_10580 gene xseA 1589 3046 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGR5 protein_id gnl|my_center|LOCUS_10580 3043 3255 gene locus_tag LOCUS_10590 3043 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 3779 3252 gene locus_tag LOCUS_10600 3779 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 4290 4099 gene locus_tag LOCUS_10610 4290 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4542 4961 gene locus_tag LOCUS_10620 4542 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence147 <1 1240 gene locus_tag LOCUS_10630 <1 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZE4:dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex 1327 5067 gene locus_tag LOCUS_10640 1327 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence148 1145 195 gene locus_tag LOCUS_10650 1145 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 2126 1218 gene locus_tag LOCUS_10660 2126 1218 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_10660 2809 2123 gene locus_tag LOCUS_10670 2809 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 protein_id gnl|my_center|LOCUS_10670 5111 2823 gene locus_tag LOCUS_10680 5111 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence149 738 151 gene locus_tag LOCUS_10690 738 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1325 735 gene locus_tag LOCUS_10700 gene def 1325 735 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_10700 1768 1358 gene locus_tag LOCUS_10710 1768 1358 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP6 protein_id gnl|my_center|LOCUS_10710 1868 2482 gene locus_tag LOCUS_10720 1868 2482 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_10720 2479 3804 gene locus_tag LOCUS_10730 2479 3804 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_10730 3818 4879 gene locus_tag LOCUS_10740 3818 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence150 <1 1384 gene locus_tag LOCUS_10750 <1 1384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038579.1:aminopeptidase 3658 1451 gene locus_tag LOCUS_10760 3658 1451 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_10760 4365 3730 gene locus_tag LOCUS_10770 4365 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence151 316 1269 gene locus_tag LOCUS_10780 316 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1295 1597 gene locus_tag LOCUS_10790 1295 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 3067 1613 gene locus_tag LOCUS_10800 3067 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 3160 3234 gene locus_tag LOCUS_t00060 3160 3234 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3818 3351 gene locus_tag LOCUS_10810 3818 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 3858 4847 gene locus_tag LOCUS_10820 3858 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 >Feature sequence152 244 2556 gene locus_tag LOCUS_10830 244 2556 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence153 2418 307 gene locus_tag LOCUS_10840 2418 307 CDS product peptidase S46 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963485.1 protein_id gnl|my_center|LOCUS_10840 2835 3797 gene locus_tag LOCUS_10850 2835 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4783 3902 gene locus_tag LOCUS_10860 4783 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence154 1261 665 gene locus_tag LOCUS_10870 1261 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_10870 2229 1297 gene locus_tag LOCUS_10880 gene etfA 2229 1297 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_10880 2986 2246 gene locus_tag LOCUS_10890 gene etfB 2986 2246 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_10890 3986 3066 gene locus_tag LOCUS_10900 gene menA 3986 3066 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW2 protein_id gnl|my_center|LOCUS_10900 4063 4138 gene locus_tag LOCUS_t00070 4063 4138 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence155 3699 313 gene locus_tag LOCUS_10910 3699 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_10910 4357 3770 gene locus_tag LOCUS_10920 4357 3770 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence156 >Feature sequence157 1116 484 gene locus_tag LOCUS_10930 1116 484 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179676.1 protein_id gnl|my_center|LOCUS_10930 1360 2379 gene locus_tag LOCUS_10940 gene glnII 1360 2379 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_10940 3691 2447 gene locus_tag LOCUS_10950 3691 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3774 4319 gene locus_tag LOCUS_10960 3774 4319 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766193.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence158 423 920 gene locus_tag LOCUS_10970 423 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 930 1220 gene locus_tag LOCUS_10980 gene gatC 930 1220 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67904 protein_id gnl|my_center|LOCUS_10980 1887 1222 gene locus_tag LOCUS_10990 gene trmB 1887 1222 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P45 protein_id gnl|my_center|LOCUS_10990 3371 1896 gene locus_tag LOCUS_11000 3371 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 3440 4015 gene locus_tag LOCUS_11010 3440 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 <4688 4027 gene locus_tag LOCUS_11020 <4688 4027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073592.1:membrane protein >Feature sequence159 >Feature sequence160 1658 363 gene locus_tag LOCUS_11030 1658 363 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_11030 3297 1810 gene locus_tag LOCUS_11040 3297 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3610 4314 gene locus_tag LOCUS_11050 gene truC 3610 4314 CDS product tRNA pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MD4 protein_id gnl|my_center|LOCUS_11050 4636 4418 gene locus_tag LOCUS_11060 4636 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence161 2862 397 gene locus_tag LOCUS_11070 2862 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3107 2874 gene locus_tag LOCUS_11080 3107 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3652 3104 gene locus_tag LOCUS_11090 3652 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence162 403 1377 gene locus_tag LOCUS_11100 403 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1481 1882 gene locus_tag LOCUS_11110 1481 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1988 2536 gene locus_tag LOCUS_11120 1988 2536 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_11120 2536 4239 gene locus_tag LOCUS_11130 2536 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence163 34 1071 gene locus_tag LOCUS_11140 34 1071 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759761.1 protein_id gnl|my_center|LOCUS_11140 1084 2412 gene locus_tag LOCUS_11150 1084 2412 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_11150 2402 2836 gene locus_tag LOCUS_11160 2402 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_11160 2840 3628 gene locus_tag LOCUS_11170 2840 3628 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_11170 3612 4076 gene locus_tag LOCUS_11180 3612 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence164 <1 729 gene locus_tag LOCUS_11190 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9JY72:thymidylate synthase 726 1238 gene locus_tag LOCUS_11200 726 1238 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81E04 protein_id gnl|my_center|LOCUS_11200 1900 1220 gene locus_tag LOCUS_11210 1900 1220 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_11210 2898 1897 gene locus_tag LOCUS_11220 gene holA 2898 1897 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_11220 4138 2891 gene locus_tag LOCUS_11230 gene pepT 4138 2891 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KH9 protein_id gnl|my_center|LOCUS_11230 4488 4171 gene locus_tag LOCUS_11240 4488 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence165 <1 802 gene locus_tag LOCUS_11250 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963272.1:glucose-1-phosphate thymidylyltransferase 928 3339 gene locus_tag LOCUS_11260 gene lon 928 3339 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_11260 <4468 3340 gene locus_tag LOCUS_11270 <4468 3340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257378.1:polyprenyl glycosylphosphotransferase >Feature sequence166 291 43 gene locus_tag LOCUS_11280 291 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 831 421 gene locus_tag LOCUS_11290 831 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1337 825 gene locus_tag LOCUS_11300 1337 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2566 1334 gene locus_tag LOCUS_11310 2566 1334 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_11310 4050 2572 gene locus_tag LOCUS_11320 gene miaB 4050 2572 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZF8 protein_id gnl|my_center|LOCUS_11320 >Feature sequence167 390 836 gene locus_tag LOCUS_11330 390 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1950 940 gene locus_tag LOCUS_11340 1950 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2700 1954 gene locus_tag LOCUS_11350 2700 1954 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667090.1 protein_id gnl|my_center|LOCUS_11350 3143 2793 gene locus_tag LOCUS_11360 3143 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 protein_id gnl|my_center|LOCUS_11360 4061 3153 gene locus_tag LOCUS_11370 4061 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence168 1025 1762 gene locus_tag LOCUS_11380 1025 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902930.1 protein_id gnl|my_center|LOCUS_11380 1805 2692 gene locus_tag LOCUS_11390 gene fabD 1805 2692 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_11390 3430 2681 gene locus_tag LOCUS_11400 gene truA 3430 2681 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_11400 >Feature sequence169 148 549 gene locus_tag LOCUS_11410 148 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1175 1534 gene locus_tag LOCUS_11420 1175 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 3762 1642 gene locus_tag LOCUS_11430 3762 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence170 <1 1083 gene locus_tag LOCUS_11440 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KAW2:uroporphyrinogen decarboxylase 1073 2305 gene locus_tag LOCUS_11450 1073 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2865 2302 gene locus_tag LOCUS_11460 2865 2302 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A749 protein_id gnl|my_center|LOCUS_11460 3776 2868 gene locus_tag LOCUS_11470 3776 2868 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_11470 <4355 3758 gene locus_tag LOCUS_11480 <4355 3758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964499.1:cell envelope biogenesis protein OmpA >Feature sequence171 515 1624 gene locus_tag LOCUS_11490 gene bioB 515 1624 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_11490 1624 2700 gene locus_tag LOCUS_11500 gene bioF 1624 2700 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_11500 4017 2713 gene locus_tag LOCUS_11510 gene nqrF 4017 2713 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_11510 >Feature sequence172 1793 321 gene locus_tag LOCUS_11520 gene hutH1 1793 321 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW5 protein_id gnl|my_center|LOCUS_11520 2782 1808 gene locus_tag LOCUS_11530 gene hemB 2782 1808 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_11530 3530 2784 gene locus_tag LOCUS_11540 3530 2784 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_11540 4285 3602 gene locus_tag LOCUS_11550 4285 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence173 1 1248 gene locus_tag LOCUS_11560 1 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1365 1832 gene locus_tag LOCUS_11570 1365 1832 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_11570 1915 2946 gene locus_tag LOCUS_11580 gene recA 1915 2946 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_11580 3081 3833 gene locus_tag LOCUS_11590 3081 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence174 750 2915 gene locus_tag LOCUS_11600 gene pepX1 750 2915 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence175 2990 4039 gene locus_tag LOCUS_11610 2990 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence176 190 828 gene locus_tag LOCUS_11620 190 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 839 1108 gene locus_tag LOCUS_11630 839 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2080 1133 gene locus_tag LOCUS_11640 gene trxB1 2080 1133 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_11640 3146 2142 gene locus_tag LOCUS_11650 3146 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_11650 4008 3082 gene locus_tag LOCUS_11660 4008 3082 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence177 232 1194 gene locus_tag LOCUS_11670 gene rocF 232 1194 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39138 protein_id gnl|my_center|LOCUS_11670 2601 1228 gene locus_tag LOCUS_11680 2601 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence178 782 1231 gene locus_tag LOCUS_11690 782 1231 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_11690 1786 2205 gene locus_tag LOCUS_11700 1786 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence179 3054 2035 gene locus_tag LOCUS_11710 3054 2035 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence180 1 252 gene locus_tag LOCUS_11720 1 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 990 247 gene locus_tag LOCUS_11730 990 247 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_11730 3134 987 gene locus_tag LOCUS_11740 3134 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 3246 4166 gene locus_tag LOCUS_11750 3246 4166 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence181 583 1107 gene locus_tag LOCUS_11760 583 1107 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107925.1 protein_id gnl|my_center|LOCUS_11760 1178 2155 gene locus_tag LOCUS_11770 1178 2155 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_11770 2156 3343 gene locus_tag LOCUS_11780 2156 3343 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459669.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence182 2817 61 gene locus_tag LOCUS_11790 2817 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3987 2821 gene locus_tag LOCUS_11800 3987 2821 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence183 <1 532 gene locus_tag LOCUS_11810 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005070886.1:OmpA family lipoprotein 852 547 gene locus_tag LOCUS_11820 852 547 CDS product Fe-S assembly SUF system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_11820 1265 852 gene locus_tag LOCUS_11830 gene sufE 1265 852 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_11830 2488 1262 gene locus_tag LOCUS_11840 gene sufS 2488 1262 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_11840 4101 2548 gene locus_tag LOCUS_11850 gene porX 4101 2548 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence184 >Feature sequence185 632 1180 gene locus_tag LOCUS_11860 632 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1240 2655 gene locus_tag LOCUS_11870 1240 2655 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108074.1 protein_id gnl|my_center|LOCUS_11870 2690 3226 gene locus_tag LOCUS_11880 2690 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 3234 3947 gene locus_tag LOCUS_11890 3234 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence186 627 214 gene locus_tag LOCUS_11900 627 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1145 627 gene locus_tag LOCUS_11910 1145 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1723 1151 gene locus_tag LOCUS_11920 1723 1151 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855621.1 protein_id gnl|my_center|LOCUS_11920 2042 3496 gene locus_tag LOCUS_11930 gene cysS 2042 3496 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_11930 4148 3765 gene locus_tag LOCUS_11940 4148 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence187 <1 949 gene locus_tag LOCUS_11950 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0Y2:Fused isobutyryl-CoA mutase 961 1479 gene locus_tag LOCUS_11960 961 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1827 1480 gene locus_tag LOCUS_11970 gene fdx1 1827 1480 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_11970 1866 2960 gene locus_tag LOCUS_11980 1866 2960 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_11980 2994 3794 gene locus_tag LOCUS_11990 gene map 2994 3794 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_11990 >Feature sequence188 464 1228 gene locus_tag LOCUS_12000 464 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1245 2816 gene locus_tag LOCUS_12010 1245 2816 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404630.1 protein_id gnl|my_center|LOCUS_12010 2882 4051 gene locus_tag LOCUS_12020 gene purM 2882 4051 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence189 3101 2853 gene locus_tag LOCUS_12030 3101 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence190 676 2199 gene locus_tag LOCUS_12040 676 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2209 3189 gene locus_tag LOCUS_12050 gene fjo19 2209 3189 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_12050 3282 3713 gene locus_tag LOCUS_12060 3282 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence191 2854 1589 gene locus_tag LOCUS_12070 2854 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_12070 <4041 2856 gene locus_tag LOCUS_12080 <4041 2856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX96:replicative DNA helicase >Feature sequence192 3252 2062 gene locus_tag LOCUS_12090 gene dinB 3252 2062 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P36 protein_id gnl|my_center|LOCUS_12090 3467 3928 gene locus_tag LOCUS_12100 3467 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence193 >Feature sequence194 272 1381 gene locus_tag LOCUS_12110 272 1381 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_12110 1382 2182 gene locus_tag LOCUS_12120 gene lpxH 1382 2182 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_12120 2179 2613 gene locus_tag LOCUS_12130 2179 2613 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_12130 2597 3817 gene locus_tag LOCUS_12140 gene ald 2597 3817 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence195 2012 555 gene locus_tag LOCUS_12150 gene gatB 2012 555 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL60 protein_id gnl|my_center|LOCUS_12150 2827 2015 gene locus_tag LOCUS_12160 2827 2015 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6K0 protein_id gnl|my_center|LOCUS_12160 3698 2811 gene locus_tag LOCUS_12170 gene lpxK 3698 2811 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_12170 >Feature sequence196 311 688 gene locus_tag LOCUS_12180 311 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681408.1 protein_id gnl|my_center|LOCUS_12180 3225 691 gene locus_tag LOCUS_12190 gene ftsK 3225 691 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence197 55 1308 gene locus_tag LOCUS_12200 55 1308 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E7 protein_id gnl|my_center|LOCUS_12200 1324 2028 gene locus_tag LOCUS_12210 1324 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 2086 2319 gene locus_tag LOCUS_12220 2086 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence198 166 1437 gene locus_tag LOCUS_12230 gene glyA 166 1437 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_12230 >Feature sequence199 97 993 gene locus_tag LOCUS_12240 gene yyaK 97 993 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_12240 1035 1955 gene locus_tag LOCUS_12250 gene natA 1035 1955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_12250 2021 3283 gene locus_tag LOCUS_12260 2021 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence200 385 780 gene locus_tag LOCUS_12270 385 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence201 564 1628 gene locus_tag LOCUS_12280 564 1628 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_12280 1703 3058 gene locus_tag LOCUS_12290 1703 3058 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_12290 3597 3055 gene locus_tag LOCUS_12300 3597 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence202 2454 634 gene locus_tag LOCUS_12310 gene mutL 2454 634 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_12310 2765 2454 gene locus_tag LOCUS_12320 2765 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence203 147 590 gene locus_tag LOCUS_12330 147 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1357 596 gene locus_tag LOCUS_12340 1357 596 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_12340 2667 1336 gene locus_tag LOCUS_12350 2667 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence204 642 1088 gene locus_tag LOCUS_12360 642 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1149 2021 gene locus_tag LOCUS_12370 gene sucD 1149 2021 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_12370 >Feature sequence205 >Feature sequence206 180 1814 gene locus_tag LOCUS_12380 gene pafA 180 1814 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_12380 1825 3012 gene locus_tag LOCUS_12390 gene argD 1825 3012 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence207 <1 1003 gene locus_tag LOCUS_12400 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZR5:transcription termination/antitermination protein NusA 1038 3722 gene locus_tag LOCUS_12410 gene infB 1038 3722 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 protein_id gnl|my_center|LOCUS_12410 >Feature sequence208 <1 1791 gene locus_tag LOCUS_12420 <1 1791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW35:transcription-repair-coupling factor 2257 1778 gene locus_tag LOCUS_12430 2257 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3411 2254 gene locus_tag LOCUS_12440 gene dxr 3411 2254 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A684 protein_id gnl|my_center|LOCUS_12440 >Feature sequence209 >Feature sequence210 431 1126 gene locus_tag LOCUS_12450 431 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1351 1118 gene locus_tag LOCUS_12460 1351 1118 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980242.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence211 323 1795 gene locus_tag LOCUS_12470 323 1795 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258272.1 protein_id gnl|my_center|LOCUS_12470 2807 1785 gene locus_tag LOCUS_12480 2807 1785 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203192.1 protein_id gnl|my_center|LOCUS_12480 2943 3401 gene locus_tag LOCUS_12490 2943 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence212 330 1601 gene locus_tag LOCUS_12500 330 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1717 3033 gene locus_tag LOCUS_12510 1717 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3186 3518 gene locus_tag LOCUS_12520 3186 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence213 269 949 gene locus_tag LOCUS_12530 269 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1808 984 gene locus_tag LOCUS_12540 1808 984 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963375.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence214 32 874 gene locus_tag LOCUS_12550 32 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_12550 <3683 915 gene locus_tag LOCUS_12560 <3683 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWI1:DNA-directed DNA polymerase >Feature sequence215 1512 349 gene locus_tag LOCUS_12570 1512 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2282 1509 gene locus_tag LOCUS_12580 gene paaG 2282 1509 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 protein_id gnl|my_center|LOCUS_12580 3338 2331 gene locus_tag LOCUS_12590 3338 2331 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_12590 3466 3338 gene locus_tag LOCUS_12600 3466 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence216 2991 2512 gene locus_tag LOCUS_12610 2991 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3330 3094 gene locus_tag LOCUS_12620 3330 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence217 113 772 gene locus_tag LOCUS_12630 113 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 826 2973 gene locus_tag LOCUS_12640 gene rnr 826 2973 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_12640 2975 3487 gene locus_tag LOCUS_12650 2975 3487 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence218 651 163 gene locus_tag LOCUS_12660 651 163 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962389.1 protein_id gnl|my_center|LOCUS_12660 794 1951 gene locus_tag LOCUS_12670 gene purT 794 1951 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP9 protein_id gnl|my_center|LOCUS_12670 >Feature sequence219 2846 2601 gene locus_tag LOCUS_12680 2846 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 3208 2855 gene locus_tag LOCUS_12690 3208 2855 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence220 1215 133 gene locus_tag LOCUS_12700 1215 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1601 1362 gene locus_tag LOCUS_12710 1601 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence221 1528 332 gene locus_tag LOCUS_12720 1528 332 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_12720 2886 1609 gene locus_tag LOCUS_12730 gene purD 2886 1609 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_12730 <3533 2886 gene locus_tag LOCUS_12740 <3533 2886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NL01:phosphoribosylformylglycinamidine synthase subunit PurQ >Feature sequence222 1582 278 gene locus_tag LOCUS_12750 gene hemL 1582 278 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW4 protein_id gnl|my_center|LOCUS_12750 1625 2038 gene locus_tag LOCUS_12760 1625 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12760 2045 2893 gene locus_tag LOCUS_12770 2045 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12770 3462 2896 gene locus_tag LOCUS_12780 gene purN 3462 2896 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_12780 >Feature sequence223 <1 600 gene locus_tag LOCUS_12790 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067083.1:methionine synthase note possible pseudo, internal stop codon 604 3273 gene locus_tag LOCUS_12800 604 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12800 >Feature sequence224 254 1231 gene locus_tag LOCUS_12810 gene asd 254 1231 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_12810 2762 1266 gene locus_tag LOCUS_12820 2762 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 2942 3484 gene locus_tag LOCUS_12830 2942 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence225 <1 2661 gene locus_tag LOCUS_12840 <1 2661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A334:DNA mismatch repair protein MutS 2663 3127 gene locus_tag LOCUS_12850 2663 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946130.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence226 9 1760 gene locus_tag LOCUS_12860 9 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 3334 1757 gene locus_tag LOCUS_12870 3334 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence227 <1 1134 gene locus_tag LOCUS_12880 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932712.1:DEAD/DEAH box family ATP-dependent RNA helicase 1148 1591 gene locus_tag LOCUS_12890 1148 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1721 2632 gene locus_tag LOCUS_12900 1721 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963614.1 protein_id gnl|my_center|LOCUS_12900 <3471 2637 gene locus_tag LOCUS_12910 <3471 2637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528761.1:NADPH flavoprotein >Feature sequence228 <1 669 gene locus_tag LOCUS_12920 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S289:malate dehydrogenase 2052 715 gene locus_tag LOCUS_12930 2052 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_12930 2272 3435 gene locus_tag LOCUS_12940 2272 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence229 1177 1833 gene locus_tag LOCUS_12950 1177 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 <3450 1989 gene locus_tag LOCUS_12960 <3450 1989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764202.1:sugar hydrolase >Feature sequence230 <1 1139 gene locus_tag LOCUS_12970 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008661626.1:magnesium chelatase 1837 1142 gene locus_tag LOCUS_12980 1837 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2250 1837 gene locus_tag LOCUS_12990 2250 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence231 712 149 gene locus_tag LOCUS_13000 712 149 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867925.1 protein_id gnl|my_center|LOCUS_13000 1329 709 gene locus_tag LOCUS_13010 1329 709 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_13010 2449 1331 gene locus_tag LOCUS_13020 2449 1331 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_13020 3323 2442 gene locus_tag LOCUS_13030 3323 2442 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence232 77 622 gene locus_tag LOCUS_13040 77 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 646 1362 gene locus_tag LOCUS_13050 gene dapB 646 1362 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_13050 1364 3229 gene locus_tag LOCUS_13060 1364 3229 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2I6 protein_id gnl|my_center|LOCUS_13060 >Feature sequence233 >Feature sequence234 573 1154 gene locus_tag LOCUS_13070 573 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_13070 3020 1158 gene locus_tag LOCUS_13080 gene ctaD 3020 1158 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence235 2562 1060 gene locus_tag LOCUS_13090 2562 1060 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207262.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence236 1427 336 gene locus_tag LOCUS_13100 gene pdxA 1427 336 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 protein_id gnl|my_center|LOCUS_13100 2538 1507 gene locus_tag LOCUS_13110 gene mutY 2538 1507 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_13110 2641 2931 gene locus_tag LOCUS_13120 gene hupA 2641 2931 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence237 814 491 gene locus_tag LOCUS_13130 814 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_13130 919 1674 gene locus_tag LOCUS_13140 919 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 2333 1719 gene locus_tag LOCUS_13150 gene nadD 2333 1719 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_13150 2917 2330 gene locus_tag LOCUS_13160 gene gmk 2917 2330 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_13160 >Feature sequence238 2543 447 gene locus_tag LOCUS_13170 2543 447 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG0 protein_id gnl|my_center|LOCUS_13170 >Feature sequence239 618 1367 gene locus_tag LOCUS_13180 gene tpiA 618 1367 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI2 protein_id gnl|my_center|LOCUS_13180 1364 2194 gene locus_tag LOCUS_13190 gene prmA 1364 2194 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence240 480 1019 gene locus_tag LOCUS_13200 480 1019 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_13200 1023 1595 gene locus_tag LOCUS_13210 gene adk 1023 1595 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_13210 1605 2609 gene locus_tag LOCUS_13220 gene obg 1605 2609 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB7 protein_id gnl|my_center|LOCUS_13220 >Feature sequence241 1959 2831 gene locus_tag LOCUS_13230 1959 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence242 184 1011 gene locus_tag LOCUS_13240 184 1011 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_13240 <3133 1020 gene locus_tag LOCUS_13250 <3133 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640121.1:penicillin amidase >Feature sequence243 275 793 gene locus_tag LOCUS_13260 gene idi 275 793 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_13260 793 1197 gene locus_tag LOCUS_13270 gene ygcM 793 1197 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_13270 1217 1828 gene locus_tag LOCUS_13280 1217 1828 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence244 3112 1529 gene locus_tag LOCUS_13290 3112 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence245 842 387 gene locus_tag LOCUS_13300 842 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_13300 2234 843 gene locus_tag LOCUS_13310 2234 843 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence246 504 836 gene locus_tag LOCUS_13320 504 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 867 1568 gene locus_tag LOCUS_13330 867 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1620 2411 gene locus_tag LOCUS_13340 gene proC 1620 2411 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR3 protein_id gnl|my_center|LOCUS_13340 >Feature sequence247 324 941 gene locus_tag LOCUS_13350 324 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 2076 955 gene locus_tag LOCUS_13360 2076 955 CDS product glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919051.1 protein_id gnl|my_center|LOCUS_13360 <3073 2064 gene locus_tag LOCUS_13370 <3073 2064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876004.1:teichoic acid biosynthesis protein >Feature sequence248 17 844 gene locus_tag LOCUS_13380 17 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 939 2912 gene locus_tag LOCUS_13390 939 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence249 805 14 gene locus_tag LOCUS_13400 805 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence250 2340 763 gene locus_tag LOCUS_13410 2340 763 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence251 >Feature sequence252 3 311 gene locus_tag LOCUS_13420 3 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 554 919 gene locus_tag LOCUS_13430 554 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence253 90 431 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcacaagtcttgatgtaagtgctaata 1571 2950 gene locus_tag LOCUS_13440 1571 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence254 1614 223 gene locus_tag LOCUS_13450 gene lpdA2 1614 223 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_13450 >Feature sequence255 204 1244 gene locus_tag LOCUS_13460 gene alkB 204 1244 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191500.1 protein_id gnl|my_center|LOCUS_13460 2915 1305 gene locus_tag LOCUS_13470 2915 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence256 >Feature sequence257 820 1584 gene locus_tag LOCUS_13480 820 1584 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_13480 2353 1574 gene locus_tag LOCUS_13490 2353 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 <2937 2355 gene locus_tag LOCUS_13500 <2937 2355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108700.1:DNA-directed RNA polymerase sigma-70 factor >Feature sequence258 126 1037 gene locus_tag LOCUS_13510 126 1037 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_13510 1040 2485 gene locus_tag LOCUS_13520 1040 2485 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence259 155 1573 gene locus_tag LOCUS_13530 155 1573 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_13530 1566 2465 gene locus_tag LOCUS_13540 gene miaA1 1566 2465 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A018 protein_id gnl|my_center|LOCUS_13540 >Feature sequence260 <1 1008 gene locus_tag LOCUS_13550 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963816.1:proline dehydrogenase 2458 998 gene locus_tag LOCUS_13560 2458 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583645.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence261 <1 666 gene locus_tag LOCUS_13570 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67314:glutamyl-tRNA reductase 653 1549 gene locus_tag LOCUS_13580 gene hemC 653 1549 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKN2 protein_id gnl|my_center|LOCUS_13580 1546 2211 gene locus_tag LOCUS_13590 1546 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence262 944 1873 gene locus_tag LOCUS_13600 gene prsA 944 1873 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_13600 1885 2511 gene locus_tag LOCUS_13610 gene rplY 1885 2511 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YZ1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence263 <1 1185 gene locus_tag LOCUS_13620 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257531.1:aminotransferase class V 1281 2066 gene locus_tag LOCUS_13630 1281 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 2634 2074 gene locus_tag LOCUS_13640 2634 2074 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366001.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence264 2 424 gene locus_tag LOCUS_13650 2 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 2100 421 gene locus_tag LOCUS_13660 2100 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_13660 2785 2132 gene locus_tag LOCUS_13670 2785 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence265 207 698 gene locus_tag LOCUS_13680 207 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 730 1410 gene locus_tag LOCUS_13690 730 1410 CDS product peptidoglycan peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_714690.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence266 >Feature sequence267 298 873 gene locus_tag LOCUS_13700 298 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 965 1807 gene locus_tag LOCUS_13710 gene rlmF 965 1807 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G2 protein_id gnl|my_center|LOCUS_13710 >Feature sequence268 <2616 441 gene locus_tag LOCUS_13720 <2616 441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362020.1:protein of unknown function precursor; adhesin >Feature sequence269 207 1349 gene locus_tag LOCUS_13730 207 1349 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_13730 1352 2515 gene locus_tag LOCUS_13740 1352 2515 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048106.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence270 >Feature sequence271 2086 482 gene locus_tag LOCUS_13750 2086 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 <2603 2089 gene locus_tag LOCUS_13760 <2603 2089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0J8:adenylosuccinate lyase >Feature sequence272 >Feature sequence273 633 1094 gene locus_tag LOCUS_13770 633 1094 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870347.1 protein_id gnl|my_center|LOCUS_13770 1166 1411 gene locus_tag LOCUS_13780 1166 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1404 2003 gene locus_tag LOCUS_13790 gene cysC 1404 2003 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HLD2 protein_id gnl|my_center|LOCUS_13790 >Feature sequence274 1188 724 gene locus_tag LOCUS_13800 1188 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1844 1188 gene locus_tag LOCUS_13810 gene tal 1844 1188 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_13810 2517 1849 gene locus_tag LOCUS_13820 2517 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence275 324 2456 gene locus_tag LOCUS_13830 324 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence276 1806 1138 gene locus_tag LOCUS_13840 1806 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 <2580 1808 gene locus_tag LOCUS_13850 <2580 1808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583420.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence277 729 43 gene locus_tag LOCUS_13860 gene trmH 729 43 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_13860 1165 719 gene locus_tag LOCUS_13870 1165 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2211 1156 gene locus_tag LOCUS_13880 2211 1156 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945949.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence278 511 879 gene locus_tag LOCUS_13890 511 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281604.1 protein_id gnl|my_center|LOCUS_13890 939 1799 gene locus_tag LOCUS_13900 939 1799 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence279 1436 393 gene locus_tag LOCUS_13910 gene yceA 1436 393 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL9 protein_id gnl|my_center|LOCUS_13910 2428 1658 gene locus_tag LOCUS_13920 2428 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence280 1247 450 gene locus_tag LOCUS_13930 1247 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_13930 1573 1244 gene locus_tag LOCUS_13940 gene gldC 1573 1244 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence281 <1 1366 gene locus_tag LOCUS_13950 <1 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64US1:Na(+)-translocating NADH-quinone reductase subunit A >Feature sequence282 266 1342 gene locus_tag LOCUS_13960 266 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence283 1643 306 gene locus_tag LOCUS_13970 1643 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 2355 1633 gene locus_tag LOCUS_13980 gene coaX 2355 1633 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B4 protein_id gnl|my_center|LOCUS_13980 >Feature sequence284 >Feature sequence285 <1 942 gene locus_tag LOCUS_13990 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0G9:tRNA-specific 2-thiouridylase MnmA 1127 939 gene locus_tag LOCUS_14000 1127 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1251 2072 gene locus_tag LOCUS_14010 1251 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2469 2050 gene locus_tag LOCUS_14020 2469 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence286 2313 541 gene locus_tag LOCUS_14030 gene gldG 2313 541 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence287 <2373 1748 gene locus_tag LOCUS_14040 <2373 1748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120931.1:aggregation factor core protein MAFp3, isoform E >Feature sequence288 1218 226 gene locus_tag LOCUS_14050 gene hpnA 1218 226 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence289 2233 1868 gene locus_tag LOCUS_14060 2233 1868 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAA4 protein_id gnl|my_center|LOCUS_14060 >Feature sequence290 574 1257 gene locus_tag LOCUS_14070 574 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705790.1 protein_id gnl|my_center|LOCUS_14070 <2290 1248 gene locus_tag LOCUS_14080 <2290 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962336.1:ATP-dependent helicase >Feature sequence291 >Feature sequence292 852 46 gene locus_tag LOCUS_14090 gene dapD 852 46 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_14090 2187 859 gene locus_tag LOCUS_14100 2187 859 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence293 642 79 gene locus_tag LOCUS_14110 gene frr 642 79 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_14110 1361 654 gene locus_tag LOCUS_14120 gene pyrH 1361 654 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_14120 <2234 1466 gene locus_tag LOCUS_14130 <2234 1466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWU1:elongation factor Ts >Feature sequence294 212 838 gene locus_tag LOCUS_14140 gene perB 212 838 CDS product hexapeptide transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 protein_id gnl|my_center|LOCUS_14140 835 1857 gene locus_tag LOCUS_14150 835 1857 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence295 388 2058 gene locus_tag LOCUS_14160 388 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence296 <1 873 gene locus_tag LOCUS_14170 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962740.1:cytochrome-c peroxidase >Feature sequence297 <1 1892 gene locus_tag LOCUS_14180 <1 1892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence298 <1 1135 gene locus_tag LOCUS_14190 <1 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963517.1:gliding motility lipoprotein GldJ >Feature sequence299 72 1286 gene locus_tag LOCUS_14200 72 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011244.1 protein_id gnl|my_center|LOCUS_14200 1521 2072 gene locus_tag LOCUS_14210 1521 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence300 1392 706 gene locus_tag LOCUS_14220 1392 706 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0S5 protein_id gnl|my_center|LOCUS_14220 1447 2058 gene locus_tag LOCUS_14230 gene glpG 1447 2058 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631577.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence301 1110 565 gene locus_tag LOCUS_14240 1110 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_14240 1198 1971 gene locus_tag LOCUS_14250 gene folP 1198 1971 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_14250 >Feature sequence302 1423 878 gene locus_tag LOCUS_14260 1423 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence303 <2057 1413 gene locus_tag LOCUS_14270 <2057 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64WQ8:1,4-dihydroxy-2-naphthoyl-CoA synthase >Feature sequence304 1321 788 gene locus_tag LOCUS_14280 gene atpH 1321 788 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_14280 1863 1324 gene locus_tag LOCUS_14290 gene atpF 1863 1324 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_14290 >Feature sequence305 1581 841 gene locus_tag LOCUS_14300 1581 841 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_14300 1993 1637 gene locus_tag LOCUS_14310 1993 1637 CDS product camphor resistance protein CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867782.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence306 1810 545 gene locus_tag LOCUS_14320 gene mscS2 1810 545 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence307 >Feature sequence308 914 483 gene locus_tag LOCUS_14330 914 483 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_14330 <1993 917 gene locus_tag LOCUS_14340 <1993 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963271.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence309 836 138 gene locus_tag LOCUS_14350 gene truB 836 138 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_14350 1627 833 gene locus_tag LOCUS_14360 gene uppP 1627 833 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H239 protein_id gnl|my_center|LOCUS_14360 1924 1646 gene locus_tag LOCUS_14370 gene fjo13 1924 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence310 1784 1029 gene locus_tag LOCUS_14380 gene sufC 1784 1029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence311 489 1820 gene locus_tag LOCUS_14390 gene pyrC1 489 1820 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_14390 >Feature sequence312 1795 200 gene locus_tag LOCUS_14400 1795 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence313 <1 1534 gene locus_tag LOCUS_14410 <1 1534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962696.1:ABC transporter >Feature sequence314 >Feature sequence315 450 1220 gene locus_tag LOCUS_14420 450 1220 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_14420 <1938 1232 gene locus_tag LOCUS_14430 <1938 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963481.1:noncanonical pyrimidine nucleotidase, YjjG family protein >Feature sequence316 465 1790 gene locus_tag LOCUS_14440 465 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence317 226 1737 gene locus_tag LOCUS_14450 226 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence318 74 373 gene locus_tag LOCUS_14460 gene rplT 74 373 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_14460 470 1453 gene locus_tag LOCUS_14470 470 1453 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence319 <1 1582 gene locus_tag LOCUS_14480 <1 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963261.1:methylmalonyl-CoA mutase >Feature sequence320 1091 1822 gene locus_tag LOCUS_14490 1091 1822 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761499.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence321 >Feature sequence322 <1 1547 gene locus_tag LOCUS_14500 <1 1547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963094.1:DEAD/DEAH box helicase >Feature sequence323 >Feature sequence324 1274 270 gene locus_tag LOCUS_14510 1274 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1630 1277 gene locus_tag LOCUS_14520 1630 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence325 >Feature sequence326 1755 400 gene locus_tag LOCUS_14530 1755 400 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence327 1134 58 gene locus_tag LOCUS_14540 1134 58 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141502.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence328 <1 739 gene locus_tag LOCUS_14550 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64Q86:ribonuclease Y >Feature sequence329 751 1314 gene locus_tag LOCUS_14560 751 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence330 414 1601 gene locus_tag LOCUS_14570 414 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence331 196 1548 gene locus_tag LOCUS_14580 196 1548 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence332 699 112 gene locus_tag LOCUS_14590 699 112 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705605.1 protein_id gnl|my_center|LOCUS_14590 804 1166 gene locus_tag LOCUS_14600 804 1166 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904590.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence333 >Feature sequence334 <1765 219 gene locus_tag LOCUS_14610 <1765 219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein >Feature sequence335 249 1145 gene locus_tag LOCUS_14620 249 1145 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_14620 1202 1522 gene locus_tag LOCUS_14630 1202 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence336 400 1104 gene locus_tag LOCUS_14640 400 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1642 1109 gene locus_tag LOCUS_14650 gene aroK 1642 1109 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4T0 protein_id gnl|my_center|LOCUS_14650 >Feature sequence337 22 1401 gene locus_tag LOCUS_14660 22 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence338 >Feature sequence339 <1 1044 gene locus_tag LOCUS_14670 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403533.1:N-acyl-L-amino acid amidohydrolase 1143 1463 gene locus_tag LOCUS_14680 1143 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence340 945 208 gene locus_tag LOCUS_14690 945 208 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence341 1070 426 gene locus_tag LOCUS_14700 1070 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 <1731 1081 gene locus_tag LOCUS_14710 <1731 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963928.1:hydroxymethylglutaryl-CoA lyase >Feature sequence342 534 73 gene locus_tag LOCUS_14720 gene mraZ 534 73 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_14720 828 1661 gene locus_tag LOCUS_14730 gene fjo11 828 1661 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence343 <1 1242 gene locus_tag LOCUS_14740 <1 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964032.1:acyl-CoA dehydrogenase 1700 1245 gene locus_tag LOCUS_14750 1700 1245 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence344 312 698 gene locus_tag LOCUS_14760 gene apaG 312 698 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE6 protein_id gnl|my_center|LOCUS_14760 1309 695 gene locus_tag LOCUS_14770 gene rsmG 1309 695 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_14770 >Feature sequence345 >Feature sequence346 382 696 gene locus_tag LOCUS_14780 382 696 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_14780 677 931 gene locus_tag LOCUS_14790 677 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence347 >Feature sequence348 1005 97 gene locus_tag LOCUS_14800 gene glpQ 1005 97 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence349 112 678 gene locus_tag LOCUS_14810 gene efp 112 678 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_14810 >Feature sequence350 <1606 482 gene locus_tag LOCUS_14820 <1606 482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228748.1:neuraminidase >Feature sequence351 <1 1012 gene locus_tag LOCUS_14830 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963836.1:acyl-CoA dehydrogenase >Feature sequence352 321 1208 gene locus_tag LOCUS_14840 321 1208 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence353 <1597 796 gene locus_tag LOCUS_14850 <1597 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860754.1:bacitracin ABC transporter ATP-binding protein >Feature sequence354 <1595 861 gene locus_tag LOCUS_14860 <1595 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023659.1:sugar transferase >Feature sequence355 <1593 315 gene locus_tag LOCUS_14870 <1593 315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759882.1:phosphohydrolase >Feature sequence356 >Feature sequence357 114 875 gene locus_tag LOCUS_14880 gene exoA 114 875 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438367.1 protein_id gnl|my_center|LOCUS_14880 1410 862 gene locus_tag LOCUS_14890 1410 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14890 >Feature sequence358 >Feature sequence359 578 87 gene locus_tag LOCUS_14900 578 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1507 578 gene locus_tag LOCUS_14910 1507 578 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence360 764 87 gene locus_tag LOCUS_14920 gene nqrD 764 87 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 protein_id gnl|my_center|LOCUS_14920 1509 766 gene locus_tag LOCUS_14930 gene nqrC 1509 766 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_14930 >Feature sequence361 >Feature sequence362 236 1345 gene locus_tag LOCUS_14940 236 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence363 293 1171 gene locus_tag LOCUS_14950 gene xerC 293 1171 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 protein_id gnl|my_center|LOCUS_14950 1175 1462 gene locus_tag LOCUS_14960 1175 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence364 <1 860 gene locus_tag LOCUS_14970 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MH1:ribosome-binding ATPase YchF >Feature sequence365 3 668 gene locus_tag LOCUS_14980 3 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence366 >Feature sequence367 >Feature sequence368 >Feature sequence369 1307 555 gene locus_tag LOCUS_14990 1307 555 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259682.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence370 <1 729 gene locus_tag LOCUS_15000 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963338.1:1-aminocyclopropane-1-carboxylate deaminase >Feature sequence371 880 329 gene locus_tag LOCUS_15010 880 329 CDS product DUF4924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_15010 1479 883 gene locus_tag LOCUS_15020 1479 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence372 1496 897 gene locus_tag LOCUS_15030 1496 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence373 >Feature sequence374 <1 578 gene locus_tag LOCUS_15040 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962644.1:peptidase M28 <1480 575 gene locus_tag LOCUS_15050 <1480 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814652.1:DNA polymerase III subunit alpha >Feature sequence375 481 185 gene locus_tag LOCUS_15060 gene fjo15 481 185 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_15060 1350 481 gene locus_tag LOCUS_15070 gene fjo14 1350 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence376 173 3 gene locus_tag LOCUS_15080 173 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1461 334 gene locus_tag LOCUS_15090 1461 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence377 >Feature sequence378 813 577 gene locus_tag LOCUS_15100 813 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 890 1372 gene locus_tag LOCUS_15110 890 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence379 <1 1062 gene locus_tag LOCUS_15120 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXP5:chorismate synthase >Feature sequence380 <1 1248 gene locus_tag LOCUS_15130 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVQ2:methionine--tRNA ligase 1331 1406 gene locus_tag LOCUS_t00080 1331 1406 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence381 >Feature sequence382 >Feature sequence383 >Feature sequence384 <1 755 gene locus_tag LOCUS_15140 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGU5:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence385 1198 83 gene locus_tag LOCUS_15150 1198 83 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence386 >Feature sequence387 >Feature sequence388 1035 496 gene locus_tag LOCUS_15160 1035 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence389 1236 43 gene locus_tag LOCUS_15170 1236 43 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759762.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence390 930 289 gene locus_tag LOCUS_15180 930 289 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence391 <1257 649 gene locus_tag LOCUS_15190 <1257 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZF6:ribosomal protein S12 methylthiotransferase RimO >Feature sequence392 41 643 gene locus_tag LOCUS_15200 41 643 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence393 54 1118 gene locus_tag LOCUS_15210 gene serC 54 1118 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 protein_id gnl|my_center|LOCUS_15210 >Feature sequence394 <1246 608 gene locus_tag LOCUS_15220 <1246 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H194:UDP-N-acetylmuramate--L-alanine ligase >Feature sequence395 <1238 523 gene locus_tag LOCUS_15230 <1238 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWA9:S-adenosylmethionine synthase >Feature sequence396 <1 903 gene locus_tag LOCUS_15240 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962800.1:3-phosphoglycerate dehydrogenase 1042 1176 gene locus_tag LOCUS_15250 1042 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence397 1120 587 gene locus_tag LOCUS_15260 1120 587 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence398 1187 69 gene locus_tag LOCUS_15270 1187 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence399 343 1140 gene locus_tag LOCUS_15280 343 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence400 928 92 gene locus_tag LOCUS_15290 928 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence401 >Feature sequence402 >Feature sequence403 >Feature sequence404 >Feature sequence405 <1174 155 gene locus_tag LOCUS_15300 <1174 155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942612.1:nucleotidyltransferase >Feature sequence406 >Feature sequence407 1107 94 gene locus_tag LOCUS_15310 1107 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence408 >Feature sequence409 587 51 gene locus_tag LOCUS_15320 587 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 <1128 592 gene locus_tag LOCUS_15330 <1128 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962436.1:deoxynucleoside kinase >Feature sequence410 <1127 508 gene locus_tag LOCUS_15340 <1127 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120931.1:aggregation factor core protein MAFp3, isoform E >Feature sequence411 >Feature sequence412 >Feature sequence413 >Feature sequence414 >Feature sequence415 226 552 gene locus_tag LOCUS_15350 226 552 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence416 >Feature sequence417 >Feature sequence418 >Feature sequence419 50 874 gene locus_tag LOCUS_15360 gene rplB 50 874 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence420 794 81 gene locus_tag LOCUS_15370 794 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence421 20 1012 gene locus_tag LOCUS_15380 gene rpoA 20 1012 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_15380 >Feature sequence422 >Feature sequence423 >Feature sequence424 4 873 gene locus_tag LOCUS_15390 4 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence425 <1027 1 gene locus_tag LOCUS_15400 <1027 1 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962291.1:membrane protein >Feature sequence426 >Feature sequence427 519 974 gene locus_tag LOCUS_15410 gene ppi 519 974 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P985 protein_id gnl|my_center|LOCUS_15410 >Feature sequence428