>Feature sequence01 28 480 gene locus_tag LOCUS_00010 28 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 471 2630 gene locus_tag LOCUS_00020 471 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3050 2868 gene locus_tag LOCUS_00030 3050 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3029 3418 gene locus_tag LOCUS_00040 3029 3418 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_00040 3469 4137 gene locus_tag LOCUS_00050 3469 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4589 4990 gene locus_tag LOCUS_00060 4589 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6202 4994 gene locus_tag LOCUS_00070 6202 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6800 7288 gene locus_tag LOCUS_00080 6800 7288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7396 8061 gene locus_tag LOCUS_00090 7396 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8206 8700 gene locus_tag LOCUS_00100 8206 8700 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_00100 9447 8965 gene locus_tag LOCUS_00110 9447 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9760 9488 gene locus_tag LOCUS_00120 9760 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10362 10126 gene locus_tag LOCUS_00130 10362 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 10783 10409 gene locus_tag LOCUS_00140 10783 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 11893 10961 gene locus_tag LOCUS_00150 11893 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 12941 11874 gene locus_tag LOCUS_00160 12941 11874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 14095 13043 gene locus_tag LOCUS_00170 14095 13043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 15254 14085 gene locus_tag LOCUS_00180 15254 14085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 15385 16542 gene locus_tag LOCUS_00190 15385 16542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 16545 17129 gene locus_tag LOCUS_00200 16545 17129 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108700.1 protein_id gnl|my_center|LOCUS_00200 17132 17683 gene locus_tag LOCUS_00210 17132 17683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 18144 17680 gene locus_tag LOCUS_00220 18144 17680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 19193 18156 gene locus_tag LOCUS_00230 gene ansA 19193 18156 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_00230 19953 19186 gene locus_tag LOCUS_00240 19953 19186 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_00240 21304 20090 gene locus_tag LOCUS_00250 gene sucB 21304 20090 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_00250 24097 21317 gene locus_tag LOCUS_00260 gene sucA 24097 21317 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_00260 24302 24940 gene locus_tag LOCUS_00270 24302 24940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 25262 24942 gene locus_tag LOCUS_00280 25262 24942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 26211 25255 gene locus_tag LOCUS_00290 26211 25255 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_00290 27083 26220 gene locus_tag LOCUS_00300 gene rfbA 27083 26220 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMQ5 protein_id gnl|my_center|LOCUS_00300 29400 27115 gene locus_tag LOCUS_00310 29400 27115 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_00310 32040 29563 gene locus_tag LOCUS_00320 32040 29563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33061 32057 gene locus_tag LOCUS_00330 33061 32057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 34300 33155 gene locus_tag LOCUS_00340 gene hppD 34300 33155 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_00340 34554 35081 gene locus_tag LOCUS_00350 34554 35081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 35191 35589 gene locus_tag LOCUS_00360 35191 35589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 35582 36415 gene locus_tag LOCUS_00370 35582 36415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 36426 37217 gene locus_tag LOCUS_00380 36426 37217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38376 37219 gene locus_tag LOCUS_00390 gene hmgA 38376 37219 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_00390 39472 38423 gene locus_tag LOCUS_00400 39472 38423 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CXS1 protein_id gnl|my_center|LOCUS_00400 39668 40606 gene locus_tag LOCUS_00410 gene ltd 39668 40606 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_00410 41101 40607 gene locus_tag LOCUS_00420 41101 40607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 41778 41215 gene locus_tag LOCUS_00430 41778 41215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 42904 41825 gene locus_tag LOCUS_00440 42904 41825 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_00440 43222 46017 gene locus_tag LOCUS_00450 gene polA 43222 46017 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_00450 48197 46089 gene locus_tag LOCUS_00460 48197 46089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 48518 48973 gene locus_tag LOCUS_00470 gene rplM 48518 48973 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 protein_id gnl|my_center|LOCUS_00470 48975 49361 gene locus_tag LOCUS_00480 gene rpsI 48975 49361 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU3 protein_id gnl|my_center|LOCUS_00480 49457 50365 gene locus_tag LOCUS_00490 gene rpsB 49457 50365 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_00490 50464 51288 gene locus_tag LOCUS_00500 gene tsf 50464 51288 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_00500 53699 51372 gene locus_tag LOCUS_00510 53699 51372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729998.1 protein_id gnl|my_center|LOCUS_00510 54510 53677 gene locus_tag LOCUS_00520 gene fdhD 54510 53677 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNU3 protein_id gnl|my_center|LOCUS_00520 55309 54605 gene locus_tag LOCUS_00530 55309 54605 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_00530 56778 55315 gene locus_tag LOCUS_00540 56778 55315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 56999 57796 gene locus_tag LOCUS_00550 56999 57796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 57832 58617 gene locus_tag LOCUS_00560 57832 58617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 58930 58622 gene locus_tag LOCUS_00570 58930 58622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 60292 59186 gene locus_tag LOCUS_00580 60292 59186 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_00580 60841 60323 gene locus_tag LOCUS_00590 60841 60323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 61049 60831 gene locus_tag LOCUS_00600 61049 60831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 62025 62228 gene locus_tag LOCUS_00610 62025 62228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 62518 63864 gene locus_tag LOCUS_00620 gene hemN 62518 63864 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_00620 64535 63897 gene locus_tag LOCUS_00630 64535 63897 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_00630 65029 64589 gene locus_tag LOCUS_00640 gene ccoH 65029 64589 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_00640 66435 65026 gene locus_tag LOCUS_00650 gene ccoG 66435 65026 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_00650 67352 66441 gene locus_tag LOCUS_00660 gene ccoP 67352 66441 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_00660 69696 67540 gene locus_tag LOCUS_00670 gene ccoN/ccoO 69696 67540 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_00670 71721 69946 gene locus_tag LOCUS_00680 71721 69946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 72399 73112 gene locus_tag LOCUS_00690 72399 73112 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_00690 73188 73628 gene locus_tag LOCUS_00700 73188 73628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 73667 74848 gene locus_tag LOCUS_00710 73667 74848 CDS product geranylgeranyl hydrogenase BchP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_00710 74954 75829 gene locus_tag LOCUS_00720 74954 75829 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_00720 75841 76323 gene locus_tag LOCUS_00730 75841 76323 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_00730 76320 76937 gene locus_tag LOCUS_00740 76320 76937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 77187 78398 gene locus_tag LOCUS_00750 77187 78398 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_00750 78472 78831 gene locus_tag LOCUS_00760 gene rbfA 78472 78831 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 protein_id gnl|my_center|LOCUS_00760 78828 80042 gene locus_tag LOCUS_00770 78828 80042 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_00770 80125 82020 gene locus_tag LOCUS_00780 80125 82020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 83006 82017 gene locus_tag LOCUS_00790 83006 82017 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_00790 83072 83992 gene locus_tag LOCUS_00800 83072 83992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 84547 83984 gene locus_tag LOCUS_00810 84547 83984 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_00810 85190 84714 gene locus_tag LOCUS_00820 85190 84714 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_00820 85772 85194 gene locus_tag LOCUS_00830 85772 85194 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_00830 86227 85775 gene locus_tag LOCUS_00840 86227 85775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 87096 86230 gene locus_tag LOCUS_00850 87096 86230 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_00850 87333 87420 gene locus_tag LOCUS_t00010 87333 87420 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 87495 89009 gene locus_tag LOCUS_00860 87495 89009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 89983 89021 gene locus_tag LOCUS_00870 89983 89021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 90469 91176 gene locus_tag LOCUS_00880 gene pyrH 90469 91176 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_00880 91194 91748 gene locus_tag LOCUS_00890 gene frr 91194 91748 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_00890 92428 91745 gene locus_tag LOCUS_00900 gene rsmI 92428 91745 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 protein_id gnl|my_center|LOCUS_00900 92766 92428 gene locus_tag LOCUS_00910 gene ogt2 92766 92428 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_00910 93436 92759 gene locus_tag LOCUS_00920 gene trmB 93436 92759 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_00920 93494 94585 gene locus_tag LOCUS_00930 93494 94585 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_00930 95590 94544 gene locus_tag LOCUS_00940 gene phoR 95590 94544 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_00940 96301 95612 gene locus_tag LOCUS_00950 gene phoP 96301 95612 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_00950 96673 97932 gene locus_tag LOCUS_00960 96673 97932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 98053 100854 gene locus_tag LOCUS_00970 98053 100854 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_00970 101086 105912 gene locus_tag LOCUS_00980 101086 105912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 107341 106148 gene locus_tag LOCUS_00990 107341 106148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 107577 109763 gene locus_tag LOCUS_01000 107577 109763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 109785 110918 gene locus_tag LOCUS_01010 109785 110918 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140568.1 protein_id gnl|my_center|LOCUS_01010 111474 110968 gene locus_tag LOCUS_01020 111474 110968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 111500 112513 gene locus_tag LOCUS_01030 111500 112513 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_01030 112567 113328 gene locus_tag LOCUS_01040 112567 113328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 118391 113376 gene locus_tag LOCUS_01050 118391 113376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 119408 118527 gene locus_tag LOCUS_01060 119408 118527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 121447 119489 gene locus_tag LOCUS_01070 121447 119489 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962869.1 protein_id gnl|my_center|LOCUS_01070 122194 121556 gene locus_tag LOCUS_01080 122194 121556 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881043.1 protein_id gnl|my_center|LOCUS_01080 124063 122330 gene locus_tag LOCUS_01090 124063 122330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 125534 124257 gene locus_tag LOCUS_01100 gene tyrS 125534 124257 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2S5 protein_id gnl|my_center|LOCUS_01100 127348 125786 gene locus_tag LOCUS_01110 127348 125786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 127673 127350 gene locus_tag LOCUS_01120 127673 127350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 127777 128790 gene locus_tag LOCUS_01130 127777 128790 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_01130 129275 128766 gene locus_tag LOCUS_01140 129275 128766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 130605 129265 gene locus_tag LOCUS_01150 gene pyrC1 130605 129265 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_01150 131349 130621 gene locus_tag LOCUS_01160 131349 130621 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_01160 131499 132662 gene locus_tag LOCUS_01170 gene porY 131499 132662 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_01170 132755 133786 gene locus_tag LOCUS_01180 132755 133786 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_01180 133790 134536 gene locus_tag LOCUS_01190 133790 134536 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_01190 134599 135681 gene locus_tag LOCUS_01200 134599 135681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 135701 136081 gene locus_tag LOCUS_01210 135701 136081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 136163 137452 gene locus_tag LOCUS_01220 136163 137452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075798.1 protein_id gnl|my_center|LOCUS_01220 137453 138133 gene locus_tag LOCUS_01230 137453 138133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391399.1 protein_id gnl|my_center|LOCUS_01230 138146 138592 gene locus_tag LOCUS_01240 138146 138592 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406227.1 protein_id gnl|my_center|LOCUS_01240 138729 139859 gene locus_tag LOCUS_01250 gene mrp 138729 139859 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 protein_id gnl|my_center|LOCUS_01250 139870 140130 gene locus_tag LOCUS_01260 139870 140130 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_01260 140133 141968 gene locus_tag LOCUS_01270 140133 141968 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403201.1 protein_id gnl|my_center|LOCUS_01270 141961 142980 gene locus_tag LOCUS_01280 141961 142980 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931856.1 protein_id gnl|my_center|LOCUS_01280 144347 143001 gene locus_tag LOCUS_01290 144347 143001 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_01290 145698 144337 gene locus_tag LOCUS_01300 145698 144337 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_01300 145868 146116 gene locus_tag LOCUS_01310 145868 146116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 146479 147162 gene locus_tag LOCUS_01320 146479 147162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762308.1 protein_id gnl|my_center|LOCUS_01320 147155 149563 gene locus_tag LOCUS_01330 147155 149563 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_01330 149668 151521 gene locus_tag LOCUS_01340 149668 151521 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_01340 151555 153600 gene locus_tag LOCUS_01350 151555 153600 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_01350 153613 153909 gene locus_tag LOCUS_01360 153613 153909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 154018 154419 gene locus_tag LOCUS_01370 154018 154419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 155037 154423 gene locus_tag LOCUS_01380 155037 154423 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_01380 158181 155125 gene locus_tag LOCUS_01390 158181 155125 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_01390 158523 158595 gene locus_tag LOCUS_t00020 158523 158595 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 159164 160228 gene locus_tag LOCUS_01400 159164 160228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 160694 161665 gene locus_tag LOCUS_01410 160694 161665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 161990 161679 gene locus_tag LOCUS_01420 161990 161679 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963921.1 protein_id gnl|my_center|LOCUS_01420 162251 161994 gene locus_tag LOCUS_01430 162251 161994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01430 162582 162803 gene locus_tag LOCUS_01440 162582 162803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 163863 162826 gene locus_tag LOCUS_01450 gene acr3 163863 162826 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 protein_id gnl|my_center|LOCUS_01450 164482 163853 gene locus_tag LOCUS_01460 gene arsC 164482 163853 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_01460 164970 164503 gene locus_tag LOCUS_01470 164970 164503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_01470 165333 165004 gene locus_tag LOCUS_01480 165333 165004 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_01480 165919 165494 gene locus_tag LOCUS_01490 gene mscL 165919 165494 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2H6 protein_id gnl|my_center|LOCUS_01490 166324 169332 gene locus_tag LOCUS_01500 166324 169332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 169456 172599 gene locus_tag LOCUS_01510 169456 172599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 172609 172827 gene locus_tag LOCUS_01520 172609 172827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 172976 176080 gene locus_tag LOCUS_01530 172976 176080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 176483 179404 gene locus_tag LOCUS_01540 176483 179404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 179414 179626 gene locus_tag LOCUS_01550 179414 179626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 180420 179755 gene locus_tag LOCUS_01560 180420 179755 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212073.1 protein_id gnl|my_center|LOCUS_01560 181732 180770 gene locus_tag LOCUS_01570 181732 180770 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253581.1 protein_id gnl|my_center|LOCUS_01570 181896 182813 gene locus_tag LOCUS_01580 181896 182813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963614.1 protein_id gnl|my_center|LOCUS_01580 182831 184078 gene locus_tag LOCUS_01590 182831 184078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 184144 186420 gene locus_tag LOCUS_01600 184144 186420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 186424 187446 gene locus_tag LOCUS_01610 186424 187446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 189655 187463 gene locus_tag LOCUS_01620 189655 187463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 190143 189667 gene locus_tag LOCUS_01630 190143 189667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 191617 190145 gene locus_tag LOCUS_01640 191617 190145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 191983 194280 gene locus_tag LOCUS_01650 191983 194280 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765025.1 protein_id gnl|my_center|LOCUS_01650 195266 194448 gene locus_tag LOCUS_01660 195266 194448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 196886 195285 gene locus_tag LOCUS_01670 196886 195285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 197098 199884 gene locus_tag LOCUS_01680 gene leuS 197098 199884 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H244 protein_id gnl|my_center|LOCUS_01680 199986 200243 gene locus_tag LOCUS_01690 199986 200243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 200291 201106 gene locus_tag LOCUS_01700 200291 201106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_01700 201192 202166 gene locus_tag LOCUS_01710 201192 202166 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_01710 202235 203551 gene locus_tag LOCUS_01720 202235 203551 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_01720 205265 203541 gene locus_tag LOCUS_01730 gene recJ 205265 203541 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_01730 206365 205271 gene locus_tag LOCUS_01740 206365 205271 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_01740 208641 206365 gene locus_tag LOCUS_01750 gene maeB 208641 206365 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_01750 209894 208695 gene locus_tag LOCUS_01760 gene hflX 209894 208695 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 protein_id gnl|my_center|LOCUS_01760 210335 209898 gene locus_tag LOCUS_01770 210335 209898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_01770 212295 211408 gene locus_tag LOCUS_01780 212295 211408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784668.1 protein_id gnl|my_center|LOCUS_01780 214000 212342 gene locus_tag LOCUS_01790 gene pgi 214000 212342 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L81 protein_id gnl|my_center|LOCUS_01790 214092 215195 gene locus_tag LOCUS_01800 214092 215195 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_01800 215904 215272 gene locus_tag LOCUS_01810 215904 215272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 215992 216507 gene locus_tag LOCUS_01820 215992 216507 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_01820 217444 216509 gene locus_tag LOCUS_01830 217444 216509 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_01830 218271 217504 gene locus_tag LOCUS_01840 218271 217504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 219476 218259 gene locus_tag LOCUS_01850 219476 218259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 219868 219473 gene locus_tag LOCUS_01860 219868 219473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 219977 220621 gene locus_tag LOCUS_01870 219977 220621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 protein_id gnl|my_center|LOCUS_01870 220653 221420 gene locus_tag LOCUS_01880 220653 221420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672055.1 protein_id gnl|my_center|LOCUS_01880 221433 222116 gene locus_tag LOCUS_01890 gene yiiX 221433 222116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702308.1 protein_id gnl|my_center|LOCUS_01890 222626 222120 gene locus_tag LOCUS_01900 222626 222120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 223135 222701 gene locus_tag LOCUS_01910 223135 222701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 224456 223239 gene locus_tag LOCUS_01920 224456 223239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 225469 224456 gene locus_tag LOCUS_01930 225469 224456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 228323 225471 gene locus_tag LOCUS_01940 228323 225471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 229716 228313 gene locus_tag LOCUS_01950 229716 228313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 232040 229812 gene locus_tag LOCUS_01960 232040 229812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 234231 232060 gene locus_tag LOCUS_01970 234231 232060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 235514 234231 gene locus_tag LOCUS_01980 235514 234231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 238059 235600 gene locus_tag LOCUS_01990 238059 235600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 238414 238178 gene locus_tag LOCUS_02000 238414 238178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 239360 238488 gene locus_tag LOCUS_02010 239360 238488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 240230 239415 gene locus_tag LOCUS_02020 240230 239415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 240693 240340 gene locus_tag LOCUS_02030 240693 240340 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_02030 241585 240677 gene locus_tag LOCUS_02040 241585 240677 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_02040 242307 241582 gene locus_tag LOCUS_02050 gene pdxJ 242307 241582 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0V3 protein_id gnl|my_center|LOCUS_02050 242344 243009 gene locus_tag LOCUS_02060 242344 243009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 243019 243897 gene locus_tag LOCUS_02070 gene nadK 243019 243897 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_02070 243957 244772 gene locus_tag LOCUS_02080 243957 244772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 244772 245515 gene locus_tag LOCUS_02090 gene uppS 244772 245515 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_02090 245524 248067 gene locus_tag LOCUS_02100 gene bamA 245524 248067 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 protein_id gnl|my_center|LOCUS_02100 248146 248652 gene locus_tag LOCUS_02110 248146 248652 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_02110 248683 249207 gene locus_tag LOCUS_02120 248683 249207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 249273 250061 gene locus_tag LOCUS_02130 gene murI 249273 250061 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181G1 protein_id gnl|my_center|LOCUS_02130 250822 250058 gene locus_tag LOCUS_02140 250822 250058 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_02140 250925 252958 gene locus_tag LOCUS_02150 gene metG 250925 252958 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_02150 253085 253157 gene locus_tag LOCUS_t00030 253085 253157 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 253184 253256 gene locus_tag LOCUS_t00040 253184 253256 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 253802 253266 gene locus_tag LOCUS_02160 253802 253266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 253898 255313 gene locus_tag LOCUS_02170 253898 255313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 257262 255322 gene locus_tag LOCUS_02180 257262 255322 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_02180 258351 257347 gene locus_tag LOCUS_02190 gene fjo30 258351 257347 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_02190 259266 258430 gene locus_tag LOCUS_02200 gene gldN 259266 258430 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_02200 260840 259278 gene locus_tag LOCUS_02210 gene gldM 260840 259278 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_02210 261554 260886 gene locus_tag LOCUS_02220 gene gldL 261554 260886 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_02220 262997 261579 gene locus_tag LOCUS_02230 gene gldK 262997 261579 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_02230 263988 263044 gene locus_tag LOCUS_02240 263988 263044 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_02240 265281 264106 gene locus_tag LOCUS_02250 gene fjo29 265281 264106 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_02250 267752 265278 gene locus_tag LOCUS_02260 gene topA 267752 265278 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_02260 268075 269361 gene locus_tag LOCUS_02270 268075 269361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 269499 270896 gene locus_tag LOCUS_02280 269499 270896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 271029 272495 gene locus_tag LOCUS_02290 gene miaB 271029 272495 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_02290 272506 272913 gene locus_tag LOCUS_02300 272506 272913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 272910 274175 gene locus_tag LOCUS_02310 272910 274175 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_02310 274176 274676 gene locus_tag LOCUS_02320 274176 274676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_02320 274677 276065 gene locus_tag LOCUS_02330 274677 276065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 276077 276460 gene locus_tag LOCUS_02340 276077 276460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 276631 276912 gene locus_tag LOCUS_02350 gene groS 276631 276912 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_02350 276950 278590 gene locus_tag LOCUS_02360 gene groL 276950 278590 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_02360 278688 279626 gene locus_tag LOCUS_02370 278688 279626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 279701 280501 gene locus_tag LOCUS_02380 279701 280501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 280984 280532 gene locus_tag LOCUS_02390 280984 280532 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_02390 283218 281110 gene locus_tag LOCUS_02400 283218 281110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 284610 283228 gene locus_tag LOCUS_02410 gene ftsA 284610 283228 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_02410 285349 284615 gene locus_tag LOCUS_02420 285349 284615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 286682 285342 gene locus_tag LOCUS_02430 gene murC 286682 285342 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_02430 287775 286672 gene locus_tag LOCUS_02440 gene murG 287775 286672 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_02440 288955 287768 gene locus_tag LOCUS_02450 gene ftsW 288955 287768 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_02450 290300 288957 gene locus_tag LOCUS_02460 gene murD 290300 288957 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_02460 291544 290303 gene locus_tag LOCUS_02470 gene mraY 291544 290303 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_02470 293007 291544 gene locus_tag LOCUS_02480 gene murE 293007 291544 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_02480 294995 293004 gene locus_tag LOCUS_02490 gene ftsI 294995 293004 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_02490 295269 294982 gene locus_tag LOCUS_02500 295269 294982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 296251 295331 gene locus_tag LOCUS_02510 gene rsmH 296251 295331 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 protein_id gnl|my_center|LOCUS_02510 296702 296229 gene locus_tag LOCUS_02520 gene mraZ 296702 296229 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_02520 296963 297568 gene locus_tag LOCUS_02530 gene engB 296963 297568 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_02530 299928 297565 gene locus_tag LOCUS_02540 299928 297565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 300309 299932 gene locus_tag LOCUS_02550 300309 299932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 300696 300355 gene locus_tag LOCUS_02560 gene gldC 300696 300355 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_02560 301747 300764 gene locus_tag LOCUS_02570 301747 300764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 301809 302444 gene locus_tag LOCUS_02580 301809 302444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 302463 303254 gene locus_tag LOCUS_02590 gene nadE 302463 303254 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 protein_id gnl|my_center|LOCUS_02590 303360 303977 gene locus_tag LOCUS_02600 303360 303977 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_02600 304064 305368 gene locus_tag LOCUS_02610 gene der 304064 305368 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_02610 305372 306898 gene locus_tag LOCUS_02620 305372 306898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 307710 306904 gene locus_tag LOCUS_02630 307710 306904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 308613 307714 gene locus_tag LOCUS_02640 gene gldA 308613 307714 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_02640 308725 309666 gene locus_tag LOCUS_02650 gene rsgA 308725 309666 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 protein_id gnl|my_center|LOCUS_02650 309666 310121 gene locus_tag LOCUS_02660 gene dtd 309666 310121 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 protein_id gnl|my_center|LOCUS_02660 310126 310458 gene locus_tag LOCUS_02670 310126 310458 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_02670 311202 310459 gene locus_tag LOCUS_02680 gene pcrB 311202 310459 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_02680 311901 311263 gene locus_tag LOCUS_02690 gene sfp 311901 311263 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_02690 311977 313293 gene locus_tag LOCUS_02700 gene ahcY 311977 313293 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_02700 313410 314486 gene locus_tag LOCUS_02710 313410 314486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 314499 315239 gene locus_tag LOCUS_02720 314499 315239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 315557 315484 gene locus_tag LOCUS_t00050 315557 315484 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 315648 316538 gene locus_tag LOCUS_02730 gene era 315648 316538 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV2 protein_id gnl|my_center|LOCUS_02730 317026 316535 gene locus_tag LOCUS_02740 317026 316535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 318014 317076 gene locus_tag LOCUS_02750 gene ribF 318014 317076 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_02750 318194 319705 gene locus_tag LOCUS_02760 gene atpD 318194 319705 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_02760 319762 320052 gene locus_tag LOCUS_02770 319762 320052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 320063 321772 gene locus_tag LOCUS_02780 320063 321772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 322210 321782 gene locus_tag LOCUS_02790 322210 321782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 322452 326075 gene locus_tag LOCUS_02800 322452 326075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 326217 330158 gene locus_tag LOCUS_02810 326217 330158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 330225 331217 gene locus_tag LOCUS_02820 330225 331217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 331301 331774 gene locus_tag LOCUS_02830 gene greA 331301 331774 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_02830 331774 332166 gene locus_tag LOCUS_02840 331774 332166 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_02840 332726 332172 gene locus_tag LOCUS_02850 gene ruvC 332726 332172 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_02850 332850 333896 gene locus_tag LOCUS_02860 332850 333896 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_02860 335157 333883 gene locus_tag LOCUS_02870 335157 333883 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_02870 336044 335163 gene locus_tag LOCUS_02880 336044 335163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 338438 336051 gene locus_tag LOCUS_02890 338438 336051 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_02890 338613 340718 gene locus_tag LOCUS_02900 338613 340718 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_02900 340724 341812 gene locus_tag LOCUS_02910 340724 341812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 342492 341809 gene locus_tag LOCUS_02920 gene aat 342492 341809 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H233 protein_id gnl|my_center|LOCUS_02920 343877 342492 gene locus_tag LOCUS_02930 gene atoE 343877 342492 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071598.1 protein_id gnl|my_center|LOCUS_02930 345614 343926 gene locus_tag LOCUS_02940 345614 343926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 346204 345854 gene locus_tag LOCUS_02950 346204 345854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_02950 347111 346209 gene locus_tag LOCUS_02960 347111 346209 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_02960 347250 347332 gene locus_tag LOCUS_t00060 347250 347332 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 347874 351515 gene locus_tag LOCUS_02970 gene cas9 347874 351515 CDS product CRISPR-associated endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZR9 protein_id gnl|my_center|LOCUS_02970 351512 352402 gene locus_tag LOCUS_02980 gene cas1 351512 352402 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_02980 352399 352746 gene locus_tag LOCUS_02990 gene cas2 352399 352746 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 protein_id gnl|my_center|LOCUS_02990 352847 356038 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attatcaaagaacagtattatcaatcagttcacaac 356532 359738 gene locus_tag LOCUS_03000 356532 359738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 359701 359973 gene locus_tag LOCUS_03010 359701 359973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 361307 360645 gene locus_tag LOCUS_03020 361307 360645 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064417.1 protein_id gnl|my_center|LOCUS_03020 362026 364521 gene locus_tag LOCUS_03030 362026 364521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 364769 367819 gene locus_tag LOCUS_03040 364769 367819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 368604 371654 gene locus_tag LOCUS_03050 368604 371654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 372313 374034 gene locus_tag LOCUS_03060 372313 374034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 374107 375171 gene locus_tag LOCUS_03070 374107 375171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 376991 375324 gene locus_tag LOCUS_03080 376991 375324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 377659 378972 gene locus_tag LOCUS_03090 gene gabT 377659 378972 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_03090 378974 379888 gene locus_tag LOCUS_03100 378974 379888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 379928 380329 gene locus_tag LOCUS_03110 379928 380329 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095835.1 protein_id gnl|my_center|LOCUS_03110 380333 383089 gene locus_tag LOCUS_03120 380333 383089 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899363.1 protein_id gnl|my_center|LOCUS_03120 383093 384568 gene locus_tag LOCUS_03130 383093 384568 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408473.1 protein_id gnl|my_center|LOCUS_03130 384581 385936 gene locus_tag LOCUS_03140 384581 385936 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947312.1 protein_id gnl|my_center|LOCUS_03140 386170 386703 gene locus_tag LOCUS_03150 386170 386703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 386882 388693 gene locus_tag LOCUS_03160 386882 388693 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 protein_id gnl|my_center|LOCUS_03160 389000 393340 gene locus_tag LOCUS_03170 389000 393340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 393408 394307 gene locus_tag LOCUS_03180 393408 394307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 394537 395184 gene locus_tag LOCUS_03190 394537 395184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 395969 395277 gene locus_tag LOCUS_03200 395969 395277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 protein_id gnl|my_center|LOCUS_03200 396756 395980 gene locus_tag LOCUS_03210 396756 395980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 396983 397378 gene locus_tag LOCUS_03220 396983 397378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 397392 398123 gene locus_tag LOCUS_03230 397392 398123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 protein_id gnl|my_center|LOCUS_03230 398126 398773 gene locus_tag LOCUS_03240 398126 398773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 398803 400983 gene locus_tag LOCUS_03250 398803 400983 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121033.1 protein_id gnl|my_center|LOCUS_03250 401058 405971 gene locus_tag LOCUS_03260 401058 405971 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121034.1 protein_id gnl|my_center|LOCUS_03260 406184 406260 gene locus_tag LOCUS_t00070 406184 406260 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 406714 410274 gene locus_tag LOCUS_03270 406714 410274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 411826 410312 gene locus_tag LOCUS_03280 411826 410312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 412883 411912 gene locus_tag LOCUS_03290 412883 411912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 414339 412885 gene locus_tag LOCUS_03300 414339 412885 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_03300 414732 414343 gene locus_tag LOCUS_03310 414732 414343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 414983 414744 gene locus_tag LOCUS_03320 414983 414744 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802828.1 protein_id gnl|my_center|LOCUS_03320 415895 415002 gene locus_tag LOCUS_03330 415895 415002 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857912.1 protein_id gnl|my_center|LOCUS_03330 417622 415904 gene locus_tag LOCUS_03340 417622 415904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291950.1 protein_id gnl|my_center|LOCUS_03340 419143 417875 gene locus_tag LOCUS_03350 419143 417875 CDS product electron-transferring-flavoprotein dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081907.1 protein_id gnl|my_center|LOCUS_03350 419753 419259 gene locus_tag LOCUS_03360 419753 419259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 420641 419841 gene locus_tag LOCUS_03370 420641 419841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 421203 420682 gene locus_tag LOCUS_03380 421203 420682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 421711 421262 gene locus_tag LOCUS_03390 421711 421262 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_03390 422251 421832 gene locus_tag LOCUS_03400 422251 421832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 422786 422391 gene locus_tag LOCUS_03410 422786 422391 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963608.1 protein_id gnl|my_center|LOCUS_03410 423414 422824 gene locus_tag LOCUS_03420 423414 422824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291518.1 protein_id gnl|my_center|LOCUS_03420 424019 424381 gene locus_tag LOCUS_03430 424019 424381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 425600 424389 gene locus_tag LOCUS_03440 gene folC 425600 424389 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_03440 426409 425600 gene locus_tag LOCUS_03450 426409 425600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 426809 426417 gene locus_tag LOCUS_03460 426809 426417 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_03460 427510 426812 gene locus_tag LOCUS_03470 427510 426812 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_03470 428740 427634 gene locus_tag LOCUS_03480 428740 427634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 428937 430283 gene locus_tag LOCUS_03490 428937 430283 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_03490 430363 431031 gene locus_tag LOCUS_03500 gene clpP 430363 431031 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_03500 431138 432379 gene locus_tag LOCUS_03510 gene clpX 431138 432379 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_03510 432864 432376 gene locus_tag LOCUS_03520 gene dfrA 432864 432376 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_03520 433878 432973 gene locus_tag LOCUS_03530 gene thyA 433878 432973 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y626 protein_id gnl|my_center|LOCUS_03530 435791 434004 gene locus_tag LOCUS_03540 435791 434004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 436377 435766 gene locus_tag LOCUS_03550 436377 435766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_03550 437342 436377 gene locus_tag LOCUS_03560 gene etfA 437342 436377 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_03560 438110 437364 gene locus_tag LOCUS_03570 gene etfB 438110 437364 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_03570 438265 439248 gene locus_tag LOCUS_03580 gene pdhB 438265 439248 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_03580 439385 441937 gene locus_tag LOCUS_03590 gene hppA1 439385 441937 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_03590 442006 442797 gene locus_tag LOCUS_03600 442006 442797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 443321 442794 gene locus_tag LOCUS_03610 443321 442794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 444761 444147 gene locus_tag LOCUS_03620 444761 444147 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_03620 445613 444834 gene locus_tag LOCUS_03630 445613 444834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 447070 445610 gene locus_tag LOCUS_03640 447070 445610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_03640 447278 447985 gene locus_tag LOCUS_03650 447278 447985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_03650 448931 447945 gene locus_tag LOCUS_03660 448931 447945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 449632 448937 gene locus_tag LOCUS_03670 449632 448937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_03670 451307 449634 gene locus_tag LOCUS_03680 451307 449634 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_03680 451407 451973 gene locus_tag LOCUS_03690 451407 451973 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_03690 451966 452586 gene locus_tag LOCUS_03700 451966 452586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03700 452727 454145 gene locus_tag LOCUS_03710 452727 454145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 454247 454906 gene locus_tag LOCUS_03720 454247 454906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 455448 454912 gene locus_tag LOCUS_03730 455448 454912 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_03730 455522 458083 gene locus_tag LOCUS_03740 gene mutS 455522 458083 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWN3 protein_id gnl|my_center|LOCUS_03740 458130 458203 gene locus_tag LOCUS_t00080 458130 458203 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 458256 458342 gene locus_tag LOCUS_t00090 458256 458342 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 459177 458425 gene locus_tag LOCUS_03750 459177 458425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 459457 460434 gene locus_tag LOCUS_03760 gene corA 459457 460434 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H3 protein_id gnl|my_center|LOCUS_03760 460517 461713 gene locus_tag LOCUS_03770 460517 461713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 462937 461714 gene locus_tag LOCUS_03780 gene dinB 462937 461714 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P36 protein_id gnl|my_center|LOCUS_03780 465977 462924 gene locus_tag LOCUS_03790 gene dnaE 465977 462924 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180P3 protein_id gnl|my_center|LOCUS_03790 467411 466179 gene locus_tag LOCUS_03800 467411 466179 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_03800 468179 467415 gene locus_tag LOCUS_03810 468179 467415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 468247 469377 gene locus_tag LOCUS_03820 gene porR 468247 469377 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_03820 469380 470696 gene locus_tag LOCUS_03830 469380 470696 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817149.1 protein_id gnl|my_center|LOCUS_03830 470700 471686 gene locus_tag LOCUS_03840 470700 471686 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_03840 471688 472713 gene locus_tag LOCUS_03850 gene galE 471688 472713 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_03850 472727 473788 gene locus_tag LOCUS_03860 gene rmlB 472727 473788 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_03860 473926 476544 gene locus_tag LOCUS_03870 473926 476544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 476748 477389 gene locus_tag LOCUS_03880 476748 477389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 478042 477398 gene locus_tag LOCUS_03890 478042 477398 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_03890 479283 478048 gene locus_tag LOCUS_03900 479283 478048 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796883.1 protein_id gnl|my_center|LOCUS_03900 479772 479362 gene locus_tag LOCUS_03910 479772 479362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 480823 479765 gene locus_tag LOCUS_03920 480823 479765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 482499 480820 gene locus_tag LOCUS_03930 482499 480820 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_03930 483063 482503 gene locus_tag LOCUS_03940 483063 482503 CDS product twin-arginine translocation pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383266.1 protein_id gnl|my_center|LOCUS_03940 485273 483222 gene locus_tag LOCUS_03950 485273 483222 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_03950 485378 485836 gene locus_tag LOCUS_03960 485378 485836 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H134 protein_id gnl|my_center|LOCUS_03960 487418 485868 gene locus_tag LOCUS_03970 gene cafA 487418 485868 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_03970 488160 487645 gene locus_tag LOCUS_03980 488160 487645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 488457 488170 gene locus_tag LOCUS_03990 gene hupA 488457 488170 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_03990 488641 489654 gene locus_tag LOCUS_04000 488641 489654 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107826.1 protein_id gnl|my_center|LOCUS_04000 489693 490112 gene locus_tag LOCUS_04010 gene ssb 489693 490112 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H058 protein_id gnl|my_center|LOCUS_04010 490236 491471 gene locus_tag LOCUS_04020 490236 491471 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_04020 491443 492027 gene locus_tag LOCUS_04030 gene gldD 491443 492027 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_04030 492015 492224 gene locus_tag LOCUS_04040 492015 492224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 493298 492270 gene locus_tag LOCUS_04050 493298 492270 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462008.1 protein_id gnl|my_center|LOCUS_04050 493872 494372 gene locus_tag LOCUS_04060 493872 494372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 496464 494428 gene locus_tag LOCUS_04070 496464 494428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 497834 496524 gene locus_tag LOCUS_04080 497834 496524 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_04080 498038 498547 gene locus_tag LOCUS_04090 498038 498547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 498574 498834 gene locus_tag LOCUS_04100 gene rpmA 498574 498834 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P8 protein_id gnl|my_center|LOCUS_04100 498925 500193 gene locus_tag LOCUS_04110 gene serS 498925 500193 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_04110 500190 500726 gene locus_tag LOCUS_04120 500190 500726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 500929 502656 gene locus_tag LOCUS_04130 500929 502656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 503614 502667 gene locus_tag LOCUS_04140 503614 502667 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_04140 504514 503741 gene locus_tag LOCUS_04150 504514 503741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 504764 505090 gene locus_tag LOCUS_04160 504764 505090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 505338 505562 gene locus_tag LOCUS_04170 505338 505562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 506856 505549 gene locus_tag LOCUS_04180 506856 505549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 508409 506895 gene locus_tag LOCUS_04190 508409 506895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 509436 508411 gene locus_tag LOCUS_04200 gene ltaE 509436 508411 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_04200 510525 509503 gene locus_tag LOCUS_04210 510525 509503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_04210 510647 511354 gene locus_tag LOCUS_04220 gene pssA 510647 511354 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_04220 511389 511640 gene locus_tag LOCUS_04230 gene purS 511389 511640 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IB1 protein_id gnl|my_center|LOCUS_04230 512219 512809 gene locus_tag LOCUS_04240 512219 512809 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_04240 513031 512861 gene locus_tag LOCUS_04250 513031 512861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 513740 513105 gene locus_tag LOCUS_04260 513740 513105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 513950 514282 gene locus_tag LOCUS_04270 513950 514282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 514301 515698 gene locus_tag LOCUS_04280 gene fumC 514301 515698 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_04280 515844 517421 gene locus_tag LOCUS_04290 515844 517421 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_04290 517470 519296 gene locus_tag LOCUS_04300 gene fadD 517470 519296 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_04300 519304 520077 gene locus_tag LOCUS_04310 519304 520077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 520195 520581 gene locus_tag LOCUS_04320 520195 520581 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_04320 520578 522983 gene locus_tag LOCUS_04330 520578 522983 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_04330 523039 524217 gene locus_tag LOCUS_04340 523039 524217 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_04340 524352 526157 gene locus_tag LOCUS_04350 524352 526157 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_04350 526277 528184 gene locus_tag LOCUS_04360 gene acsA 526277 528184 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_04360 528181 528732 gene locus_tag LOCUS_04370 528181 528732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 528800 529933 gene locus_tag LOCUS_04380 528800 529933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_04380 530370 529969 gene locus_tag LOCUS_04390 530370 529969 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551711.1 protein_id gnl|my_center|LOCUS_04390 530823 530374 gene locus_tag LOCUS_04400 530823 530374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 530961 532199 gene locus_tag LOCUS_04410 530961 532199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_04410 532714 532196 gene locus_tag LOCUS_04420 532714 532196 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_04420 534699 532930 gene locus_tag LOCUS_04430 534699 532930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 536932 534755 gene locus_tag LOCUS_04440 gene pepX1 536932 534755 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_04440 537083 538486 gene locus_tag LOCUS_04450 gene glcD 537083 538486 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_04450 538606 540603 gene locus_tag LOCUS_04460 538606 540603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 541793 540600 gene locus_tag LOCUS_04470 gene argD 541793 540600 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_04470 542333 541812 gene locus_tag LOCUS_04480 542333 541812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 542637 544484 gene locus_tag LOCUS_04490 542637 544484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 545333 544467 gene locus_tag LOCUS_04500 545333 544467 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963393.1 protein_id gnl|my_center|LOCUS_04500 546361 545333 gene locus_tag LOCUS_04510 546361 545333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 546981 546361 gene locus_tag LOCUS_04520 546981 546361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 547023 547766 gene locus_tag LOCUS_04530 547023 547766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143505.1 protein_id gnl|my_center|LOCUS_04530 548932 547763 gene locus_tag LOCUS_04540 548932 547763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 549252 548929 gene locus_tag LOCUS_04550 549252 548929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 549251 549418 gene locus_tag LOCUS_04560 549251 549418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 551941 549812 gene locus_tag LOCUS_04570 gene recG 551941 549812 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_04570 551941 554322 gene locus_tag LOCUS_04580 551941 554322 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963153.1 protein_id gnl|my_center|LOCUS_04580 554781 555722 gene locus_tag LOCUS_04590 554781 555722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 556814 555723 gene locus_tag LOCUS_04600 556814 555723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530607.1 protein_id gnl|my_center|LOCUS_04600 557872 556811 gene locus_tag LOCUS_04610 557872 556811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 559112 558387 gene locus_tag LOCUS_04620 559112 558387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705544.1 protein_id gnl|my_center|LOCUS_04620 560207 559113 gene locus_tag LOCUS_04630 560207 559113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 561216 560752 gene locus_tag LOCUS_04640 561216 560752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 562698 561328 gene locus_tag LOCUS_04650 562698 561328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039143.1 protein_id gnl|my_center|LOCUS_04650 564564 562828 gene locus_tag LOCUS_04660 564564 562828 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453764.1 protein_id gnl|my_center|LOCUS_04660 564797 565150 gene locus_tag LOCUS_04670 564797 565150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 565279 566457 gene locus_tag LOCUS_04680 565279 566457 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_04680 567003 566467 gene locus_tag LOCUS_04690 567003 566467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_04690 567414 567019 gene locus_tag LOCUS_04700 567414 567019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 568059 567643 gene locus_tag LOCUS_04710 568059 567643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_04710 569012 568170 gene locus_tag LOCUS_04720 gene menB 569012 568170 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_04720 570391 569099 gene locus_tag LOCUS_04730 570391 569099 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020294.1 protein_id gnl|my_center|LOCUS_04730 570836 570459 gene locus_tag LOCUS_04740 570836 570459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 571033 572223 gene locus_tag LOCUS_04750 gene sucC 571033 572223 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_04750 573205 573684 gene locus_tag LOCUS_04760 573205 573684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 573803 575026 gene locus_tag LOCUS_04770 573803 575026 CDS product cytochrome d ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047985.1 protein_id gnl|my_center|LOCUS_04770 575030 575404 gene locus_tag LOCUS_04780 575030 575404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923332.1 protein_id gnl|my_center|LOCUS_04780 576226 575432 gene locus_tag LOCUS_04790 576226 575432 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212588.1 protein_id gnl|my_center|LOCUS_04790 577485 576271 gene locus_tag LOCUS_04800 577485 576271 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765688.1 protein_id gnl|my_center|LOCUS_04800 579183 577639 gene locus_tag LOCUS_04810 579183 577639 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_04810 580071 579325 gene locus_tag LOCUS_04820 580071 579325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 580279 580710 gene locus_tag LOCUS_04830 580279 580710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 581114 582613 gene locus_tag LOCUS_04840 581114 582613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 583258 583698 gene locus_tag LOCUS_04850 583258 583698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 584294 585586 gene locus_tag LOCUS_04860 584294 585586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 586034 586660 gene locus_tag LOCUS_04870 586034 586660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 586888 587883 gene locus_tag LOCUS_04880 586888 587883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 588269 589708 gene locus_tag LOCUS_04890 588269 589708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 591119 589926 gene locus_tag LOCUS_04900 591119 589926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 591769 591125 gene locus_tag LOCUS_04910 591769 591125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 593325 591766 gene locus_tag LOCUS_04920 593325 591766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 protein_id gnl|my_center|LOCUS_04920 594556 593270 gene locus_tag LOCUS_04930 gene purA 594556 593270 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_04930 595039 594578 gene locus_tag LOCUS_04940 gene fur 595039 594578 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_04940 597297 595072 gene locus_tag LOCUS_04950 gene relA 597297 595072 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_04950 599304 598033 gene locus_tag LOCUS_04960 gene fahA 599304 598033 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_04960 599463 600737 gene locus_tag LOCUS_04970 gene glyA 599463 600737 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_04970 600749 601471 gene locus_tag LOCUS_04980 600749 601471 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_04980 601666 601472 gene locus_tag LOCUS_04990 601666 601472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 601596 602246 gene locus_tag LOCUS_05000 601596 602246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 603153 602305 gene locus_tag LOCUS_05010 603153 602305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 603612 603271 gene locus_tag LOCUS_05020 603612 603271 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_05020 604015 603737 gene locus_tag LOCUS_05030 604015 603737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 604793 604017 gene locus_tag LOCUS_05040 604793 604017 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 protein_id gnl|my_center|LOCUS_05040 605866 604883 gene locus_tag LOCUS_05050 605866 604883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 606010 606375 gene locus_tag LOCUS_05060 606010 606375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_05060 607079 606372 gene locus_tag LOCUS_05070 607079 606372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 608166 607138 gene locus_tag LOCUS_05080 608166 607138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_05080 608828 608331 gene locus_tag LOCUS_05090 608828 608331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 609006 612173 gene locus_tag LOCUS_05100 609006 612173 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0E1 protein_id gnl|my_center|LOCUS_05100 612261 612836 gene locus_tag LOCUS_05110 612261 612836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 613822 612833 gene locus_tag LOCUS_05120 613822 612833 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q99XR4 protein_id gnl|my_center|LOCUS_05120 614846 613824 gene locus_tag LOCUS_05130 614846 613824 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963810.1 protein_id gnl|my_center|LOCUS_05130 616087 614846 gene locus_tag LOCUS_05140 gene hutI 616087 614846 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_05140 616323 616487 gene locus_tag LOCUS_05150 616323 616487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 616794 616579 gene locus_tag LOCUS_05160 616794 616579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 616733 619030 gene locus_tag LOCUS_05170 616733 619030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 619089 620153 gene locus_tag LOCUS_05180 gene aroC 619089 620153 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_05180 620158 621570 gene locus_tag LOCUS_05190 gene gltP 620158 621570 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_05190 621677 624445 gene locus_tag LOCUS_05200 621677 624445 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109118.1 protein_id gnl|my_center|LOCUS_05200 624468 626447 gene locus_tag LOCUS_05210 624468 626447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 627077 626730 gene locus_tag LOCUS_05220 gene rplS 627077 626730 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_05220 627895 627218 gene locus_tag LOCUS_05230 gene trmD 627895 627218 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_05230 628479 627994 gene locus_tag LOCUS_05240 gene msrB 628479 627994 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066093.1 protein_id gnl|my_center|LOCUS_05240 629472 628597 gene locus_tag LOCUS_05250 629472 628597 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963827.1 protein_id gnl|my_center|LOCUS_05250 629982 629896 gene locus_tag LOCUS_t00100 629982 629896 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 630247 630174 gene locus_tag LOCUS_t00110 630247 630174 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 630474 630986 gene locus_tag LOCUS_05260 gene aroK 630474 630986 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 protein_id gnl|my_center|LOCUS_05260 630979 631569 gene locus_tag LOCUS_05270 630979 631569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 632801 631566 gene locus_tag LOCUS_05280 632801 631566 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_05280 633577 633020 gene locus_tag LOCUS_05290 633577 633020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_05290 634198 633620 gene locus_tag LOCUS_05300 634198 633620 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962190.1 protein_id gnl|my_center|LOCUS_05300 636828 634273 gene locus_tag LOCUS_05310 gene clpA 636828 634273 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_05310 637100 639664 gene locus_tag LOCUS_05320 gene gyrA 637100 639664 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_05320 640634 639729 gene locus_tag LOCUS_05330 640634 639729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 641173 643059 gene locus_tag LOCUS_05340 gene htpG 641173 643059 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_05340 643236 643931 gene locus_tag LOCUS_05350 643236 643931 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_05350 643964 645682 gene locus_tag LOCUS_05360 643964 645682 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_05360 646995 646717 gene locus_tag LOCUS_05370 646995 646717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 647988 648785 gene locus_tag LOCUS_05380 647988 648785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 648772 650016 gene locus_tag LOCUS_05390 648772 650016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 650071 650958 gene locus_tag LOCUS_05400 650071 650958 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_05400 651142 651747 gene locus_tag LOCUS_05410 651142 651747 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_05410 651994 651752 gene locus_tag LOCUS_05420 651994 651752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 658242 652027 gene locus_tag LOCUS_05430 658242 652027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 663017 658431 gene locus_tag LOCUS_05440 663017 658431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 663620 663117 gene locus_tag LOCUS_05450 663620 663117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 664178 663633 gene locus_tag LOCUS_05460 664178 663633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 666974 664242 gene locus_tag LOCUS_05470 666974 664242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 667777 666974 gene locus_tag LOCUS_05480 667777 666974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 668423 667863 gene locus_tag LOCUS_05490 668423 667863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 670868 668847 gene locus_tag LOCUS_05500 670868 668847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 671707 671018 gene locus_tag LOCUS_05510 671707 671018 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_05510 671758 672726 gene locus_tag LOCUS_05520 671758 672726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 672786 673556 gene locus_tag LOCUS_05530 672786 673556 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_05530 673774 673565 gene locus_tag LOCUS_05540 673774 673565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861328.1 protein_id gnl|my_center|LOCUS_05540 674988 673780 gene locus_tag LOCUS_05550 674988 673780 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_05550 675879 675079 gene locus_tag LOCUS_05560 675879 675079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946941.1 protein_id gnl|my_center|LOCUS_05560 677457 676258 gene locus_tag LOCUS_05570 677457 676258 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_05570 681830 677469 gene locus_tag LOCUS_05580 681830 677469 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_05580 682262 681900 gene locus_tag LOCUS_05590 682262 681900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 682321 683244 gene locus_tag LOCUS_05600 682321 683244 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121843.1 protein_id gnl|my_center|LOCUS_05600 683283 684527 gene locus_tag LOCUS_05610 683283 684527 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_05610 685717 684584 gene locus_tag LOCUS_05620 685717 684584 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262031.1 protein_id gnl|my_center|LOCUS_05620 686403 685843 gene locus_tag LOCUS_05630 686403 685843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 687690 686512 gene locus_tag LOCUS_05640 687690 686512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05640 688198 687833 gene locus_tag LOCUS_05650 688198 687833 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761500.1 protein_id gnl|my_center|LOCUS_05650 690834 688279 gene locus_tag LOCUS_05660 gene cphA 690834 688279 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963250.1 protein_id gnl|my_center|LOCUS_05660 691015 691869 gene locus_tag LOCUS_05670 gene cphB 691015 691869 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963249.1 protein_id gnl|my_center|LOCUS_05670 692806 691874 gene locus_tag LOCUS_05680 gene ansA 692806 691874 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 protein_id gnl|my_center|LOCUS_05680 693125 692847 gene locus_tag LOCUS_05690 693125 692847 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025680.1 protein_id gnl|my_center|LOCUS_05690 693848 693129 gene locus_tag LOCUS_05700 693848 693129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 695415 694378 gene locus_tag LOCUS_05710 695415 694378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_05710 696480 695422 gene locus_tag LOCUS_05720 696480 695422 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064866.1 protein_id gnl|my_center|LOCUS_05720 696586 697371 gene locus_tag LOCUS_05730 696586 697371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 699518 697386 gene locus_tag LOCUS_05740 gene pepX2 699518 697386 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963251.1 protein_id gnl|my_center|LOCUS_05740 699940 701028 gene locus_tag LOCUS_05750 699940 701028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 702530 701067 gene locus_tag LOCUS_05760 702530 701067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 703013 702534 gene locus_tag LOCUS_05770 703013 702534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 704155 703028 gene locus_tag LOCUS_05780 704155 703028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 705836 704223 gene locus_tag LOCUS_05790 705836 704223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 706706 706209 gene locus_tag LOCUS_05800 706706 706209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 707101 707397 gene locus_tag LOCUS_05810 707101 707397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05810 711501 710722 gene locus_tag LOCUS_05820 711501 710722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 712211 711504 gene locus_tag LOCUS_05830 712211 711504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 713451 712204 gene locus_tag LOCUS_05840 gene nosD 713451 712204 CDS product NosD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403089.1 protein_id gnl|my_center|LOCUS_05840 713891 713448 gene locus_tag LOCUS_05850 713891 713448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 714562 713984 gene locus_tag LOCUS_05860 714562 713984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 716639 714675 gene locus_tag LOCUS_05870 gene nosZ 716639 714675 CDS product nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403087.1 protein_id gnl|my_center|LOCUS_05870 717144 716662 gene locus_tag LOCUS_05880 717144 716662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 718765 717278 gene locus_tag LOCUS_05890 718765 717278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 718994 718743 gene locus_tag LOCUS_05900 718994 718743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 719276 719004 gene locus_tag LOCUS_05910 719276 719004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 720193 719360 gene locus_tag LOCUS_05920 720193 719360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 720620 720246 gene locus_tag LOCUS_05930 720620 720246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 721007 721435 gene locus_tag LOCUS_05940 721007 721435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 721488 722228 gene locus_tag LOCUS_05950 721488 722228 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_05950 722232 722663 gene locus_tag LOCUS_05960 722232 722663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 722679 723593 gene locus_tag LOCUS_05970 722679 723593 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_05970 723987 727115 gene locus_tag LOCUS_05980 723987 727115 CDS product type II endonuclease-methyltransferasefusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962421.1 protein_id gnl|my_center|LOCUS_05980 728211 727147 gene locus_tag LOCUS_05990 728211 727147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 728548 728213 gene locus_tag LOCUS_06000 728548 728213 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962788.1 protein_id gnl|my_center|LOCUS_06000 729687 728632 gene locus_tag LOCUS_06010 729687 728632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 731083 729938 gene locus_tag LOCUS_06020 731083 729938 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361999.1 protein_id gnl|my_center|LOCUS_06020 732688 731285 gene locus_tag LOCUS_06030 gene mnmE 732688 731285 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_06030 735706 732800 gene locus_tag LOCUS_06040 735706 732800 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933213.1 protein_id gnl|my_center|LOCUS_06040 735884 736975 gene locus_tag LOCUS_06050 gene engD 735884 736975 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC6 protein_id gnl|my_center|LOCUS_06050 737075 738946 gene locus_tag LOCUS_06060 gene parE 737075 738946 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_06060 738936 739427 gene locus_tag LOCUS_06070 738936 739427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 739411 742026 gene locus_tag LOCUS_06080 gene parC 739411 742026 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_06080 742037 743668 gene locus_tag LOCUS_06090 742037 743668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 743701 744891 gene locus_tag LOCUS_06100 743701 744891 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 protein_id gnl|my_center|LOCUS_06100 745505 744888 gene locus_tag LOCUS_06110 745505 744888 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202967.1 protein_id gnl|my_center|LOCUS_06110 746712 745495 gene locus_tag LOCUS_06120 746712 745495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 746776 748104 gene locus_tag LOCUS_06130 746776 748104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 748177 749523 gene locus_tag LOCUS_06140 748177 749523 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_06140 749544 749891 gene locus_tag LOCUS_06150 749544 749891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 749893 750270 gene locus_tag LOCUS_06160 749893 750270 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_06160 750267 751418 gene locus_tag LOCUS_06170 750267 751418 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765042.1 protein_id gnl|my_center|LOCUS_06170 751539 752165 gene locus_tag LOCUS_06180 751539 752165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 752265 754400 gene locus_tag LOCUS_06190 752265 754400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765878.1 protein_id gnl|my_center|LOCUS_06190 756149 754692 gene locus_tag LOCUS_06200 756149 754692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 756941 756168 gene locus_tag LOCUS_06210 756941 756168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 757136 757945 gene locus_tag LOCUS_06220 757136 757945 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765880.1 protein_id gnl|my_center|LOCUS_06220 758001 759086 gene locus_tag LOCUS_06230 758001 759086 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_06230 759090 759935 gene locus_tag LOCUS_06240 759090 759935 CDS product glycosyl transferase family A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765895.1 protein_id gnl|my_center|LOCUS_06240 759935 761107 gene locus_tag LOCUS_06250 759935 761107 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_06250 761201 763204 gene locus_tag LOCUS_06260 761201 763204 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481540.1 protein_id gnl|my_center|LOCUS_06260 763393 765414 gene locus_tag LOCUS_06270 763393 765414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 766505 765804 gene locus_tag LOCUS_06280 766505 765804 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_06280 769359 766519 gene locus_tag LOCUS_06290 gene uvrA2 769359 766519 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX6 protein_id gnl|my_center|LOCUS_06290 770442 769381 gene locus_tag LOCUS_06300 770442 769381 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_06300 770989 770435 gene locus_tag LOCUS_06310 770989 770435 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_06310 771142 773292 gene locus_tag LOCUS_06320 771142 773292 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_06320 773316 773975 gene locus_tag LOCUS_06330 773316 773975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 773985 775079 gene locus_tag LOCUS_06340 773985 775079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 775083 775844 gene locus_tag LOCUS_06350 775083 775844 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_06350 775916 777040 gene locus_tag LOCUS_06360 775916 777040 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_06360 777660 777085 gene locus_tag LOCUS_06370 777660 777085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_06370 777998 778252 gene locus_tag LOCUS_06380 777998 778252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 778702 779004 gene locus_tag LOCUS_06390 778702 779004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 779026 779577 gene locus_tag LOCUS_06400 779026 779577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 779863 780054 gene locus_tag LOCUS_06410 gene cspC 779863 780054 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 protein_id gnl|my_center|LOCUS_06410 780574 780158 gene locus_tag LOCUS_06420 gene speH 780574 780158 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZC3 protein_id gnl|my_center|LOCUS_06420 781509 780574 gene locus_tag LOCUS_06430 781509 780574 CDS product calcium-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250851.1 protein_id gnl|my_center|LOCUS_06430 782185 781610 gene locus_tag LOCUS_06440 782185 781610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 783731 782187 gene locus_tag LOCUS_06450 gene speE2 783731 782187 CDS product polyamine aminopropyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67365 protein_id gnl|my_center|LOCUS_06450 784610 783738 gene locus_tag LOCUS_06460 784610 783738 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425211.1 protein_id gnl|my_center|LOCUS_06460 785437 784631 gene locus_tag LOCUS_06470 785437 784631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 786002 785439 gene locus_tag LOCUS_06480 786002 785439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 786872 786174 gene locus_tag LOCUS_06490 786872 786174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 protein_id gnl|my_center|LOCUS_06490 787201 788313 gene locus_tag LOCUS_06500 787201 788313 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113032.1 protein_id gnl|my_center|LOCUS_06500 788456 789940 gene locus_tag LOCUS_06510 gene accC 788456 789940 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_06510 789937 790599 gene locus_tag LOCUS_06520 789937 790599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 791188 790601 gene locus_tag LOCUS_06530 791188 790601 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_06530 791229 792470 gene locus_tag LOCUS_06540 791229 792470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 792464 793516 gene locus_tag LOCUS_06550 792464 793516 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_06550 794509 793502 gene locus_tag LOCUS_06560 gene fabH2 794509 793502 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_06560 794622 795332 gene locus_tag LOCUS_06570 794622 795332 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNC3 protein_id gnl|my_center|LOCUS_06570 795555 796880 gene locus_tag LOCUS_06580 795555 796880 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_06580 796989 798593 gene locus_tag LOCUS_06590 gene bshC 796989 798593 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_06590 799378 798677 gene locus_tag LOCUS_06600 799378 798677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 800560 799391 gene locus_tag LOCUS_06610 800560 799391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 800765 802804 gene locus_tag LOCUS_06620 800765 802804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 802801 803556 gene locus_tag LOCUS_06630 802801 803556 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_06630 803695 805674 gene locus_tag LOCUS_06640 803695 805674 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203283.1 protein_id gnl|my_center|LOCUS_06640 805735 806163 gene locus_tag LOCUS_06650 805735 806163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 806509 806168 gene locus_tag LOCUS_06660 806509 806168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 807624 806587 gene locus_tag LOCUS_06670 807624 806587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 807865 808611 gene locus_tag LOCUS_06680 807865 808611 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_06680 808828 810708 gene locus_tag LOCUS_06690 808828 810708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 810724 811539 gene locus_tag LOCUS_06700 810724 811539 CDS product primosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141843.1 protein_id gnl|my_center|LOCUS_06700 812610 812984 gene locus_tag LOCUS_06710 812610 812984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 813003 814460 gene locus_tag LOCUS_06720 gene pepD 813003 814460 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964033.1 protein_id gnl|my_center|LOCUS_06720 814462 815328 gene locus_tag LOCUS_06730 gene mvaB 814462 815328 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_06730 815335 815802 gene locus_tag LOCUS_06740 815335 815802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 815824 816111 gene locus_tag LOCUS_06750 815824 816111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 816108 816875 gene locus_tag LOCUS_06760 816108 816875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 817399 816872 gene locus_tag LOCUS_06770 817399 816872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 817487 817987 gene locus_tag LOCUS_06780 817487 817987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404561.1 protein_id gnl|my_center|LOCUS_06780 818133 818435 gene locus_tag LOCUS_06790 818133 818435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 818699 818896 gene locus_tag LOCUS_06800 818699 818896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 819487 821295 gene locus_tag LOCUS_06810 819487 821295 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_06810 821392 822678 gene locus_tag LOCUS_06820 821392 822678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 822696 822896 gene locus_tag LOCUS_06830 822696 822896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 823043 826018 gene locus_tag LOCUS_06840 823043 826018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 826039 826797 gene locus_tag LOCUS_06850 826039 826797 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_06850 827913 826882 gene locus_tag LOCUS_06860 827913 826882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 828532 828068 gene locus_tag LOCUS_06870 828532 828068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_06870 830159 828525 gene locus_tag LOCUS_06880 830159 828525 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_06880 830293 830712 gene locus_tag LOCUS_06890 830293 830712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 831555 830728 gene locus_tag LOCUS_06900 831555 830728 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_06900 833692 831563 gene locus_tag LOCUS_06910 833692 831563 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107669.1 protein_id gnl|my_center|LOCUS_06910 833831 834199 gene locus_tag LOCUS_06920 833831 834199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 834305 835966 gene locus_tag LOCUS_06930 834305 835966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_06930 836222 836446 gene locus_tag LOCUS_06940 836222 836446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 836786 837103 gene locus_tag LOCUS_06950 836786 837103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 837113 838030 gene locus_tag LOCUS_06960 837113 838030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06960 838474 838079 gene locus_tag LOCUS_06970 838474 838079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 838597 839022 gene locus_tag LOCUS_06980 838597 839022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 839470 839054 gene locus_tag LOCUS_06990 839470 839054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 839870 839457 gene locus_tag LOCUS_07000 839870 839457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 839980 840375 gene locus_tag LOCUS_07010 839980 840375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 841426 840380 gene locus_tag LOCUS_07020 841426 840380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 841513 842748 gene locus_tag LOCUS_07030 841513 842748 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964498.1 protein_id gnl|my_center|LOCUS_07030 843394 842738 gene locus_tag LOCUS_07040 843394 842738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 844680 843406 gene locus_tag LOCUS_07050 844680 843406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 845921 844710 gene locus_tag LOCUS_07060 845921 844710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 846466 845918 gene locus_tag LOCUS_07070 846466 845918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 846837 847454 gene locus_tag LOCUS_07080 846837 847454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 848173 847877 gene locus_tag LOCUS_07090 848173 847877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 848316 849626 gene locus_tag LOCUS_07100 848316 849626 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730651.1 protein_id gnl|my_center|LOCUS_07100 849623 850654 gene locus_tag LOCUS_07110 849623 850654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 850713 853154 gene locus_tag LOCUS_07120 850713 853154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 853159 853887 gene locus_tag LOCUS_07130 853159 853887 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_07130 854012 854269 gene locus_tag LOCUS_07140 854012 854269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 854305 855036 gene locus_tag LOCUS_07150 854305 855036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 855334 857301 gene locus_tag LOCUS_07160 855334 857301 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963575.1 protein_id gnl|my_center|LOCUS_07160 857298 858263 gene locus_tag LOCUS_07170 857298 858263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 858279 859253 gene locus_tag LOCUS_07180 858279 859253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 859337 860290 gene locus_tag LOCUS_07190 859337 860290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766582.1 protein_id gnl|my_center|LOCUS_07190 860271 861011 gene locus_tag LOCUS_07200 860271 861011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_07200 861015 861569 gene locus_tag LOCUS_07210 861015 861569 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141084.1 protein_id gnl|my_center|LOCUS_07210 863329 861566 gene locus_tag LOCUS_07220 863329 861566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_07220 865633 863342 gene locus_tag LOCUS_07230 gene mrcA 865633 863342 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_07230 866343 865693 gene locus_tag LOCUS_07240 gene upp 866343 865693 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_07240 866819 866442 gene locus_tag LOCUS_07250 866819 866442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 867706 866843 gene locus_tag LOCUS_07260 867706 866843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 868221 867703 gene locus_tag LOCUS_07270 868221 867703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 868484 869335 gene locus_tag LOCUS_07280 868484 869335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 869935 869342 gene locus_tag LOCUS_07290 869935 869342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 870612 869968 gene locus_tag LOCUS_07300 870612 869968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 870724 871029 gene locus_tag LOCUS_07310 870724 871029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 871131 873425 gene locus_tag LOCUS_07320 871131 873425 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108131.1 protein_id gnl|my_center|LOCUS_07320 875671 873422 gene locus_tag LOCUS_07330 875671 873422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 876198 875734 gene locus_tag LOCUS_07340 876198 875734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_07340 877272 876244 gene locus_tag LOCUS_07350 877272 876244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 878282 877257 gene locus_tag LOCUS_07360 878282 877257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 879383 878529 gene locus_tag LOCUS_07370 879383 878529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_07370 879626 880450 gene locus_tag LOCUS_07380 879626 880450 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_07380 880431 881489 gene locus_tag LOCUS_07390 880431 881489 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 protein_id gnl|my_center|LOCUS_07390 881549 882349 gene locus_tag LOCUS_07400 gene bamD 881549 882349 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_07400 882352 882693 gene locus_tag LOCUS_07410 882352 882693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_07410 882700 883914 gene locus_tag LOCUS_07420 gene coaBC 882700 883914 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_07420 883889 884797 gene locus_tag LOCUS_07430 883889 884797 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404280.1 protein_id gnl|my_center|LOCUS_07430 884817 886472 gene locus_tag LOCUS_07440 gene recN 884817 886472 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_07440 886652 887731 gene locus_tag LOCUS_07450 886652 887731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 887728 888702 gene locus_tag LOCUS_07460 887728 888702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 889828 888704 gene locus_tag LOCUS_07470 889828 888704 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_07470 890381 889818 gene locus_tag LOCUS_07480 890381 889818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_07480 890890 890468 gene locus_tag LOCUS_07490 890890 890468 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793753.1 protein_id gnl|my_center|LOCUS_07490 892255 891026 gene locus_tag LOCUS_07500 892255 891026 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_07500 892544 893641 gene locus_tag LOCUS_07510 892544 893641 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_07510 893847 893638 gene locus_tag LOCUS_07520 893847 893638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 893884 894270 gene locus_tag LOCUS_07530 893884 894270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_07530 894742 894347 gene locus_tag LOCUS_07540 894742 894347 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_07540 895203 894832 gene locus_tag LOCUS_07550 895203 894832 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035971.1 protein_id gnl|my_center|LOCUS_07550 895649 895350 gene locus_tag LOCUS_07560 895649 895350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_07560 895965 897221 gene locus_tag LOCUS_07570 895965 897221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962908.1 protein_id gnl|my_center|LOCUS_07570 897977 897714 gene locus_tag LOCUS_07580 897977 897714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 899828 898098 gene locus_tag LOCUS_07590 899828 898098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 901665 900088 gene locus_tag LOCUS_07600 901665 900088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 901870 903048 gene locus_tag LOCUS_07610 901870 903048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 903067 903993 gene locus_tag LOCUS_07620 903067 903993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 904720 904067 gene locus_tag LOCUS_07630 904720 904067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 906302 904713 gene locus_tag LOCUS_07640 906302 904713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 908059 906428 gene locus_tag LOCUS_07650 908059 906428 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962719.1 protein_id gnl|my_center|LOCUS_07650 908144 908479 gene locus_tag LOCUS_07660 gene phnA 908144 908479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357741.1 protein_id gnl|my_center|LOCUS_07660 908676 909224 gene locus_tag LOCUS_07670 908676 909224 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_07670 909221 910522 gene locus_tag LOCUS_07680 909221 910522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 910530 912863 gene locus_tag LOCUS_07690 910530 912863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 913370 912918 gene locus_tag LOCUS_07700 913370 912918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 914936 913506 gene locus_tag LOCUS_07710 914936 913506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 915848 914955 gene locus_tag LOCUS_07720 915848 914955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 916874 916116 gene locus_tag LOCUS_07730 916874 916116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 917660 917010 gene locus_tag LOCUS_07740 917660 917010 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_07740 919428 917650 gene locus_tag LOCUS_07750 919428 917650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 920647 919520 gene locus_tag LOCUS_07760 920647 919520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 922217 920721 gene locus_tag LOCUS_07770 gene mocR 922217 920721 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208163.1 protein_id gnl|my_center|LOCUS_07770 922310 922984 gene locus_tag LOCUS_07780 922310 922984 CDS product flavin-nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530752.1 protein_id gnl|my_center|LOCUS_07780 923523 923074 gene locus_tag LOCUS_07790 923523 923074 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292665.1 protein_id gnl|my_center|LOCUS_07790 923846 925066 gene locus_tag LOCUS_07800 gene rhlE 923846 925066 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948368.1 protein_id gnl|my_center|LOCUS_07800 925432 927183 gene locus_tag LOCUS_07810 925432 927183 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_07810 927719 927180 gene locus_tag LOCUS_07820 927719 927180 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384995.1 protein_id gnl|my_center|LOCUS_07820 928169 931786 gene locus_tag LOCUS_07830 928169 931786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 934052 931857 gene locus_tag LOCUS_07840 934052 931857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 935657 934257 gene locus_tag LOCUS_07850 935657 934257 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485353.1 protein_id gnl|my_center|LOCUS_07850 936184 935678 gene locus_tag LOCUS_07860 936184 935678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 936458 937021 gene locus_tag LOCUS_07870 936458 937021 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141762.1 protein_id gnl|my_center|LOCUS_07870 937023 937826 gene locus_tag LOCUS_07880 937023 937826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 938641 937823 gene locus_tag LOCUS_07890 938641 937823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 939823 938678 gene locus_tag LOCUS_07900 939823 938678 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_07900 940732 939851 gene locus_tag LOCUS_07910 gene psd 940732 939851 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RGF2 protein_id gnl|my_center|LOCUS_07910 941828 940764 gene locus_tag LOCUS_07920 941828 940764 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_07920 943372 941885 gene locus_tag LOCUS_07930 943372 941885 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948035.1 protein_id gnl|my_center|LOCUS_07930 944133 943774 gene locus_tag LOCUS_07940 944133 943774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 944507 944292 gene locus_tag LOCUS_07950 944507 944292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 945246 944806 gene locus_tag LOCUS_07960 945246 944806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence02 5396 486 gene locus_tag LOCUS_07970 5396 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 6830 6096 gene locus_tag LOCUS_07980 6830 6096 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_07980 7863 6823 gene locus_tag LOCUS_07990 7863 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 8701 7970 gene locus_tag LOCUS_08000 8701 7970 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785272.1 protein_id gnl|my_center|LOCUS_08000 9489 8836 gene locus_tag LOCUS_08010 9489 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 11226 10267 gene locus_tag LOCUS_08020 gene serA 11226 10267 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_08020 12316 11243 gene locus_tag LOCUS_08030 gene serC 12316 11243 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 protein_id gnl|my_center|LOCUS_08030 12591 13823 gene locus_tag LOCUS_08040 12591 13823 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_08040 13820 14278 gene locus_tag LOCUS_08050 13820 14278 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_08050 14788 14294 gene locus_tag LOCUS_08060 14788 14294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08060 15591 14788 gene locus_tag LOCUS_08070 15591 14788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08070 17017 15641 gene locus_tag LOCUS_08080 17017 15641 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_08080 17194 18447 gene locus_tag LOCUS_08090 17194 18447 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_08090 18454 19158 gene locus_tag LOCUS_08100 18454 19158 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_08100 19168 21582 gene locus_tag LOCUS_08110 19168 21582 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_08110 22621 21665 gene locus_tag LOCUS_08120 22621 21665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 22788 24047 gene locus_tag LOCUS_08130 gene lysC 22788 24047 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_08130 24953 24051 gene locus_tag LOCUS_08140 24953 24051 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_08140 27399 24970 gene locus_tag LOCUS_08150 gene pheT 27399 24970 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_08150 27550 28230 gene locus_tag LOCUS_08160 27550 28230 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_08160 28928 28227 gene locus_tag LOCUS_08170 28928 28227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 29695 28940 gene locus_tag LOCUS_08180 29695 28940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 30189 29680 gene locus_tag LOCUS_08190 30189 29680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 30437 31702 gene locus_tag LOCUS_08200 30437 31702 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_08200 32316 31699 gene locus_tag LOCUS_08210 32316 31699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761413.1 protein_id gnl|my_center|LOCUS_08210 33275 32313 gene locus_tag LOCUS_08220 gene purC 33275 32313 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_08220 34209 33265 gene locus_tag LOCUS_08230 34209 33265 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_08230 34333 35127 gene locus_tag LOCUS_08240 gene fjo14 34333 35127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_08240 35124 35417 gene locus_tag LOCUS_08250 gene fjo15 35124 35417 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_08250 35419 36150 gene locus_tag LOCUS_08260 gene gldF 35419 36150 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_08260 36150 37865 gene locus_tag LOCUS_08270 gene gldG 36150 37865 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_08270 37867 38886 gene locus_tag LOCUS_08280 37867 38886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 38971 40092 gene locus_tag LOCUS_08290 gene dnaN 38971 40092 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_08290 40113 40760 gene locus_tag LOCUS_08300 40113 40760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 40881 42512 gene locus_tag LOCUS_08310 gene pruA 40881 42512 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_08310 42742 43074 gene locus_tag LOCUS_08320 42742 43074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 43139 43900 gene locus_tag LOCUS_08330 43139 43900 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ21 protein_id gnl|my_center|LOCUS_08330 43921 44595 gene locus_tag LOCUS_08340 43921 44595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 46075 44600 gene locus_tag LOCUS_08350 46075 44600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_08350 46219 46470 gene locus_tag LOCUS_08360 gene rpmE 46219 46470 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_08360 46555 47724 gene locus_tag LOCUS_08370 46555 47724 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_08370 47815 50274 gene locus_tag LOCUS_08380 gene lon 47815 50274 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_08380 50457 50278 gene locus_tag LOCUS_08390 50457 50278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 50417 51370 gene locus_tag LOCUS_08400 gene porQ 50417 51370 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_08400 51433 52059 gene locus_tag LOCUS_08410 gene cmk 51433 52059 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 protein_id gnl|my_center|LOCUS_08410 52366 52052 gene locus_tag LOCUS_08420 52366 52052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 53059 52400 gene locus_tag LOCUS_08430 gene psd 53059 52400 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_08430 53883 53059 gene locus_tag LOCUS_08440 53883 53059 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0L5 protein_id gnl|my_center|LOCUS_08440 54512 53883 gene locus_tag LOCUS_08450 54512 53883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_08450 56608 54545 gene locus_tag LOCUS_08460 gene ftsH 56608 54545 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_08460 57001 56636 gene locus_tag LOCUS_08470 gene rsfS 57001 56636 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_08470 57078 57830 gene locus_tag LOCUS_08480 57078 57830 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_08480 58209 57817 gene locus_tag LOCUS_08490 58209 57817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 58878 58228 gene locus_tag LOCUS_08500 gene pyrE 58878 58228 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 protein_id gnl|my_center|LOCUS_08500 58877 59491 gene locus_tag LOCUS_08510 58877 59491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 59938 59483 gene locus_tag LOCUS_08520 gene coaD 59938 59483 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_08520 60920 59940 gene locus_tag LOCUS_08530 gene ddl 60920 59940 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD5 protein_id gnl|my_center|LOCUS_08530 61092 61427 gene locus_tag LOCUS_08540 61092 61427 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809059.1 protein_id gnl|my_center|LOCUS_08540 61437 62492 gene locus_tag LOCUS_08550 61437 62492 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_08550 63352 62498 gene locus_tag LOCUS_08560 63352 62498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_08560 64478 63396 gene locus_tag LOCUS_08570 gene dinB2 64478 63396 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_08570 64594 65031 gene locus_tag LOCUS_08580 64594 65031 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_08580 66820 65033 gene locus_tag LOCUS_08590 66820 65033 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258464.1 protein_id gnl|my_center|LOCUS_08590 67653 67027 gene locus_tag LOCUS_08600 67653 67027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 68639 67725 gene locus_tag LOCUS_08610 68639 67725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 68730 70280 gene locus_tag LOCUS_08620 68730 70280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 71068 70277 gene locus_tag LOCUS_08630 71068 70277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 72386 71100 gene locus_tag LOCUS_08640 gene hemL 72386 71100 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW4 protein_id gnl|my_center|LOCUS_08640 73525 72548 gene locus_tag LOCUS_08650 gene hemB 73525 72548 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_08650 74427 73525 gene locus_tag LOCUS_08660 gene hemF 74427 73525 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_08660 75456 74428 gene locus_tag LOCUS_08670 gene hemE 75456 74428 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 protein_id gnl|my_center|LOCUS_08670 76156 75443 gene locus_tag LOCUS_08680 76156 75443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 77060 76158 gene locus_tag LOCUS_08690 gene hemC 77060 76158 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP0 protein_id gnl|my_center|LOCUS_08690 78322 77072 gene locus_tag LOCUS_08700 gene hemA 78322 77072 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 protein_id gnl|my_center|LOCUS_08700 78513 79433 gene locus_tag LOCUS_08710 78513 79433 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_08710 79426 80451 gene locus_tag LOCUS_08720 gene hemH 79426 80451 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_08720 80486 81211 gene locus_tag LOCUS_08730 80486 81211 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975024.1 protein_id gnl|my_center|LOCUS_08730 82461 81292 gene locus_tag LOCUS_08740 82461 81292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107664.1 protein_id gnl|my_center|LOCUS_08740 83189 82473 gene locus_tag LOCUS_08750 83189 82473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 85232 83274 gene locus_tag LOCUS_08760 85232 83274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 86316 85261 gene locus_tag LOCUS_08770 86316 85261 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202126.1 protein_id gnl|my_center|LOCUS_08770 86944 86357 gene locus_tag LOCUS_08780 86944 86357 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_08780 87369 89162 gene locus_tag LOCUS_08790 87369 89162 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_08790 89388 90290 gene locus_tag LOCUS_08800 89388 90290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 90514 91689 gene locus_tag LOCUS_08810 90514 91689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 92058 93359 gene locus_tag LOCUS_08820 92058 93359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 93541 94011 gene locus_tag LOCUS_08830 93541 94011 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_08830 94008 95723 gene locus_tag LOCUS_08840 94008 95723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 95881 96321 gene locus_tag LOCUS_08850 95881 96321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_08850 96329 96502 gene locus_tag LOCUS_08860 96329 96502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 96526 96879 gene locus_tag LOCUS_08870 96526 96879 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_08870 96944 97465 gene locus_tag LOCUS_08880 96944 97465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 97515 98564 gene locus_tag LOCUS_08890 97515 98564 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990135.1 protein_id gnl|my_center|LOCUS_08890 98561 99226 gene locus_tag LOCUS_08900 98561 99226 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 protein_id gnl|my_center|LOCUS_08900 99723 99223 gene locus_tag LOCUS_08910 99723 99223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681855.1 protein_id gnl|my_center|LOCUS_08910 100287 99733 gene locus_tag LOCUS_08920 100287 99733 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948547.1 protein_id gnl|my_center|LOCUS_08920 100597 100782 gene locus_tag LOCUS_08930 100597 100782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 101533 101137 gene locus_tag LOCUS_tm00010 101533 101137 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 101615 102820 gene locus_tag LOCUS_08940 101615 102820 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_08940 102896 103717 gene locus_tag LOCUS_08950 102896 103717 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784029.1 protein_id gnl|my_center|LOCUS_08950 103710 104669 gene locus_tag LOCUS_08960 103710 104669 CDS product hemolysin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_08960 105320 104673 gene locus_tag LOCUS_08970 gene rpe 105320 104673 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_08970 106289 105426 gene locus_tag LOCUS_08980 gene rpoD 106289 105426 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_08980 108493 106367 gene locus_tag LOCUS_08990 gene pnp 108493 106367 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_08990 108844 108575 gene locus_tag LOCUS_09000 gene rpsO 108844 108575 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A418 protein_id gnl|my_center|LOCUS_09000 109781 108906 gene locus_tag LOCUS_09010 gene accD 109781 108906 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_09010 110915 109851 gene locus_tag LOCUS_09020 110915 109851 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_09020 113164 110975 gene locus_tag LOCUS_09030 113164 110975 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_09030 113386 114027 gene locus_tag LOCUS_09040 113386 114027 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_09040 114863 114024 gene locus_tag LOCUS_09050 114863 114024 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262934.1 protein_id gnl|my_center|LOCUS_09050 116470 114893 gene locus_tag LOCUS_09060 116470 114893 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_09060 117203 116478 gene locus_tag LOCUS_09070 gene porT 117203 116478 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_09070 117932 117207 gene locus_tag LOCUS_09080 gene menG 117932 117207 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_09080 119776 117968 gene locus_tag LOCUS_09090 119776 117968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 120806 119766 gene locus_tag LOCUS_09100 120806 119766 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108790.1 protein_id gnl|my_center|LOCUS_09100 121419 120808 gene locus_tag LOCUS_09110 121419 120808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_09110 122616 121420 gene locus_tag LOCUS_09120 gene aspC1 122616 121420 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_09120 122779 123231 gene locus_tag LOCUS_09130 122779 123231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_09130 123587 125722 gene locus_tag LOCUS_09140 123587 125722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 125737 127470 gene locus_tag LOCUS_09150 125737 127470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 128522 127509 gene locus_tag LOCUS_09160 gene argK 128522 127509 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962733.1 protein_id gnl|my_center|LOCUS_09160 128847 128524 gene locus_tag LOCUS_09170 128847 128524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 130990 128852 gene locus_tag LOCUS_09180 gene mutB 130990 128852 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 protein_id gnl|my_center|LOCUS_09180 132357 130987 gene locus_tag LOCUS_09190 132357 130987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 132707 133096 gene locus_tag LOCUS_09200 132707 133096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 133077 134279 gene locus_tag LOCUS_09210 133077 134279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 134269 134670 gene locus_tag LOCUS_09220 134269 134670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 134927 134709 gene locus_tag LOCUS_09230 134927 134709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 136899 135100 gene locus_tag LOCUS_09240 136899 135100 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_09240 137016 138695 gene locus_tag LOCUS_09250 gene snf 137016 138695 CDS product sodium:calcium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_09250 138692 138835 gene locus_tag LOCUS_09260 138692 138835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 138845 139918 gene locus_tag LOCUS_09270 138845 139918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 139948 141120 gene locus_tag LOCUS_09280 139948 141120 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_09280 141212 141403 gene locus_tag LOCUS_09290 gene rpsU 141212 141403 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_09290 141467 142360 gene locus_tag LOCUS_09300 gene xerC 141467 142360 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 protein_id gnl|my_center|LOCUS_09300 142366 142668 gene locus_tag LOCUS_09310 142366 142668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_09310 142764 142838 gene locus_tag LOCUS_t00120 142764 142838 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 142889 142971 gene locus_tag LOCUS_t00130 142889 142971 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 143018 143092 gene locus_tag LOCUS_t00140 143018 143092 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 143226 143298 gene locus_tag LOCUS_t00150 143226 143298 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 143359 144546 gene locus_tag LOCUS_09320 gene tuf 143359 144546 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU7 protein_id gnl|my_center|LOCUS_09320 144639 144712 gene locus_tag LOCUS_t00160 144639 144712 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 144944 145495 gene locus_tag LOCUS_09330 gene nusG 144944 145495 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU5 protein_id gnl|my_center|LOCUS_09330 145591 146028 gene locus_tag LOCUS_09340 gene rplK 145591 146028 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU4 protein_id gnl|my_center|LOCUS_09340 146052 146741 gene locus_tag LOCUS_09350 gene rplA 146052 146741 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU3 protein_id gnl|my_center|LOCUS_09350 146754 147278 gene locus_tag LOCUS_09360 gene rplJ 146754 147278 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU2 protein_id gnl|my_center|LOCUS_09360 147346 147726 gene locus_tag LOCUS_09370 gene rplL 147346 147726 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU1 protein_id gnl|my_center|LOCUS_09370 147834 151655 gene locus_tag LOCUS_09380 gene rpoB 147834 151655 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU0 protein_id gnl|my_center|LOCUS_09380 151687 156003 gene locus_tag LOCUS_09390 gene rpoC 151687 156003 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT9 protein_id gnl|my_center|LOCUS_09390 156003 156332 gene locus_tag LOCUS_09400 156003 156332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_09400 156580 157485 gene locus_tag LOCUS_09410 156580 157485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 158923 157610 gene locus_tag LOCUS_09420 158923 157610 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107462.1 protein_id gnl|my_center|LOCUS_09420 159285 158920 gene locus_tag LOCUS_09430 159285 158920 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_09430 160194 159445 gene locus_tag LOCUS_09440 160194 159445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083293.1 protein_id gnl|my_center|LOCUS_09440 160280 161050 gene locus_tag LOCUS_09450 gene surE 160280 161050 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_09450 161469 162578 gene locus_tag LOCUS_09460 gene lpxB 161469 162578 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_09460 162565 163764 gene locus_tag LOCUS_09470 162565 163764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 164930 163995 gene locus_tag LOCUS_09480 164930 163995 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_09480 165832 164936 gene locus_tag LOCUS_09490 gene rimK 165832 164936 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_09490 166260 165829 gene locus_tag LOCUS_09500 gene rimK2 166260 165829 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_09500 169982 166323 gene locus_tag LOCUS_09510 169982 166323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 170643 170119 gene locus_tag LOCUS_09520 170643 170119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 171522 170965 gene locus_tag LOCUS_09530 171522 170965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 171930 172673 gene locus_tag LOCUS_09540 171930 172673 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_09540 172787 174640 gene locus_tag LOCUS_09550 172787 174640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 174777 176687 gene locus_tag LOCUS_09560 174777 176687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 178063 176765 gene locus_tag LOCUS_09570 178063 176765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 181211 178053 gene locus_tag LOCUS_09580 181211 178053 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_09580 182334 181213 gene locus_tag LOCUS_09590 182334 181213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 182742 182338 gene locus_tag LOCUS_09600 182742 182338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 183454 184221 gene locus_tag LOCUS_09610 183454 184221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 184223 186550 gene locus_tag LOCUS_09620 184223 186550 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_09620 186534 187286 gene locus_tag LOCUS_09630 186534 187286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 188656 187316 gene locus_tag LOCUS_09640 188656 187316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 189029 190138 gene locus_tag LOCUS_09650 189029 190138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 190319 191026 gene locus_tag LOCUS_09660 190319 191026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 191252 191178 gene locus_tag LOCUS_t00170 191252 191178 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 191605 191294 gene locus_tag LOCUS_09670 191605 191294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 192179 191565 gene locus_tag LOCUS_09680 gene plsY 192179 191565 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WTS7 protein_id gnl|my_center|LOCUS_09680 194477 192231 gene locus_tag LOCUS_09690 gene purL 194477 192231 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD17 protein_id gnl|my_center|LOCUS_09690 196967 194694 gene locus_tag LOCUS_09700 gene acnA 196967 194694 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_09700 198455 197115 gene locus_tag LOCUS_09710 gene purB 198455 197115 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_09710 198507 199265 gene locus_tag LOCUS_09720 gene cysZ 198507 199265 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I595 protein_id gnl|my_center|LOCUS_09720 200439 199273 gene locus_tag LOCUS_09730 200439 199273 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_09730 200884 200429 gene locus_tag LOCUS_09740 200884 200429 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_09740 200939 201949 gene locus_tag LOCUS_09750 gene holA 200939 201949 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_09750 202005 204344 gene locus_tag LOCUS_09760 202005 204344 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404901.1 protein_id gnl|my_center|LOCUS_09760 205079 204360 gene locus_tag LOCUS_09770 205079 204360 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_09770 205271 207547 gene locus_tag LOCUS_09780 205271 207547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 209302 207578 gene locus_tag LOCUS_09790 209302 207578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 209471 210409 gene locus_tag LOCUS_09800 209471 210409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_09800 210587 210661 gene locus_tag LOCUS_t00180 210587 210661 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 211075 211593 gene locus_tag LOCUS_09810 211075 211593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 211679 212395 gene locus_tag LOCUS_09820 211679 212395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 212720 213937 gene locus_tag LOCUS_09830 212720 213937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 214272 214979 gene locus_tag LOCUS_09840 214272 214979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 215419 215054 gene locus_tag LOCUS_09850 215419 215054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_09850 215525 216403 gene locus_tag LOCUS_09860 215525 216403 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_09860 216539 218710 gene locus_tag LOCUS_09870 gene recQ 216539 218710 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957598.1 protein_id gnl|my_center|LOCUS_09870 218742 219611 gene locus_tag LOCUS_09880 218742 219611 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_09880 220803 219613 gene locus_tag LOCUS_09890 220803 219613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 220902 221483 gene locus_tag LOCUS_09900 220902 221483 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_09900 221595 223382 gene locus_tag LOCUS_09910 gene yfbS 221595 223382 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261126.1 protein_id gnl|my_center|LOCUS_09910 223382 223987 gene locus_tag LOCUS_09920 gene cysC 223382 223987 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJA6 protein_id gnl|my_center|LOCUS_09920 223991 224893 gene locus_tag LOCUS_09930 gene cysD 223991 224893 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_09930 224942 226204 gene locus_tag LOCUS_09940 gene cysN 224942 226204 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_09940 226365 227075 gene locus_tag LOCUS_09950 226365 227075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 227083 229551 gene locus_tag LOCUS_09960 gene wzc 227083 229551 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_09960 229642 230925 gene locus_tag LOCUS_09970 229642 230925 CDS product UDP-glucose/GDP-mannose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 protein_id gnl|my_center|LOCUS_09970 230912 231943 gene locus_tag LOCUS_09980 230912 231943 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_09980 231990 232967 gene locus_tag LOCUS_09990 231990 232967 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807052.1 protein_id gnl|my_center|LOCUS_09990 232980 234104 gene locus_tag LOCUS_10000 232980 234104 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 protein_id gnl|my_center|LOCUS_10000 234105 236006 gene locus_tag LOCUS_10010 gene asnB-1 234105 236006 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772517.1 protein_id gnl|my_center|LOCUS_10010 236065 236514 gene locus_tag LOCUS_10020 236065 236514 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957834.1 protein_id gnl|my_center|LOCUS_10020 236575 237750 gene locus_tag LOCUS_10030 gene wbpG 236575 237750 CDS product LPS biosynthesis protein WbpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_10030 237754 238377 gene locus_tag LOCUS_10040 gene hisH2 237754 238377 CDS product imidazole glycerol phosphate synthase subunit HisH 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72138 protein_id gnl|my_center|LOCUS_10040 238431 239144 gene locus_tag LOCUS_10050 gene hisF2 238431 239144 CDS product putative imidazole glycerol phosphate synthase subunit hisF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72139 protein_id gnl|my_center|LOCUS_10050 239147 239857 gene locus_tag LOCUS_10060 239147 239857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 239850 240755 gene locus_tag LOCUS_10070 gene lpxD1 239850 240755 CDS product UDP-3-O-acylglucosamine N-acyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NI06 protein_id gnl|my_center|LOCUS_10070 240772 241188 gene locus_tag LOCUS_10080 240772 241188 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775533.1 protein_id gnl|my_center|LOCUS_10080 241169 242755 gene locus_tag LOCUS_10090 241169 242755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202156.1 protein_id gnl|my_center|LOCUS_10090 242752 242973 gene locus_tag LOCUS_10100 242752 242973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 242992 244161 gene locus_tag LOCUS_10110 242992 244161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 244161 245456 gene locus_tag LOCUS_10120 244161 245456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 245453 246571 gene locus_tag LOCUS_10130 gene capI 245453 246571 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 protein_id gnl|my_center|LOCUS_10130 246574 247707 gene locus_tag LOCUS_10140 246574 247707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 247763 248779 gene locus_tag LOCUS_10150 247763 248779 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_10150 248786 249184 gene locus_tag LOCUS_10160 248786 249184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 249186 249944 gene locus_tag LOCUS_10170 249186 249944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 250047 251141 gene locus_tag LOCUS_10180 250047 251141 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202631.1 protein_id gnl|my_center|LOCUS_10180 251270 252385 gene locus_tag LOCUS_10190 251270 252385 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_10190 252387 253565 gene locus_tag LOCUS_10200 252387 253565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 253888 254898 gene locus_tag LOCUS_10210 gene wbjB 253888 254898 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942886.1 protein_id gnl|my_center|LOCUS_10210 254895 256013 gene locus_tag LOCUS_10220 gene capF 254895 256013 CDS product capsular polysaccharide biosynthesis protein CapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028283.1 protein_id gnl|my_center|LOCUS_10220 256032 257162 gene locus_tag LOCUS_10230 gene fnlC 256032 257162 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963417.1 protein_id gnl|my_center|LOCUS_10230 257150 258370 gene locus_tag LOCUS_10240 257150 258370 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_10240 258810 259328 gene locus_tag LOCUS_10250 258810 259328 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_10250 259325 260509 gene locus_tag LOCUS_10260 259325 260509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 260511 261662 gene locus_tag LOCUS_10270 260511 261662 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202265.1 protein_id gnl|my_center|LOCUS_10270 261788 263725 gene locus_tag LOCUS_10280 261788 263725 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_10280 263718 265325 gene locus_tag LOCUS_10290 263718 265325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 265328 265903 gene locus_tag LOCUS_10300 265328 265903 CDS product exosortase family protein XrtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964136.1 protein_id gnl|my_center|LOCUS_10300 266409 267089 gene locus_tag LOCUS_10310 266409 267089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_10310 267108 268343 gene locus_tag LOCUS_10320 267108 268343 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_10320 268351 269616 gene locus_tag LOCUS_10330 268351 269616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_10330 269634 270722 gene locus_tag LOCUS_10340 269634 270722 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_10340 270876 270724 gene locus_tag LOCUS_10350 270876 270724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 271306 270869 gene locus_tag LOCUS_10360 271306 270869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 272222 271371 gene locus_tag LOCUS_10370 272222 271371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_10370 272341 273021 gene locus_tag LOCUS_10380 272341 273021 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122143.1 protein_id gnl|my_center|LOCUS_10380 273097 273795 gene locus_tag LOCUS_10390 gene radC 273097 273795 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_10390 273816 275120 gene locus_tag LOCUS_10400 273816 275120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255207.1 protein_id gnl|my_center|LOCUS_10400 275117 276028 gene locus_tag LOCUS_10410 275117 276028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 276025 276720 gene locus_tag LOCUS_10420 276025 276720 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_10420 277153 276722 gene locus_tag LOCUS_10430 277153 276722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 277499 279142 gene locus_tag LOCUS_10440 277499 279142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 279241 282651 gene locus_tag LOCUS_10450 gene icmF 279241 282651 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_10450 285003 282670 gene locus_tag LOCUS_10460 285003 282670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 285318 285659 gene locus_tag LOCUS_10470 285318 285659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223901.1 protein_id gnl|my_center|LOCUS_10470 285720 286949 gene locus_tag LOCUS_10480 285720 286949 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117973.1 protein_id gnl|my_center|LOCUS_10480 289632 286939 gene locus_tag LOCUS_10490 289632 286939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 289775 292855 gene locus_tag LOCUS_10500 289775 292855 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_10500 292930 293232 gene locus_tag LOCUS_10510 292930 293232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 293238 294176 gene locus_tag LOCUS_10520 gene yrbG 293238 294176 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_10520 294290 296476 gene locus_tag LOCUS_10530 gene glnA 294290 296476 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_10530 296640 299174 gene locus_tag LOCUS_10540 296640 299174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 299243 300418 gene locus_tag LOCUS_10550 gene purM 299243 300418 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_10550 300430 301503 gene locus_tag LOCUS_10560 gene prfA 300430 301503 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_10560 301508 302323 gene locus_tag LOCUS_10570 gene pyrF 301508 302323 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_10570 302769 302320 gene locus_tag LOCUS_10580 302769 302320 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_10580 303038 304315 gene locus_tag LOCUS_10590 303038 304315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_10590 304656 305546 gene locus_tag LOCUS_10600 304656 305546 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_10600 305720 306628 gene locus_tag LOCUS_10610 305720 306628 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_10610 307001 309847 gene locus_tag LOCUS_10620 gene carB 307001 309847 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_10620 309855 310100 gene locus_tag LOCUS_10630 309855 310100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 310275 312791 gene locus_tag LOCUS_10640 310275 312791 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_10640 312891 314093 gene locus_tag LOCUS_10650 312891 314093 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_10650 314090 315229 gene locus_tag LOCUS_10660 314090 315229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 315844 315209 gene locus_tag LOCUS_10670 315844 315209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 316061 317137 gene locus_tag LOCUS_10680 316061 317137 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_10680 317201 318691 gene locus_tag LOCUS_10690 317201 318691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963503.1 protein_id gnl|my_center|LOCUS_10690 320047 318704 gene locus_tag LOCUS_10700 320047 318704 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582954.1 protein_id gnl|my_center|LOCUS_10700 321249 320047 gene locus_tag LOCUS_10710 321249 320047 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987001.1 protein_id gnl|my_center|LOCUS_10710 322149 321253 gene locus_tag LOCUS_10720 322149 321253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 322994 322152 gene locus_tag LOCUS_10730 322994 322152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 324336 323122 gene locus_tag LOCUS_10740 324336 323122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 324830 324390 gene locus_tag LOCUS_10750 324830 324390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_10750 325759 324827 gene locus_tag LOCUS_10760 gene yfkH 325759 324827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_10760 326612 325764 gene locus_tag LOCUS_10770 326612 325764 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_10770 326716 327189 gene locus_tag LOCUS_10780 gene rlmH 326716 327189 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_10780 327167 327784 gene locus_tag LOCUS_10790 327167 327784 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_10790 328334 327738 gene locus_tag LOCUS_10800 328334 327738 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_10800 329214 328354 gene locus_tag LOCUS_10810 329214 328354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 protein_id gnl|my_center|LOCUS_10810 329806 329198 gene locus_tag LOCUS_10820 329806 329198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 329910 331337 gene locus_tag LOCUS_10830 329910 331337 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_10830 331541 332026 gene locus_tag LOCUS_10840 331541 332026 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_10840 332037 333536 gene locus_tag LOCUS_10850 332037 333536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 334999 333533 gene locus_tag LOCUS_10860 334999 333533 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787747.1 protein_id gnl|my_center|LOCUS_10860 336341 334992 gene locus_tag LOCUS_10870 336341 334992 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_10870 337600 336341 gene locus_tag LOCUS_10880 337600 336341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 338055 339653 gene locus_tag LOCUS_10890 338055 339653 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293016.1 protein_id gnl|my_center|LOCUS_10890 339689 340897 gene locus_tag LOCUS_10900 339689 340897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 protein_id gnl|my_center|LOCUS_10900 341242 340880 gene locus_tag LOCUS_10910 341242 340880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207903.1 protein_id gnl|my_center|LOCUS_10910 341490 341281 gene locus_tag LOCUS_10920 341490 341281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 343707 341506 gene locus_tag LOCUS_10930 gene recQ1 343707 341506 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 protein_id gnl|my_center|LOCUS_10930 343851 344681 gene locus_tag LOCUS_10940 gene tatC 343851 344681 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_10940 344721 345452 gene locus_tag LOCUS_10950 gene lptB 344721 345452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_10950 346658 345699 gene locus_tag LOCUS_10960 gene sua5 346658 345699 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAV8 protein_id gnl|my_center|LOCUS_10960 347614 346658 gene locus_tag LOCUS_10970 347614 346658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 348821 347622 gene locus_tag LOCUS_10980 348821 347622 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_10980 349081 350436 gene locus_tag LOCUS_10990 gene nqrA 349081 350436 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_10990 350455 351645 gene locus_tag LOCUS_11000 gene nqrB 350455 351645 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K8 protein_id gnl|my_center|LOCUS_11000 351648 352448 gene locus_tag LOCUS_11010 gene nqrC 351648 352448 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 protein_id gnl|my_center|LOCUS_11010 352448 353119 gene locus_tag LOCUS_11020 gene nqrD 352448 353119 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 protein_id gnl|my_center|LOCUS_11020 353139 353756 gene locus_tag LOCUS_11030 gene nqrE 353139 353756 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR7 protein_id gnl|my_center|LOCUS_11030 353784 355094 gene locus_tag LOCUS_11040 gene nqrF 353784 355094 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_11040 356558 355134 gene locus_tag LOCUS_11050 356558 355134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 356636 357646 gene locus_tag LOCUS_11060 356636 357646 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_11060 357986 357786 gene locus_tag LOCUS_11070 357986 357786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 359046 358030 gene locus_tag LOCUS_11080 gene murB 359046 358030 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_11080 360222 359056 gene locus_tag LOCUS_11090 gene aspC2 360222 359056 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_11090 360777 360328 gene locus_tag LOCUS_11100 360777 360328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962565.1 protein_id gnl|my_center|LOCUS_11100 360939 363572 gene locus_tag LOCUS_11110 gene valS 360939 363572 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H092 protein_id gnl|my_center|LOCUS_11110 365966 363579 gene locus_tag LOCUS_11120 365966 363579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 366734 365970 gene locus_tag LOCUS_11130 366734 365970 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762416.1 protein_id gnl|my_center|LOCUS_11130 368043 366676 gene locus_tag LOCUS_11140 368043 366676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 369715 368123 gene locus_tag LOCUS_11150 369715 368123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 370455 369775 gene locus_tag LOCUS_11160 gene ung2 370455 369775 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_11160 370690 371034 gene locus_tag LOCUS_11170 gene ytxJ 370690 371034 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_11170 371027 371794 gene locus_tag LOCUS_11180 371027 371794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 371800 372672 gene locus_tag LOCUS_11190 gene lipA 371800 372672 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_11190 372736 375927 gene locus_tag LOCUS_11200 372736 375927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 376049 376813 gene locus_tag LOCUS_11210 376049 376813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 376871 377452 gene locus_tag LOCUS_11220 gene miaE 376871 377452 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_11220 377494 377892 gene locus_tag LOCUS_11230 377494 377892 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_11230 377914 378993 gene locus_tag LOCUS_11240 gene gcvT 377914 378993 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_11240 380522 379068 gene locus_tag LOCUS_11250 gene gapA2 380522 379068 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX7 protein_id gnl|my_center|LOCUS_11250 382096 380648 gene locus_tag LOCUS_11260 382096 380648 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_11260 382209 382985 gene locus_tag LOCUS_11270 gene dapF 382209 382985 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_11270 382982 383509 gene locus_tag LOCUS_11280 382982 383509 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_11280 383512 385464 gene locus_tag LOCUS_11290 383512 385464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 388071 385456 gene locus_tag LOCUS_11300 gene clpB 388071 385456 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0F9 protein_id gnl|my_center|LOCUS_11300 393074 388227 gene locus_tag LOCUS_11310 393074 388227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 393789 393178 gene locus_tag LOCUS_11320 393789 393178 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_11320 394553 393786 gene locus_tag LOCUS_11330 394553 393786 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_11330 395893 394553 gene locus_tag LOCUS_11340 gene bfmBB 395893 394553 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_11340 397977 396013 gene locus_tag LOCUS_11350 397977 396013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 399293 397974 gene locus_tag LOCUS_11360 399293 397974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 399975 399346 gene locus_tag LOCUS_11370 gene recR 399975 399346 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_11370 400098 401486 gene locus_tag LOCUS_11380 400098 401486 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767085.1 protein_id gnl|my_center|LOCUS_11380 406434 401539 gene locus_tag LOCUS_11390 406434 401539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 406676 409075 gene locus_tag LOCUS_11400 406676 409075 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_11400 409180 410907 gene locus_tag LOCUS_11410 409180 410907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 411661 410876 gene locus_tag LOCUS_11420 411661 410876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143505.1 protein_id gnl|my_center|LOCUS_11420 412682 411717 gene locus_tag LOCUS_11430 412682 411717 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_11430 413854 412694 gene locus_tag LOCUS_11440 413854 412694 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119788.1 protein_id gnl|my_center|LOCUS_11440 414791 413862 gene locus_tag LOCUS_11450 414791 413862 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_11450 416527 414866 gene locus_tag LOCUS_11460 416527 414866 CDS product fused response regulator/thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_11460 417948 416548 gene locus_tag LOCUS_11470 417948 416548 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223372.1 protein_id gnl|my_center|LOCUS_11470 420430 418091 gene locus_tag LOCUS_11480 420430 418091 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_11480 421810 420551 gene locus_tag LOCUS_11490 gene rodA 421810 420551 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_11490 423663 421807 gene locus_tag LOCUS_11500 gene pbpA 423663 421807 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_11500 424170 423667 gene locus_tag LOCUS_11510 424170 423667 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_11510 424895 424182 gene locus_tag LOCUS_11520 gene mreC 424895 424182 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 protein_id gnl|my_center|LOCUS_11520 426044 425019 gene locus_tag LOCUS_11530 gene mreB 426044 425019 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_11530 427561 426050 gene locus_tag LOCUS_11540 gene purH 427561 426050 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NT9 protein_id gnl|my_center|LOCUS_11540 427652 428914 gene locus_tag LOCUS_11550 427652 428914 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_11550 429386 428895 gene locus_tag LOCUS_11560 429386 428895 CDS product GAF domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_11560 429637 429383 gene locus_tag LOCUS_11570 429637 429383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 429929 432679 gene locus_tag LOCUS_11580 429929 432679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 432689 434197 gene locus_tag LOCUS_11590 432689 434197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 434851 434276 gene locus_tag LOCUS_11600 434851 434276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962189.1 protein_id gnl|my_center|LOCUS_11600 435009 435674 gene locus_tag LOCUS_11610 435009 435674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_11610 435671 436981 gene locus_tag LOCUS_11620 435671 436981 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_11620 437087 438172 gene locus_tag LOCUS_11630 gene bioF 437087 438172 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_11630 438169 438810 gene locus_tag LOCUS_11640 gene bioD 438169 438810 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_11640 438797 440089 gene locus_tag LOCUS_11650 gene bioA 438797 440089 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_11650 440093 441241 gene locus_tag LOCUS_11660 440093 441241 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964416.1 protein_id gnl|my_center|LOCUS_11660 441245 442315 gene locus_tag LOCUS_11670 gene bioB 441245 442315 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_11670 443499 442360 gene locus_tag LOCUS_11680 443499 442360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 444645 443557 gene locus_tag LOCUS_11690 444645 443557 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_11690 445537 444647 gene locus_tag LOCUS_11700 445537 444647 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_11700 446296 445544 gene locus_tag LOCUS_11710 446296 445544 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_11710 448122 446296 gene locus_tag LOCUS_11720 gene mutL 448122 446296 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_11720 448397 448122 gene locus_tag LOCUS_11730 448397 448122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 448694 451570 gene locus_tag LOCUS_11740 448694 451570 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_11740 451527 452183 gene locus_tag LOCUS_11750 451527 452183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 452208 453341 gene locus_tag LOCUS_11760 452208 453341 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_11760 453696 453343 gene locus_tag LOCUS_11770 453696 453343 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_11770 454649 453693 gene locus_tag LOCUS_11780 454649 453693 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_11780 455535 454609 gene locus_tag LOCUS_11790 455535 454609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993022.1 protein_id gnl|my_center|LOCUS_11790 455612 457588 gene locus_tag LOCUS_11800 gene bfmBA 455612 457588 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_11800 458489 457596 gene locus_tag LOCUS_11810 gene xerD 458489 457596 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_11810 458531 458953 gene locus_tag LOCUS_11820 gene aroQ 458531 458953 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3W2 protein_id gnl|my_center|LOCUS_11820 459984 458941 gene locus_tag LOCUS_11830 459984 458941 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_11830 460738 459977 gene locus_tag LOCUS_11840 460738 459977 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_11840 462317 460854 gene locus_tag LOCUS_11850 462317 460854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 462464 462549 gene locus_tag LOCUS_t00190 462464 462549 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 463306 462611 gene locus_tag LOCUS_11860 463306 462611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 463928 463320 gene locus_tag LOCUS_11870 463928 463320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 464389 465213 gene locus_tag LOCUS_11880 464389 465213 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_11880 465641 465210 gene locus_tag LOCUS_11890 465641 465210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 466475 465699 gene locus_tag LOCUS_11900 466475 465699 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_11900 467661 466486 gene locus_tag LOCUS_11910 467661 466486 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_11910 467832 469946 gene locus_tag LOCUS_11920 467832 469946 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762019.1 protein_id gnl|my_center|LOCUS_11920 470056 470144 gene locus_tag LOCUS_t00200 470056 470144 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 470197 470271 gene locus_tag LOCUS_t00210 470197 470271 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 472494 470983 gene locus_tag LOCUS_11930 472494 470983 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 protein_id gnl|my_center|LOCUS_11930 472706 472497 gene locus_tag LOCUS_11940 472706 472497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107822.1 protein_id gnl|my_center|LOCUS_11940 473314 472778 gene locus_tag LOCUS_11950 473314 472778 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_11950 474712 473813 gene locus_tag LOCUS_11960 474712 473813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence03 389 102 gene locus_tag LOCUS_11970 389 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 578 393 gene locus_tag LOCUS_11980 578 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 896 582 gene locus_tag LOCUS_11990 896 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1147 893 gene locus_tag LOCUS_12000 1147 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1215 1625 gene locus_tag LOCUS_12010 1215 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1735 2115 gene locus_tag LOCUS_12020 1735 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2199 2801 gene locus_tag LOCUS_12030 2199 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2798 3046 gene locus_tag LOCUS_12040 2798 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3063 3575 gene locus_tag LOCUS_12050 3063 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3591 4436 gene locus_tag LOCUS_12060 3591 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546359.1 protein_id gnl|my_center|LOCUS_12060 4455 5573 gene locus_tag LOCUS_12070 4455 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 5555 6298 gene locus_tag LOCUS_12080 5555 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_12080 8853 7537 gene locus_tag LOCUS_12090 8853 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 9071 8997 gene locus_tag LOCUS_t00220 9071 8997 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14154 9181 gene locus_tag LOCUS_12100 14154 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 14418 15032 gene locus_tag LOCUS_12110 14418 15032 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_12110 15399 14995 gene locus_tag LOCUS_12120 15399 14995 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_12120 17102 15402 gene locus_tag LOCUS_12130 gene msbA 17102 15402 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_12130 18259 17390 gene locus_tag LOCUS_12140 18259 17390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 18744 18262 gene locus_tag LOCUS_12150 18744 18262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 20147 18756 gene locus_tag LOCUS_12160 20147 18756 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769373.1 protein_id gnl|my_center|LOCUS_12160 23295 20152 gene locus_tag LOCUS_12170 23295 20152 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_12170 26244 23404 gene locus_tag LOCUS_12180 26244 23404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 26964 26269 gene locus_tag LOCUS_12190 26964 26269 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107446.1 protein_id gnl|my_center|LOCUS_12190 27090 28073 gene locus_tag LOCUS_12200 gene pfkA 27090 28073 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_12200 28086 29078 gene locus_tag LOCUS_12210 gene gapA 28086 29078 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCE2 protein_id gnl|my_center|LOCUS_12210 29131 30018 gene locus_tag LOCUS_12220 29131 30018 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_12220 30015 30677 gene locus_tag LOCUS_12230 gene pgmB2 30015 30677 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_12230 30667 32982 gene locus_tag LOCUS_12240 30667 32982 CDS product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_12240 32979 35306 gene locus_tag LOCUS_12250 32979 35306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 35309 36703 gene locus_tag LOCUS_12260 35309 36703 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 protein_id gnl|my_center|LOCUS_12260 36780 38174 gene locus_tag LOCUS_12270 36780 38174 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_12270 39906 38176 gene locus_tag LOCUS_12280 39906 38176 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405126.1 protein_id gnl|my_center|LOCUS_12280 40151 41821 gene locus_tag LOCUS_12290 40151 41821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 41941 42525 gene locus_tag LOCUS_12300 41941 42525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 42573 43058 gene locus_tag LOCUS_12310 42573 43058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 43108 43758 gene locus_tag LOCUS_12320 43108 43758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 44264 43809 gene locus_tag LOCUS_12330 gene yqiW 44264 43809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_12330 44775 44329 gene locus_tag LOCUS_12340 gene tadA 44775 44329 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_12340 44847 46595 gene locus_tag LOCUS_12350 gene aspS 44847 46595 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_12350 46597 48372 gene locus_tag LOCUS_12360 46597 48372 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 protein_id gnl|my_center|LOCUS_12360 48615 53057 gene locus_tag LOCUS_12370 48615 53057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 53158 53598 gene locus_tag LOCUS_12380 53158 53598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 53598 56729 gene locus_tag LOCUS_12390 53598 56729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 56793 57485 gene locus_tag LOCUS_12400 gene purQ 56793 57485 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU4 protein_id gnl|my_center|LOCUS_12400 58432 57482 gene locus_tag LOCUS_12410 58432 57482 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_12410 58834 58499 gene locus_tag LOCUS_12420 58834 58499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 61682 58884 gene locus_tag LOCUS_12430 61682 58884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_12430 66183 61768 gene locus_tag LOCUS_12440 66183 61768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 67029 66190 gene locus_tag LOCUS_12450 gene prmA 67029 66190 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_12450 67832 67050 gene locus_tag LOCUS_12460 gene tpiA 67832 67050 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI2 protein_id gnl|my_center|LOCUS_12460 68872 67844 gene locus_tag LOCUS_12470 68872 67844 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_12470 70067 68919 gene locus_tag LOCUS_12480 70067 68919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_12480 70759 70217 gene locus_tag LOCUS_12490 70759 70217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_12490 70804 71685 gene locus_tag LOCUS_12500 70804 71685 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_12500 71685 72458 gene locus_tag LOCUS_12510 71685 72458 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_12510 72644 73006 gene locus_tag LOCUS_12520 72644 73006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 74835 72961 gene locus_tag LOCUS_12530 74835 72961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 75753 75181 gene locus_tag LOCUS_12540 gene nadD 75753 75181 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_12540 76332 75760 gene locus_tag LOCUS_12550 gene gmk 76332 75760 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_12550 77211 76342 gene locus_tag LOCUS_12560 77211 76342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_12560 78201 77296 gene locus_tag LOCUS_12570 78201 77296 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_12570 79541 80707 gene locus_tag LOCUS_12580 79541 80707 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_12580 80711 81388 gene locus_tag LOCUS_12590 gene ktrC 80711 81388 CDS product ktr system potassium uptake protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39760 protein_id gnl|my_center|LOCUS_12590 81402 82106 gene locus_tag LOCUS_12600 81402 82106 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271036.1 protein_id gnl|my_center|LOCUS_12600 82096 82632 gene locus_tag LOCUS_12610 82096 82632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 83362 82790 gene locus_tag LOCUS_12620 83362 82790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 83596 83988 gene locus_tag LOCUS_12630 83596 83988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 84147 85706 gene locus_tag LOCUS_12640 gene pccB 84147 85706 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_12640 85766 86587 gene locus_tag LOCUS_12650 85766 86587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 86772 87395 gene locus_tag LOCUS_12660 86772 87395 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_12660 90772 88073 gene locus_tag LOCUS_12670 90772 88073 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_12670 91689 90814 gene locus_tag LOCUS_12680 91689 90814 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_12680 92109 91846 gene locus_tag LOCUS_12690 92109 91846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 91997 94093 gene locus_tag LOCUS_12700 91997 94093 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_12700 94914 94102 gene locus_tag LOCUS_12710 gene deoD 94914 94102 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH2 protein_id gnl|my_center|LOCUS_12710 95504 94911 gene locus_tag LOCUS_12720 95504 94911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_12720 98658 95593 gene locus_tag LOCUS_12730 98658 95593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 99764 98655 gene locus_tag LOCUS_12740 gene smf 99764 98655 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_12740 101582 99813 gene locus_tag LOCUS_12750 101582 99813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 101791 102348 gene locus_tag LOCUS_12760 101791 102348 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_12760 102338 103777 gene locus_tag LOCUS_12770 102338 103777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 103811 104914 gene locus_tag LOCUS_12780 103811 104914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 104940 105479 gene locus_tag LOCUS_12790 104940 105479 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_12790 106412 105465 gene locus_tag LOCUS_12800 106412 105465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 106431 106622 gene locus_tag LOCUS_12810 106431 106622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 107891 106623 gene locus_tag LOCUS_12820 gene purD 107891 106623 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_12820 108080 109429 gene locus_tag LOCUS_12830 gene gdhA 108080 109429 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_12830 109793 109500 gene locus_tag LOCUS_12840 gene gatC 109793 109500 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y5 protein_id gnl|my_center|LOCUS_12840 110367 109768 gene locus_tag LOCUS_12850 110367 109768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 110607 111578 gene locus_tag LOCUS_12860 gene trpS 110607 111578 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_12860 113399 111582 gene locus_tag LOCUS_12870 gene lepA 113399 111582 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_12870 113618 115927 gene locus_tag LOCUS_12880 113618 115927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 116291 118630 gene locus_tag LOCUS_12890 116291 118630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 120081 118744 gene locus_tag LOCUS_12900 gene accC 120081 118744 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_12900 120594 120112 gene locus_tag LOCUS_12910 gene accB 120594 120112 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_12910 121634 120639 gene locus_tag LOCUS_12920 gene fabH3 121634 120639 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_12920 122576 121635 gene locus_tag LOCUS_12930 122576 121635 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_12930 122812 122624 gene locus_tag LOCUS_12940 gene rpmF 122812 122624 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_12940 123355 122825 gene locus_tag LOCUS_12950 123355 122825 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_12950 124462 123413 gene locus_tag LOCUS_12960 gene pdxA 124462 123413 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_12960 125886 124459 gene locus_tag LOCUS_12970 125886 124459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 126034 128706 gene locus_tag LOCUS_12980 126034 128706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 128722 129312 gene locus_tag LOCUS_12990 gene ribE 128722 129312 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_12990 130968 129313 gene locus_tag LOCUS_13000 gene dxs 130968 129313 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWC0 protein_id gnl|my_center|LOCUS_13000 131152 132855 gene locus_tag LOCUS_13010 gene lysS 131152 132855 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 protein_id gnl|my_center|LOCUS_13010 133075 133728 gene locus_tag LOCUS_13020 133075 133728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 133751 134305 gene locus_tag LOCUS_13030 133751 134305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 134356 135642 gene locus_tag LOCUS_13040 134356 135642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 135647 137896 gene locus_tag LOCUS_13050 135647 137896 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767848.1 protein_id gnl|my_center|LOCUS_13050 138944 138129 gene locus_tag LOCUS_13060 138944 138129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141159.1 protein_id gnl|my_center|LOCUS_13060 139499 138945 gene locus_tag LOCUS_13070 139499 138945 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266351.1 protein_id gnl|my_center|LOCUS_13070 140019 139627 gene locus_tag LOCUS_13080 140019 139627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 140279 142519 gene locus_tag LOCUS_13090 140279 142519 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG0 protein_id gnl|my_center|LOCUS_13090 142548 143798 gene locus_tag LOCUS_13100 142548 143798 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_13100 143809 145194 gene locus_tag LOCUS_13110 143809 145194 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_13110 145552 145184 gene locus_tag LOCUS_13120 145552 145184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 145838 146302 gene locus_tag LOCUS_13130 145838 146302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 148663 146594 gene locus_tag LOCUS_13140 148663 146594 CDS product tungsten formylmethanofuran dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403352.1 protein_id gnl|my_center|LOCUS_13140 148894 150402 gene locus_tag LOCUS_13150 148894 150402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 150446 151117 gene locus_tag LOCUS_13160 150446 151117 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_13160 151806 151120 gene locus_tag LOCUS_13170 151806 151120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 152072 152725 gene locus_tag LOCUS_13180 152072 152725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 153693 152731 gene locus_tag LOCUS_13190 153693 152731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 154185 153784 gene locus_tag LOCUS_13200 154185 153784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 154982 154239 gene locus_tag LOCUS_13210 154982 154239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 156099 154975 gene locus_tag LOCUS_13220 156099 154975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 157925 156108 gene locus_tag LOCUS_13230 157925 156108 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034322.1 protein_id gnl|my_center|LOCUS_13230 158188 159306 gene locus_tag LOCUS_13240 158188 159306 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_13240 160279 159389 gene locus_tag LOCUS_13250 160279 159389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_13250 161149 160379 gene locus_tag LOCUS_13260 161149 160379 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_13260 163254 161203 gene locus_tag LOCUS_13270 gene paaZ 163254 161203 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976331.1 protein_id gnl|my_center|LOCUS_13270 164607 163540 gene locus_tag LOCUS_13280 gene fabH1 164607 163540 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_13280 164778 165662 gene locus_tag LOCUS_13290 164778 165662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 167922 165748 gene locus_tag LOCUS_13300 167922 165748 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_13300 168065 168469 gene locus_tag LOCUS_13310 168065 168469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 177562 168602 gene locus_tag LOCUS_13320 177562 168602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 178599 177985 gene locus_tag LOCUS_13330 178599 177985 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705605.1 protein_id gnl|my_center|LOCUS_13330 179815 178610 gene locus_tag LOCUS_13340 gene pcaF 179815 178610 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206932.1 protein_id gnl|my_center|LOCUS_13340 180253 179837 gene locus_tag LOCUS_13350 gene paaI 180253 179837 CDS product phenylacetic acid degradation protein PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535436.1 protein_id gnl|my_center|LOCUS_13350 180735 180250 gene locus_tag LOCUS_13360 180735 180250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 181989 180847 gene locus_tag LOCUS_13370 gene paaE 181989 180847 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 protein_id gnl|my_center|LOCUS_13370 182191 184794 gene locus_tag LOCUS_13380 182191 184794 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_13380 184880 185869 gene locus_tag LOCUS_13390 gene paaA 184880 185869 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_13390 185891 186181 gene locus_tag LOCUS_13400 gene paaB 185891 186181 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709132.1 protein_id gnl|my_center|LOCUS_13400 186204 186956 gene locus_tag LOCUS_13410 gene paaC 186204 186956 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813293.1 protein_id gnl|my_center|LOCUS_13410 186960 187448 gene locus_tag LOCUS_13420 gene paaD 186960 187448 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_13420 187503 188282 gene locus_tag LOCUS_13430 187503 188282 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_13430 188239 189456 gene locus_tag LOCUS_13440 188239 189456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 189982 190944 gene locus_tag LOCUS_13450 189982 190944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 190965 191669 gene locus_tag LOCUS_13460 190965 191669 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_13460 192112 191666 gene locus_tag LOCUS_13470 192112 191666 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775709.1 protein_id gnl|my_center|LOCUS_13470 193565 192204 gene locus_tag LOCUS_13480 193565 192204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 194327 193569 gene locus_tag LOCUS_13490 194327 193569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 194779 194324 gene locus_tag LOCUS_13500 194779 194324 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_13500 195131 197221 gene locus_tag LOCUS_13510 gene rnr 195131 197221 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_13510 197272 197685 gene locus_tag LOCUS_13520 197272 197685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 199621 197756 gene locus_tag LOCUS_13530 199621 197756 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_13530 200496 199639 gene locus_tag LOCUS_13540 200496 199639 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_13540 200671 201495 gene locus_tag LOCUS_13550 200671 201495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 201923 201492 gene locus_tag LOCUS_13560 gene rpiB 201923 201492 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_13560 202342 204006 gene locus_tag LOCUS_13570 202342 204006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 204075 204650 gene locus_tag LOCUS_13580 204075 204650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 204663 205877 gene locus_tag LOCUS_13590 204663 205877 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_13590 205968 207698 gene locus_tag LOCUS_13600 205968 207698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 207773 208477 gene locus_tag LOCUS_13610 207773 208477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 209049 208531 gene locus_tag LOCUS_13620 209049 208531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_13620 209135 209680 gene locus_tag LOCUS_13630 209135 209680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 210474 209677 gene locus_tag LOCUS_13640 210474 209677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 212104 210563 gene locus_tag LOCUS_13650 gene pcd 212104 210563 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_13650 214201 212246 gene locus_tag LOCUS_13660 214201 212246 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_13660 216196 214379 gene locus_tag LOCUS_13670 216196 214379 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103008.1 protein_id gnl|my_center|LOCUS_13670 216536 216463 gene locus_tag LOCUS_t00230 216536 216463 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 216933 216577 gene locus_tag LOCUS_13680 gene folB 216933 216577 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_13680 218468 216933 gene locus_tag LOCUS_13690 gene gltX 218468 216933 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 protein_id gnl|my_center|LOCUS_13690 218585 221866 gene locus_tag LOCUS_13700 218585 221866 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_13700 221863 222285 gene locus_tag LOCUS_13710 gene ybeY 221863 222285 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2M2 protein_id gnl|my_center|LOCUS_13710 222322 224190 gene locus_tag LOCUS_13720 gene mnmG 222322 224190 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_13720 224220 225104 gene locus_tag LOCUS_13730 224220 225104 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_13730 226345 225209 gene locus_tag LOCUS_13740 gene holB 226345 225209 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_13740 226399 227592 gene locus_tag LOCUS_13750 gene pgk 226399 227592 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_13750 228104 227589 gene locus_tag LOCUS_13760 228104 227589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 228146 228502 gene locus_tag LOCUS_13770 228146 228502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_13770 228910 228488 gene locus_tag LOCUS_13780 228910 228488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 229275 228910 gene locus_tag LOCUS_13790 229275 228910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 229351 230370 gene locus_tag LOCUS_13800 gene pheS 229351 230370 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_13800 230603 230367 gene locus_tag LOCUS_13810 230603 230367 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VD93 protein_id gnl|my_center|LOCUS_13810 232027 230606 gene locus_tag LOCUS_13820 gene pykA 232027 230606 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_13820 232529 232038 gene locus_tag LOCUS_13830 232529 232038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 233250 232531 gene locus_tag LOCUS_13840 gene rnc 233250 232531 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E8 protein_id gnl|my_center|LOCUS_13840 234501 233251 gene locus_tag LOCUS_13850 gene fabF 234501 233251 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_13850 234747 234511 gene locus_tag LOCUS_13860 gene acpP 234747 234511 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_13860 234887 235456 gene locus_tag LOCUS_13870 gene purN 234887 235456 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 protein_id gnl|my_center|LOCUS_13870 235453 235914 gene locus_tag LOCUS_13880 gene rnhA 235453 235914 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_13880 236797 235931 gene locus_tag LOCUS_13890 236797 235931 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_13890 237108 239603 gene locus_tag LOCUS_13900 237108 239603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 239600 240016 gene locus_tag LOCUS_13910 239600 240016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 239964 240206 gene locus_tag LOCUS_13920 239964 240206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 240232 240615 gene locus_tag LOCUS_13930 240232 240615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 240676 241920 gene locus_tag LOCUS_13940 gene atpB 240676 241920 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_13940 241958 242149 gene locus_tag LOCUS_13950 gene atpE 241958 242149 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E0 protein_id gnl|my_center|LOCUS_13950 242233 242733 gene locus_tag LOCUS_13960 gene atpF 242233 242733 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_13960 242736 243293 gene locus_tag LOCUS_13970 gene atpH 242736 243293 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_13970 243317 244891 gene locus_tag LOCUS_13980 gene atpA 243317 244891 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_13980 244956 245825 gene locus_tag LOCUS_13990 gene atpG 244956 245825 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_13990 245945 247387 gene locus_tag LOCUS_14000 245945 247387 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_14000 247541 248191 gene locus_tag LOCUS_14010 247541 248191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 248299 249081 gene locus_tag LOCUS_14020 gene crt 248299 249081 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_14020 249078 249725 gene locus_tag LOCUS_14030 249078 249725 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_14030 250105 249722 gene locus_tag LOCUS_14040 250105 249722 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_14040 250227 250928 gene locus_tag LOCUS_14050 250227 250928 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_14050 251626 250925 gene locus_tag LOCUS_14060 251626 250925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 251749 252312 gene locus_tag LOCUS_14070 251749 252312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 252465 254864 gene locus_tag LOCUS_14080 gene ladS 252465 254864 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_14080 255726 255004 gene locus_tag LOCUS_14090 255726 255004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 258149 256110 gene locus_tag LOCUS_14100 258149 256110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 259425 258958 gene locus_tag LOCUS_14110 259425 258958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 260975 260505 gene locus_tag LOCUS_14120 260975 260505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_14120 263217 261028 gene locus_tag LOCUS_14130 263217 261028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 265043 264159 gene locus_tag LOCUS_14140 265043 264159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 266378 265485 gene locus_tag LOCUS_14150 266378 265485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 266546 267004 gene locus_tag LOCUS_14160 266546 267004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 267377 268000 gene locus_tag LOCUS_14170 267377 268000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 268328 268825 gene locus_tag LOCUS_14180 268328 268825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 269975 269409 gene locus_tag LOCUS_14190 269975 269409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 270099 269929 gene locus_tag LOCUS_14200 270099 269929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 270471 271277 gene locus_tag LOCUS_14210 270471 271277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 272537 273472 gene locus_tag LOCUS_14220 272537 273472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 273537 274313 gene locus_tag LOCUS_14230 273537 274313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 274406 274726 gene locus_tag LOCUS_14240 274406 274726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 274829 275053 gene locus_tag LOCUS_14250 274829 275053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 275058 275726 gene locus_tag LOCUS_14260 275058 275726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 276053 276523 gene locus_tag LOCUS_14270 276053 276523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence04 394 1242 gene locus_tag LOCUS_14280 394 1242 CDS product chemotaxis protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429044.1 protein_id gnl|my_center|LOCUS_14280 1208 1795 gene locus_tag LOCUS_14290 gene cheB2 1208 1795 CDS product putative chemotaxis protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5D8 protein_id gnl|my_center|LOCUS_14290 1788 2810 gene locus_tag LOCUS_14300 1788 2810 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767908.1 protein_id gnl|my_center|LOCUS_14300 3009 3941 gene locus_tag LOCUS_14310 3009 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 4474 4016 gene locus_tag LOCUS_14320 4474 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 6314 4476 gene locus_tag LOCUS_14330 gene yidC 6314 4476 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T26 protein_id gnl|my_center|LOCUS_14330 7933 6323 gene locus_tag LOCUS_14340 gene pyrG 7933 6323 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_14340 8962 8009 gene locus_tag LOCUS_14350 8962 8009 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_14350 10313 8964 gene locus_tag LOCUS_14360 gene surA 10313 8964 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT1 protein_id gnl|my_center|LOCUS_14360 11194 10313 gene locus_tag LOCUS_14370 11194 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 13145 11178 gene locus_tag LOCUS_14380 13145 11178 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_14380 14661 13186 gene locus_tag LOCUS_14390 gene guaB 14661 13186 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_14390 18231 14794 gene locus_tag LOCUS_14400 18231 14794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 21818 18378 gene locus_tag LOCUS_14410 21818 18378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 22926 21985 gene locus_tag LOCUS_14420 22926 21985 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_14420 24509 22926 gene locus_tag LOCUS_14430 24509 22926 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_14430 25692 24514 gene locus_tag LOCUS_14440 gene mnmA 25692 24514 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_14440 26418 25696 gene locus_tag LOCUS_14450 26418 25696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964005.1 protein_id gnl|my_center|LOCUS_14450 27480 26521 gene locus_tag LOCUS_14460 27480 26521 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_14460 28067 27492 gene locus_tag LOCUS_14470 28067 27492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963274.1 protein_id gnl|my_center|LOCUS_14470 28398 29051 gene locus_tag LOCUS_14480 gene tal 28398 29051 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_14480 29134 29757 gene locus_tag LOCUS_14490 29134 29757 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_14490 30280 30101 gene locus_tag LOCUS_14500 30280 30101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 30558 31187 gene locus_tag LOCUS_14510 30558 31187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 31762 31184 gene locus_tag LOCUS_14520 gene coaE 31762 31184 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_14520 32754 31759 gene locus_tag LOCUS_14530 32754 31759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 33119 32790 gene locus_tag LOCUS_14540 33119 32790 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_14540 33626 33123 gene locus_tag LOCUS_14550 33626 33123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 34624 33683 gene locus_tag LOCUS_14560 34624 33683 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY9 protein_id gnl|my_center|LOCUS_14560 35744 34644 gene locus_tag LOCUS_14570 gene vdh 35744 34644 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_14570 35871 37646 gene locus_tag LOCUS_14580 35871 37646 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_14580 37736 38149 gene locus_tag LOCUS_14590 37736 38149 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_14590 38692 38174 gene locus_tag LOCUS_14600 38692 38174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 38871 39656 gene locus_tag LOCUS_14610 gene parA 38871 39656 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_14610 39725 40615 gene locus_tag LOCUS_14620 gene parB 39725 40615 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_14620 40612 41187 gene locus_tag LOCUS_14630 40612 41187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_14630 41187 41894 gene locus_tag LOCUS_14640 gene dapB 41187 41894 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_14640 41897 43543 gene locus_tag LOCUS_14650 gene lepB 41897 43543 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP1 protein_id gnl|my_center|LOCUS_14650 43543 44172 gene locus_tag LOCUS_14660 43543 44172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 protein_id gnl|my_center|LOCUS_14660 44261 45427 gene locus_tag LOCUS_14670 44261 45427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 45432 47066 gene locus_tag LOCUS_14680 45432 47066 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_14680 47195 48619 gene locus_tag LOCUS_14690 47195 48619 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_14690 48620 48913 gene locus_tag LOCUS_14700 48620 48913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 48988 50613 gene locus_tag LOCUS_14710 48988 50613 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_14710 51430 50783 gene locus_tag LOCUS_14720 51430 50783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180345.1 protein_id gnl|my_center|LOCUS_14720 51834 53240 gene locus_tag LOCUS_14730 51834 53240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 55261 53972 gene locus_tag LOCUS_14740 gene rocD 55261 53972 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_14740 55414 56865 gene locus_tag LOCUS_14750 55414 56865 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255358.1 protein_id gnl|my_center|LOCUS_14750 56945 57496 gene locus_tag LOCUS_14760 56945 57496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_14760 57975 57493 gene locus_tag LOCUS_14770 57975 57493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963179.1 protein_id gnl|my_center|LOCUS_14770 58085 58660 gene locus_tag LOCUS_14780 gene tpm 58085 58660 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_14780 58689 59198 gene locus_tag LOCUS_14790 gene pyrR2 58689 59198 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_14790 59527 59186 gene locus_tag LOCUS_14800 59527 59186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 60399 59911 gene locus_tag LOCUS_14810 gene crtZ 60399 59911 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_14810 61073 60396 gene locus_tag LOCUS_14820 61073 60396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 61770 61114 gene locus_tag LOCUS_14830 gene sirR 61770 61114 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_14830 61958 63004 gene locus_tag LOCUS_14840 61958 63004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 64763 63069 gene locus_tag LOCUS_14850 64763 63069 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 protein_id gnl|my_center|LOCUS_14850 64874 65593 gene locus_tag LOCUS_14860 64874 65593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 65715 66005 gene locus_tag LOCUS_14870 65715 66005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 67076 66906 gene locus_tag LOCUS_14880 67076 66906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 67140 67532 gene locus_tag LOCUS_14890 67140 67532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 67568 68599 gene locus_tag LOCUS_14900 gene ribD 67568 68599 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_14900 68596 69468 gene locus_tag LOCUS_14910 68596 69468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 69468 70076 gene locus_tag LOCUS_14920 69468 70076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_14920 70086 71891 gene locus_tag LOCUS_14930 70086 71891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 72304 71894 gene locus_tag LOCUS_14940 72304 71894 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_14940 72630 73958 gene locus_tag LOCUS_14950 gene dnaA 72630 73958 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_14950 74673 74095 gene locus_tag LOCUS_14960 74673 74095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 74988 75392 gene locus_tag LOCUS_14970 74988 75392 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 protein_id gnl|my_center|LOCUS_14970 75376 76107 gene locus_tag LOCUS_14980 75376 76107 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_14980 78319 76124 gene locus_tag LOCUS_14990 gene dpp11 78319 76124 CDS product Asp/Glu-specific dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWM2 protein_id gnl|my_center|LOCUS_14990 78441 78755 gene locus_tag LOCUS_15000 78441 78755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 78885 79268 gene locus_tag LOCUS_15010 78885 79268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 80245 79319 gene locus_tag LOCUS_15020 gene oxyR 80245 79319 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_15020 80388 82547 gene locus_tag LOCUS_15030 gene katG 80388 82547 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C4 protein_id gnl|my_center|LOCUS_15030 82665 83543 gene locus_tag LOCUS_15040 82665 83543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037844.1 protein_id gnl|my_center|LOCUS_15040 84003 86747 gene locus_tag LOCUS_15050 84003 86747 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_15050 86750 87775 gene locus_tag LOCUS_15060 gene phy 86750 87775 CDS product 3-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42094 protein_id gnl|my_center|LOCUS_15060 88067 88507 gene locus_tag LOCUS_15070 88067 88507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 88650 89456 gene locus_tag LOCUS_15080 88650 89456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 89480 90061 gene locus_tag LOCUS_15090 89480 90061 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_15090 90117 90443 gene locus_tag LOCUS_15100 90117 90443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 90471 90860 gene locus_tag LOCUS_15110 90471 90860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 90905 91297 gene locus_tag LOCUS_15120 90905 91297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 91308 91889 gene locus_tag LOCUS_15130 91308 91889 CDS product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103689.1 protein_id gnl|my_center|LOCUS_15130 92330 92857 gene locus_tag LOCUS_15140 92330 92857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 92916 93554 gene locus_tag LOCUS_15150 92916 93554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 93563 94450 gene locus_tag LOCUS_15160 93563 94450 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729119.1 protein_id gnl|my_center|LOCUS_15160 94856 95437 gene locus_tag LOCUS_15170 94856 95437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 95452 96312 gene locus_tag LOCUS_15180 95452 96312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 96454 97281 gene locus_tag LOCUS_15190 96454 97281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 97324 97644 gene locus_tag LOCUS_15200 gene yqjZ 97324 97644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54563 protein_id gnl|my_center|LOCUS_15200 97670 98116 gene locus_tag LOCUS_15210 97670 98116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108259.1 protein_id gnl|my_center|LOCUS_15210 98440 98967 gene locus_tag LOCUS_15220 98440 98967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 98968 99315 gene locus_tag LOCUS_15230 98968 99315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 99948 100181 gene locus_tag LOCUS_15240 99948 100181 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_15240 100251 100853 gene locus_tag LOCUS_15250 100251 100853 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204186.1 protein_id gnl|my_center|LOCUS_15250 100900 101313 gene locus_tag LOCUS_15260 100900 101313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 102082 101387 gene locus_tag LOCUS_15270 102082 101387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 102235 102828 gene locus_tag LOCUS_15280 102235 102828 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454679.1 protein_id gnl|my_center|LOCUS_15280 102905 103630 gene locus_tag LOCUS_15290 102905 103630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 103642 104874 gene locus_tag LOCUS_15300 103642 104874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 105169 106524 gene locus_tag LOCUS_15310 gene rhlE 105169 106524 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_15310 106620 107000 gene locus_tag LOCUS_15320 106620 107000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 107105 107572 gene locus_tag LOCUS_15330 107105 107572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 107597 107884 gene locus_tag LOCUS_15340 107597 107884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262427.1 protein_id gnl|my_center|LOCUS_15340 107909 108109 gene locus_tag LOCUS_15350 107909 108109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 108318 108944 gene locus_tag LOCUS_15360 gene cynT 108318 108944 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_15360 109109 109963 gene locus_tag LOCUS_15370 109109 109963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 110116 110745 gene locus_tag LOCUS_15380 110116 110745 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397598.1 protein_id gnl|my_center|LOCUS_15380 110844 111425 gene locus_tag LOCUS_15390 110844 111425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_15390 111450 111761 gene locus_tag LOCUS_15400 111450 111761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 112640 111765 gene locus_tag LOCUS_15410 112640 111765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 112821 113447 gene locus_tag LOCUS_15420 112821 113447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 113495 114028 gene locus_tag LOCUS_15430 113495 114028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 114355 114870 gene locus_tag LOCUS_15440 114355 114870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 115198 115881 gene locus_tag LOCUS_15450 115198 115881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 116001 117062 gene locus_tag LOCUS_15460 116001 117062 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640075.1 protein_id gnl|my_center|LOCUS_15460 117134 117373 gene locus_tag LOCUS_15470 117134 117373 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7H1 protein_id gnl|my_center|LOCUS_15470 117410 117988 gene locus_tag LOCUS_15480 117410 117988 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_15480 118196 118693 gene locus_tag LOCUS_15490 118196 118693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 119131 119514 gene locus_tag LOCUS_15500 gene ywkD 119131 119514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45871 protein_id gnl|my_center|LOCUS_15500 119656 121725 gene locus_tag LOCUS_15510 119656 121725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 122030 122308 gene locus_tag LOCUS_15520 122030 122308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 124442 122388 gene locus_tag LOCUS_15530 124442 122388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 126324 125137 gene locus_tag LOCUS_15540 126324 125137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 126911 127243 gene locus_tag LOCUS_15550 126911 127243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 127351 127887 gene locus_tag LOCUS_15560 127351 127887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 127911 128447 gene locus_tag LOCUS_15570 127911 128447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 128548 129054 gene locus_tag LOCUS_15580 128548 129054 CDS product phosphinothricin N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990112.1 protein_id gnl|my_center|LOCUS_15580 129071 130099 gene locus_tag LOCUS_15590 129071 130099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 130223 131680 gene locus_tag LOCUS_15600 130223 131680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 131808 132389 gene locus_tag LOCUS_15610 131808 132389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 132465 132902 gene locus_tag LOCUS_15620 132465 132902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_15620 132985 133449 gene locus_tag LOCUS_15630 132985 133449 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_15630 133453 133773 gene locus_tag LOCUS_15640 133453 133773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 133877 134722 gene locus_tag LOCUS_15650 133877 134722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 135387 134758 gene locus_tag LOCUS_15660 135387 134758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 136497 135511 gene locus_tag LOCUS_15670 136497 135511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 136875 137528 gene locus_tag LOCUS_15680 136875 137528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 138145 138753 gene locus_tag LOCUS_15690 138145 138753 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021349.1 protein_id gnl|my_center|LOCUS_15690 138906 139448 gene locus_tag LOCUS_15700 138906 139448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 139700 140194 gene locus_tag LOCUS_15710 139700 140194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 140350 141240 gene locus_tag LOCUS_15720 140350 141240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 141278 142000 gene locus_tag LOCUS_15730 141278 142000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 142182 142523 gene locus_tag LOCUS_15740 142182 142523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 142637 143539 gene locus_tag LOCUS_15750 142637 143539 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67619 protein_id gnl|my_center|LOCUS_15750 143634 144491 gene locus_tag LOCUS_15760 143634 144491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 144555 145070 gene locus_tag LOCUS_15770 144555 145070 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 protein_id gnl|my_center|LOCUS_15770 145083 145892 gene locus_tag LOCUS_15780 145083 145892 CDS product alpha/beta family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265531.1 protein_id gnl|my_center|LOCUS_15780 145912 146271 gene locus_tag LOCUS_15790 145912 146271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 146918 147583 gene locus_tag LOCUS_15800 146918 147583 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_15800 147887 148186 gene locus_tag LOCUS_15810 147887 148186 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_15810 148894 149739 gene locus_tag LOCUS_15820 148894 149739 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948667.1 protein_id gnl|my_center|LOCUS_15820 149762 150268 gene locus_tag LOCUS_15830 149762 150268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 150272 150925 gene locus_tag LOCUS_15840 150272 150925 CDS product peptidase M54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903951.1 protein_id gnl|my_center|LOCUS_15840 150984 151556 gene locus_tag LOCUS_15850 150984 151556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 151716 153401 gene locus_tag LOCUS_15860 151716 153401 CDS product urease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071259.1 protein_id gnl|my_center|LOCUS_15860 153595 156954 gene locus_tag LOCUS_15870 153595 156954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 157558 158310 gene locus_tag LOCUS_15880 157558 158310 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX9 protein_id gnl|my_center|LOCUS_15880 158392 159357 gene locus_tag LOCUS_15890 gene rlmF 158392 159357 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G2 protein_id gnl|my_center|LOCUS_15890 159458 160021 gene locus_tag LOCUS_15900 159458 160021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049030.1 protein_id gnl|my_center|LOCUS_15900 160064 161107 gene locus_tag LOCUS_15910 160064 161107 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WXS5 protein_id gnl|my_center|LOCUS_15910 161104 161547 gene locus_tag LOCUS_15920 161104 161547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 161564 162619 gene locus_tag LOCUS_15930 161564 162619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 162816 164327 gene locus_tag LOCUS_15940 162816 164327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 164689 164435 gene locus_tag LOCUS_15950 164689 164435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 164996 164715 gene locus_tag LOCUS_15960 164996 164715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_15960 165902 165318 gene locus_tag LOCUS_15970 165902 165318 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_15970 166093 168903 gene locus_tag LOCUS_15980 gene uvrA1 166093 168903 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_15980 169124 168900 gene locus_tag LOCUS_15990 169124 168900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 169544 170053 gene locus_tag LOCUS_16000 169544 170053 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_16000 170119 170487 gene locus_tag LOCUS_16010 170119 170487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920332.1 protein_id gnl|my_center|LOCUS_16010 170505 171461 gene locus_tag LOCUS_16020 170505 171461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 171493 172770 gene locus_tag LOCUS_16030 gene ndh 171493 172770 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_16030 172938 173648 gene locus_tag LOCUS_16040 172938 173648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_16040 173648 174697 gene locus_tag LOCUS_16050 173648 174697 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_16050 174808 175269 gene locus_tag LOCUS_16060 174808 175269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 175269 175601 gene locus_tag LOCUS_16070 175269 175601 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_16070 175604 177376 gene locus_tag LOCUS_16080 175604 177376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_16080 177545 180334 gene locus_tag LOCUS_16090 177545 180334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962879.1 protein_id gnl|my_center|LOCUS_16090 180482 182902 gene locus_tag LOCUS_16100 180482 182902 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_16100 182917 184146 gene locus_tag LOCUS_16110 gene rsmB 182917 184146 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_16110 184149 184952 gene locus_tag LOCUS_16120 gene murQ 184149 184952 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_16120 185611 184949 gene locus_tag LOCUS_16130 185611 184949 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_16130 186027 185614 gene locus_tag LOCUS_16140 186027 185614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 187136 186225 gene locus_tag LOCUS_16150 gene ilvE2 187136 186225 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_16150 187851 187129 gene locus_tag LOCUS_16160 187851 187129 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_16160 188054 188128 gene locus_tag LOCUS_t00240 188054 188128 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 188384 189619 gene locus_tag LOCUS_16170 188384 189619 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_16170 190674 190519 gene locus_tag LOCUS_16180 190674 190519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 190759 191139 gene locus_tag LOCUS_16190 190759 191139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 191381 191196 gene locus_tag LOCUS_16200 191381 191196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 191938 192624 gene locus_tag LOCUS_16210 191938 192624 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963651.1 protein_id gnl|my_center|LOCUS_16210 192611 193276 gene locus_tag LOCUS_16220 192611 193276 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_16220 193292 193555 gene locus_tag LOCUS_16230 193292 193555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 194325 193864 gene locus_tag LOCUS_16240 194325 193864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 194901 194398 gene locus_tag LOCUS_16250 194901 194398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 197017 194918 gene locus_tag LOCUS_16260 197017 194918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 197668 197147 gene locus_tag LOCUS_16270 197668 197147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 199746 197665 gene locus_tag LOCUS_16280 199746 197665 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence05 1528 362 gene locus_tag LOCUS_16290 1528 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 3395 1689 gene locus_tag LOCUS_16300 3395 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 3697 5643 gene locus_tag LOCUS_16310 3697 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 5821 6654 gene locus_tag LOCUS_16320 gene splB 5821 6654 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079210.1 protein_id gnl|my_center|LOCUS_16320 7484 6651 gene locus_tag LOCUS_16330 7484 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 9732 7474 gene locus_tag LOCUS_16340 gene xloA 9732 7474 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_16340 10998 9769 gene locus_tag LOCUS_16350 10998 9769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 12005 10995 gene locus_tag LOCUS_16360 12005 10995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 13728 12007 gene locus_tag LOCUS_16370 13728 12007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 15673 13730 gene locus_tag LOCUS_16380 15673 13730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 17324 15690 gene locus_tag LOCUS_16390 17324 15690 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_16390 18703 17354 gene locus_tag LOCUS_16400 18703 17354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_16400 19498 18707 gene locus_tag LOCUS_16410 19498 18707 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_16410 19621 21219 gene locus_tag LOCUS_16420 19621 21219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 21674 21336 gene locus_tag LOCUS_16430 21674 21336 CDS product dksA/traR C4-type zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 protein_id gnl|my_center|LOCUS_16430 21802 22794 gene locus_tag LOCUS_16440 gene gapA1 21802 22794 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963588.1 protein_id gnl|my_center|LOCUS_16440 24055 22853 gene locus_tag LOCUS_16450 24055 22853 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_16450 25528 24062 gene locus_tag LOCUS_16460 gene gatB 25528 24062 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1B9 protein_id gnl|my_center|LOCUS_16460 26494 25640 gene locus_tag LOCUS_16470 gene lpxK 26494 25640 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6K1 protein_id gnl|my_center|LOCUS_16470 27603 26701 gene locus_tag LOCUS_16480 gene miaA1 27603 26701 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A018 protein_id gnl|my_center|LOCUS_16480 28418 27603 gene locus_tag LOCUS_16490 28418 27603 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_16490 29233 28415 gene locus_tag LOCUS_16500 29233 28415 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_16500 30129 29230 gene locus_tag LOCUS_16510 30129 29230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_16510 30227 30541 gene locus_tag LOCUS_16520 30227 30541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 31041 30538 gene locus_tag LOCUS_16530 31041 30538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 32458 31034 gene locus_tag LOCUS_16540 gene cca 32458 31034 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_16540 32830 32468 gene locus_tag LOCUS_16550 32830 32468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 33426 32989 gene locus_tag LOCUS_16560 33426 32989 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439097.1 protein_id gnl|my_center|LOCUS_16560 34461 33505 gene locus_tag LOCUS_16570 34461 33505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 34634 35758 gene locus_tag LOCUS_16580 gene mauG 34634 35758 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_16580 35773 36462 gene locus_tag LOCUS_16590 35773 36462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 36473 36997 gene locus_tag LOCUS_16600 36473 36997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 37669 37001 gene locus_tag LOCUS_16610 37669 37001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 39035 38268 gene locus_tag LOCUS_16620 39035 38268 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_16620 40135 39032 gene locus_tag LOCUS_16630 40135 39032 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_16630 41428 40148 gene locus_tag LOCUS_16640 gene pyrC2 41428 40148 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_16640 43254 41434 gene locus_tag LOCUS_16650 43254 41434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405130.1 protein_id gnl|my_center|LOCUS_16650 44541 43543 gene locus_tag LOCUS_16660 44541 43543 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698132.1 protein_id gnl|my_center|LOCUS_16660 44990 44538 gene locus_tag LOCUS_16670 44990 44538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 45408 44983 gene locus_tag LOCUS_16680 45408 44983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 46588 45401 gene locus_tag LOCUS_16690 46588 45401 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 protein_id gnl|my_center|LOCUS_16690 47211 46585 gene locus_tag LOCUS_16700 47211 46585 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860736.1 protein_id gnl|my_center|LOCUS_16700 47226 47663 gene locus_tag LOCUS_16710 47226 47663 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_16710 49290 47665 gene locus_tag LOCUS_16720 49290 47665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 49751 49290 gene locus_tag LOCUS_16730 49751 49290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 49997 52309 gene locus_tag LOCUS_16740 49997 52309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908521.1 protein_id gnl|my_center|LOCUS_16740 52317 53021 gene locus_tag LOCUS_16750 52317 53021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 53026 55158 gene locus_tag LOCUS_16760 53026 55158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 55158 56258 gene locus_tag LOCUS_16770 55158 56258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 56282 56659 gene locus_tag LOCUS_16780 56282 56659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 58231 56648 gene locus_tag LOCUS_16790 gene prfC 58231 56648 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT6 protein_id gnl|my_center|LOCUS_16790 58470 58973 gene locus_tag LOCUS_16800 58470 58973 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108357.1 protein_id gnl|my_center|LOCUS_16800 58984 60495 gene locus_tag LOCUS_16810 gene crtI 58984 60495 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_16810 60479 61315 gene locus_tag LOCUS_16820 gene crtB 60479 61315 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_16820 61336 61857 gene locus_tag LOCUS_16830 gene idi 61336 61857 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_16830 61854 62261 gene locus_tag LOCUS_16840 gene ygcM 61854 62261 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_16840 62280 63593 gene locus_tag LOCUS_16850 gene phrB1 62280 63593 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_16850 64672 63590 gene locus_tag LOCUS_16860 64672 63590 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_16860 64799 65365 gene locus_tag LOCUS_16870 gene adk 64799 65365 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_16870 65379 66374 gene locus_tag LOCUS_16880 gene obg 65379 66374 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB7 protein_id gnl|my_center|LOCUS_16880 66379 66939 gene locus_tag LOCUS_16890 66379 66939 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_16890 66936 67304 gene locus_tag LOCUS_16900 gene crcB 66936 67304 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J1 protein_id gnl|my_center|LOCUS_16900 69492 67297 gene locus_tag LOCUS_16910 69492 67297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 70465 69563 gene locus_tag LOCUS_16920 70465 69563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_16920 71814 70465 gene locus_tag LOCUS_16930 gene mvaA 71814 70465 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_16930 71904 72176 gene locus_tag LOCUS_16940 71904 72176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 73069 72569 gene locus_tag LOCUS_16950 73069 72569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 75236 73182 gene locus_tag LOCUS_16960 75236 73182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 76162 76560 gene locus_tag LOCUS_16970 76162 76560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 76571 78649 gene locus_tag LOCUS_16980 76571 78649 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036620.1 protein_id gnl|my_center|LOCUS_16980 78800 79738 gene locus_tag LOCUS_16990 gene mdh 78800 79738 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S289 protein_id gnl|my_center|LOCUS_16990 79880 80509 gene locus_tag LOCUS_17000 79880 80509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 82368 80614 gene locus_tag LOCUS_17010 82368 80614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 82978 82508 gene locus_tag LOCUS_17020 82978 82508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 83316 86306 gene locus_tag LOCUS_17030 83316 86306 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963634.1 protein_id gnl|my_center|LOCUS_17030 86303 87067 gene locus_tag LOCUS_17040 86303 87067 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_17040 87636 87238 gene locus_tag LOCUS_17050 87636 87238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 87845 88363 gene locus_tag LOCUS_17060 87845 88363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 88369 89250 gene locus_tag LOCUS_17070 88369 89250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 91042 89309 gene locus_tag LOCUS_17080 gene rho 91042 89309 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_17080 91242 91646 gene locus_tag LOCUS_17090 91242 91646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_17090 92138 91647 gene locus_tag LOCUS_17100 92138 91647 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_17100 92278 92937 gene locus_tag LOCUS_17110 gene truA 92278 92937 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_17110 92927 94807 gene locus_tag LOCUS_17120 92927 94807 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_17120 95820 94804 gene locus_tag LOCUS_17130 95820 94804 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889560.1 protein_id gnl|my_center|LOCUS_17130 96644 95895 gene locus_tag LOCUS_17140 96644 95895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 97017 96700 gene locus_tag LOCUS_17150 97017 96700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 98156 97227 gene locus_tag LOCUS_17160 98156 97227 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_17160 98942 98244 gene locus_tag LOCUS_17170 98942 98244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 99425 98946 gene locus_tag LOCUS_17180 99425 98946 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459931.1 protein_id gnl|my_center|LOCUS_17180 99891 99418 gene locus_tag LOCUS_17190 99891 99418 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_17190 100532 100038 gene locus_tag LOCUS_17200 100532 100038 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_17200 101938 100529 gene locus_tag LOCUS_17210 gene wcaJ 101938 100529 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_17210 102845 101955 gene locus_tag LOCUS_17220 102845 101955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 103835 102849 gene locus_tag LOCUS_17230 103835 102849 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_17230 104029 104682 gene locus_tag LOCUS_17240 gene pcm 104029 104682 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_17240 105172 104687 gene locus_tag LOCUS_17250 105172 104687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 105624 105277 gene locus_tag LOCUS_17260 105624 105277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 105962 107350 gene locus_tag LOCUS_17270 gene lpdA2 105962 107350 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_17270 107454 108596 gene locus_tag LOCUS_17280 107454 108596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 108598 109071 gene locus_tag LOCUS_17290 108598 109071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 109203 111305 gene locus_tag LOCUS_17300 109203 111305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 112291 111302 gene locus_tag LOCUS_17310 112291 111302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 112404 113390 gene locus_tag LOCUS_17320 112404 113390 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_17320 113853 113509 gene locus_tag LOCUS_17330 gene rplT 113853 113509 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_17330 114129 113935 gene locus_tag LOCUS_17340 gene rpmI 114129 113935 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_17340 114532 114155 gene locus_tag LOCUS_17350 114532 114155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 116669 114729 gene locus_tag LOCUS_17360 gene thrS 116669 114729 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 protein_id gnl|my_center|LOCUS_17360 117052 117474 gene locus_tag LOCUS_17370 117052 117474 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_17370 117479 118450 gene locus_tag LOCUS_17380 117479 118450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 118451 120136 gene locus_tag LOCUS_17390 gene menD 118451 120136 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_17390 120129 120677 gene locus_tag LOCUS_17400 120129 120677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 120670 122178 gene locus_tag LOCUS_17410 120670 122178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 122253 123149 gene locus_tag LOCUS_17420 gene menA 122253 123149 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTJ7 protein_id gnl|my_center|LOCUS_17420 123146 124180 gene locus_tag LOCUS_17430 gene menC 123146 124180 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_17430 126574 124175 gene locus_tag LOCUS_17440 126574 124175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_17440 126767 127780 gene locus_tag LOCUS_17450 gene menE 126767 127780 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_17450 127821 128684 gene locus_tag LOCUS_17460 127821 128684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 129612 128644 gene locus_tag LOCUS_17470 129612 128644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 129854 132019 gene locus_tag LOCUS_17480 129854 132019 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963773.1 protein_id gnl|my_center|LOCUS_17480 132124 133038 gene locus_tag LOCUS_17490 132124 133038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 133259 133044 gene locus_tag LOCUS_17500 133259 133044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 133177 134448 gene locus_tag LOCUS_17510 gene hisS 133177 134448 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6N7 protein_id gnl|my_center|LOCUS_17510 134472 135965 gene locus_tag LOCUS_17520 gene hutH1 134472 135965 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW5 protein_id gnl|my_center|LOCUS_17520 139214 135984 gene locus_tag LOCUS_17530 139214 135984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 140525 139338 gene locus_tag LOCUS_17540 140525 139338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 protein_id gnl|my_center|LOCUS_17540 141184 140546 gene locus_tag LOCUS_17550 141184 140546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_17550 141332 150433 gene locus_tag LOCUS_17560 141332 150433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 150627 158099 gene locus_tag LOCUS_17570 150627 158099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 158831 158133 gene locus_tag LOCUS_17580 158831 158133 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZP8 protein_id gnl|my_center|LOCUS_17580 159863 158841 gene locus_tag LOCUS_17590 gene tsaD 159863 158841 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_17590 159938 164335 gene locus_tag LOCUS_17600 159938 164335 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_17600 164705 164340 gene locus_tag LOCUS_17610 164705 164340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 165889 164750 gene locus_tag LOCUS_17620 gene ribBA 165889 164750 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_17620 166943 165855 gene locus_tag LOCUS_17630 166943 165855 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_17630 168211 167018 gene locus_tag LOCUS_17640 168211 167018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 169571 168216 gene locus_tag LOCUS_17650 169571 168216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 170302 169655 gene locus_tag LOCUS_17660 170302 169655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 172648 170315 gene locus_tag LOCUS_17670 gene ftsK 172648 170315 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_17670 173745 172861 gene locus_tag LOCUS_17680 173745 172861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 176246 173745 gene locus_tag LOCUS_17690 176246 173745 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_17690 177347 176448 gene locus_tag LOCUS_17700 177347 176448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 179644 177350 gene locus_tag LOCUS_17710 179644 177350 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_17710 180640 179675 gene locus_tag LOCUS_17720 180640 179675 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816609.1 protein_id gnl|my_center|LOCUS_17720 181436 180828 gene locus_tag LOCUS_17730 181436 180828 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_17730 181534 182478 gene locus_tag LOCUS_17740 181534 182478 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI78 protein_id gnl|my_center|LOCUS_17740 182493 184271 gene locus_tag LOCUS_17750 gene argS 182493 184271 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 protein_id gnl|my_center|LOCUS_17750 184343 185680 gene locus_tag LOCUS_17760 gene ffh 184343 185680 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 protein_id gnl|my_center|LOCUS_17760 185704 186576 gene locus_tag LOCUS_17770 gene folD 185704 186576 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 protein_id gnl|my_center|LOCUS_17770 187290 186604 gene locus_tag LOCUS_17780 187290 186604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036264.1 protein_id gnl|my_center|LOCUS_17780 187801 187283 gene locus_tag LOCUS_17790 187801 187283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 188937 188125 gene locus_tag LOCUS_17800 188937 188125 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_17800 190018 189083 gene locus_tag LOCUS_17810 190018 189083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 191150 190221 gene locus_tag LOCUS_17820 191150 190221 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074155.1 protein_id gnl|my_center|LOCUS_17820 191661 191335 gene locus_tag LOCUS_17830 191661 191335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 191965 191783 gene locus_tag LOCUS_17840 191965 191783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 194050 192881 gene locus_tag LOCUS_17850 194050 192881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 194655 194353 gene locus_tag LOCUS_17860 194655 194353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 195813 194779 gene locus_tag LOCUS_17870 195813 194779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence06 <1 5871 gene locus_tag LOCUS_17880 <1 5871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein 6852 6088 gene locus_tag LOCUS_17890 gene lpxH 6852 6088 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_17890 7549 6941 gene locus_tag LOCUS_17900 gene sodA 7549 6941 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_17900 7776 10958 gene locus_tag LOCUS_17910 7776 10958 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_17910 11012 12202 gene locus_tag LOCUS_17920 gene kbl 11012 12202 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_17920 13337 12228 gene locus_tag LOCUS_17930 13337 12228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 13514 15202 gene locus_tag LOCUS_17940 13514 15202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 16239 15256 gene locus_tag LOCUS_17950 16239 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 17051 18289 gene locus_tag LOCUS_17960 17051 18289 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW51 protein_id gnl|my_center|LOCUS_17960 19104 18265 gene locus_tag LOCUS_17970 gene sau96I-like 19104 18265 CDS product Eco47II family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166415.1 protein_id gnl|my_center|LOCUS_17970 19817 19269 gene locus_tag LOCUS_17980 19817 19269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 20645 19827 gene locus_tag LOCUS_17990 20645 19827 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_17990 21034 20711 gene locus_tag LOCUS_18000 21034 20711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 22018 21071 gene locus_tag LOCUS_18010 22018 21071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 22464 22015 gene locus_tag LOCUS_18020 22464 22015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 23818 22517 gene locus_tag LOCUS_18030 gene dbpA 23818 22517 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_18030 24826 23939 gene locus_tag LOCUS_18040 24826 23939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 25810 24965 gene locus_tag LOCUS_18050 25810 24965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 25988 26317 gene locus_tag LOCUS_18060 25988 26317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 26321 26665 gene locus_tag LOCUS_18070 26321 26665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 26680 27015 gene locus_tag LOCUS_18080 26680 27015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 27570 27073 gene locus_tag LOCUS_18090 27570 27073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 27717 28379 gene locus_tag LOCUS_18100 27717 28379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 29347 28376 gene locus_tag LOCUS_18110 29347 28376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 30594 29443 gene locus_tag LOCUS_18120 30594 29443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 30828 32222 gene locus_tag LOCUS_18130 gene speA 30828 32222 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_18130 32330 33310 gene locus_tag LOCUS_18140 32330 33310 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_18140 33333 33623 gene locus_tag LOCUS_18150 33333 33623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 34221 33658 gene locus_tag LOCUS_18160 34221 33658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 34768 34313 gene locus_tag LOCUS_18170 34768 34313 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_18170 35777 34755 gene locus_tag LOCUS_18180 gene asd 35777 34755 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_18180 35819 38695 gene locus_tag LOCUS_18190 35819 38695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 38785 39819 gene locus_tag LOCUS_18200 gene speB 38785 39819 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_18200 39973 40695 gene locus_tag LOCUS_18210 39973 40695 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_18210 40688 42355 gene locus_tag LOCUS_18220 gene gsiA 40688 42355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_18220 43408 42356 gene locus_tag LOCUS_18230 43408 42356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 43511 44362 gene locus_tag LOCUS_18240 43511 44362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937664.1 protein_id gnl|my_center|LOCUS_18240 45177 44365 gene locus_tag LOCUS_18250 45177 44365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 45988 45179 gene locus_tag LOCUS_18260 45988 45179 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_18260 46340 45978 gene locus_tag LOCUS_18270 46340 45978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393712.1 protein_id gnl|my_center|LOCUS_18270 47043 46333 gene locus_tag LOCUS_18280 47043 46333 CDS product putative glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269011.1 protein_id gnl|my_center|LOCUS_18280 48416 47040 gene locus_tag LOCUS_18290 48416 47040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 49066 48413 gene locus_tag LOCUS_18300 gene atoA 49066 48413 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_18300 49787 49086 gene locus_tag LOCUS_18310 gene atoD 49787 49086 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_18310 52093 49799 gene locus_tag LOCUS_18320 gene mrcA 52093 49799 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_18320 52660 52178 gene locus_tag LOCUS_18330 52660 52178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 53711 52647 gene locus_tag LOCUS_18340 53711 52647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 53968 56280 gene locus_tag LOCUS_18350 53968 56280 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_18350 56281 57003 gene locus_tag LOCUS_18360 gene recO 56281 57003 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM7 protein_id gnl|my_center|LOCUS_18360 58020 57007 gene locus_tag LOCUS_18370 58020 57007 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_18370 59564 58020 gene locus_tag LOCUS_18380 gene mltD 59564 58020 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962200.1 protein_id gnl|my_center|LOCUS_18380 61139 59718 gene locus_tag LOCUS_18390 gene gatA 61139 59718 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 protein_id gnl|my_center|LOCUS_18390 61358 61170 gene locus_tag LOCUS_18400 61358 61170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 62752 61439 gene locus_tag LOCUS_18410 62752 61439 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108845.1 protein_id gnl|my_center|LOCUS_18410 63593 62796 gene locus_tag LOCUS_18420 63593 62796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 65266 63590 gene locus_tag LOCUS_18430 65266 63590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_18430 66305 65301 gene locus_tag LOCUS_18440 66305 65301 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_18440 66829 66395 gene locus_tag LOCUS_18450 gene dut 66829 66395 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_18450 68289 66826 gene locus_tag LOCUS_18460 68289 66826 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769160.1 protein_id gnl|my_center|LOCUS_18460 68498 70177 gene locus_tag LOCUS_18470 68498 70177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 70179 71162 gene locus_tag LOCUS_18480 gene gpsA 70179 71162 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_18480 74359 71186 gene locus_tag LOCUS_18490 74359 71186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_18490 74387 75061 gene locus_tag LOCUS_18500 74387 75061 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_18500 75295 76434 gene locus_tag LOCUS_18510 75295 76434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962429.1 protein_id gnl|my_center|LOCUS_18510 77115 76444 gene locus_tag LOCUS_18520 77115 76444 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256448.1 protein_id gnl|my_center|LOCUS_18520 79273 77135 gene locus_tag LOCUS_18530 79273 77135 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_18530 81136 79331 gene locus_tag LOCUS_18540 gene uvrC 81136 79331 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_18540 81217 81561 gene locus_tag LOCUS_18550 81217 81561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 82667 81558 gene locus_tag LOCUS_18560 82667 81558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 86594 82983 gene locus_tag LOCUS_18570 86594 82983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 87803 86640 gene locus_tag LOCUS_18580 87803 86640 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_18580 89181 87844 gene locus_tag LOCUS_18590 89181 87844 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_18590 89880 89257 gene locus_tag LOCUS_18600 89880 89257 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_18600 90031 91461 gene locus_tag LOCUS_18610 gene asnS 90031 91461 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_18610 91592 93049 gene locus_tag LOCUS_18620 gene rpoN 91592 93049 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_18620 93049 93651 gene locus_tag LOCUS_18630 93049 93651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962552.1 protein_id gnl|my_center|LOCUS_18630 94289 93648 gene locus_tag LOCUS_18640 94289 93648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_18640 95097 94378 gene locus_tag LOCUS_18650 gene lipB 95097 94378 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_18650 96086 95097 gene locus_tag LOCUS_18660 96086 95097 CDS product phosphate starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_18660 96765 96163 gene locus_tag LOCUS_18670 gene lspA 96765 96163 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U05 protein_id gnl|my_center|LOCUS_18670 97148 96771 gene locus_tag LOCUS_18680 gene dksA 97148 96771 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_18680 100629 97231 gene locus_tag LOCUS_18690 gene ileS 100629 97231 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_18690 100921 101499 gene locus_tag LOCUS_18700 100921 101499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 101604 104261 gene locus_tag LOCUS_18710 101604 104261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 104318 104959 gene locus_tag LOCUS_18720 104318 104959 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705044.1 protein_id gnl|my_center|LOCUS_18720 105113 106111 gene locus_tag LOCUS_18730 105113 106111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 106118 108301 gene locus_tag LOCUS_18740 106118 108301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 109659 108391 gene locus_tag LOCUS_18750 109659 108391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 109870 110445 gene locus_tag LOCUS_18760 109870 110445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 110445 111188 gene locus_tag LOCUS_18770 110445 111188 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_18770 111189 112403 gene locus_tag LOCUS_18780 111189 112403 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_18780 112441 113652 gene locus_tag LOCUS_18790 112441 113652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_18790 113649 114341 gene locus_tag LOCUS_18800 113649 114341 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_18800 114376 115548 gene locus_tag LOCUS_18810 114376 115548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_18810 115589 116446 gene locus_tag LOCUS_18820 115589 116446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 117354 116443 gene locus_tag LOCUS_18830 117354 116443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 117842 117426 gene locus_tag LOCUS_18840 117842 117426 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_18840 119708 117855 gene locus_tag LOCUS_18850 119708 117855 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072494.1 protein_id gnl|my_center|LOCUS_18850 119799 120392 gene locus_tag LOCUS_18860 119799 120392 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_18860 120473 120697 gene locus_tag LOCUS_18870 120473 120697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_18870 122759 120768 gene locus_tag LOCUS_18880 122759 120768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 123195 122782 gene locus_tag LOCUS_18890 123195 122782 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326711.1 protein_id gnl|my_center|LOCUS_18890 125321 123264 gene locus_tag LOCUS_18900 125321 123264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 126442 125321 gene locus_tag LOCUS_18910 126442 125321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_18910 126698 130036 gene locus_tag LOCUS_18920 gene secA 126698 130036 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_18920 130187 130807 gene locus_tag LOCUS_18930 130187 130807 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_18930 130807 132297 gene locus_tag LOCUS_18940 130807 132297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 133607 132306 gene locus_tag LOCUS_18950 133607 132306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 135079 133871 gene locus_tag LOCUS_18960 135079 133871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 136251 135163 gene locus_tag LOCUS_18970 136251 135163 CDS product methionine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705579.1 protein_id gnl|my_center|LOCUS_18970 136587 138365 gene locus_tag LOCUS_18980 136587 138365 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_18980 138406 139110 gene locus_tag LOCUS_18990 138406 139110 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_18990 139134 139922 gene locus_tag LOCUS_19000 139134 139922 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_19000 139943 141391 gene locus_tag LOCUS_19010 139943 141391 CDS product 2-hydroxymuconic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 protein_id gnl|my_center|LOCUS_19010 143031 141688 gene locus_tag LOCUS_19020 gene rmuC 143031 141688 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_19020 143621 143034 gene locus_tag LOCUS_19030 143621 143034 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053861.1 protein_id gnl|my_center|LOCUS_19030 144125 143748 gene locus_tag LOCUS_19040 144125 143748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 146027 144387 gene locus_tag LOCUS_19050 146027 144387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 146153 148774 gene locus_tag LOCUS_19060 146153 148774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 148829 148903 gene locus_tag LOCUS_t00250 148829 148903 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 149216 149479 gene locus_tag LOCUS_19070 149216 149479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 149534 150076 gene locus_tag LOCUS_19080 149534 150076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 150263 150580 gene locus_tag LOCUS_19090 150263 150580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 150778 151983 gene locus_tag LOCUS_19100 150778 151983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 152339 152046 gene locus_tag LOCUS_19110 152339 152046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 153038 152466 gene locus_tag LOCUS_19120 153038 152466 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_19120 153994 153092 gene locus_tag LOCUS_19130 153994 153092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 155049 154138 gene locus_tag LOCUS_19140 155049 154138 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_19140 155885 155160 gene locus_tag LOCUS_19150 155885 155160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 156261 155932 gene locus_tag LOCUS_19160 156261 155932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 156818 156360 gene locus_tag LOCUS_19170 156818 156360 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 protein_id gnl|my_center|LOCUS_19170 156903 157364 gene locus_tag LOCUS_19180 156903 157364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 158456 157425 gene locus_tag LOCUS_19190 158456 157425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 158724 159143 gene locus_tag LOCUS_19200 158724 159143 CDS product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361994.1 protein_id gnl|my_center|LOCUS_19200 159130 159675 gene locus_tag LOCUS_19210 159130 159675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 159650 161002 gene locus_tag LOCUS_19220 159650 161002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 161930 161058 gene locus_tag LOCUS_19230 161930 161058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 162627 161935 gene locus_tag LOCUS_19240 162627 161935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 162794 163465 gene locus_tag LOCUS_19250 162794 163465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 164736 163462 gene locus_tag LOCUS_19260 164736 163462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 165452 164736 gene locus_tag LOCUS_19270 165452 164736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 167226 165586 gene locus_tag LOCUS_19280 167226 165586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 167414 168727 gene locus_tag LOCUS_19290 167414 168727 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867775.1 protein_id gnl|my_center|LOCUS_19290 168733 170331 gene locus_tag LOCUS_19300 168733 170331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 170374 170817 gene locus_tag LOCUS_19310 170374 170817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 170810 171499 gene locus_tag LOCUS_19320 170810 171499 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_19320 171503 172975 gene locus_tag LOCUS_19330 171503 172975 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_19330 174948 175883 gene locus_tag LOCUS_19340 174948 175883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 176588 175908 gene locus_tag LOCUS_19350 176588 175908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_19350 178423 176648 gene locus_tag LOCUS_19360 gene batD 178423 176648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_19360 179211 178426 gene locus_tag LOCUS_19370 179211 178426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 180238 179195 gene locus_tag LOCUS_19380 gene batB 180238 179195 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_19380 181239 180238 gene locus_tag LOCUS_19390 gene batA 181239 180238 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_19390 182146 181229 gene locus_tag LOCUS_19400 182146 181229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_19400 182904 182146 gene locus_tag LOCUS_19410 182904 182146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_19410 184034 183030 gene locus_tag LOCUS_19420 184034 183030 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_19420 184753 184241 gene locus_tag LOCUS_19430 184753 184241 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEB9 protein_id gnl|my_center|LOCUS_19430 185613 186500 gene locus_tag LOCUS_19440 185613 186500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 186497 187120 gene locus_tag LOCUS_19450 186497 187120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 187400 189721 gene locus_tag LOCUS_19460 187400 189721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 189675 190550 gene locus_tag LOCUS_19470 189675 190550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87PM1 protein_id gnl|my_center|LOCUS_19470 191192 190554 gene locus_tag LOCUS_19480 191192 190554 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 protein_id gnl|my_center|LOCUS_19480 191711 191199 gene locus_tag LOCUS_19490 191711 191199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 194165 191892 gene locus_tag LOCUS_19500 194165 191892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201873.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence07 1812 463 gene locus_tag LOCUS_19510 gene norM 1812 463 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_19510 2153 1917 gene locus_tag LOCUS_19520 2153 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_19520 3422 2259 gene locus_tag LOCUS_19530 3422 2259 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_19530 4345 3401 gene locus_tag LOCUS_19540 4345 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 5184 4342 gene locus_tag LOCUS_19550 5184 4342 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_19550 6487 5186 gene locus_tag LOCUS_19560 gene natB 6487 5186 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_19560 7386 6484 gene locus_tag LOCUS_19570 gene natA 7386 6484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_19570 7765 13242 gene locus_tag LOCUS_19580 7765 13242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_19580 13221 15545 gene locus_tag LOCUS_19590 13221 15545 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_19590 16019 15549 gene locus_tag LOCUS_19600 16019 15549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 17182 16052 gene locus_tag LOCUS_19610 gene dnaJ 17182 16052 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_19610 17762 17196 gene locus_tag LOCUS_19620 gene grpE 17762 17196 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_19620 18527 17922 gene locus_tag LOCUS_19630 18527 17922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 19850 18543 gene locus_tag LOCUS_19640 gene murA 19850 18543 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 protein_id gnl|my_center|LOCUS_19640 20495 19863 gene locus_tag LOCUS_19650 20495 19863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_19650 22806 20506 gene locus_tag LOCUS_19660 gene uvrD 22806 20506 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_19660 23302 23538 gene locus_tag LOCUS_19670 23302 23538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 23557 24027 gene locus_tag LOCUS_19680 gene rpsG 23557 24027 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_19680 24052 26154 gene locus_tag LOCUS_19690 gene fusA 24052 26154 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 protein_id gnl|my_center|LOCUS_19690 26166 26471 gene locus_tag LOCUS_19700 gene rpsJ 26166 26471 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_19700 26504 27121 gene locus_tag LOCUS_19710 gene rplC 26504 27121 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ99 protein_id gnl|my_center|LOCUS_19710 27121 27750 gene locus_tag LOCUS_19720 gene rplD 27121 27750 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_19720 27754 28044 gene locus_tag LOCUS_19730 gene rplW 27754 28044 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ97 protein_id gnl|my_center|LOCUS_19730 28050 28877 gene locus_tag LOCUS_19740 gene rplB 28050 28877 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ96 protein_id gnl|my_center|LOCUS_19740 28883 29164 gene locus_tag LOCUS_19750 gene rpsS 28883 29164 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ95 protein_id gnl|my_center|LOCUS_19750 29176 29613 gene locus_tag LOCUS_19760 gene rplV 29176 29613 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 protein_id gnl|my_center|LOCUS_19760 29619 30347 gene locus_tag LOCUS_19770 gene rpsC 29619 30347 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_19770 30373 30795 gene locus_tag LOCUS_19780 gene rplP 30373 30795 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ92 protein_id gnl|my_center|LOCUS_19780 30807 31010 gene locus_tag LOCUS_19790 gene rpmC 30807 31010 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A484 protein_id gnl|my_center|LOCUS_19790 31010 31279 gene locus_tag LOCUS_19800 gene rpsQ1 31010 31279 CDS product 30S ribosomal protein S17 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A485 protein_id gnl|my_center|LOCUS_19800 31279 31647 gene locus_tag LOCUS_19810 gene rplN 31279 31647 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_19810 31660 31980 gene locus_tag LOCUS_19820 gene rplX 31660 31980 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL9 protein_id gnl|my_center|LOCUS_19820 31980 32528 gene locus_tag LOCUS_19830 gene rplE 31980 32528 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_19830 32531 32800 gene locus_tag LOCUS_19840 gene rpsN 32531 32800 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_19840 32805 33206 gene locus_tag LOCUS_19850 gene rpsH 32805 33206 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A490 protein_id gnl|my_center|LOCUS_19850 33230 33781 gene locus_tag LOCUS_19860 gene rplF 33230 33781 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 protein_id gnl|my_center|LOCUS_19860 33788 34141 gene locus_tag LOCUS_19870 gene rplR 33788 34141 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ83 protein_id gnl|my_center|LOCUS_19870 34151 34675 gene locus_tag LOCUS_19880 gene rpsE 34151 34675 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ82 protein_id gnl|my_center|LOCUS_19880 34690 34872 gene locus_tag LOCUS_19890 gene rpmD 34690 34872 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ81 protein_id gnl|my_center|LOCUS_19890 34896 35345 gene locus_tag LOCUS_19900 gene rplO 34896 35345 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM7 protein_id gnl|my_center|LOCUS_19900 35355 36701 gene locus_tag LOCUS_19910 gene secY 35355 36701 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM8 protein_id gnl|my_center|LOCUS_19910 36723 36938 gene locus_tag LOCUS_19920 gene infA 36723 36938 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ78 protein_id gnl|my_center|LOCUS_19920 37099 37476 gene locus_tag LOCUS_19930 gene rpsM 37099 37476 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ76 protein_id gnl|my_center|LOCUS_19930 37489 37884 gene locus_tag LOCUS_19940 gene rpsK 37489 37884 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 protein_id gnl|my_center|LOCUS_19940 37905 38510 gene locus_tag LOCUS_19950 gene rpsD 37905 38510 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ74 protein_id gnl|my_center|LOCUS_19950 38578 39531 gene locus_tag LOCUS_19960 gene rpoA 38578 39531 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_19960 39538 40104 gene locus_tag LOCUS_19970 gene rplQ 39538 40104 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ72 protein_id gnl|my_center|LOCUS_19970 40201 41319 gene locus_tag LOCUS_19980 gene carA 40201 41319 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_19980 41319 42608 gene locus_tag LOCUS_19990 gene eno 41319 42608 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIR2 protein_id gnl|my_center|LOCUS_19990 42633 43940 gene locus_tag LOCUS_20000 gene gltA 42633 43940 CDS product type I citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_20000 44277 46196 gene locus_tag LOCUS_20010 gene rpsA 44277 46196 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963900.1 protein_id gnl|my_center|LOCUS_20010 46320 48044 gene locus_tag LOCUS_20020 46320 48044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 48198 49835 gene locus_tag LOCUS_20030 48198 49835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 49849 50649 gene locus_tag LOCUS_20040 49849 50649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 50712 51071 gene locus_tag LOCUS_20050 50712 51071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 51189 51962 gene locus_tag LOCUS_20060 51189 51962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 52007 53101 gene locus_tag LOCUS_20070 52007 53101 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 protein_id gnl|my_center|LOCUS_20070 53107 53892 gene locus_tag LOCUS_20080 53107 53892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_20080 53957 55432 gene locus_tag LOCUS_20090 53957 55432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 55481 56569 gene locus_tag LOCUS_20100 55481 56569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 56562 57089 gene locus_tag LOCUS_20110 56562 57089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 57655 57086 gene locus_tag LOCUS_20120 57655 57086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 60080 57777 gene locus_tag LOCUS_20130 60080 57777 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_20130 60771 60187 gene locus_tag LOCUS_20140 60771 60187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_20140 61280 60768 gene locus_tag LOCUS_20150 61280 60768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 61346 62632 gene locus_tag LOCUS_20160 61346 62632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205701.1 protein_id gnl|my_center|LOCUS_20160 62632 63339 gene locus_tag LOCUS_20170 gene pepE 62632 63339 CDS product dipeptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_20170 63336 64025 gene locus_tag LOCUS_20180 63336 64025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531709.1 protein_id gnl|my_center|LOCUS_20180 64022 65185 gene locus_tag LOCUS_20190 64022 65185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 65193 65876 gene locus_tag LOCUS_20200 65193 65876 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU9 protein_id gnl|my_center|LOCUS_20200 66051 67571 gene locus_tag LOCUS_20210 gene gpmI 66051 67571 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_20210 67574 67996 gene locus_tag LOCUS_20220 67574 67996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761508.1 protein_id gnl|my_center|LOCUS_20220 67996 68784 gene locus_tag LOCUS_20230 gene map 67996 68784 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_20230 68781 69551 gene locus_tag LOCUS_20240 68781 69551 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_20240 70665 69553 gene locus_tag LOCUS_20250 70665 69553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 72404 70923 gene locus_tag LOCUS_20260 gene cysS 72404 70923 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_20260 73230 72517 gene locus_tag LOCUS_20270 gene folE2 73230 72517 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_20270 76655 73362 gene locus_tag LOCUS_20280 76655 73362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_20280 78236 76716 gene locus_tag LOCUS_20290 78236 76716 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_20290 78930 78172 gene locus_tag LOCUS_20300 78930 78172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 79632 79393 gene locus_tag LOCUS_20310 79632 79393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 80076 81554 gene locus_tag LOCUS_20320 gene proS 80076 81554 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_20320 81556 82248 gene locus_tag LOCUS_20330 81556 82248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 82325 82397 gene locus_tag LOCUS_t00260 82325 82397 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 82420 82671 gene locus_tag LOCUS_20340 gene rpsT 82420 82671 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_20340 83613 82717 gene locus_tag LOCUS_20350 83613 82717 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_20350 83682 84251 gene locus_tag LOCUS_20360 83682 84251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 84680 84225 gene locus_tag LOCUS_20370 84680 84225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 85361 84681 gene locus_tag LOCUS_20380 85361 84681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_20380 85812 85351 gene locus_tag LOCUS_20390 85812 85351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 86321 85821 gene locus_tag LOCUS_20400 86321 85821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 86401 87450 gene locus_tag LOCUS_20410 86401 87450 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_20410 87577 88065 gene locus_tag LOCUS_20420 87577 88065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 88062 88259 gene locus_tag LOCUS_20430 88062 88259 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496448.1 protein_id gnl|my_center|LOCUS_20430 88324 88983 gene locus_tag LOCUS_20440 88324 88983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 88995 89387 gene locus_tag LOCUS_20450 88995 89387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 90699 89446 gene locus_tag LOCUS_20460 gene metK 90699 89446 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_20460 91173 92180 gene locus_tag LOCUS_20470 91173 92180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20470 92190 94832 gene locus_tag LOCUS_20480 92190 94832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20480 94848 95801 gene locus_tag LOCUS_20490 94848 95801 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU8 protein_id gnl|my_center|LOCUS_20490 97570 95855 gene locus_tag LOCUS_20500 97570 95855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 99549 97837 gene locus_tag LOCUS_20510 99549 97837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 99855 101222 gene locus_tag LOCUS_20520 99855 101222 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107715.1 protein_id gnl|my_center|LOCUS_20520 102185 101214 gene locus_tag LOCUS_20530 102185 101214 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682158.1 protein_id gnl|my_center|LOCUS_20530 103867 102254 gene locus_tag LOCUS_20540 gene pckA1 103867 102254 CDS product phosphoenolpyruvate carboxykinase [ATP] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKS7 protein_id gnl|my_center|LOCUS_20540 104368 103964 gene locus_tag LOCUS_20550 104368 103964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 105300 104365 gene locus_tag LOCUS_20560 105300 104365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 105380 106726 gene locus_tag LOCUS_20570 105380 106726 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_20570 106749 107285 gene locus_tag LOCUS_20580 gene yfiT 106749 107285 CDS product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 protein_id gnl|my_center|LOCUS_20580 108388 107279 gene locus_tag LOCUS_20590 108388 107279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 109442 108459 gene locus_tag LOCUS_20600 109442 108459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_20600 109773 109564 gene locus_tag LOCUS_20610 109773 109564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 110113 109733 gene locus_tag LOCUS_20620 110113 109733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 110870 110166 gene locus_tag LOCUS_20630 110870 110166 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9H7 protein_id gnl|my_center|LOCUS_20630 111393 110857 gene locus_tag LOCUS_20640 gene rimM 111393 110857 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_20640 111985 111404 gene locus_tag LOCUS_20650 111985 111404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 112185 116477 gene locus_tag LOCUS_20660 gene dnaE 112185 116477 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_20660 116579 116899 gene locus_tag LOCUS_20670 116579 116899 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_20670 117456 117028 gene locus_tag LOCUS_20680 117456 117028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 117693 119174 gene locus_tag LOCUS_20690 gene rprX 117693 119174 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_20690 119171 119869 gene locus_tag LOCUS_20700 gene rprY 119171 119869 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_20700 120309 119866 gene locus_tag LOCUS_20710 120309 119866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 120427 122106 gene locus_tag LOCUS_20720 120427 122106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_20720 123040 122159 gene locus_tag LOCUS_20730 123040 122159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 123180 124040 gene locus_tag LOCUS_20740 gene udp 123180 124040 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_20740 125556 124024 gene locus_tag LOCUS_20750 gene rny 125556 124024 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 protein_id gnl|my_center|LOCUS_20750 126069 125779 gene locus_tag LOCUS_20760 126069 125779 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 protein_id gnl|my_center|LOCUS_20760 126372 126082 gene locus_tag LOCUS_20770 126372 126082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993398.1 protein_id gnl|my_center|LOCUS_20770 126502 128208 gene locus_tag LOCUS_20780 126502 128208 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_20780 128213 128905 gene locus_tag LOCUS_20790 128213 128905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 128923 131415 gene locus_tag LOCUS_20800 128923 131415 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_20800 131494 132009 gene locus_tag LOCUS_20810 131494 132009 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 protein_id gnl|my_center|LOCUS_20810 132770 132051 gene locus_tag LOCUS_20820 132770 132051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_20820 132977 133402 gene locus_tag LOCUS_20830 132977 133402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 133495 134742 gene locus_tag LOCUS_20840 133495 134742 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 protein_id gnl|my_center|LOCUS_20840 134804 135043 gene locus_tag LOCUS_20850 gene rpmB 134804 135043 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_20850 135064 135246 gene locus_tag LOCUS_20860 gene rpmG 135064 135246 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_20860 135267 135419 gene locus_tag LOCUS_20870 135267 135419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 136795 136040 gene locus_tag LOCUS_20880 136795 136040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 139015 136796 gene locus_tag LOCUS_20890 139015 136796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 139345 140304 gene locus_tag LOCUS_20900 gene ftsY 139345 140304 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 protein_id gnl|my_center|LOCUS_20900 140324 141625 gene locus_tag LOCUS_20910 gene rimO 140324 141625 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_20910 142134 141637 gene locus_tag LOCUS_20920 gene ribH 142134 141637 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_20920 142823 142134 gene locus_tag LOCUS_20930 142823 142134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_20930 142924 144036 gene locus_tag LOCUS_20940 gene recF 142924 144036 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_20940 144023 144310 gene locus_tag LOCUS_20950 144023 144310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 144758 144363 gene locus_tag LOCUS_20960 gene ndk 144758 144363 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_20960 144983 145855 gene locus_tag LOCUS_20970 144983 145855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 145935 146660 gene locus_tag LOCUS_20980 145935 146660 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_20980 147654 146635 gene locus_tag LOCUS_20990 147654 146635 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048106.1 protein_id gnl|my_center|LOCUS_20990 148693 147779 gene locus_tag LOCUS_21000 148693 147779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 148835 148759 gene locus_tag LOCUS_t00270 148835 148759 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 149415 148918 gene locus_tag LOCUS_21010 149415 148918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109357.1 protein_id gnl|my_center|LOCUS_21010 149788 149417 gene locus_tag LOCUS_21020 149788 149417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 150358 149813 gene locus_tag LOCUS_21030 150358 149813 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_21030 151368 150409 gene locus_tag LOCUS_21040 gene tktC 151368 150409 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_21040 152716 151370 gene locus_tag LOCUS_21050 152716 151370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 153613 152765 gene locus_tag LOCUS_21060 gene tktA 153613 152765 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_21060 153819 154154 gene locus_tag LOCUS_21070 gene rpsF 153819 154154 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 protein_id gnl|my_center|LOCUS_21070 154167 154454 gene locus_tag LOCUS_21080 gene rpsR 154167 154454 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_21080 154466 154915 gene locus_tag LOCUS_21090 gene rplI 154466 154915 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P1 protein_id gnl|my_center|LOCUS_21090 156247 155003 gene locus_tag LOCUS_21100 156247 155003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_21100 156314 156448 gene locus_tag LOCUS_21110 156314 156448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 156438 158915 gene locus_tag LOCUS_21120 156438 158915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 158995 159870 gene locus_tag LOCUS_21130 158995 159870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 161082 159874 gene locus_tag LOCUS_21140 161082 159874 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_21140 162013 161090 gene locus_tag LOCUS_21150 162013 161090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_21150 162518 162000 gene locus_tag LOCUS_21160 162518 162000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 162985 163374 gene locus_tag LOCUS_21170 162985 163374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 164651 163371 gene locus_tag LOCUS_21180 164651 163371 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_21180 164802 165746 gene locus_tag LOCUS_21190 gene fjo19 164802 165746 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_21190 165748 166290 gene locus_tag LOCUS_21200 165748 166290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 166292 167404 gene locus_tag LOCUS_21210 gene ppiC 166292 167404 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_21210 167409 168341 gene locus_tag LOCUS_21220 gene ppiC 167409 168341 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_21220 169152 168421 gene locus_tag LOCUS_21230 169152 168421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 171020 169242 gene locus_tag LOCUS_21240 171020 169242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 171175 171798 gene locus_tag LOCUS_21250 171175 171798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 174204 171835 gene locus_tag LOCUS_21260 174204 171835 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_21260 176723 174324 gene locus_tag LOCUS_21270 176723 174324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 177547 176819 gene locus_tag LOCUS_21280 177547 176819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 179258 177537 gene locus_tag LOCUS_21290 179258 177537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 181437 179419 gene locus_tag LOCUS_21300 gene uvrB 181437 179419 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY25 protein_id gnl|my_center|LOCUS_21300 182554 181568 gene locus_tag LOCUS_21310 182554 181568 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 protein_id gnl|my_center|LOCUS_21310 183350 182607 gene locus_tag LOCUS_21320 183350 182607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_21320 184337 183786 gene locus_tag LOCUS_21330 184337 183786 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_21330 184664 184891 gene locus_tag LOCUS_21340 184664 184891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 184911 185762 gene locus_tag LOCUS_21350 184911 185762 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123291.1 protein_id gnl|my_center|LOCUS_21350 185893 186855 gene locus_tag LOCUS_21360 185893 186855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 187462 187839 gene locus_tag LOCUS_21370 187462 187839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_21370 188032 188808 gene locus_tag LOCUS_21380 188032 188808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 188899 189510 gene locus_tag LOCUS_21390 188899 189510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 189510 190562 gene locus_tag LOCUS_21400 189510 190562 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717004.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence08 2774 1098 gene locus_tag LOCUS_21410 2774 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2757 2912 gene locus_tag LOCUS_21420 2757 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 3486 3860 gene locus_tag LOCUS_21430 3486 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 4289 4711 gene locus_tag LOCUS_21440 4289 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 4704 5024 gene locus_tag LOCUS_21450 4704 5024 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067287.1 protein_id gnl|my_center|LOCUS_21450 5021 5566 gene locus_tag LOCUS_21460 5021 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 5570 5908 gene locus_tag LOCUS_21470 5570 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 6697 7659 gene locus_tag LOCUS_21480 6697 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 9655 7712 gene locus_tag LOCUS_21490 gene gyrB 9655 7712 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX10 protein_id gnl|my_center|LOCUS_21490 9891 10997 gene locus_tag LOCUS_21500 9891 10997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_21500 11000 12466 gene locus_tag LOCUS_21510 11000 12466 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_21510 14624 12468 gene locus_tag LOCUS_21520 14624 12468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 protein_id gnl|my_center|LOCUS_21520 16147 14615 gene locus_tag LOCUS_21530 gene guaA 16147 14615 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_21530 16298 17332 gene locus_tag LOCUS_21540 16298 17332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963854.1 protein_id gnl|my_center|LOCUS_21540 19789 17567 gene locus_tag LOCUS_21550 19789 17567 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_21550 21070 19817 gene locus_tag LOCUS_21560 21070 19817 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_21560 21832 21260 gene locus_tag LOCUS_21570 21832 21260 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109225.1 protein_id gnl|my_center|LOCUS_21570 23263 21836 gene locus_tag LOCUS_21580 23263 21836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 24612 23278 gene locus_tag LOCUS_21590 24612 23278 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_21590 25315 24596 gene locus_tag LOCUS_21600 gene coaX 25315 24596 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_21600 25416 25489 gene locus_tag LOCUS_t00280 25416 25489 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 26652 25810 gene locus_tag LOCUS_21610 26652 25810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 27213 26866 gene locus_tag LOCUS_21620 27213 26866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 28123 27566 gene locus_tag LOCUS_21630 gene kptA 28123 27566 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW7 protein_id gnl|my_center|LOCUS_21630 28578 28234 gene locus_tag LOCUS_21640 28578 28234 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_21640 29403 28708 gene locus_tag LOCUS_21650 29403 28708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 30247 29747 gene locus_tag LOCUS_21660 30247 29747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 30590 31201 gene locus_tag LOCUS_21670 30590 31201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 31919 31410 gene locus_tag LOCUS_21680 31919 31410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 32824 32006 gene locus_tag LOCUS_21690 32824 32006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 33685 33044 gene locus_tag LOCUS_21700 33685 33044 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355137.1 protein_id gnl|my_center|LOCUS_21700 35579 33696 gene locus_tag LOCUS_21710 35579 33696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 36392 35634 gene locus_tag LOCUS_21720 36392 35634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 36863 36456 gene locus_tag LOCUS_21730 36863 36456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 37029 38210 gene locus_tag LOCUS_21740 37029 38210 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272494.1 protein_id gnl|my_center|LOCUS_21740 38207 38542 gene locus_tag LOCUS_21750 38207 38542 CDS product ModE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546328.1 protein_id gnl|my_center|LOCUS_21750 38546 39130 gene locus_tag LOCUS_21760 38546 39130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 39108 39338 gene locus_tag LOCUS_21770 39108 39338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 39350 39790 gene locus_tag LOCUS_21780 39350 39790 CDS product molybdenum cofactor biosynthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722669.1 protein_id gnl|my_center|LOCUS_21780 39795 40727 gene locus_tag LOCUS_21790 gene moaCB 39795 40727 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_21790 40728 41726 gene locus_tag LOCUS_21800 gene moaA 40728 41726 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT69 protein_id gnl|my_center|LOCUS_21800 41971 44250 gene locus_tag LOCUS_21810 41971 44250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 45213 52094 gene locus_tag LOCUS_21820 45213 52094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 53026 52520 gene locus_tag LOCUS_21830 53026 52520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 54686 53169 gene locus_tag LOCUS_21840 54686 53169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 55605 54922 gene locus_tag LOCUS_21850 55605 54922 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168573.1 protein_id gnl|my_center|LOCUS_21850 56777 56076 gene locus_tag LOCUS_21860 56777 56076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 57238 56861 gene locus_tag LOCUS_21870 gene yjgF 57238 56861 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_21870 57198 57890 gene locus_tag LOCUS_21880 gene pabA 57198 57890 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_21880 60546 57904 gene locus_tag LOCUS_21890 60546 57904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_21890 60727 61830 gene locus_tag LOCUS_21900 60727 61830 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790917.1 protein_id gnl|my_center|LOCUS_21900 61861 62892 gene locus_tag LOCUS_21910 61861 62892 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941594.1 protein_id gnl|my_center|LOCUS_21910 63078 64235 gene locus_tag LOCUS_21920 63078 64235 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_21920 64242 64667 gene locus_tag LOCUS_21930 64242 64667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_21930 64669 65271 gene locus_tag LOCUS_21940 64669 65271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 65275 66069 gene locus_tag LOCUS_21950 65275 66069 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_21950 66195 68165 gene locus_tag LOCUS_21960 66195 68165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 68237 68719 gene locus_tag LOCUS_21970 68237 68719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_21970 69504 68716 gene locus_tag LOCUS_21980 69504 68716 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_21980 70868 69528 gene locus_tag LOCUS_21990 70868 69528 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_21990 71378 70905 gene locus_tag LOCUS_22000 71378 70905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 73063 72488 gene locus_tag LOCUS_22010 73063 72488 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Q0 protein_id gnl|my_center|LOCUS_22010 73290 73946 gene locus_tag LOCUS_22020 73290 73946 CDS product cytochrome C biogenesis protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404914.1 protein_id gnl|my_center|LOCUS_22020 74070 74633 gene locus_tag LOCUS_22030 74070 74633 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404915.1 protein_id gnl|my_center|LOCUS_22030 74646 74864 gene locus_tag LOCUS_22040 74646 74864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 74866 75258 gene locus_tag LOCUS_22050 74866 75258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 75262 77688 gene locus_tag LOCUS_22060 75262 77688 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_22060 78490 77690 gene locus_tag LOCUS_22070 78490 77690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 78529 79494 gene locus_tag LOCUS_22080 78529 79494 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_22080 79481 80155 gene locus_tag LOCUS_22090 79481 80155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 80152 81405 gene locus_tag LOCUS_22100 80152 81405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 81411 82505 gene locus_tag LOCUS_22110 81411 82505 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_22110 82645 83832 gene locus_tag LOCUS_22120 82645 83832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_22120 84668 83829 gene locus_tag LOCUS_22130 84668 83829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056262.1 protein_id gnl|my_center|LOCUS_22130 86926 85025 gene locus_tag LOCUS_22140 86926 85025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 89035 87023 gene locus_tag LOCUS_22150 89035 87023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 89197 89946 gene locus_tag LOCUS_22160 89197 89946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_22160 89930 90460 gene locus_tag LOCUS_22170 gene kdsC 89930 90460 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_22170 90501 91409 gene locus_tag LOCUS_22180 90501 91409 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_22180 91409 91987 gene locus_tag LOCUS_22190 91409 91987 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_22190 92018 93460 gene locus_tag LOCUS_22200 92018 93460 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_22200 93462 94394 gene locus_tag LOCUS_22210 93462 94394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016250.1 protein_id gnl|my_center|LOCUS_22210 95492 94560 gene locus_tag LOCUS_22220 95492 94560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 96210 95560 gene locus_tag LOCUS_22230 96210 95560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 99327 97669 gene locus_tag LOCUS_22240 99327 97669 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_22240 100267 99329 gene locus_tag LOCUS_22250 100267 99329 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_22250 101838 100264 gene locus_tag LOCUS_22260 gene mscS1 101838 100264 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963046.1 protein_id gnl|my_center|LOCUS_22260 103256 101904 gene locus_tag LOCUS_22270 gene mgtE 103256 101904 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_22270 104017 103253 gene locus_tag LOCUS_22280 gene rsmA 104017 103253 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_22280 104712 104071 gene locus_tag LOCUS_22290 104712 104071 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_22290 104926 104678 gene locus_tag LOCUS_22300 104926 104678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 105306 104935 gene locus_tag LOCUS_22310 105306 104935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 105668 105303 gene locus_tag LOCUS_22320 105668 105303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 107705 105669 gene locus_tag LOCUS_22330 gene dcp1 107705 105669 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_22330 108515 107883 gene locus_tag LOCUS_22340 108515 107883 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_22340 109381 108680 gene locus_tag LOCUS_22350 109381 108680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_22350 110115 109378 gene locus_tag LOCUS_22360 110115 109378 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_22360 110910 110125 gene locus_tag LOCUS_22370 110910 110125 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I5U8 protein_id gnl|my_center|LOCUS_22370 112773 110986 gene locus_tag LOCUS_22380 112773 110986 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403150.1 protein_id gnl|my_center|LOCUS_22380 112937 113248 gene locus_tag LOCUS_22390 112937 113248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 113238 114407 gene locus_tag LOCUS_22400 113238 114407 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_22400 114361 115428 gene locus_tag LOCUS_22410 114361 115428 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_22410 115476 117929 gene locus_tag LOCUS_22420 gene priA 115476 117929 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 protein_id gnl|my_center|LOCUS_22420 118606 117926 gene locus_tag LOCUS_22430 118606 117926 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704333.1 protein_id gnl|my_center|LOCUS_22430 119409 118609 gene locus_tag LOCUS_22440 119409 118609 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_22440 119588 120067 gene locus_tag LOCUS_22450 119588 120067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 121104 120136 gene locus_tag LOCUS_22460 121104 120136 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QE9 protein_id gnl|my_center|LOCUS_22460 121505 121086 gene locus_tag LOCUS_22470 121505 121086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 123013 121667 gene locus_tag LOCUS_22480 123013 121667 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_22480 123697 123065 gene locus_tag LOCUS_22490 123697 123065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 124405 123698 gene locus_tag LOCUS_22500 124405 123698 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_22500 125224 124406 gene locus_tag LOCUS_22510 gene panB 125224 124406 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_22510 125370 126437 gene locus_tag LOCUS_22520 125370 126437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 126592 128508 gene locus_tag LOCUS_22530 gene dnaK 126592 128508 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_22530 128592 129092 gene locus_tag LOCUS_22540 gene tpx 128592 129092 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZY8 protein_id gnl|my_center|LOCUS_22540 130034 129132 gene locus_tag LOCUS_22550 gene ppx 130034 129132 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_22550 132104 130035 gene locus_tag LOCUS_22560 gene ppk 132104 130035 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY90 protein_id gnl|my_center|LOCUS_22560 132598 132101 gene locus_tag LOCUS_22570 gene sixA 132598 132101 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_22570 133496 132723 gene locus_tag LOCUS_22580 133496 132723 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_22580 133967 133500 gene locus_tag LOCUS_22590 133967 133500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_22590 134440 133970 gene locus_tag LOCUS_22600 134440 133970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 135074 134505 gene locus_tag LOCUS_22610 gene def 135074 134505 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_22610 135581 135114 gene locus_tag LOCUS_22620 135581 135114 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_22620 135595 136410 gene locus_tag LOCUS_22630 gene dapD 135595 136410 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_22630 136516 137196 gene locus_tag LOCUS_22640 136516 137196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 137309 140125 gene locus_tag LOCUS_22650 137309 140125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 142102 140129 gene locus_tag LOCUS_22660 142102 140129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 144032 142104 gene locus_tag LOCUS_22670 144032 142104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 147360 144058 gene locus_tag LOCUS_22680 147360 144058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 148212 147427 gene locus_tag LOCUS_22690 148212 147427 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_22690 148362 149798 gene locus_tag LOCUS_22700 148362 149798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_22700 150342 150004 gene locus_tag LOCUS_22710 150342 150004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 151564 150428 gene locus_tag LOCUS_22720 151564 150428 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_22720 153051 151567 gene locus_tag LOCUS_22730 153051 151567 CDS product selenocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_22730 154450 153056 gene locus_tag LOCUS_22740 154450 153056 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_22740 154617 156014 gene locus_tag LOCUS_22750 154617 156014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_22750 156054 156965 gene locus_tag LOCUS_22760 156054 156965 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_22760 156981 157706 gene locus_tag LOCUS_22770 gene aroE 156981 157706 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_22770 157731 159902 gene locus_tag LOCUS_22780 157731 159902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963876.1 protein_id gnl|my_center|LOCUS_22780 159981 160484 gene locus_tag LOCUS_22790 159981 160484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 160569 162458 gene locus_tag LOCUS_22800 160569 162458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 162606 163973 gene locus_tag LOCUS_22810 gene aldH 162606 163973 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0U1 protein_id gnl|my_center|LOCUS_22810 164318 164794 gene locus_tag LOCUS_22820 164318 164794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 164932 165297 gene locus_tag LOCUS_22830 164932 165297 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_22830 165972 165472 gene locus_tag LOCUS_22840 165972 165472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257683.1 protein_id gnl|my_center|LOCUS_22840 167147 165969 gene locus_tag LOCUS_22850 167147 165969 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103065.1 protein_id gnl|my_center|LOCUS_22850 168295 167726 gene locus_tag LOCUS_22860 168295 167726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 168917 169126 gene locus_tag LOCUS_22870 168917 169126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 169568 169188 gene locus_tag LOCUS_22880 169568 169188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 169975 169565 gene locus_tag LOCUS_22890 169975 169565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 170400 169972 gene locus_tag LOCUS_22900 170400 169972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 170626 170444 gene locus_tag LOCUS_22910 170626 170444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 171596 170718 gene locus_tag LOCUS_22920 171596 170718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 172050 171766 gene locus_tag LOCUS_22930 172050 171766 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_22930 172390 172052 gene locus_tag LOCUS_22940 172390 172052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence09 310 1239 gene locus_tag LOCUS_22950 310 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 1236 6284 gene locus_tag LOCUS_22960 1236 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 8465 6567 gene locus_tag LOCUS_22970 gene purF 8465 6567 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_22970 9552 8500 gene locus_tag LOCUS_22980 9552 8500 CDS product 2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731314.1 protein_id gnl|my_center|LOCUS_22980 10211 9603 gene locus_tag LOCUS_22990 10211 9603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 10552 10208 gene locus_tag LOCUS_23000 10552 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 11166 10639 gene locus_tag LOCUS_23010 gene haaO 11166 10639 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_23010 11299 12291 gene locus_tag LOCUS_23020 11299 12291 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 protein_id gnl|my_center|LOCUS_23020 12830 12324 gene locus_tag LOCUS_23030 12830 12324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_23030 12914 15301 gene locus_tag LOCUS_23040 12914 15301 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_23040 15966 15298 gene locus_tag LOCUS_23050 15966 15298 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_23050 16039 16476 gene locus_tag LOCUS_23060 16039 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 16989 16480 gene locus_tag LOCUS_23070 16989 16480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_23070 17320 17000 gene locus_tag LOCUS_23080 17320 17000 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_23080 17757 17332 gene locus_tag LOCUS_23090 gene sufE 17757 17332 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_23090 18763 17846 gene locus_tag LOCUS_23100 18763 17846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 20048 18816 gene locus_tag LOCUS_23110 gene sufS 20048 18816 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_23110 21376 20048 gene locus_tag LOCUS_23120 gene sufD 21376 20048 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_23120 22140 21388 gene locus_tag LOCUS_23130 gene sufC 22140 21388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_23130 23646 22207 gene locus_tag LOCUS_23140 gene sufB 23646 22207 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_23140 23992 23663 gene locus_tag LOCUS_23150 gene sufA 23992 23663 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_23150 24159 27908 gene locus_tag LOCUS_23160 24159 27908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 28971 27892 gene locus_tag LOCUS_23170 gene moeB 28971 27892 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_23170 30083 28971 gene locus_tag LOCUS_23180 gene thiH 30083 28971 CDS product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_23180 30852 30076 gene locus_tag LOCUS_23190 gene thiG 30852 30076 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS0 protein_id gnl|my_center|LOCUS_23190 31471 30845 gene locus_tag LOCUS_23200 gene thiE 31471 30845 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWR9 protein_id gnl|my_center|LOCUS_23200 32225 31473 gene locus_tag LOCUS_23210 gene thiD 32225 31473 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962599.1 protein_id gnl|my_center|LOCUS_23210 32832 32218 gene locus_tag LOCUS_23220 32832 32218 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788060.1 protein_id gnl|my_center|LOCUS_23220 34694 32835 gene locus_tag LOCUS_23230 gene thiC 34694 32835 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWR6 protein_id gnl|my_center|LOCUS_23230 34920 34717 gene locus_tag LOCUS_23240 34920 34717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 35184 36239 gene locus_tag LOCUS_23250 gene thiL 35184 36239 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_23250 37018 36236 gene locus_tag LOCUS_23260 37018 36236 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_23260 38313 37024 gene locus_tag LOCUS_23270 gene pepP 38313 37024 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_23270 38561 39139 gene locus_tag LOCUS_23280 gene sdhC 38561 39139 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_23280 39152 41167 gene locus_tag LOCUS_23290 gene sdhA 39152 41167 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_23290 41174 41920 gene locus_tag LOCUS_23300 gene sdhB 41174 41920 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_23300 42578 43360 gene locus_tag LOCUS_23310 42578 43360 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_23310 44942 43347 gene locus_tag LOCUS_23320 44942 43347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_23320 45688 45110 gene locus_tag LOCUS_23330 45688 45110 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_23330 49152 45829 gene locus_tag LOCUS_23340 49152 45829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_23340 49376 50137 gene locus_tag LOCUS_23350 gene xth 49376 50137 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_23350 50231 51217 gene locus_tag LOCUS_23360 50231 51217 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_23360 52595 51222 gene locus_tag LOCUS_23370 gene radA 52595 51222 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_23370 53595 52597 gene locus_tag LOCUS_23380 53595 52597 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_23380 53947 53597 gene locus_tag LOCUS_23390 gene panD 53947 53597 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 protein_id gnl|my_center|LOCUS_23390 54804 53962 gene locus_tag LOCUS_23400 gene panC 54804 53962 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 protein_id gnl|my_center|LOCUS_23400 54905 55723 gene locus_tag LOCUS_23410 54905 55723 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_23410 55739 57088 gene locus_tag LOCUS_23420 55739 57088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 57096 58940 gene locus_tag LOCUS_23430 gene glmS 57096 58940 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_23430 59556 58990 gene locus_tag LOCUS_23440 gene pth 59556 58990 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 protein_id gnl|my_center|LOCUS_23440 60208 59579 gene locus_tag LOCUS_23450 gene rplY 60208 59579 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 protein_id gnl|my_center|LOCUS_23450 61164 60232 gene locus_tag LOCUS_23460 gene prsA 61164 60232 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_23460 61339 61421 gene locus_tag LOCUS_t00290 61339 61421 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 61971 61489 gene locus_tag LOCUS_23470 61971 61489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 63428 61992 gene locus_tag LOCUS_23480 63428 61992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 63698 64126 gene locus_tag LOCUS_23490 63698 64126 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_23490 64116 65684 gene locus_tag LOCUS_23500 64116 65684 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_23500 66039 65785 gene locus_tag LOCUS_23510 66039 65785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 67646 66117 gene locus_tag LOCUS_23520 gene glyS 67646 66117 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2A9 protein_id gnl|my_center|LOCUS_23520 68187 69599 gene locus_tag LOCUS_23530 68187 69599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 70201 69629 gene locus_tag LOCUS_23540 70201 69629 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_23540 70339 70908 gene locus_tag LOCUS_23550 70339 70908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_23550 71243 72217 gene locus_tag LOCUS_23560 gene nrdB 71243 72217 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_23560 72271 74736 gene locus_tag LOCUS_23570 gene nrdA 72271 74736 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_23570 74799 75269 gene locus_tag LOCUS_23580 74799 75269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 75280 75684 gene locus_tag LOCUS_23590 75280 75684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 77199 76180 gene locus_tag LOCUS_23600 77199 76180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 77421 77966 gene locus_tag LOCUS_23610 77421 77966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 78064 79509 gene locus_tag LOCUS_23620 78064 79509 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_23620 79687 81855 gene locus_tag LOCUS_23630 79687 81855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 82395 81874 gene locus_tag LOCUS_23640 82395 81874 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_23640 83573 82395 gene locus_tag LOCUS_23650 gene gcdH 83573 82395 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_23650 83652 84470 gene locus_tag LOCUS_23660 83652 84470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 85221 85970 gene locus_tag LOCUS_23670 85221 85970 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_23670 86036 86410 gene locus_tag LOCUS_23680 gene rnpA 86036 86410 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGG4 protein_id gnl|my_center|LOCUS_23680 86484 88130 gene locus_tag LOCUS_23690 86484 88130 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_23690 88643 88134 gene locus_tag LOCUS_23700 88643 88134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 91296 89368 gene locus_tag LOCUS_23710 gene dnaG 91296 89368 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_23710 92223 91408 gene locus_tag LOCUS_23720 92223 91408 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_23720 93220 92246 gene locus_tag LOCUS_23730 93220 92246 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_23730 94369 93317 gene locus_tag LOCUS_23740 gene rlmN 94369 93317 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_23740 95518 94469 gene locus_tag LOCUS_23750 gene queA 95518 94469 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_23750 96250 95618 gene locus_tag LOCUS_23760 96250 95618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 96378 96968 gene locus_tag LOCUS_23770 gene tdk 96378 96968 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_23770 96955 99423 gene locus_tag LOCUS_23780 gene mur/alr 96955 99423 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_23780 100016 99426 gene locus_tag LOCUS_23790 100016 99426 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXS5 protein_id gnl|my_center|LOCUS_23790 101855 100077 gene locus_tag LOCUS_23800 gene pepN 101855 100077 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038579.1 protein_id gnl|my_center|LOCUS_23800 102008 102367 gene locus_tag LOCUS_23810 102008 102367 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_23810 102718 102368 gene locus_tag LOCUS_23820 102718 102368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_23820 103509 102805 gene locus_tag LOCUS_23830 gene truB 103509 102805 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_23830 104297 103506 gene locus_tag LOCUS_23840 gene uppP 104297 103506 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_23840 104520 104290 gene locus_tag LOCUS_23850 104520 104290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 105404 104526 gene locus_tag LOCUS_23860 gene ftsX 105404 104526 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_23860 105745 107136 gene locus_tag LOCUS_23870 105745 107136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 107175 107942 gene locus_tag LOCUS_23880 gene cobB 107175 107942 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MN7 protein_id gnl|my_center|LOCUS_23880 107939 108403 gene locus_tag LOCUS_23890 gene rimP 107939 108403 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV6 protein_id gnl|my_center|LOCUS_23890 108416 109651 gene locus_tag LOCUS_23900 gene nusA 108416 109651 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_23900 109666 112668 gene locus_tag LOCUS_23910 gene infB 109666 112668 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 protein_id gnl|my_center|LOCUS_23910 113201 112737 gene locus_tag LOCUS_23920 113201 112737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 113631 113224 gene locus_tag LOCUS_23930 113631 113224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 113797 115044 gene locus_tag LOCUS_23940 gene actA 113797 115044 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_23940 115071 118202 gene locus_tag LOCUS_23950 gene actB 115071 118202 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_23950 118224 119609 gene locus_tag LOCUS_23960 gene actC 118224 119609 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_23960 119599 120132 gene locus_tag LOCUS_23970 gene actD 119599 120132 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_23970 120140 120802 gene locus_tag LOCUS_23980 gene actE 120140 120802 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_23980 120815 122272 gene locus_tag LOCUS_23990 gene actF 120815 122272 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_23990 122440 123483 gene locus_tag LOCUS_24000 gene ctaC 122440 123483 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_24000 123513 125285 gene locus_tag LOCUS_24010 gene ctaD 123513 125285 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_24010 125665 126693 gene locus_tag LOCUS_24020 gene ruvB 125665 126693 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_24020 126683 127621 gene locus_tag LOCUS_24030 gene queG 126683 127621 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_24030 128219 127614 gene locus_tag LOCUS_24040 128219 127614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 129089 128220 gene locus_tag LOCUS_24050 129089 128220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 129975 129094 gene locus_tag LOCUS_24060 129975 129094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 130797 130039 gene locus_tag LOCUS_24070 130797 130039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 131271 130819 gene locus_tag LOCUS_24080 gene resA 131271 130819 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HL81 protein_id gnl|my_center|LOCUS_24080 >Feature sequence10 94 315 gene locus_tag LOCUS_24090 94 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 397 1824 gene locus_tag LOCUS_24100 397 1824 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_24100 1827 3122 gene locus_tag LOCUS_24110 1827 3122 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_24110 3129 3821 gene locus_tag LOCUS_24120 3129 3821 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_24120 4384 3818 gene locus_tag LOCUS_24130 gene tag 4384 3818 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_24130 5845 4436 gene locus_tag LOCUS_24140 5845 4436 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016943.1 protein_id gnl|my_center|LOCUS_24140 6874 6023 gene locus_tag LOCUS_24150 6874 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 7160 6846 gene locus_tag LOCUS_24160 7160 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 7338 7147 gene locus_tag LOCUS_24170 7338 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 7661 7374 gene locus_tag LOCUS_24180 7661 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 8794 7811 gene locus_tag LOCUS_24190 8794 7811 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257679.1 protein_id gnl|my_center|LOCUS_24190 8938 10197 gene locus_tag LOCUS_24200 8938 10197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 10811 10194 gene locus_tag LOCUS_24210 10811 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_24210 12349 10961 gene locus_tag LOCUS_24220 12349 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 14510 12429 gene locus_tag LOCUS_24230 gene yyaL 14510 12429 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_24230 16005 14620 gene locus_tag LOCUS_24240 16005 14620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_24240 16880 16056 gene locus_tag LOCUS_24250 16880 16056 CDS product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_24250 17880 16942 gene locus_tag LOCUS_24260 gene mvaK 17880 16942 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_24260 18914 17877 gene locus_tag LOCUS_24270 gene mvaD 18914 17877 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_24270 19386 18925 gene locus_tag LOCUS_24280 19386 18925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_24280 20311 19433 gene locus_tag LOCUS_24290 gene fabD 20311 19433 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_24290 20757 20335 gene locus_tag LOCUS_24300 20757 20335 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_24300 21383 20832 gene locus_tag LOCUS_24310 gene gmhB 21383 20832 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAI7 protein_id gnl|my_center|LOCUS_24310 22062 21358 gene locus_tag LOCUS_24320 22062 21358 CDS product D-mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107286.1 protein_id gnl|my_center|LOCUS_24320 22643 22059 gene locus_tag LOCUS_24330 gene gmhA 22643 22059 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EQ4 protein_id gnl|my_center|LOCUS_24330 23653 22625 gene locus_tag LOCUS_24340 23653 22625 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766012.1 protein_id gnl|my_center|LOCUS_24340 24792 23650 gene locus_tag LOCUS_24350 24792 23650 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_24350 25351 24968 gene locus_tag LOCUS_24360 25351 24968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 26077 25403 gene locus_tag LOCUS_24370 26077 25403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 27366 26140 gene locus_tag LOCUS_24380 27366 26140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 27647 29014 gene locus_tag LOCUS_24390 27647 29014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 29413 29060 gene locus_tag LOCUS_24400 29413 29060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 29961 29404 gene locus_tag LOCUS_24410 29961 29404 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_24410 30701 29976 gene locus_tag LOCUS_24420 gene pcgL 30701 29976 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSD4 protein_id gnl|my_center|LOCUS_24420 31039 30704 gene locus_tag LOCUS_24430 31039 30704 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_24430 32010 31039 gene locus_tag LOCUS_24440 32010 31039 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_24440 32144 34765 gene locus_tag LOCUS_24450 gene alaS 32144 34765 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YB4 protein_id gnl|my_center|LOCUS_24450 34779 35510 gene locus_tag LOCUS_24460 34779 35510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 35927 35517 gene locus_tag LOCUS_24470 35927 35517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 36524 35934 gene locus_tag LOCUS_24480 36524 35934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 38604 36613 gene locus_tag LOCUS_24490 gene hutU 38604 36613 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_24490 38862 39824 gene locus_tag LOCUS_24500 gene acdS 38862 39824 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_24500 39847 40701 gene locus_tag LOCUS_24510 39847 40701 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_24510 43318 40703 gene locus_tag LOCUS_24520 43318 40703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 43985 43377 gene locus_tag LOCUS_24530 gene rnhB 43985 43377 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_24530 45108 43975 gene locus_tag LOCUS_24540 45108 43975 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355946.1 protein_id gnl|my_center|LOCUS_24540 45216 46655 gene locus_tag LOCUS_24550 45216 46655 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868271.1 protein_id gnl|my_center|LOCUS_24550 46707 47747 gene locus_tag LOCUS_24560 46707 47747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 48389 49177 gene locus_tag LOCUS_24570 48389 49177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 49339 52524 gene locus_tag LOCUS_24580 49339 52524 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 protein_id gnl|my_center|LOCUS_24580 52543 53955 gene locus_tag LOCUS_24590 52543 53955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_24590 54943 54014 gene locus_tag LOCUS_24600 54943 54014 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_24600 55508 54945 gene locus_tag LOCUS_24610 gene efp 55508 54945 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_24610 56357 55734 gene locus_tag LOCUS_24620 56357 55734 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403557.1 protein_id gnl|my_center|LOCUS_24620 57142 56360 gene locus_tag LOCUS_24630 gene lpxA 57142 56360 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_24630 58543 57143 gene locus_tag LOCUS_24640 gene fabZ 58543 57143 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_24640 59569 58547 gene locus_tag LOCUS_24650 gene lpxD 59569 58547 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_24650 60823 59600 gene locus_tag LOCUS_24660 60823 59600 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_24660 60877 62430 gene locus_tag LOCUS_24670 gene porX 60877 62430 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_24670 62455 62886 gene locus_tag LOCUS_24680 62455 62886 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_24680 62879 64084 gene locus_tag LOCUS_24690 gene ald 62879 64084 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_24690 64137 64517 gene locus_tag LOCUS_24700 64137 64517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963214.1 protein_id gnl|my_center|LOCUS_24700 65683 64514 gene locus_tag LOCUS_24710 gene putA 65683 64514 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_24710 65771 66826 gene locus_tag LOCUS_24720 gene aroB 65771 66826 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_24720 66819 68069 gene locus_tag LOCUS_24730 gene aroA 66819 68069 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW83 protein_id gnl|my_center|LOCUS_24730 70084 68066 gene locus_tag LOCUS_24740 70084 68066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404282.1 protein_id gnl|my_center|LOCUS_24740 70881 70081 gene locus_tag LOCUS_24750 70881 70081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 70927 73827 gene locus_tag LOCUS_24760 70927 73827 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963634.1 protein_id gnl|my_center|LOCUS_24760 73854 74612 gene locus_tag LOCUS_24770 73854 74612 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_24770 75270 74782 gene locus_tag LOCUS_24780 gene purE 75270 74782 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_24780 76438 75272 gene locus_tag LOCUS_24790 gene purK 76438 75272 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_24790 77060 76425 gene locus_tag LOCUS_24800 77060 76425 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_24800 77316 77987 gene locus_tag LOCUS_24810 77316 77987 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_24810 77984 78745 gene locus_tag LOCUS_24820 77984 78745 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_24820 80887 78836 gene locus_tag LOCUS_24830 80887 78836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 83059 81008 gene locus_tag LOCUS_24840 83059 81008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 86056 83186 gene locus_tag LOCUS_24850 gene gcvP 86056 83186 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_24850 86625 87038 gene locus_tag LOCUS_24860 86625 87038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 87062 88330 gene locus_tag LOCUS_24870 gene kynU 87062 88330 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_24870 88332 89672 gene locus_tag LOCUS_24880 gene kmo 88332 89672 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_24880 89952 93209 gene locus_tag LOCUS_24890 89952 93209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 93849 93181 gene locus_tag LOCUS_24900 gene nth 93849 93181 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_24900 93910 94380 gene locus_tag LOCUS_24910 gene bcp-1 93910 94380 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_24910 94838 94377 gene locus_tag LOCUS_24920 94838 94377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 96846 94849 gene locus_tag LOCUS_24930 gene dsbD 96846 94849 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_24930 98180 96852 gene locus_tag LOCUS_24940 gene tilS 98180 96852 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_24940 99497 98223 gene locus_tag LOCUS_24950 gene pabB 99497 98223 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_24950 103588 99494 gene locus_tag LOCUS_24960 103588 99494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 105070 103670 gene locus_tag LOCUS_24970 gene lpdA1 105070 103670 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_24970 105236 106333 gene locus_tag LOCUS_24980 gene prfB 105236 106333 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_24980 106516 109722 gene locus_tag LOCUS_24990 106516 109722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 109755 110093 gene locus_tag LOCUS_25000 gene arsC 109755 110093 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 protein_id gnl|my_center|LOCUS_25000 110992 110090 gene locus_tag LOCUS_25010 110992 110090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 114107 112050 gene locus_tag LOCUS_25020 gene ptrB 114107 112050 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_25020 114111 115106 gene locus_tag LOCUS_25030 gene ykuF 114111 115106 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_25030 116173 115109 gene locus_tag LOCUS_25040 116173 115109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 117327 116332 gene locus_tag LOCUS_25050 gene recA 117327 116332 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_25050 >Feature sequence11 265 1170 gene locus_tag LOCUS_25060 265 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 1223 1660 gene locus_tag LOCUS_25070 1223 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 2285 3493 gene locus_tag LOCUS_25080 2285 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 3490 3891 gene locus_tag LOCUS_25090 3490 3891 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_25090 4065 4541 gene locus_tag LOCUS_25100 4065 4541 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_25100 5136 4666 gene locus_tag LOCUS_25110 5136 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 5355 6356 gene locus_tag LOCUS_25120 5355 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 6612 7565 gene locus_tag LOCUS_25130 6612 7565 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120056.1 protein_id gnl|my_center|LOCUS_25130 7588 8100 gene locus_tag LOCUS_25140 7588 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 8102 9013 gene locus_tag LOCUS_25150 8102 9013 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_25150 9538 9098 gene locus_tag LOCUS_25160 9538 9098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 9574 9978 gene locus_tag LOCUS_25170 9574 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228912.1 protein_id gnl|my_center|LOCUS_25170 10648 11091 gene locus_tag LOCUS_25180 10648 11091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783513.1 protein_id gnl|my_center|LOCUS_25180 12049 11144 gene locus_tag LOCUS_25190 12049 11144 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_25190 12749 12375 gene locus_tag LOCUS_25200 12749 12375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 13405 12752 gene locus_tag LOCUS_25210 13405 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 13764 16025 gene locus_tag LOCUS_25220 13764 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 16514 16062 gene locus_tag LOCUS_25230 16514 16062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 17848 18516 gene locus_tag LOCUS_25240 17848 18516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 19903 18503 gene locus_tag LOCUS_25250 19903 18503 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_25250 21264 19900 gene locus_tag LOCUS_25260 21264 19900 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_25260 22987 21257 gene locus_tag LOCUS_25270 22987 21257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_25270 23324 23608 gene locus_tag LOCUS_25280 23324 23608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 23803 24234 gene locus_tag LOCUS_25290 23803 24234 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732153.1 protein_id gnl|my_center|LOCUS_25290 24285 24773 gene locus_tag LOCUS_25300 24285 24773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 24803 25225 gene locus_tag LOCUS_25310 24803 25225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 25313 25882 gene locus_tag LOCUS_25320 25313 25882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 27275 25917 gene locus_tag LOCUS_25330 27275 25917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 27605 29503 gene locus_tag LOCUS_25340 27605 29503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 29490 29888 gene locus_tag LOCUS_25350 29490 29888 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_25350 30054 30542 gene locus_tag LOCUS_25360 30054 30542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 30619 32406 gene locus_tag LOCUS_25370 30619 32406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 32472 33701 gene locus_tag LOCUS_25380 gene icd 32472 33701 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R4 protein_id gnl|my_center|LOCUS_25380 33780 34481 gene locus_tag LOCUS_25390 33780 34481 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836548.1 protein_id gnl|my_center|LOCUS_25390 34592 35221 gene locus_tag LOCUS_25400 34592 35221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898085.1 protein_id gnl|my_center|LOCUS_25400 35435 36958 gene locus_tag LOCUS_25410 35435 36958 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_25410 37008 38138 gene locus_tag LOCUS_25420 37008 38138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 38917 38135 gene locus_tag LOCUS_25430 38917 38135 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255958.1 protein_id gnl|my_center|LOCUS_25430 38936 39631 gene locus_tag LOCUS_25440 38936 39631 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_25440 39718 40260 gene locus_tag LOCUS_25450 39718 40260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 40351 40677 gene locus_tag LOCUS_25460 40351 40677 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_25460 40674 41129 gene locus_tag LOCUS_25470 40674 41129 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808562.1 protein_id gnl|my_center|LOCUS_25470 41143 41619 gene locus_tag LOCUS_25480 41143 41619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 41696 42454 gene locus_tag LOCUS_25490 41696 42454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 42513 43568 gene locus_tag LOCUS_25500 42513 43568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 43594 43965 gene locus_tag LOCUS_25510 43594 43965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 44841 44011 gene locus_tag LOCUS_25520 44841 44011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 45125 45373 gene locus_tag LOCUS_25530 45125 45373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 45485 47785 gene locus_tag LOCUS_25540 45485 47785 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107767.1 protein_id gnl|my_center|LOCUS_25540 47823 48605 gene locus_tag LOCUS_25550 47823 48605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 48606 49019 gene locus_tag LOCUS_25560 48606 49019 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870334.1 protein_id gnl|my_center|LOCUS_25560 49105 50235 gene locus_tag LOCUS_25570 49105 50235 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789721.1 protein_id gnl|my_center|LOCUS_25570 51020 50232 gene locus_tag LOCUS_25580 51020 50232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 51913 51092 gene locus_tag LOCUS_25590 51913 51092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 52111 55371 gene locus_tag LOCUS_25600 52111 55371 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K6 protein_id gnl|my_center|LOCUS_25600 56296 55403 gene locus_tag LOCUS_25610 56296 55403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 56528 57277 gene locus_tag LOCUS_25620 56528 57277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 57322 58080 gene locus_tag LOCUS_25630 57322 58080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 58485 59210 gene locus_tag LOCUS_25640 58485 59210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 59533 60324 gene locus_tag LOCUS_25650 59533 60324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 60477 62225 gene locus_tag LOCUS_25660 60477 62225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 62222 62782 gene locus_tag LOCUS_25670 62222 62782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 62847 63758 gene locus_tag LOCUS_25680 gene dhmA2 62847 63758 CDS product haloalkane dehalogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64304 protein_id gnl|my_center|LOCUS_25680 63858 64838 gene locus_tag LOCUS_25690 63858 64838 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 protein_id gnl|my_center|LOCUS_25690 64916 65515 gene locus_tag LOCUS_25700 64916 65515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 65679 66638 gene locus_tag LOCUS_25710 65679 66638 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_25710 67011 67952 gene locus_tag LOCUS_25720 gene ldh 67011 67952 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16115 protein_id gnl|my_center|LOCUS_25720 68560 70401 gene locus_tag LOCUS_25730 68560 70401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 70428 71012 gene locus_tag LOCUS_25740 70428 71012 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_25740 71110 71688 gene locus_tag LOCUS_25750 71110 71688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 73912 71723 gene locus_tag LOCUS_25760 73912 71723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence12 1693 929 gene locus_tag LOCUS_25770 1693 929 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_25770 2451 1690 gene locus_tag LOCUS_25780 gene kdsB 2451 1690 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S0 protein_id gnl|my_center|LOCUS_25780 2599 4611 gene locus_tag LOCUS_25790 gene ligA 2599 4611 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 protein_id gnl|my_center|LOCUS_25790 4611 5141 gene locus_tag LOCUS_25800 4611 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 5145 6026 gene locus_tag LOCUS_25810 gene dapA 5145 6026 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_25810 6097 6678 gene locus_tag LOCUS_25820 6097 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 6700 8130 gene locus_tag LOCUS_25830 6700 8130 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851858.1 protein_id gnl|my_center|LOCUS_25830 8155 8622 gene locus_tag LOCUS_25840 8155 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 8678 9289 gene locus_tag LOCUS_25850 gene ychE 8678 9289 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 protein_id gnl|my_center|LOCUS_25850 9328 10137 gene locus_tag LOCUS_25860 9328 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 10124 10741 gene locus_tag LOCUS_25870 10124 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 10822 11565 gene locus_tag LOCUS_25880 10822 11565 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002068284.1 protein_id gnl|my_center|LOCUS_25880 11634 12404 gene locus_tag LOCUS_25890 11634 12404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 12459 13346 gene locus_tag LOCUS_25900 gene kka 12459 13346 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972041.1 protein_id gnl|my_center|LOCUS_25900 13409 14650 gene locus_tag LOCUS_25910 13409 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 14718 15383 gene locus_tag LOCUS_25920 14718 15383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 15461 15877 gene locus_tag LOCUS_25930 15461 15877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 16397 16143 gene locus_tag LOCUS_25940 16397 16143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25940 16907 16539 gene locus_tag LOCUS_25950 16907 16539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25950 17859 17347 gene locus_tag LOCUS_25960 17859 17347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 18160 17861 gene locus_tag LOCUS_25970 18160 17861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 18771 18190 gene locus_tag LOCUS_25980 18771 18190 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_25980 18842 19690 gene locus_tag LOCUS_25990 18842 19690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 20251 19676 gene locus_tag LOCUS_26000 20251 19676 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049241.1 protein_id gnl|my_center|LOCUS_26000 21031 20375 gene locus_tag LOCUS_26010 21031 20375 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448622.1 protein_id gnl|my_center|LOCUS_26010 21669 21142 gene locus_tag LOCUS_26020 21669 21142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 22182 21766 gene locus_tag LOCUS_26030 22182 21766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 22406 22179 gene locus_tag LOCUS_26040 22406 22179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 22538 22924 gene locus_tag LOCUS_26050 22538 22924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 23740 22934 gene locus_tag LOCUS_26060 23740 22934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 23841 25019 gene locus_tag LOCUS_26070 gene pepC 23841 25019 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_26070 25512 26051 gene locus_tag LOCUS_26080 25512 26051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704518.1 protein_id gnl|my_center|LOCUS_26080 26665 26048 gene locus_tag LOCUS_26090 26665 26048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 26781 27410 gene locus_tag LOCUS_26100 gene queE 26781 27410 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_26100 27489 28310 gene locus_tag LOCUS_26110 27489 28310 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 protein_id gnl|my_center|LOCUS_26110 28371 29213 gene locus_tag LOCUS_26120 gene prmC 28371 29213 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_26120 29574 29260 gene locus_tag LOCUS_26130 gene hupB 29574 29260 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_26130 30637 29693 gene locus_tag LOCUS_26140 gene fmt 30637 29693 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H148 protein_id gnl|my_center|LOCUS_26140 31682 30696 gene locus_tag LOCUS_26150 31682 30696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 33645 31750 gene locus_tag LOCUS_26160 33645 31750 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109026.1 protein_id gnl|my_center|LOCUS_26160 34181 33642 gene locus_tag LOCUS_26170 34181 33642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932608.1 protein_id gnl|my_center|LOCUS_26170 34665 34186 gene locus_tag LOCUS_26180 34665 34186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_26180 34739 35026 gene locus_tag LOCUS_26190 34739 35026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 35214 35032 gene locus_tag LOCUS_26200 35214 35032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 35355 36698 gene locus_tag LOCUS_26210 35355 36698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 37706 36759 gene locus_tag LOCUS_26220 gene rnz 37706 36759 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_26220 38470 37706 gene locus_tag LOCUS_26230 38470 37706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 39434 38493 gene locus_tag LOCUS_26240 gene pyrB 39434 38493 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_26240 39972 39427 gene locus_tag LOCUS_26250 gene pyrR1 39972 39427 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_26250 41370 40012 gene locus_tag LOCUS_26260 41370 40012 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_26260 42191 41442 gene locus_tag LOCUS_26270 42191 41442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 42882 42193 gene locus_tag LOCUS_26280 42882 42193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 43814 43041 gene locus_tag LOCUS_26290 43814 43041 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_26290 44494 43862 gene locus_tag LOCUS_26300 44494 43862 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_26300 45314 44502 gene locus_tag LOCUS_26310 45314 44502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 45431 46372 gene locus_tag LOCUS_26320 gene oxyR 45431 46372 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_26320 46481 47197 gene locus_tag LOCUS_26330 gene ppiB 46481 47197 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U1N3 protein_id gnl|my_center|LOCUS_26330 47300 48181 gene locus_tag LOCUS_26340 gene sucD 47300 48181 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_26340 48370 48296 gene locus_tag LOCUS_t00300 48370 48296 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 48500 48892 gene locus_tag LOCUS_26350 48500 48892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_26350 48893 49537 gene locus_tag LOCUS_26360 48893 49537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 49543 51195 gene locus_tag LOCUS_26370 49543 51195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142698.1 protein_id gnl|my_center|LOCUS_26370 51935 51192 gene locus_tag LOCUS_26380 51935 51192 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_26380 52031 54853 gene locus_tag LOCUS_26390 52031 54853 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_26390 54910 56583 gene locus_tag LOCUS_26400 54910 56583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 56738 57592 gene locus_tag LOCUS_26410 56738 57592 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_26410 58148 57585 gene locus_tag LOCUS_26420 58148 57585 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_26420 58220 58861 gene locus_tag LOCUS_26430 gene pdxH 58220 58861 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4S5 protein_id gnl|my_center|LOCUS_26430 59104 58862 gene locus_tag LOCUS_26440 59104 58862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 59508 61181 gene locus_tag LOCUS_26450 59508 61181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 61213 71754 gene locus_tag LOCUS_26460 61213 71754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 >Feature sequence13 874 1527 gene locus_tag LOCUS_26470 gene sirR 874 1527 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_26470 1524 2438 gene locus_tag LOCUS_26480 gene mtsA 1524 2438 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123738.1 protein_id gnl|my_center|LOCUS_26480 2435 3259 gene locus_tag LOCUS_26490 gene mntA 2435 3259 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_26490 3252 4544 gene locus_tag LOCUS_26500 gene mntC 3252 4544 CDS product manganese transport system membrane protein MntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35024 protein_id gnl|my_center|LOCUS_26500 4544 5419 gene locus_tag LOCUS_26510 gene mntD 4544 5419 CDS product manganese transport system membrane protein MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34500 protein_id gnl|my_center|LOCUS_26510 6740 5421 gene locus_tag LOCUS_26520 6740 5421 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_26520 8474 6813 gene locus_tag LOCUS_26530 8474 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 8601 9101 gene locus_tag LOCUS_26540 gene pycA 8601 9101 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403592.1 protein_id gnl|my_center|LOCUS_26540 10269 9121 gene locus_tag LOCUS_26550 10269 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 11511 10270 gene locus_tag LOCUS_26560 11511 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 12068 11508 gene locus_tag LOCUS_26570 12068 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 13207 12284 gene locus_tag LOCUS_26580 13207 12284 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_26580 13297 13371 gene locus_tag LOCUS_t00310 13297 13371 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 13455 14336 gene locus_tag LOCUS_26590 13455 14336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 14425 14670 gene locus_tag LOCUS_26600 14425 14670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 14672 15580 gene locus_tag LOCUS_26610 14672 15580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 15649 16887 gene locus_tag LOCUS_26620 15649 16887 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203295.1 protein_id gnl|my_center|LOCUS_26620 17975 17109 gene locus_tag LOCUS_26630 17975 17109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 19306 18089 gene locus_tag LOCUS_26640 19306 18089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861451.1 protein_id gnl|my_center|LOCUS_26640 22058 19299 gene locus_tag LOCUS_26650 22058 19299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 24755 22083 gene locus_tag LOCUS_26660 24755 22083 CDS product type III restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964263.1 protein_id gnl|my_center|LOCUS_26660 26371 24764 gene locus_tag LOCUS_26670 26371 24764 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964265.1 protein_id gnl|my_center|LOCUS_26670 26712 27086 gene locus_tag LOCUS_26680 26712 27086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 27146 27586 gene locus_tag LOCUS_26690 27146 27586 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107090.1 protein_id gnl|my_center|LOCUS_26690 27888 27664 gene locus_tag LOCUS_26700 27888 27664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 28000 28716 gene locus_tag LOCUS_26710 28000 28716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 29513 29136 gene locus_tag LOCUS_26720 29513 29136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 30633 29536 gene locus_tag LOCUS_26730 30633 29536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 32284 31736 gene locus_tag LOCUS_26740 32284 31736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 33339 32401 gene locus_tag LOCUS_26750 33339 32401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 34267 33323 gene locus_tag LOCUS_26760 gene xerD 34267 33323 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WTL7 protein_id gnl|my_center|LOCUS_26760 35896 34268 gene locus_tag LOCUS_26770 35896 34268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 36022 36384 gene locus_tag LOCUS_26780 36022 36384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 37004 36432 gene locus_tag LOCUS_26790 37004 36432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 44265 37015 gene locus_tag LOCUS_26800 44265 37015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 50574 44434 gene locus_tag LOCUS_26810 50574 44434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 51019 50576 gene locus_tag LOCUS_26820 51019 50576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 51445 51044 gene locus_tag LOCUS_26830 51445 51044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 53657 51780 gene locus_tag LOCUS_26840 53657 51780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence14 334 179 gene locus_tag LOCUS_26850 334 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 1360 704 gene locus_tag LOCUS_26860 1360 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 4593 1360 gene locus_tag LOCUS_26870 4593 1360 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_26870 4854 4600 gene locus_tag LOCUS_26880 4854 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 7982 4854 gene locus_tag LOCUS_26890 7982 4854 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239259.1 protein_id gnl|my_center|LOCUS_26890 9645 8173 gene locus_tag LOCUS_26900 9645 8173 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109309.1 protein_id gnl|my_center|LOCUS_26900 10016 9663 gene locus_tag LOCUS_26910 10016 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 protein_id gnl|my_center|LOCUS_26910 12040 10052 gene locus_tag LOCUS_26920 12040 10052 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202281.1 protein_id gnl|my_center|LOCUS_26920 12240 12040 gene locus_tag LOCUS_26930 12240 12040 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202676.1 protein_id gnl|my_center|LOCUS_26930 13138 12410 gene locus_tag LOCUS_26940 13138 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 13768 13175 gene locus_tag LOCUS_26950 13768 13175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26950 15589 14192 gene locus_tag LOCUS_26960 15589 14192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 16439 17056 gene locus_tag LOCUS_26970 16439 17056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 17053 17346 gene locus_tag LOCUS_26980 17053 17346 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_26980 17401 18762 gene locus_tag LOCUS_26990 17401 18762 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_26990 19083 19673 gene locus_tag LOCUS_27000 19083 19673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 20930 19677 gene locus_tag LOCUS_27010 gene ybfO 20930 19677 CDS product putative hydrolase YbfO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31455 protein_id gnl|my_center|LOCUS_27010 21497 20946 gene locus_tag LOCUS_27020 21497 20946 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262230.1 protein_id gnl|my_center|LOCUS_27020 21939 21499 gene locus_tag LOCUS_27030 21939 21499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 22844 22281 gene locus_tag LOCUS_27040 22844 22281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 23035 23757 gene locus_tag LOCUS_27050 23035 23757 CDS product lipoprotein signal peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969609.1 protein_id gnl|my_center|LOCUS_27050 23754 24287 gene locus_tag LOCUS_27060 23754 24287 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107163.1 protein_id gnl|my_center|LOCUS_27060 24344 26086 gene locus_tag LOCUS_27070 24344 26086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 26165 27325 gene locus_tag LOCUS_27080 26165 27325 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_27080 27478 27996 gene locus_tag LOCUS_27090 gene lspA 27478 27996 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97H98 protein_id gnl|my_center|LOCUS_27090 28501 28010 gene locus_tag LOCUS_27100 28501 28010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 29261 28506 gene locus_tag LOCUS_27110 29261 28506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 29307 30578 gene locus_tag LOCUS_27120 29307 30578 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_27120 31422 30592 gene locus_tag LOCUS_27130 31422 30592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 32904 31495 gene locus_tag LOCUS_27140 32904 31495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 34469 32910 gene locus_tag LOCUS_27150 34469 32910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 34782 36854 gene locus_tag LOCUS_27160 34782 36854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 36851 38098 gene locus_tag LOCUS_27170 36851 38098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 39996 38095 gene locus_tag LOCUS_27180 39996 38095 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_27180 40116 40925 gene locus_tag LOCUS_27190 40116 40925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 41431 40916 gene locus_tag LOCUS_27200 41431 40916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 41829 41422 gene locus_tag LOCUS_27210 gene osmC 41829 41422 CDS product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_27210 43526 41832 gene locus_tag LOCUS_27220 43526 41832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_27220 46696 43529 gene locus_tag LOCUS_27230 46696 43529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_27230 46875 47561 gene locus_tag LOCUS_27240 gene ftsE 46875 47561 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_27240 47593 48477 gene locus_tag LOCUS_27250 47593 48477 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_27250 49568 48450 gene locus_tag LOCUS_27260 gene capI 49568 48450 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 protein_id gnl|my_center|LOCUS_27260 49589 50818 gene locus_tag LOCUS_27270 gene queA 49589 50818 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P8 protein_id gnl|my_center|LOCUS_27270 50811 51983 gene locus_tag LOCUS_27280 50811 51983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence15 604 1542 gene locus_tag LOCUS_27290 604 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 1542 2219 gene locus_tag LOCUS_27300 1542 2219 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107796.1 protein_id gnl|my_center|LOCUS_27300 2393 5803 gene locus_tag LOCUS_27310 2393 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 6576 5977 gene locus_tag LOCUS_27320 6576 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 7323 6808 gene locus_tag LOCUS_27330 7323 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 7713 12536 gene locus_tag LOCUS_27340 7713 12536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 12543 13454 gene locus_tag LOCUS_27350 12543 13454 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_27350 13454 15421 gene locus_tag LOCUS_27360 13454 15421 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_27360 15491 15566 gene locus_tag LOCUS_t00320 15491 15566 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 16112 15894 gene locus_tag LOCUS_27370 16112 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 17124 16435 gene locus_tag LOCUS_27380 17124 16435 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_27380 18160 17117 gene locus_tag LOCUS_27390 18160 17117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 18477 24383 gene locus_tag LOCUS_27400 18477 24383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 24484 25293 gene locus_tag LOCUS_27410 24484 25293 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_27410 25730 25299 gene locus_tag LOCUS_27420 25730 25299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 25860 26636 gene locus_tag LOCUS_27430 25860 26636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880895.1 protein_id gnl|my_center|LOCUS_27430 26679 27716 gene locus_tag LOCUS_27440 26679 27716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_27440 29024 27744 gene locus_tag LOCUS_27450 29024 27744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27450 29591 29052 gene locus_tag LOCUS_27460 29591 29052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27460 29975 29805 gene locus_tag LOCUS_27470 29975 29805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 30352 29975 gene locus_tag LOCUS_27480 30352 29975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 30795 30433 gene locus_tag LOCUS_27490 30795 30433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 31714 30893 gene locus_tag LOCUS_27500 31714 30893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 33401 31995 gene locus_tag LOCUS_27510 33401 31995 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_27510 34769 33543 gene locus_tag LOCUS_27520 34769 33543 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_27520 35870 34836 gene locus_tag LOCUS_27530 35870 34836 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_27530 35982 37124 gene locus_tag LOCUS_27540 35982 37124 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_27540 38431 37130 gene locus_tag LOCUS_27550 gene murF 38431 37130 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_27550 40057 38477 gene locus_tag LOCUS_27560 gene gldJ 40057 38477 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_27560 41083 40097 gene locus_tag LOCUS_27570 41083 40097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 41301 44747 gene locus_tag LOCUS_27580 gene porU 41301 44747 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_27580 44816 46039 gene locus_tag LOCUS_27590 gene porV 44816 46039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_27590 46071 46547 gene locus_tag LOCUS_27600 gene cdd 46071 46547 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_27600 46599 47594 gene locus_tag LOCUS_27610 gene pdhA 46599 47594 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_27610 47609 48841 gene locus_tag LOCUS_27620 gene pdhC 47609 48841 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_27620 48918 49610 gene locus_tag LOCUS_27630 48918 49610 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence16 538 134 gene locus_tag LOCUS_27640 538 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 808 539 gene locus_tag LOCUS_27650 808 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 1977 967 gene locus_tag LOCUS_27660 1977 967 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_27660 3449 2934 gene locus_tag LOCUS_27670 3449 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 3910 3458 gene locus_tag LOCUS_27680 gene smpB 3910 3458 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABD1 protein_id gnl|my_center|LOCUS_27680 4165 5073 gene locus_tag LOCUS_27690 gene pyrD 4165 5073 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_27690 5885 5082 gene locus_tag LOCUS_27700 5885 5082 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_27700 7258 5885 gene locus_tag LOCUS_27710 7258 5885 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_27710 8436 7315 gene locus_tag LOCUS_27720 8436 7315 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_27720 8563 9750 gene locus_tag LOCUS_27730 8563 9750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_27730 10413 9757 gene locus_tag LOCUS_27740 10413 9757 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_27740 10946 10410 gene locus_tag LOCUS_27750 gene ppa 10946 10410 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ21 protein_id gnl|my_center|LOCUS_27750 11648 10962 gene locus_tag LOCUS_27760 11648 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 12423 11641 gene locus_tag LOCUS_27770 12423 11641 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZQ5 protein_id gnl|my_center|LOCUS_27770 13024 12428 gene locus_tag LOCUS_27780 13024 12428 CDS product sigma factor regulator FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762908.1 protein_id gnl|my_center|LOCUS_27780 13195 13365 gene locus_tag LOCUS_27790 13195 13365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 13775 15019 gene locus_tag LOCUS_27800 13775 15019 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480279.1 protein_id gnl|my_center|LOCUS_27800 15038 15718 gene locus_tag LOCUS_27810 gene SEC59 15038 15718 CDS product dolichol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126013.1 protein_id gnl|my_center|LOCUS_27810 16626 17042 gene locus_tag LOCUS_27820 16626 17042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 17707 17054 gene locus_tag LOCUS_27830 gene lolD 17707 17054 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z80 protein_id gnl|my_center|LOCUS_27830 20115 17701 gene locus_tag LOCUS_27840 20115 17701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 21845 20232 gene locus_tag LOCUS_27850 21845 20232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 22372 21923 gene locus_tag LOCUS_27860 22372 21923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 22630 23784 gene locus_tag LOCUS_27870 gene fucP 22630 23784 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_27870 23795 24757 gene locus_tag LOCUS_27880 23795 24757 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_27880 24760 27672 gene locus_tag LOCUS_27890 24760 27672 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292032.1 protein_id gnl|my_center|LOCUS_27890 29108 27669 gene locus_tag LOCUS_27900 29108 27669 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 protein_id gnl|my_center|LOCUS_27900 30142 29126 gene locus_tag LOCUS_27910 30142 29126 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_27910 32417 30156 gene locus_tag LOCUS_27920 32417 30156 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_27920 33109 32414 gene locus_tag LOCUS_27930 gene cutC 33109 32414 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S45 protein_id gnl|my_center|LOCUS_27930 35355 33118 gene locus_tag LOCUS_27940 35355 33118 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107598.1 protein_id gnl|my_center|LOCUS_27940 36355 35357 gene locus_tag LOCUS_27950 gene aspG 36355 35357 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_27950 37748 36513 gene locus_tag LOCUS_27960 37748 36513 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107842.1 protein_id gnl|my_center|LOCUS_27960 39192 37789 gene locus_tag LOCUS_27970 39192 37789 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786303.1 protein_id gnl|my_center|LOCUS_27970 40207 39182 gene locus_tag LOCUS_27980 gene ybjZ 40207 39182 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_27980 41082 40345 gene locus_tag LOCUS_27990 41082 40345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27990 41679 41221 gene locus_tag LOCUS_28000 41679 41221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 42373 41708 gene locus_tag LOCUS_28010 42373 41708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786282.1 protein_id gnl|my_center|LOCUS_28010 43506 42391 gene locus_tag LOCUS_28020 43506 42391 CDS product macrolide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947946.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence17 1 636 gene locus_tag LOCUS_28030 1 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 3215 840 gene locus_tag LOCUS_28040 3215 840 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_28040 6856 3521 gene locus_tag LOCUS_28050 gene mfd 6856 3521 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_28050 7104 7433 gene locus_tag LOCUS_28060 7104 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 7904 8272 gene locus_tag LOCUS_28070 7904 8272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 9830 8235 gene locus_tag LOCUS_28080 gene sulP 9830 8235 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_28080 10585 9866 gene locus_tag LOCUS_28090 10585 9866 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_28090 11381 10626 gene locus_tag LOCUS_28100 11381 10626 CDS product L-allo-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017148.1 protein_id gnl|my_center|LOCUS_28100 11927 11460 gene locus_tag LOCUS_28110 11927 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 12081 12713 gene locus_tag LOCUS_28120 12081 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 12658 13089 gene locus_tag LOCUS_28130 12658 13089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 14115 13099 gene locus_tag LOCUS_28140 gene fbp 14115 13099 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJT2 protein_id gnl|my_center|LOCUS_28140 15080 14220 gene locus_tag LOCUS_28150 15080 14220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 15483 15136 gene locus_tag LOCUS_28160 gene fdx1 15483 15136 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_28160 15529 16599 gene locus_tag LOCUS_28170 15529 16599 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_28170 16691 17560 gene locus_tag LOCUS_28180 16691 17560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 17637 19415 gene locus_tag LOCUS_28190 17637 19415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 19415 20458 gene locus_tag LOCUS_28200 19415 20458 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_28200 20539 21654 gene locus_tag LOCUS_28210 gene mauG 20539 21654 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_28210 22286 21657 gene locus_tag LOCUS_28220 gene rsmG 22286 21657 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_28220 23254 22286 gene locus_tag LOCUS_28230 23254 22286 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_28230 23501 24631 gene locus_tag LOCUS_28240 gene tgt 23501 24631 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_28240 24704 25714 gene locus_tag LOCUS_28250 24704 25714 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_28250 26146 26685 gene locus_tag LOCUS_28260 26146 26685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 26791 27741 gene locus_tag LOCUS_28270 gene accA 26791 27741 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_28270 29320 27743 gene locus_tag LOCUS_28280 29320 27743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 30656 29385 gene locus_tag LOCUS_28290 30656 29385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 30720 32204 gene locus_tag LOCUS_28300 gene dnaB 30720 32204 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_28300 32242 33456 gene locus_tag LOCUS_28310 32242 33456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_28310 34506 33496 gene locus_tag LOCUS_28320 34506 33496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 34645 35538 gene locus_tag LOCUS_28330 34645 35538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 35531 36046 gene locus_tag LOCUS_28340 35531 36046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 >Feature sequence18 151 2115 gene locus_tag LOCUS_28350 151 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 2267 2971 gene locus_tag LOCUS_28360 2267 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 3113 3694 gene locus_tag LOCUS_28370 gene ruvA 3113 3694 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6A7 protein_id gnl|my_center|LOCUS_28370 3694 11031 gene locus_tag LOCUS_28380 gene sprA 3694 11031 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_28380 11084 11464 gene locus_tag LOCUS_28390 gene gcvH 11084 11464 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_28390 11482 11844 gene locus_tag LOCUS_28400 11482 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 12065 12790 gene locus_tag LOCUS_28410 12065 12790 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_28410 12839 13567 gene locus_tag LOCUS_28420 12839 13567 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU3 protein_id gnl|my_center|LOCUS_28420 13651 14358 gene locus_tag LOCUS_28430 13651 14358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 14422 15237 gene locus_tag LOCUS_28440 14422 15237 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107256.1 protein_id gnl|my_center|LOCUS_28440 15283 16209 gene locus_tag LOCUS_28450 gene ctaB 15283 16209 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_28450 16209 16784 gene locus_tag LOCUS_28460 16209 16784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 16806 17720 gene locus_tag LOCUS_28470 16806 17720 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_28470 17742 18089 gene locus_tag LOCUS_28480 17742 18089 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_28480 18095 18859 gene locus_tag LOCUS_28490 18095 18859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence19 1395 295 gene locus_tag LOCUS_28500 1395 295 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_28500 1607 1987 gene locus_tag LOCUS_28510 1607 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2712 6101 gene locus_tag LOCUS_28520 2712 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 6127 10560 gene locus_tag LOCUS_28530 6127 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 >Feature sequence20 575 1219 gene locus_tag LOCUS_28540 575 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28540 1741 3996 gene locus_tag LOCUS_28550 1741 3996 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_28550 4095 4871 gene locus_tag LOCUS_28560 4095 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 4927 6297 gene locus_tag LOCUS_28570 4927 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 7269 6727 gene locus_tag LOCUS_28580 7269 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 >Feature sequence21 3946 35 gene locus_tag LOCUS_28590 3946 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 5169 3979 gene locus_tag LOCUS_28600 5169 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28600 >Feature sequence22 <1 827 gene locus_tag LOCUS_28610 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957128.1:sugar-binding protein 824 1321 gene locus_tag LOCUS_28620 824 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 1723 2853 gene locus_tag LOCUS_28630 1723 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 2872 3369 gene locus_tag LOCUS_28640 2872 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence23 1219 284 gene locus_tag LOCUS_28650 1219 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 1996 1472 gene locus_tag LOCUS_28660 1996 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 3727 2624 gene locus_tag LOCUS_28670 3727 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 >Feature sequence24 1336 698 gene locus_tag LOCUS_28680 1336 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 <2234 1338 gene locus_tag LOCUS_28690 <2234 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957128.1:sugar-binding protein >Feature sequence25 1 312 gene locus_tag LOCUS_28700 1 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 841 1470 gene locus_tag LOCUS_28710 841 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710