>Feature sequence0001 2234 1833 gene locus_tag LOCUS_00010 2234 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 6939 2221 gene locus_tag LOCUS_00020 6939 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 7391 7317 gene locus_tag LOCUS_t00010 7391 7317 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7680 8963 gene locus_tag LOCUS_00030 7680 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 9541 8993 gene locus_tag LOCUS_00040 9541 8993 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 protein_id gnl|my_center|LOCUS_00040 9744 9577 gene locus_tag LOCUS_00050 9744 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 10296 9826 gene locus_tag LOCUS_00060 10296 9826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 >Feature sequence0002 1479 538 gene locus_tag LOCUS_00070 1479 538 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_00070 2738 1479 gene locus_tag LOCUS_00080 2738 1479 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_00080 4749 2758 gene locus_tag LOCUS_00090 gene dnaG 4749 2758 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_00090 4959 5192 gene locus_tag LOCUS_00100 4959 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 6287 5448 gene locus_tag LOCUS_00110 6287 5448 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_00110 7333 6359 gene locus_tag LOCUS_00120 7333 6359 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_00120 7527 9029 gene locus_tag LOCUS_00130 7527 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 >Feature sequence0003 2661 1738 gene locus_tag LOCUS_00140 2661 1738 CDS product S49 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962964.1 protein_id gnl|my_center|LOCUS_00140 3425 2835 gene locus_tag LOCUS_00150 3425 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 4066 3467 gene locus_tag LOCUS_00160 4066 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 4464 4063 gene locus_tag LOCUS_00170 4464 4063 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766442.1 protein_id gnl|my_center|LOCUS_00170 4805 4512 gene locus_tag LOCUS_00180 4805 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 5233 4805 gene locus_tag LOCUS_00190 5233 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 8911 5252 gene locus_tag LOCUS_00200 8911 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 9321 8911 gene locus_tag LOCUS_00210 9321 8911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 >Feature sequence0004 886 431 gene locus_tag LOCUS_00220 886 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454240.1 protein_id gnl|my_center|LOCUS_00220 1405 887 gene locus_tag LOCUS_00230 1405 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 2369 1428 gene locus_tag LOCUS_00240 2369 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_00240 3382 2603 gene locus_tag LOCUS_00250 3382 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 4116 3385 gene locus_tag LOCUS_00260 4116 3385 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251231.1 protein_id gnl|my_center|LOCUS_00260 5405 4113 gene locus_tag LOCUS_00270 5405 4113 CDS product copper-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550379.1 protein_id gnl|my_center|LOCUS_00270 5842 5402 gene locus_tag LOCUS_00280 5842 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 6499 5879 gene locus_tag LOCUS_00290 6499 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 <7410 6661 gene locus_tag LOCUS_00300 <7410 6661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403087.1:nitrous-oxide reductase >Feature sequence0005 2625 1054 gene locus_tag LOCUS_00310 2625 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 3638 2655 gene locus_tag LOCUS_00320 gene gpsA 3638 2655 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_00320 5346 3664 gene locus_tag LOCUS_00330 5346 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 5425 6936 gene locus_tag LOCUS_00340 5425 6936 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769160.1 protein_id gnl|my_center|LOCUS_00340 >Feature sequence0006 3 6149 gene locus_tag LOCUS_00350 3 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 >Feature sequence0007 <1 676 gene locus_tag LOCUS_00360 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404096.1:succinate-semialdehyde dehydrogenase 864 673 gene locus_tag LOCUS_00370 864 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 899 1030 gene locus_tag LOCUS_00380 899 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 1064 1306 gene locus_tag LOCUS_00390 1064 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00390 1699 1400 gene locus_tag LOCUS_00400 1699 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 1954 3267 gene locus_tag LOCUS_00410 1954 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 4540 3908 gene locus_tag LOCUS_00420 4540 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 5115 4552 gene locus_tag LOCUS_00430 5115 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 >Feature sequence0008 817 215 gene locus_tag LOCUS_00440 817 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932444.1 protein_id gnl|my_center|LOCUS_00440 2271 820 gene locus_tag LOCUS_00450 gene rpoN 2271 820 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_00450 3848 2412 gene locus_tag LOCUS_00460 gene asnS 3848 2412 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_00460 3992 4606 gene locus_tag LOCUS_00470 3992 4606 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_00470 4606 5985 gene locus_tag LOCUS_00480 4606 5985 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932440.1 protein_id gnl|my_center|LOCUS_00480 >Feature sequence0009 805 431 gene locus_tag LOCUS_00490 805 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404040.1 protein_id gnl|my_center|LOCUS_00490 1752 973 gene locus_tag LOCUS_00500 gene paaG 1752 973 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528003.1 protein_id gnl|my_center|LOCUS_00500 2061 1879 gene locus_tag LOCUS_00510 2061 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 2026 2562 gene locus_tag LOCUS_00520 2026 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 3051 2563 gene locus_tag LOCUS_00530 gene paaD 3051 2563 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_00530 3734 3072 gene locus_tag LOCUS_00540 3734 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 4597 3845 gene locus_tag LOCUS_00550 gene paaC 4597 3845 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813293.1 protein_id gnl|my_center|LOCUS_00550 5047 4757 gene locus_tag LOCUS_00560 gene paaB 5047 4757 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709132.1 protein_id gnl|my_center|LOCUS_00560 5277 5050 gene locus_tag LOCUS_00570 5277 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 5570 5304 gene locus_tag LOCUS_00580 5570 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 <6172 5570 gene locus_tag LOCUS_00590 <6172 5570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813298.1:phenylacetic acid degradation protein >Feature sequence0010 <1 854 gene locus_tag LOCUS_00600 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964536.1:nucleotidyltransferase 829 2565 gene locus_tag LOCUS_00610 829 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_00610 2555 3358 gene locus_tag LOCUS_00620 2555 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 protein_id gnl|my_center|LOCUS_00620 3399 4703 gene locus_tag LOCUS_00630 3399 4703 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_00630 5122 5901 gene locus_tag LOCUS_00640 5122 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 >Feature sequence0011 711 178 gene locus_tag LOCUS_00650 gene ruvC 711 178 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_00650 780 1880 gene locus_tag LOCUS_00660 780 1880 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_00660 3147 1834 gene locus_tag LOCUS_00670 3147 1834 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_00670 3397 5595 gene locus_tag LOCUS_00680 3397 5595 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_00680 >Feature sequence0012 1120 41 gene locus_tag LOCUS_00690 1120 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_00690 1806 1180 gene locus_tag LOCUS_00700 1806 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 2192 1839 gene locus_tag LOCUS_00710 gene yqjZ 2192 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54563 protein_id gnl|my_center|LOCUS_00710 2621 2244 gene locus_tag LOCUS_00720 2621 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_00720 4760 2709 gene locus_tag LOCUS_00730 gene paaN 4760 2709 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709127.1 protein_id gnl|my_center|LOCUS_00730 >Feature sequence0013 1992 1423 gene locus_tag LOCUS_00740 1992 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 2786 2115 gene locus_tag LOCUS_00750 2786 2115 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 protein_id gnl|my_center|LOCUS_00750 5026 2897 gene locus_tag LOCUS_00760 5026 2897 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_00760 >Feature sequence0014 2914 1322 gene locus_tag LOCUS_00770 2914 1322 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_00770 3050 3574 gene locus_tag LOCUS_00780 3050 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 4427 3744 gene locus_tag LOCUS_00790 4427 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969534.1 protein_id gnl|my_center|LOCUS_00790 <5061 4424 gene locus_tag LOCUS_00800 <5061 4424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964229.1:dipeptidase E >Feature sequence0015 834 2309 gene locus_tag LOCUS_00810 gene gltX 834 2309 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 protein_id gnl|my_center|LOCUS_00810 2309 2677 gene locus_tag LOCUS_00820 gene folB 2309 2677 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_00820 2730 2801 gene locus_tag LOCUS_t00020 2730 2801 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3149 3976 gene locus_tag LOCUS_00830 3149 3976 CDS product 2,5-didehydrogluconate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974782.1 protein_id gnl|my_center|LOCUS_00830 3973 4566 gene locus_tag LOCUS_00840 3973 4566 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EY6 protein_id gnl|my_center|LOCUS_00840 >Feature sequence0016 <1 1244 gene locus_tag LOCUS_00850 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963763.1:histidine kinase 1248 2006 gene locus_tag LOCUS_00860 1248 2006 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_00860 3295 2003 gene locus_tag LOCUS_00870 3295 2003 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_00870 3392 4408 gene locus_tag LOCUS_00880 gene fjo19 3392 4408 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_00880 4494 4958 gene locus_tag LOCUS_00890 4494 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 >Feature sequence0017 136 2157 gene locus_tag LOCUS_00900 136 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 3181 2174 gene locus_tag LOCUS_00910 gene fjo11 3181 2174 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_00910 3560 4369 gene locus_tag LOCUS_00920 3560 4369 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_00920 >Feature sequence0018 1815 3824 gene locus_tag LOCUS_00930 gene yyaL 1815 3824 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_00930 3840 4457 gene locus_tag LOCUS_00940 3840 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_00940 4461 4619 gene locus_tag LOCUS_00950 4461 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 >Feature sequence0019 1138 2922 gene locus_tag LOCUS_00960 1138 2922 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_00960 <4853 2919 gene locus_tag LOCUS_00970 <4853 2919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763077.1:bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase >Feature sequence0020 45 1136 gene locus_tag LOCUS_00980 45 1136 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 protein_id gnl|my_center|LOCUS_00980 1142 1921 gene locus_tag LOCUS_00990 1142 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_00990 1926 3443 gene locus_tag LOCUS_01000 1926 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 3522 4595 gene locus_tag LOCUS_01010 3522 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 >Feature sequence0021 <1 796 gene locus_tag LOCUS_01020 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808446.1:glycosyl transferase 803 1891 gene locus_tag LOCUS_01030 gene rgpA 803 1891 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837186.1 protein_id gnl|my_center|LOCUS_01030 3314 1935 gene locus_tag LOCUS_01040 3314 1935 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766006.1 protein_id gnl|my_center|LOCUS_01040 <4767 3314 gene locus_tag LOCUS_01050 <4767 3314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142782.1:aminopeptidase >Feature sequence0022 1 633 gene locus_tag LOCUS_01060 1 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 1012 1458 gene locus_tag LOCUS_01070 1012 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087770.1 protein_id gnl|my_center|LOCUS_01070 2062 1460 gene locus_tag LOCUS_01080 2062 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 3713 2199 gene locus_tag LOCUS_01090 3713 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 4568 3756 gene locus_tag LOCUS_01100 4568 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 >Feature sequence0023 <1 922 gene locus_tag LOCUS_01110 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962729.1:cytochrome-c peroxidase 1210 3564 gene locus_tag LOCUS_01120 1210 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 3527 4405 gene locus_tag LOCUS_01130 3527 4405 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287963.1 protein_id gnl|my_center|LOCUS_01130 >Feature sequence0024 <1 3913 gene locus_tag LOCUS_01140 <1 3913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023607.1:cell surface protein >Feature sequence0025 870 2102 gene locus_tag LOCUS_01150 870 2102 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_01150 2245 2565 gene locus_tag LOCUS_01160 2245 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 2562 3014 gene locus_tag LOCUS_01170 2562 3014 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_01170 3011 4099 gene locus_tag LOCUS_01180 3011 4099 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_01180 >Feature sequence0026 3552 2155 gene locus_tag LOCUS_01190 gene lpdA1 3552 2155 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_01190 >Feature sequence0027 1497 883 gene locus_tag LOCUS_01200 1497 883 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087377.1 protein_id gnl|my_center|LOCUS_01200 1823 1473 gene locus_tag LOCUS_01210 1823 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_01210 1910 2635 gene locus_tag LOCUS_01220 1910 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 3284 2625 gene locus_tag LOCUS_01230 gene truB 3284 2625 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_01230 4122 3310 gene locus_tag LOCUS_01240 gene uppP 4122 3310 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U3 protein_id gnl|my_center|LOCUS_01240 4354 4115 gene locus_tag LOCUS_01250 gene fjo13 4354 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_01250 >Feature sequence0028 2138 1005 gene locus_tag LOCUS_01260 2138 1005 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_01260 2798 2223 gene locus_tag LOCUS_01270 2798 2223 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_01270 3015 3887 gene locus_tag LOCUS_01280 3015 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 >Feature sequence0029 837 1505 gene locus_tag LOCUS_01290 837 1505 CDS product DUF4271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962358.1 protein_id gnl|my_center|LOCUS_01290 1546 2295 gene locus_tag LOCUS_01300 1546 2295 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_01300 2337 2729 gene locus_tag LOCUS_01310 gene rnpA 2337 2729 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 protein_id gnl|my_center|LOCUS_01310 2787 4439 gene locus_tag LOCUS_01320 2787 4439 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791282.1 protein_id gnl|my_center|LOCUS_01320 >Feature sequence0030 119 619 gene locus_tag LOCUS_01330 119 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 612 761 gene locus_tag LOCUS_01340 612 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 818 1423 gene locus_tag LOCUS_01350 818 1423 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_01350 1870 1433 gene locus_tag LOCUS_01360 1870 1433 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_01360 3967 2141 gene locus_tag LOCUS_01370 gene msbA 3967 2141 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_01370 >Feature sequence0031 274 2361 gene locus_tag LOCUS_01380 274 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 2458 3171 gene locus_tag LOCUS_01390 2458 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 >Feature sequence0032 538 50 gene locus_tag LOCUS_01400 gene purE 538 50 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_01400 1701 535 gene locus_tag LOCUS_01410 gene purK 1701 535 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_01410 2332 1694 gene locus_tag LOCUS_01420 2332 1694 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_01420 2511 3260 gene locus_tag LOCUS_01430 2511 3260 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_01430 3260 4012 gene locus_tag LOCUS_01440 3260 4012 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_01440 >Feature sequence0033 1941 907 gene locus_tag LOCUS_01450 1941 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 3076 1976 gene locus_tag LOCUS_01460 3076 1976 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963378.1 protein_id gnl|my_center|LOCUS_01460 4034 3099 gene locus_tag LOCUS_01470 4034 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 >Feature sequence0034 <1 644 gene locus_tag LOCUS_01480 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962243.1:exodeoxyribonuclease III 748 1728 gene locus_tag LOCUS_01490 748 1728 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_01490 2976 1822 gene locus_tag LOCUS_01500 2976 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 >Feature sequence0035 523 1824 gene locus_tag LOCUS_01510 523 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 1933 2412 gene locus_tag LOCUS_01520 1933 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 2460 2789 gene locus_tag LOCUS_01530 2460 2789 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953396.1 protein_id gnl|my_center|LOCUS_01530 3241 2795 gene locus_tag LOCUS_01540 3241 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 3408 3821 gene locus_tag LOCUS_01550 3408 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 >Feature sequence0036 3566 936 gene locus_tag LOCUS_01560 3566 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 >Feature sequence0037 <1 780 gene locus_tag LOCUS_01570 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846612.1:AIR synthase 771 1424 gene locus_tag LOCUS_01580 771 1424 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403989.1 protein_id gnl|my_center|LOCUS_01580 1421 1705 gene locus_tag LOCUS_01590 1421 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 1761 2399 gene locus_tag LOCUS_01600 1761 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 2488 2901 gene locus_tag LOCUS_01610 2488 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068355.1 protein_id gnl|my_center|LOCUS_01610 >Feature sequence0038 2182 1244 gene locus_tag LOCUS_01620 2182 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 2306 3235 gene locus_tag LOCUS_01630 2306 3235 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_01630 3426 3773 gene locus_tag LOCUS_01640 3426 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 >Feature sequence0039 1311 3788 gene locus_tag LOCUS_01650 gene topA 1311 3788 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_01650 >Feature sequence0040 1091 1822 gene locus_tag LOCUS_01660 1091 1822 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_01660 1856 2914 gene locus_tag LOCUS_01670 1856 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 >Feature sequence0041 314 2443 gene locus_tag LOCUS_01680 314 2443 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_01680 3260 2412 gene locus_tag LOCUS_01690 3260 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 >Feature sequence0042 <1 524 gene locus_tag LOCUS_01700 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103862.1:histidine kinase note possible pseudo, internal stop codon, frameshifted 529 1593 gene locus_tag LOCUS_01710 529 1593 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 protein_id gnl|my_center|LOCUS_01710 1738 2547 gene locus_tag LOCUS_01720 1738 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 2684 4030 gene locus_tag LOCUS_01730 gene hemN 2684 4030 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_01730 >Feature sequence0043 258 4031 gene locus_tag LOCUS_01740 258 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 >Feature sequence0044 775 569 gene locus_tag LOCUS_01750 775 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 1346 879 gene locus_tag LOCUS_01760 1346 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 2052 1408 gene locus_tag LOCUS_01770 2052 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 2671 2033 gene locus_tag LOCUS_01780 2671 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 3454 2756 gene locus_tag LOCUS_01790 3454 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 >Feature sequence0045 368 1429 gene locus_tag LOCUS_01800 368 1429 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107718.1 protein_id gnl|my_center|LOCUS_01800 1426 2724 gene locus_tag LOCUS_01810 1426 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 >Feature sequence0046 <1 1645 gene locus_tag LOCUS_01820 <1 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963830.1:AMP-dependent synthetase 1740 2186 gene locus_tag LOCUS_01830 1740 2186 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_01830 >Feature sequence0047 99 1769 gene locus_tag LOCUS_01840 99 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 2779 1766 gene locus_tag LOCUS_01850 gene fbp 2779 1766 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJT2 protein_id gnl|my_center|LOCUS_01850 3400 2885 gene locus_tag LOCUS_01860 3400 2885 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_01860 >Feature sequence0048 1147 275 gene locus_tag LOCUS_01870 1147 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 1892 1263 gene locus_tag LOCUS_01880 gene lipB 1892 1263 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_01880 2950 1961 gene locus_tag LOCUS_01890 2950 1961 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66954 protein_id gnl|my_center|LOCUS_01890 3677 3027 gene locus_tag LOCUS_01900 3677 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 >Feature sequence0049 2012 2905 gene locus_tag LOCUS_01910 gene cas1 2012 2905 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_01910 3351 >3836 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtttcaaagaaccatcttctgaatcaaatcacaac >Feature sequence0050 2398 1121 gene locus_tag LOCUS_01920 2398 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_01920 <3815 2647 gene locus_tag LOCUS_01930 <3815 2647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868766.1:peptide ABC transporter substrate-binding protein >Feature sequence0051 <1 900 gene locus_tag LOCUS_01940 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963198.1:DNA polymerase III subunit delta 901 3267 gene locus_tag LOCUS_01950 901 3267 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404901.1 protein_id gnl|my_center|LOCUS_01950 >Feature sequence0052 208 801 gene locus_tag LOCUS_01960 208 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 1677 811 gene locus_tag LOCUS_01970 gene mvaB 1677 811 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_01970 3168 1705 gene locus_tag LOCUS_01980 gene pepD 3168 1705 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964033.1 protein_id gnl|my_center|LOCUS_01980 3539 3189 gene locus_tag LOCUS_01990 3539 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 >Feature sequence0053 951 763 gene locus_tag LOCUS_02000 951 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 3151 977 gene locus_tag LOCUS_02010 3151 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 >Feature sequence0054 1211 657 gene locus_tag LOCUS_02020 1211 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 1323 2078 gene locus_tag LOCUS_02030 1323 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 2059 2553 gene locus_tag LOCUS_02040 2059 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence0055 3 1592 gene locus_tag LOCUS_02050 3 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 2400 1627 gene locus_tag LOCUS_02060 2400 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143505.1 protein_id gnl|my_center|LOCUS_02060 3425 2454 gene locus_tag LOCUS_02070 3425 2454 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_02070 >Feature sequence0056 134 1339 gene locus_tag LOCUS_02080 gene coaBC 134 1339 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_02080 1320 2198 gene locus_tag LOCUS_02090 1320 2198 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404280.1 protein_id gnl|my_center|LOCUS_02090 >Feature sequence0057 688 1620 gene locus_tag LOCUS_02100 688 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_02100 1914 1988 gene locus_tag LOCUS_t00030 1914 1988 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2155 3378 gene locus_tag LOCUS_02110 2155 3378 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784676.1 protein_id gnl|my_center|LOCUS_02110 >Feature sequence0058 278 1336 gene locus_tag LOCUS_02120 278 1336 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775575.1 protein_id gnl|my_center|LOCUS_02120 1696 1815 gene locus_tag LOCUS_02130 1696 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 3013 1859 gene locus_tag LOCUS_02140 3013 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 >Feature sequence0059 2365 308 gene locus_tag LOCUS_02150 2365 308 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727420.1 protein_id gnl|my_center|LOCUS_02150 3053 2421 gene locus_tag LOCUS_02160 3053 2421 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence0060 69 1151 gene locus_tag LOCUS_02170 gene gcvT 69 1151 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_02170 >Feature sequence0061 435 1184 gene locus_tag LOCUS_02180 gene npdA 435 1184 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM95 protein_id gnl|my_center|LOCUS_02180 1266 1730 gene locus_tag LOCUS_02190 gene rimP 1266 1730 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV6 protein_id gnl|my_center|LOCUS_02190 1742 2977 gene locus_tag LOCUS_02200 gene nusA 1742 2977 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_02200 >Feature sequence0062 >Feature sequence0063 <1 882 gene locus_tag LOCUS_02210 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963126.1:phosphohydrolase 919 1947 gene locus_tag LOCUS_02220 gene lpxD 919 1947 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_02220 1944 3344 gene locus_tag LOCUS_02230 gene fabZ 1944 3344 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_02230 >Feature sequence0064 1754 1149 gene locus_tag LOCUS_02240 1754 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 3558 1834 gene locus_tag LOCUS_02250 3558 1834 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_02250 >Feature sequence0065 784 314 gene locus_tag LOCUS_02260 784 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 1103 930 gene locus_tag LOCUS_02270 1103 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 2040 2228 gene locus_tag LOCUS_02280 2040 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 2228 2998 gene locus_tag LOCUS_02290 2228 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 >Feature sequence0066 492 929 gene locus_tag LOCUS_02300 492 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 >Feature sequence0067 405 64 gene locus_tag LOCUS_02310 405 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963258.1 protein_id gnl|my_center|LOCUS_02310 2339 564 gene locus_tag LOCUS_02320 2339 564 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_02320 >Feature sequence0068 977 1714 gene locus_tag LOCUS_02330 977 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 1726 3228 gene locus_tag LOCUS_02340 1726 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 3521 3276 gene locus_tag LOCUS_02350 3521 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 >Feature sequence0069 990 2537 gene locus_tag LOCUS_02360 990 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 <3512 2545 gene locus_tag LOCUS_02370 <3512 2545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964115.1:murein transglycosylase >Feature sequence0070 1373 1828 gene locus_tag LOCUS_02380 1373 1828 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_02380 1825 2448 gene locus_tag LOCUS_02390 1825 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02390 >Feature sequence0071 2999 3475 gene locus_tag LOCUS_02400 2999 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 >Feature sequence0072 >Feature sequence0073 <1 795 gene locus_tag LOCUS_02410 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963537.1:serine hydrolase 2135 798 gene locus_tag LOCUS_02420 gene rmuC 2135 798 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_02420 2801 2148 gene locus_tag LOCUS_02430 2801 2148 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q89 protein_id gnl|my_center|LOCUS_02430 2945 3019 gene locus_tag LOCUS_t00040 2945 3019 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0074 <1 639 gene locus_tag LOCUS_02440 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000346242.1:6-aminohexanoate-dimer hydrolase 1244 636 gene locus_tag LOCUS_02450 1244 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 2024 1323 gene locus_tag LOCUS_02460 2024 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035555.1 protein_id gnl|my_center|LOCUS_02460 2335 2021 gene locus_tag LOCUS_02470 2335 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 >Feature sequence0075 <1 800 gene locus_tag LOCUS_02480 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962929.1:acetyl-CoA acetyltransferase 816 1592 gene locus_tag LOCUS_02490 816 1592 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_02490 1684 2112 gene locus_tag LOCUS_02500 1684 2112 CDS product SOS-response transcriptional regulator UmuD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202621.1 protein_id gnl|my_center|LOCUS_02500 2982 2167 gene locus_tag LOCUS_02510 2982 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 3430 3002 gene locus_tag LOCUS_02520 3430 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 >Feature sequence0076 120 455 gene locus_tag LOCUS_02530 120 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 476 919 gene locus_tag LOCUS_02540 476 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 1072 2487 gene locus_tag LOCUS_02550 1072 2487 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_02550 <3429 2469 gene locus_tag LOCUS_02560 <3429 2469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461064.1:diguanylate cyclase >Feature sequence0077 386 1702 gene locus_tag LOCUS_02570 gene tilS 386 1702 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_02570 >Feature sequence0078 295 1299 gene locus_tag LOCUS_02580 gene trpS 295 1299 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_02580 3223 1412 gene locus_tag LOCUS_02590 gene lepA 3223 1412 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_02590 >Feature sequence0079 2004 301 gene locus_tag LOCUS_02600 2004 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 2537 2025 gene locus_tag LOCUS_02610 2537 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 >Feature sequence0080 1237 1905 gene locus_tag LOCUS_02620 1237 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 >Feature sequence0081 2333 3304 gene locus_tag LOCUS_02630 2333 3304 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_02630 >Feature sequence0082 144 548 gene locus_tag LOCUS_02640 144 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 541 1476 gene locus_tag LOCUS_02650 541 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 1473 1970 gene locus_tag LOCUS_02660 1473 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964402.1 protein_id gnl|my_center|LOCUS_02660 1967 3208 gene locus_tag LOCUS_02670 1967 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964403.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence0083 1445 2851 gene locus_tag LOCUS_02680 1445 2851 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963534.1 protein_id gnl|my_center|LOCUS_02680 >Feature sequence0084 >Feature sequence0085 1136 240 gene locus_tag LOCUS_02690 1136 240 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_02690 1987 1133 gene locus_tag LOCUS_02700 1987 1133 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869424.1 protein_id gnl|my_center|LOCUS_02700 3140 1980 gene locus_tag LOCUS_02710 3140 1980 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_02710 >Feature sequence0086 >Feature sequence0087 1986 541 gene locus_tag LOCUS_02720 1986 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 >Feature sequence0088 746 417 gene locus_tag LOCUS_02730 746 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 >Feature sequence0089 434 1975 gene locus_tag LOCUS_02740 434 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 <3284 1944 gene locus_tag LOCUS_02750 <3284 1944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140567.1:mercuric reductase >Feature sequence0090 <1 544 gene locus_tag LOCUS_02760 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXK5:N-acetylmuramic acid 6-phosphate etherase 2409 550 gene locus_tag LOCUS_02770 2409 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 2580 3227 gene locus_tag LOCUS_02780 2580 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 >Feature sequence0091 2358 1903 gene locus_tag LOCUS_02790 2358 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 >Feature sequence0092 80 511 gene locus_tag LOCUS_02800 80 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 562 1296 gene locus_tag LOCUS_02810 562 1296 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_02810 1341 3149 gene locus_tag LOCUS_02820 1341 3149 CDS product cytochrome oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963071.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence0093 2078 606 gene locus_tag LOCUS_02830 2078 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405190.1 protein_id gnl|my_center|LOCUS_02830 3179 2139 gene locus_tag LOCUS_02840 3179 2139 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_02840 >Feature sequence0094 1349 1125 gene locus_tag LOCUS_02850 1349 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_02850 1966 1421 gene locus_tag LOCUS_02860 1966 1421 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_02860 2160 2489 gene locus_tag LOCUS_02870 2160 2489 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_02870 2557 3063 gene locus_tag LOCUS_02880 2557 3063 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271013.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence0095 <1 1486 gene locus_tag LOCUS_02890 <1 1486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962469.1:membrane protein 1613 2161 gene locus_tag LOCUS_02900 1613 2161 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_02900 3150 2299 gene locus_tag LOCUS_02910 3150 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence0096 2617 908 gene locus_tag LOCUS_02920 2617 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence0097 483 851 gene locus_tag LOCUS_02930 483 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 1022 3058 gene locus_tag LOCUS_02940 gene metG 1022 3058 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_02940 3116 3188 gene locus_tag LOCUS_t00050 3116 3188 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0098 789 19 gene locus_tag LOCUS_02950 789 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 1635 793 gene locus_tag LOCUS_02960 1635 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 <3187 1650 gene locus_tag LOCUS_02970 <3187 1650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268293.1:glycosyl transferase family 1 >Feature sequence0099 844 278 gene locus_tag LOCUS_02980 844 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 1104 1589 gene locus_tag LOCUS_02990 1104 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 1583 1858 gene locus_tag LOCUS_03000 1583 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 2403 1855 gene locus_tag LOCUS_03010 2403 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 2571 2494 gene locus_tag LOCUS_t00060 2571 2494 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2721 3023 gene locus_tag LOCUS_03020 2721 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 >Feature sequence0100 1470 1988 gene locus_tag LOCUS_03030 1470 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963095.1 protein_id gnl|my_center|LOCUS_03030 <3151 2120 gene locus_tag LOCUS_03040 <3151 2120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011069661.1:guanylate cyclase >Feature sequence0101 353 1057 gene locus_tag LOCUS_03050 353 1057 CDS product DUF4386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022315.1 protein_id gnl|my_center|LOCUS_03050 1269 1538 gene locus_tag LOCUS_03060 1269 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 1970 1885 gene locus_tag LOCUS_t00070 1970 1885 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0102 2621 465 gene locus_tag LOCUS_03070 2621 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 >Feature sequence0103 >Feature sequence0104 1592 1137 gene locus_tag LOCUS_03080 gene coaD 1592 1137 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_03080 2575 1589 gene locus_tag LOCUS_03090 gene ddl 2575 1589 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD5 protein_id gnl|my_center|LOCUS_03090 2749 3084 gene locus_tag LOCUS_03100 2749 3084 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 protein_id gnl|my_center|LOCUS_03100 >Feature sequence0105 780 2717 gene locus_tag LOCUS_03110 780 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence0106 460 723 gene locus_tag LOCUS_03120 460 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 720 1139 gene locus_tag LOCUS_03130 720 1139 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_03130 1136 2011 gene locus_tag LOCUS_03140 1136 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816527.1 protein_id gnl|my_center|LOCUS_03140 2123 2845 gene locus_tag LOCUS_03150 2123 2845 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence0107 1112 570 gene locus_tag LOCUS_03160 gene yfiT 1112 570 CDS product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 protein_id gnl|my_center|LOCUS_03160 >Feature sequence0108 1465 440 gene locus_tag LOCUS_03170 gene ruvB 1465 440 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_03170 1981 1571 gene locus_tag LOCUS_03180 1981 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 2711 2893 gene locus_tag LOCUS_03190 2711 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 >Feature sequence0109 <1 566 gene locus_tag LOCUS_03200 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257692.1:polyisoprenoid-binding protein 652 1224 gene locus_tag LOCUS_03210 652 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44577 protein_id gnl|my_center|LOCUS_03210 1251 1766 gene locus_tag LOCUS_03220 1251 1766 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_03220 1917 2360 gene locus_tag LOCUS_03230 1917 2360 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973463.1 protein_id gnl|my_center|LOCUS_03230 2360 2785 gene locus_tag LOCUS_03240 2360 2785 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence0110 1939 794 gene locus_tag LOCUS_03250 gene hppD 1939 794 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_03250 >Feature sequence0111 1181 882 gene locus_tag LOCUS_03260 1181 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 1255 2733 gene locus_tag LOCUS_03270 gene accC 1255 2733 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_03270 >Feature sequence0112 <1 734 gene locus_tag LOCUS_03280 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814727.1:iron-sulfur cluster repair di-iron protein 824 1213 gene locus_tag LOCUS_03290 824 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920892.1 protein_id gnl|my_center|LOCUS_03290 1316 2299 gene locus_tag LOCUS_03300 gene nadA 1316 2299 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_03300 >Feature sequence0113 1241 2560 gene locus_tag LOCUS_03310 gene gcdH 1241 2560 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228249.1 protein_id gnl|my_center|LOCUS_03310 2596 3018 gene locus_tag LOCUS_03320 2596 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 >Feature sequence0114 >Feature sequence0115 <1 594 gene locus_tag LOCUS_03330 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000581323.1:histidine kinase 931 1812 gene locus_tag LOCUS_03340 931 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_03340 1828 2751 gene locus_tag LOCUS_03350 1828 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 >Feature sequence0116 <1 1079 gene locus_tag LOCUS_03360 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964389.1:general secretion pathway protein GspE 1079 2983 gene locus_tag LOCUS_03370 1079 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 >Feature sequence0117 <1 649 gene locus_tag LOCUS_03380 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962587.1:SAM-dependent methyltransferase 1944 757 gene locus_tag LOCUS_03390 1944 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 <3014 2160 gene locus_tag LOCUS_03400 <3014 2160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX80:cysteine--tRNA ligase >Feature sequence0118 1841 1227 gene locus_tag LOCUS_03410 1841 1227 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 protein_id gnl|my_center|LOCUS_03410 1869 2006 gene locus_tag LOCUS_03420 1869 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 <3005 2073 gene locus_tag LOCUS_03430 <3005 2073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963280.1:TonB-dependent receptor >Feature sequence0119 2584 1040 gene locus_tag LOCUS_03440 2584 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 >Feature sequence0120 1285 539 gene locus_tag LOCUS_03450 1285 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 >Feature sequence0121 1112 609 gene locus_tag LOCUS_03460 1112 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 1699 1331 gene locus_tag LOCUS_03470 1699 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 1919 2833 gene locus_tag LOCUS_03480 1919 2833 CDS product pirin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921014.1 protein_id gnl|my_center|LOCUS_03480 >Feature sequence0122 3 470 gene locus_tag LOCUS_03490 3 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 493 1524 gene locus_tag LOCUS_03500 gene ctaC 493 1524 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_03500 >Feature sequence0123 >Feature sequence0124 401 189 gene locus_tag LOCUS_03510 401 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 1457 729 gene locus_tag LOCUS_03520 1457 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 2429 1650 gene locus_tag LOCUS_03530 2429 1650 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972833.1 protein_id gnl|my_center|LOCUS_03530 2970 2491 gene locus_tag LOCUS_03540 2970 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 >Feature sequence0125 1181 780 gene locus_tag LOCUS_03550 1181 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence0126 <1 2099 gene locus_tag LOCUS_03560 <1 2099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KD17:phosphoribosylformylglycinamidine synthase subunit PurL 2244 2861 gene locus_tag LOCUS_03570 gene plsY 2244 2861 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WTS7 protein_id gnl|my_center|LOCUS_03570 >Feature sequence0127 1163 429 gene locus_tag LOCUS_03580 1163 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 2075 1335 gene locus_tag LOCUS_03590 2075 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 >Feature sequence0128 1661 1990 gene locus_tag LOCUS_03600 gene sufA 1661 1990 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence0129 484 714 gene locus_tag LOCUS_03610 484 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 699 1097 gene locus_tag LOCUS_03620 699 1097 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496939.1 protein_id gnl|my_center|LOCUS_03620 1143 1427 gene locus_tag LOCUS_03630 1143 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 1336 1587 gene locus_tag LOCUS_03640 1336 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 1717 2298 gene locus_tag LOCUS_03650 1717 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 2908 2372 gene locus_tag LOCUS_03660 2908 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence0130 1359 733 gene locus_tag LOCUS_03670 1359 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 >Feature sequence0131 1382 222 gene locus_tag LOCUS_03680 1382 222 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119917.1 protein_id gnl|my_center|LOCUS_03680 1919 1512 gene locus_tag LOCUS_03690 1919 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2460 2113 gene locus_tag LOCUS_03700 2460 2113 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_03700 >Feature sequence0132 1325 198 gene locus_tag LOCUS_03710 1325 198 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_03710 1517 1867 gene locus_tag LOCUS_03720 1517 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 <2918 2227 gene locus_tag LOCUS_03730 <2918 2227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962888.1:RNA methyltransferase >Feature sequence0133 593 174 gene locus_tag LOCUS_03740 593 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 1924 695 gene locus_tag LOCUS_03750 1924 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 2904 1924 gene locus_tag LOCUS_03760 2904 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence0134 84 1622 gene locus_tag LOCUS_03770 gene rny 84 1622 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 protein_id gnl|my_center|LOCUS_03770 >Feature sequence0135 252 1280 gene locus_tag LOCUS_03780 252 1280 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_03780 1709 1281 gene locus_tag LOCUS_03790 1709 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 2205 1780 gene locus_tag LOCUS_03800 gene aroQ 2205 1780 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3W2 protein_id gnl|my_center|LOCUS_03800 >Feature sequence0136 >Feature sequence0137 <2900 1563 gene locus_tag LOCUS_03810 <2900 1563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962373.1:amidophosphoribosyltransferase >Feature sequence0138 1434 169 gene locus_tag LOCUS_03820 1434 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 2151 1720 gene locus_tag LOCUS_03830 2151 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 2325 2663 gene locus_tag LOCUS_03840 2325 2663 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_03840 >Feature sequence0139 1079 1612 gene locus_tag LOCUS_03850 1079 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 1660 2802 gene locus_tag LOCUS_03860 1660 2802 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_03860 >Feature sequence0140 1635 850 gene locus_tag LOCUS_03870 1635 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 <2855 1641 gene locus_tag LOCUS_03880 <2855 1641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962850.1:collagen-binding protein >Feature sequence0141 1486 2370 gene locus_tag LOCUS_03890 gene ykuF 1486 2370 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence0142 2026 395 gene locus_tag LOCUS_03900 gene pruA 2026 395 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_03900 2807 2148 gene locus_tag LOCUS_03910 2807 2148 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_03910 >Feature sequence0143 <1 938 gene locus_tag LOCUS_03920 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64N73:polyribonucleotide nucleotidyltransferase 1029 1352 gene locus_tag LOCUS_03930 1029 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03930 1371 1892 gene locus_tag LOCUS_03940 1371 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03940 >Feature sequence0144 168 1475 gene locus_tag LOCUS_03950 168 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 1549 2154 gene locus_tag LOCUS_03960 1549 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence0145 864 616 gene locus_tag LOCUS_03970 864 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 1967 1083 gene locus_tag LOCUS_03980 gene ykgA 1967 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34497 protein_id gnl|my_center|LOCUS_03980 <2841 1975 gene locus_tag LOCUS_03990 <2841 1975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868155.1:threonine synthase >Feature sequence0146 474 91 gene locus_tag LOCUS_04000 gene dksA 474 91 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_04000 <2837 547 gene locus_tag LOCUS_04010 <2837 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW60:isoleucine--tRNA ligase >Feature sequence0147 <2834 903 gene locus_tag LOCUS_04020 <2834 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056720.1:hybrid sensor histidine kinase/response regulator >Feature sequence0148 <1 855 gene locus_tag LOCUS_04030 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYX7:glyceraldehyde-3-phosphate dehydrogenase <2826 1147 gene locus_tag LOCUS_04040 <2826 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022311.1:cell surface protein >Feature sequence0149 2048 1395 gene locus_tag LOCUS_04050 gene uppS 2048 1395 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_04050 >Feature sequence0150 <1 1193 gene locus_tag LOCUS_04060 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UIR2:enolase 1214 2518 gene locus_tag LOCUS_04070 gene gltA 1214 2518 CDS product type I citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence0151 <1 1233 gene locus_tag LOCUS_04080 <1 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P61343:aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B 1247 2434 gene locus_tag LOCUS_04090 1247 2434 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_04090 >Feature sequence0152 <1 611 gene locus_tag LOCUS_04100 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0G9:tRNA-specific 2-thiouridylase MnmA 619 2208 gene locus_tag LOCUS_04110 619 2208 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764149.1 protein_id gnl|my_center|LOCUS_04110 >Feature sequence0153 1710 1237 gene locus_tag LOCUS_04120 gene rpsG 1710 1237 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_04120 2107 1727 gene locus_tag LOCUS_04130 gene rpsL 2107 1727 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 protein_id gnl|my_center|LOCUS_04130 2766 2332 gene locus_tag LOCUS_04140 2766 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 >Feature sequence0154 392 42 gene locus_tag LOCUS_04150 gene panD 392 42 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 protein_id gnl|my_center|LOCUS_04150 1249 407 gene locus_tag LOCUS_04160 gene panC 1249 407 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67891 protein_id gnl|my_center|LOCUS_04160 1351 2166 gene locus_tag LOCUS_04170 1351 2166 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence0155 <1 897 gene locus_tag LOCUS_04180 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000600562.1:glycosyl transferase 966 1313 gene locus_tag LOCUS_04190 966 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 1336 2745 gene locus_tag LOCUS_04200 gene cca 1336 2745 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence0156 1857 871 gene locus_tag LOCUS_04210 gene rnz 1857 871 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XI2 protein_id gnl|my_center|LOCUS_04210 2615 1857 gene locus_tag LOCUS_04220 2615 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 >Feature sequence0157 >Feature sequence0158 236 1123 gene locus_tag LOCUS_04230 236 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 1120 1554 gene locus_tag LOCUS_04240 1120 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 >Feature sequence0159 296 481 gene locus_tag LOCUS_04250 296 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 2521 491 gene locus_tag LOCUS_04260 2521 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 >Feature sequence0160 497 1195 gene locus_tag LOCUS_04270 497 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 1192 1596 gene locus_tag LOCUS_04280 1192 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 2341 1598 gene locus_tag LOCUS_04290 2341 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence0161 1176 388 gene locus_tag LOCUS_04300 1176 388 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_04300 2371 1289 gene locus_tag LOCUS_04310 2371 1289 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence0162 40 861 gene locus_tag LOCUS_04320 40 861 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786528.1 protein_id gnl|my_center|LOCUS_04320 929 1831 gene locus_tag LOCUS_04330 gene ctaB 929 1831 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_04330 1835 2416 gene locus_tag LOCUS_04340 gene ctaE 1835 2416 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence0163 >Feature sequence0164 3 515 gene locus_tag LOCUS_04350 3 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 1018 512 gene locus_tag LOCUS_04360 gene pycA 1018 512 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403592.1 protein_id gnl|my_center|LOCUS_04360 >Feature sequence0165 472 80 gene locus_tag LOCUS_04370 472 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 1029 568 gene locus_tag LOCUS_04380 1029 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 1691 1092 gene locus_tag LOCUS_04390 1691 1092 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530472.1 protein_id gnl|my_center|LOCUS_04390 2027 1794 gene locus_tag LOCUS_04400 2027 1794 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_04400 2246 2584 gene locus_tag LOCUS_04410 2246 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923332.1 protein_id gnl|my_center|LOCUS_04410 >Feature sequence0166 196 1020 gene locus_tag LOCUS_04420 196 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 1047 2024 gene locus_tag LOCUS_04430 1047 2024 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975608.1 protein_id gnl|my_center|LOCUS_04430 >Feature sequence0167 1670 474 gene locus_tag LOCUS_04440 1670 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 2525 1905 gene locus_tag LOCUS_04450 2525 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 >Feature sequence0168 187 1077 gene locus_tag LOCUS_04460 187 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 1486 1112 gene locus_tag LOCUS_04470 1486 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 2307 1594 gene locus_tag LOCUS_04480 2307 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016858.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence0169 <1 741 gene locus_tag LOCUS_04490 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2A9:glycine--tRNA ligase 821 1066 gene locus_tag LOCUS_04500 821 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 <2710 1187 gene locus_tag LOCUS_04510 <2710 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962632.1:peptidase S41 >Feature sequence0170 >Feature sequence0171 397 1809 gene locus_tag LOCUS_04520 397 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 2071 1892 gene locus_tag LOCUS_04530 2071 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 2139 2459 gene locus_tag LOCUS_04540 2139 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence0172 724 1605 gene locus_tag LOCUS_04550 gene mrr 724 1605 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053942.1 protein_id gnl|my_center|LOCUS_04550 1935 2456 gene locus_tag LOCUS_04560 1935 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence0173 267 1091 gene locus_tag LOCUS_04570 gene tsf 267 1091 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_04570 2343 1216 gene locus_tag LOCUS_04580 2343 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 >Feature sequence0174 74 1726 gene locus_tag LOCUS_04590 74 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_04590 >Feature sequence0175 <1 1668 gene locus_tag LOCUS_04600 <1 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107990.1:TonB-dependent receptor >Feature sequence0176 <1 575 gene locus_tag LOCUS_04610 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972107.1:signal transduction histidine kinase 583 1152 gene locus_tag LOCUS_04620 583 1152 CDS product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_296358.1 protein_id gnl|my_center|LOCUS_04620 2658 1321 gene locus_tag LOCUS_04630 2658 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 >Feature sequence0177 126 1082 gene locus_tag LOCUS_04640 126 1082 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_04640 1708 1079 gene locus_tag LOCUS_04650 1708 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 1799 2314 gene locus_tag LOCUS_04660 1799 2314 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_04660 >Feature sequence0178 343 209 gene locus_tag LOCUS_04670 343 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 >Feature sequence0179 1215 16 gene locus_tag LOCUS_04680 gene hflX 1215 16 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 protein_id gnl|my_center|LOCUS_04680 1656 1219 gene locus_tag LOCUS_04690 1656 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_04690 2188 1694 gene locus_tag LOCUS_04700 2188 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence0180 1156 584 gene locus_tag LOCUS_04710 gene mcbG 1156 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 protein_id gnl|my_center|LOCUS_04710 1920 1240 gene locus_tag LOCUS_04720 1920 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 <2653 2110 gene locus_tag LOCUS_04730 <2653 2110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963090.1:acetyl-coenzyme A synthetase >Feature sequence0181 >Feature sequence0182 2323 446 gene locus_tag LOCUS_04740 2323 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence0183 >Feature sequence0184 434 1018 gene locus_tag LOCUS_04750 gene tdk 434 1018 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_04750 1011 1748 gene locus_tag LOCUS_04760 1011 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04760 >Feature sequence0185 <1 1066 gene locus_tag LOCUS_04770 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962917.1:beta-N-acetylglucosaminidase 1050 1676 gene locus_tag LOCUS_04780 1050 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence0186 187 567 gene locus_tag LOCUS_04790 187 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 911 564 gene locus_tag LOCUS_04800 911 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_04800 940 1467 gene locus_tag LOCUS_04810 940 1467 CDS product cvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225491.1 protein_id gnl|my_center|LOCUS_04810 <2617 1454 gene locus_tag LOCUS_04820 <2617 1454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVL5:phosphoglycerate kinase >Feature sequence0187 446 1231 gene locus_tag LOCUS_04830 446 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 1228 2010 gene locus_tag LOCUS_04840 1228 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence0188 1130 2020 gene locus_tag LOCUS_04850 1130 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 >Feature sequence0189 1505 63 gene locus_tag LOCUS_04860 1505 63 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860779.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence0190 1909 365 gene locus_tag LOCUS_04870 1909 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793299.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence0191 1147 53 gene locus_tag LOCUS_04880 1147 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 1739 1242 gene locus_tag LOCUS_04890 1739 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 1857 2516 gene locus_tag LOCUS_04900 1857 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 >Feature sequence0192 <2566 419 gene locus_tag LOCUS_04910 <2566 419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWM2:Asp/Glu-specific dipeptidyl-peptidase >Feature sequence0193 491 739 gene locus_tag LOCUS_04920 gene parD1 491 739 CDS product antitoxin ParD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58091 protein_id gnl|my_center|LOCUS_04920 739 1038 gene locus_tag LOCUS_04930 gene parE1 739 1038 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9T8 protein_id gnl|my_center|LOCUS_04930 1942 1064 gene locus_tag LOCUS_04940 1942 1064 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 protein_id gnl|my_center|LOCUS_04940 >Feature sequence0194 1245 769 gene locus_tag LOCUS_04950 1245 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 1557 1246 gene locus_tag LOCUS_04960 1557 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 <2561 1644 gene locus_tag LOCUS_04970 <2561 1644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889560.1:methylamine utilization protein >Feature sequence0195 <1 1544 gene locus_tag LOCUS_04980 <1 1544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262307.1:isocitrate dehydrogenase, NADP-dependent note possible pseudo, internal stop codon 1563 1691 gene locus_tag LOCUS_04990 1563 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04990 1756 2475 gene locus_tag LOCUS_05000 1756 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence0196 240 85 gene locus_tag LOCUS_05010 gene yqaE 240 85 CDS product proteolipid membrane potential modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508177.1 protein_id gnl|my_center|LOCUS_05010 308 565 gene locus_tag LOCUS_05020 308 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 630 1340 gene locus_tag LOCUS_05030 630 1340 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNC3 protein_id gnl|my_center|LOCUS_05030 1340 1747 gene locus_tag LOCUS_05040 gene osmC 1340 1747 CDS product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_05040 <2553 1764 gene locus_tag LOCUS_05050 <2553 1764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005768437.1:radical SAM protein >Feature sequence0197 3 383 gene locus_tag LOCUS_05060 3 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 1782 436 gene locus_tag LOCUS_05070 1782 436 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence0198 <1 1295 gene locus_tag LOCUS_05080 <1 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020394.1:cell surface protein >Feature sequence0199 >Feature sequence0200 157 492 gene locus_tag LOCUS_05090 gene gldC 157 492 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_05090 1206 592 gene locus_tag LOCUS_05100 gene engB 1206 592 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_05100 1704 1267 gene locus_tag LOCUS_05110 1704 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 1977 2450 gene locus_tag LOCUS_05120 gene mraZ 1977 2450 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_05120 >Feature sequence0201 <2532 1329 gene locus_tag LOCUS_05130 <2532 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405255.1:transporter >Feature sequence0202 735 19 gene locus_tag LOCUS_05140 735 19 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_05140 1087 740 gene locus_tag LOCUS_05150 1087 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 1650 1120 gene locus_tag LOCUS_05160 1650 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 2139 1711 gene locus_tag LOCUS_05170 gene osmC 2139 1711 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404057.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence0203 2085 997 gene locus_tag LOCUS_05180 2085 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 >Feature sequence0204 826 900 gene locus_tag LOCUS_t00080 826 900 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1654 983 gene locus_tag LOCUS_05190 1654 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 >Feature sequence0205 <2519 949 gene locus_tag LOCUS_05200 <2519 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108721.1:sensor histidine kinase >Feature sequence0206 901 311 gene locus_tag LOCUS_05210 901 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 1406 894 gene locus_tag LOCUS_05220 gene aroK 1406 894 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 protein_id gnl|my_center|LOCUS_05220 1589 1662 gene locus_tag LOCUS_t00090 1589 1662 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1761 1846 gene locus_tag LOCUS_t00100 1761 1846 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0207 2116 5 gene locus_tag LOCUS_05230 2116 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence0208 421 1476 gene locus_tag LOCUS_05240 gene pdxA 421 1476 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_05240 1536 2072 gene locus_tag LOCUS_05250 1536 2072 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_05250 2095 2289 gene locus_tag LOCUS_05260 gene rpmF 2095 2289 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_05260 >Feature sequence0209 1332 1811 gene locus_tag LOCUS_05270 1332 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2048 2260 gene locus_tag LOCUS_05280 2048 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05280 >Feature sequence0210 3 416 gene locus_tag LOCUS_05290 3 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 447 998 gene locus_tag LOCUS_05300 447 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 998 2419 gene locus_tag LOCUS_05310 998 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 >Feature sequence0211 196 708 gene locus_tag LOCUS_05320 196 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 1178 702 gene locus_tag LOCUS_05330 1178 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05330 1773 1168 gene locus_tag LOCUS_05340 1773 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05340 >Feature sequence0212 94 20 gene locus_tag LOCUS_t00110 94 20 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 279 1208 gene locus_tag LOCUS_05350 279 1208 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_05350 1423 1983 gene locus_tag LOCUS_05360 1423 1983 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202433.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence0213 133 2217 gene locus_tag LOCUS_05370 133 2217 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108276.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence0214 <2489 1367 gene locus_tag LOCUS_05380 <2489 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962735.1:dehydrogenase >Feature sequence0215 <1 616 gene locus_tag LOCUS_05390 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203604.1:3-deoxy-D-manno-octulosonic acid transferase 875 606 gene locus_tag LOCUS_05400 875 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 1848 1006 gene locus_tag LOCUS_05410 1848 1006 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674768.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence0216 659 315 gene locus_tag LOCUS_05420 659 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 1430 807 gene locus_tag LOCUS_05430 gene bsaA 1430 807 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH0 protein_id gnl|my_center|LOCUS_05430 2002 1613 gene locus_tag LOCUS_05440 2002 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence0217 18 1046 gene locus_tag LOCUS_05450 18 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 1043 1900 gene locus_tag LOCUS_05460 1043 1900 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_05460 >Feature sequence0218 >Feature sequence0219 326 1243 gene locus_tag LOCUS_05470 326 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 1328 1744 gene locus_tag LOCUS_05480 gene sufE 1328 1744 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_05480 1745 2089 gene locus_tag LOCUS_05490 1745 2089 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence0220 2396 1014 gene locus_tag LOCUS_05500 2396 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence0221 204 998 gene locus_tag LOCUS_05510 204 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 1001 1393 gene locus_tag LOCUS_05520 1001 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 1413 1964 gene locus_tag LOCUS_05530 1413 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 >Feature sequence0222 1579 302 gene locus_tag LOCUS_05540 1579 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 1694 1915 gene locus_tag LOCUS_05550 1694 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 1899 2312 gene locus_tag LOCUS_05560 1899 2312 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680499.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence0223 519 1550 gene locus_tag LOCUS_05570 519 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 >Feature sequence0224 1439 456 gene locus_tag LOCUS_05580 1439 456 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_05580 2207 1476 gene locus_tag LOCUS_05590 2207 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence0225 2019 949 gene locus_tag LOCUS_05600 2019 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence0226 >Feature sequence0227 710 279 gene locus_tag LOCUS_05610 gene rpiB 710 279 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence0228 1518 931 gene locus_tag LOCUS_05620 1518 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 <2429 1581 gene locus_tag LOCUS_05630 <2429 1581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963922.1:MBL fold metallo-hydrolase >Feature sequence0229 <2422 1689 gene locus_tag LOCUS_05640 <2422 1689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q186L0:lipoate--protein ligase >Feature sequence0230 1658 432 gene locus_tag LOCUS_05650 1658 432 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_05650 <2419 1741 gene locus_tag LOCUS_05660 <2419 1741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964031.1:anhydro-N-acetylmuramic acid kinase >Feature sequence0231 2 622 gene locus_tag LOCUS_05670 2 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence0232 >Feature sequence0233 <1 1361 gene locus_tag LOCUS_05680 <1 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0L3:inosine-5'-monophosphate dehydrogenase >Feature sequence0234 865 173 gene locus_tag LOCUS_05690 865 173 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_05690 1305 862 gene locus_tag LOCUS_05700 gene ccoH 1305 862 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_05700 <2408 1397 gene locus_tag LOCUS_05710 <2408 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963297.1:cytochrome c oxidase accessory protein CcoG >Feature sequence0235 263 1525 gene locus_tag LOCUS_05720 263 1525 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963533.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence0236 1270 653 gene locus_tag LOCUS_05730 1270 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203248.1 protein_id gnl|my_center|LOCUS_05730 1443 2081 gene locus_tag LOCUS_05740 1443 2081 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_05740 >Feature sequence0237 819 325 gene locus_tag LOCUS_05750 gene ribH 819 325 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_05750 1514 819 gene locus_tag LOCUS_05760 1514 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_05760 >Feature sequence0238 <1 994 gene locus_tag LOCUS_05770 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MBE5:DNA polymerase IV >Feature sequence0239 >Feature sequence0240 799 290 gene locus_tag LOCUS_05780 799 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 862 1230 gene locus_tag LOCUS_05790 862 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 1554 1276 gene locus_tag LOCUS_05800 1554 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 <2378 1695 gene locus_tag LOCUS_05810 <2378 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0K9:UPF0721 transmembrane protein >Feature sequence0241 1027 575 gene locus_tag LOCUS_05820 1027 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770938.1 protein_id gnl|my_center|LOCUS_05820 1479 1024 gene locus_tag LOCUS_05830 1479 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 1786 1646 gene locus_tag LOCUS_05840 1786 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 >Feature sequence0242 630 151 gene locus_tag LOCUS_05850 630 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 1540 701 gene locus_tag LOCUS_05860 1540 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_05860 <2364 1603 gene locus_tag LOCUS_05870 <2364 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UKE5:DNA polymerase IV >Feature sequence0243 333 1628 gene locus_tag LOCUS_05880 333 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 2350 1625 gene locus_tag LOCUS_05890 2350 1625 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_05890 >Feature sequence0244 1156 722 gene locus_tag LOCUS_05900 1156 722 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762486.1 protein_id gnl|my_center|LOCUS_05900 1771 1220 gene locus_tag LOCUS_05910 1771 1220 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_05910 >Feature sequence0245 1380 208 gene locus_tag LOCUS_05920 gene purM 1380 208 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_05920 <2351 1450 gene locus_tag LOCUS_05930 <2351 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964499.1:cell envelope biogenesis protein OmpA >Feature sequence0246 1039 1485 gene locus_tag LOCUS_05940 1039 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 <2344 1563 gene locus_tag LOCUS_05950 <2344 1563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946042.1:amino acid transporter >Feature sequence0247 213 665 gene locus_tag LOCUS_05960 213 665 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 protein_id gnl|my_center|LOCUS_05960 662 1573 gene locus_tag LOCUS_05970 gene rimK 662 1573 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_05970 1573 2265 gene locus_tag LOCUS_05980 1573 2265 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_05980 >Feature sequence0248 <1 619 gene locus_tag LOCUS_05990 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYP1:signal peptidase I 676 1275 gene locus_tag LOCUS_06000 676 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence0249 289 525 gene locus_tag LOCUS_06010 289 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 682 1551 gene locus_tag LOCUS_06020 682 1551 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_06020 2211 1564 gene locus_tag LOCUS_06030 2211 1564 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence0250 >Feature sequence0251 <1 1119 gene locus_tag LOCUS_06040 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962206.1:penicillin-binding protein 1A 1823 1113 gene locus_tag LOCUS_06050 1823 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_06050 1878 2069 gene locus_tag LOCUS_06060 1878 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 >Feature sequence0252 101 1909 gene locus_tag LOCUS_06070 101 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 >Feature sequence0253 139 1062 gene locus_tag LOCUS_06080 139 1062 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_06080 1098 2216 gene locus_tag LOCUS_06090 1098 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090572.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence0254 104 1033 gene locus_tag LOCUS_06100 104 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1298 1672 gene locus_tag LOCUS_06110 1298 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence0255 <2322 667 gene locus_tag LOCUS_06120 <2322 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769481.1:TonB-dependent receptor >Feature sequence0256 1894 896 gene locus_tag LOCUS_06130 1894 896 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence0257 <1 1313 gene locus_tag LOCUS_06140 <1 1313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVK0:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG 1335 2213 gene locus_tag LOCUS_06150 1335 2213 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_06150 >Feature sequence0258 1027 305 gene locus_tag LOCUS_06160 1027 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 1492 1073 gene locus_tag LOCUS_06170 1492 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 1838 1458 gene locus_tag LOCUS_06180 gene gcvH 1838 1458 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_06180 >Feature sequence0259 1431 223 gene locus_tag LOCUS_06190 1431 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 <2303 1524 gene locus_tag LOCUS_06200 <2303 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765688.1:RNA helicase >Feature sequence0260 1578 2273 gene locus_tag LOCUS_06210 1578 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence0261 492 76 gene locus_tag LOCUS_06220 492 76 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 protein_id gnl|my_center|LOCUS_06220 1232 492 gene locus_tag LOCUS_06230 1232 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 <2292 1229 gene locus_tag LOCUS_06240 <2292 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143551.1:sensor histidine kinase >Feature sequence0262 1987 956 gene locus_tag LOCUS_06250 1987 956 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_06250 2292 1987 gene locus_tag LOCUS_06260 2292 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence0263 420 986 gene locus_tag LOCUS_06270 420 986 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721773.1 protein_id gnl|my_center|LOCUS_06270 1068 1220 gene locus_tag LOCUS_06280 1068 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence0264 848 1600 gene locus_tag LOCUS_06290 gene yqjF 848 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54543 protein_id gnl|my_center|LOCUS_06290 >Feature sequence0265 >Feature sequence0266 <1 1006 gene locus_tag LOCUS_06300 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963607.1:TonB-dependent receptor >Feature sequence0267 <1 1104 gene locus_tag LOCUS_06310 <1 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943545.1:two-component sensor histidine kinase 1174 2025 gene locus_tag LOCUS_06320 1174 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence0268 339 64 gene locus_tag LOCUS_06330 339 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 1224 397 gene locus_tag LOCUS_06340 1224 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 1892 1227 gene locus_tag LOCUS_06350 1892 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 >Feature sequence0269 101 1948 gene locus_tag LOCUS_06360 gene korA 101 1948 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence0270 >Feature sequence0271 61 1503 gene locus_tag LOCUS_06370 gene sufB 61 1503 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence0272 <1 1614 gene locus_tag LOCUS_06380 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYU0:DNA-directed RNA polymerase subunit beta >Feature sequence0273 >Feature sequence0274 201 887 gene locus_tag LOCUS_06390 201 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 965 1918 gene locus_tag LOCUS_06400 965 1918 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202930.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence0275 >Feature sequence0276 1 627 gene locus_tag LOCUS_06410 1 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 <2236 689 gene locus_tag LOCUS_06420 <2236 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028572.1:ribonuclease >Feature sequence0277 572 141 gene locus_tag LOCUS_06430 572 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1752 565 gene locus_tag LOCUS_06440 1752 565 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence0278 3 980 gene locus_tag LOCUS_06450 3 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 977 1816 gene locus_tag LOCUS_06460 gene crtB 977 1816 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence0279 >Feature sequence0280 221 610 gene locus_tag LOCUS_06470 221 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920892.1 protein_id gnl|my_center|LOCUS_06470 1037 1399 gene locus_tag LOCUS_06480 1037 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06480 1418 1993 gene locus_tag LOCUS_06490 1418 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06490 >Feature sequence0281 84 821 gene locus_tag LOCUS_06500 84 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 814 1644 gene locus_tag LOCUS_06510 814 1644 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF03 protein_id gnl|my_center|LOCUS_06510 >Feature sequence0282 26 1846 gene locus_tag LOCUS_06520 26 1846 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence0283 <1 596 gene locus_tag LOCUS_06530 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963228.1:gliding motility-associated ABC transporter permease subunit GldF >Feature sequence0284 >Feature sequence0285 >Feature sequence0286 <2210 1006 gene locus_tag LOCUS_06540 <2210 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877095.1:serine/threonine protein kinase >Feature sequence0287 >Feature sequence0288 2195 93 gene locus_tag LOCUS_06550 gene ftsH 2195 93 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_06550 >Feature sequence0289 2141 120 gene locus_tag LOCUS_06560 2141 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence0290 <1 1465 gene locus_tag LOCUS_06570 <1 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023607.1:cell surface protein 2092 1478 gene locus_tag LOCUS_06580 2092 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06580 >Feature sequence0291 288 1493 gene locus_tag LOCUS_06590 288 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 1586 2200 gene locus_tag LOCUS_06600 1586 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 >Feature sequence0292 <1 1111 gene locus_tag LOCUS_06610 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0J8:adenylosuccinate lyase 1111 2052 gene locus_tag LOCUS_06620 1111 2052 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence0293 1470 475 gene locus_tag LOCUS_06630 gene fabH3 1470 475 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_06630 <2204 1449 gene locus_tag LOCUS_06640 <2204 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18B41:phosphate acyltransferase >Feature sequence0294 1663 110 gene locus_tag LOCUS_06650 1663 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 1781 2182 gene locus_tag LOCUS_06660 gene gspG 1781 2182 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964391.1 protein_id gnl|my_center|LOCUS_06660 >Feature sequence0295 1463 273 gene locus_tag LOCUS_06670 1463 273 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence0296 394 1440 gene locus_tag LOCUS_06680 gene phoR 394 1440 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_06680 <2198 1405 gene locus_tag LOCUS_06690 <2198 1405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962537.1:glycosyl transferase >Feature sequence0297 972 79 gene locus_tag LOCUS_06700 972 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence0298 961 332 gene locus_tag LOCUS_06710 961 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 >Feature sequence0299 >Feature sequence0300 >Feature sequence0301 >Feature sequence0302 1806 1447 gene locus_tag LOCUS_06720 1806 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 >Feature sequence0303 1665 46 gene locus_tag LOCUS_06730 1665 46 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958070.1 protein_id gnl|my_center|LOCUS_06730 2163 1720 gene locus_tag LOCUS_06740 2163 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence0304 816 436 gene locus_tag LOCUS_06750 816 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 1240 1638 gene locus_tag LOCUS_06760 1240 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence0305 >Feature sequence0306 1253 309 gene locus_tag LOCUS_06770 1253 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence0307 <1 510 gene locus_tag LOCUS_06780 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0T6:GMP synthase [glutamine-hydrolyzing] >Feature sequence0308 1451 36 gene locus_tag LOCUS_06790 1451 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2060 1476 gene locus_tag LOCUS_06800 2060 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence0309 <2157 1453 gene locus_tag LOCUS_06810 <2157 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202998.1:polysaccharide export outer membrane protein >Feature sequence0310 >Feature sequence0311 687 1022 gene locus_tag LOCUS_06820 687 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 >Feature sequence0312 1669 2148 gene locus_tag LOCUS_06830 1669 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence0313 >Feature sequence0314 473 1399 gene locus_tag LOCUS_06840 473 1399 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence0315 <1 529 gene locus_tag LOCUS_06850 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964107.1:transcriptional regulator 1390 545 gene locus_tag LOCUS_06860 1390 545 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence0316 1374 844 gene locus_tag LOCUS_06870 gene rimM 1374 844 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_06870 2052 1378 gene locus_tag LOCUS_06880 2052 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence0317 531 1076 gene locus_tag LOCUS_06890 531 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence0318 <1 508 gene locus_tag LOCUS_06900 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255958.1:DUF547 domain-containing protein 1663 515 gene locus_tag LOCUS_06910 1663 515 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204047.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence0319 362 1528 gene locus_tag LOCUS_06920 gene paaE 362 1528 CDS product phenylacetic acid degradation NADH oxidoreductase PaaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551026.1 protein_id gnl|my_center|LOCUS_06920 1980 1516 gene locus_tag LOCUS_06930 1980 1516 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038584.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence0320 54 1073 gene locus_tag LOCUS_06940 54 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06940 >Feature sequence0321 <1 1141 gene locus_tag LOCUS_06950 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962644.1:peptidase M28 1411 1872 gene locus_tag LOCUS_06960 1411 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880015.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence0322 <1 704 gene locus_tag LOCUS_06970 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403312.1:nucleoside transporter NupC 868 701 gene locus_tag LOCUS_06980 868 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 1332 910 gene locus_tag LOCUS_06990 1332 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06990 1780 1376 gene locus_tag LOCUS_07000 1780 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence0323 418 1215 gene locus_tag LOCUS_07010 gene mntD 418 1215 CDS product manganese transport system membrane protein MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34500 protein_id gnl|my_center|LOCUS_07010 1453 1253 gene locus_tag LOCUS_07020 gene yozG 1453 1253 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946172.1 protein_id gnl|my_center|LOCUS_07020 2052 1453 gene locus_tag LOCUS_07030 2052 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence0324 2044 662 gene locus_tag LOCUS_07040 gene atoE 2044 662 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence0325 474 2021 gene locus_tag LOCUS_07050 474 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence0326 2 526 gene locus_tag LOCUS_07060 2 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 526 1764 gene locus_tag LOCUS_07070 gene mraY 526 1764 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_07070 >Feature sequence0327 <1 1349 gene locus_tag LOCUS_07080 <1 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010538536.1:serine protease >Feature sequence0328 >Feature sequence0329 1 192 gene locus_tag LOCUS_07090 1 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 273 1517 gene locus_tag LOCUS_07100 gene clpX 273 1517 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_07100 2015 1530 gene locus_tag LOCUS_07110 gene dfrA 2015 1530 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_07110 >Feature sequence0330 1426 398 gene locus_tag LOCUS_07120 1426 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence0331 127 348 gene locus_tag LOCUS_07130 127 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 479 634 gene locus_tag LOCUS_07140 479 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 663 800 gene locus_tag LOCUS_07150 663 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 879 1088 gene locus_tag LOCUS_07160 879 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 1600 1163 gene locus_tag LOCUS_07170 1600 1163 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107090.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence0332 379 1410 gene locus_tag LOCUS_07180 379 1410 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence0333 >Feature sequence0334 <2067 1149 gene locus_tag LOCUS_07190 <2067 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962455.1:peptidase M36 >Feature sequence0335 381 1340 gene locus_tag LOCUS_07200 381 1340 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_07200 1316 1654 gene locus_tag LOCUS_07210 1316 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence0336 >Feature sequence0337 197 898 gene locus_tag LOCUS_07220 gene atoD 197 898 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence0338 598 50 gene locus_tag LOCUS_07230 598 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 <2061 824 gene locus_tag LOCUS_07240 <2061 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118436.1:DNA ligase-associated DEXH box helicase >Feature sequence0339 <2060 938 gene locus_tag LOCUS_07250 <2060 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase >Feature sequence0340 <1 1061 gene locus_tag LOCUS_07260 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYW8:chromosomal replication initiator protein DnaA 1256 1717 gene locus_tag LOCUS_07270 1256 1717 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence0341 488 45 gene locus_tag LOCUS_07280 488 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 766 1452 gene locus_tag LOCUS_07290 766 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 >Feature sequence0342 903 1205 gene locus_tag LOCUS_07300 903 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 >Feature sequence0343 1187 855 gene locus_tag LOCUS_07310 1187 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 1569 1240 gene locus_tag LOCUS_07320 1569 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence0344 <1 711 gene locus_tag LOCUS_07330 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0V0:peptidyl-prolyl cis-trans isomerase 730 1671 gene locus_tag LOCUS_07340 gene ppiC 730 1671 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_07340 >Feature sequence0345 713 1282 gene locus_tag LOCUS_07350 gene gmk 713 1282 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_07350 1279 1857 gene locus_tag LOCUS_07360 gene nadD 1279 1857 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_07360 >Feature sequence0346 >Feature sequence0347 494 883 gene locus_tag LOCUS_07370 494 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384085.1 protein_id gnl|my_center|LOCUS_07370 967 1581 gene locus_tag LOCUS_07380 967 1581 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_07380 1834 1586 gene locus_tag LOCUS_07390 1834 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence0348 <1 719 gene locus_tag LOCUS_07400 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963517.1:gliding motility lipoprotein GldJ >Feature sequence0349 1014 775 gene locus_tag LOCUS_07410 1014 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 1541 1095 gene locus_tag LOCUS_07420 1541 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07420 1880 1542 gene locus_tag LOCUS_07430 1880 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07430 >Feature sequence0350 >Feature sequence0351 >Feature sequence0352 136 705 gene locus_tag LOCUS_07440 136 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence0353 684 322 gene locus_tag LOCUS_07450 684 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1717 854 gene locus_tag LOCUS_07460 1717 854 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X27 protein_id gnl|my_center|LOCUS_07460 >Feature sequence0354 1182 2000 gene locus_tag LOCUS_07470 1182 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence0355 <1 605 gene locus_tag LOCUS_07480 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962645.1:alanine dehydrogenase 653 1507 gene locus_tag LOCUS_07490 653 1507 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence0356 1733 492 gene locus_tag LOCUS_07500 gene pdhC 1733 492 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_07500 >Feature sequence0357 1271 348 gene locus_tag LOCUS_07510 1271 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_07510 <2023 1293 gene locus_tag LOCUS_07520 <2023 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962360.1:enoyl-CoA hydratase >Feature sequence0358 173 841 gene locus_tag LOCUS_07530 gene rplY 173 841 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 protein_id gnl|my_center|LOCUS_07530 850 1416 gene locus_tag LOCUS_07540 gene pth 850 1416 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_07540 >Feature sequence0359 <1 1126 gene locus_tag LOCUS_07550 <1 1126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963061.1:peptidase M61 >Feature sequence0360 345 1079 gene locus_tag LOCUS_07560 345 1079 CDS product ABC transporter-associated protein EcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454391.1 protein_id gnl|my_center|LOCUS_07560 1849 1427 gene locus_tag LOCUS_07570 1849 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence0361 669 1616 gene locus_tag LOCUS_07580 669 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence0362 <1 615 gene locus_tag LOCUS_07590 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64PU2:cytidylate kinase 875 606 gene locus_tag LOCUS_07600 875 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 1565 906 gene locus_tag LOCUS_07610 gene psd 1565 906 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence0363 1493 327 gene locus_tag LOCUS_07620 1493 327 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_07620 1938 1483 gene locus_tag LOCUS_07630 1938 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence0364 1750 1175 gene locus_tag LOCUS_07640 1750 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence0365 921 1847 gene locus_tag LOCUS_07650 gene porR 921 1847 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07650 >Feature sequence0366 1274 132 gene locus_tag LOCUS_07660 1274 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 <2001 1494 gene locus_tag LOCUS_07670 <2001 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496534.1:universal stress protein >Feature sequence0367 <1 1343 gene locus_tag LOCUS_07680 <1 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 >Feature sequence0368 904 245 gene locus_tag LOCUS_07690 gene actE 904 245 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_07690 1446 919 gene locus_tag LOCUS_07700 gene actD 1446 919 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_07700 <1992 1436 gene locus_tag LOCUS_07710 <1992 1436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962545.1:molybdopterin oxidoreductase >Feature sequence0369 492 725 gene locus_tag LOCUS_07720 492 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence0370 <1 1648 gene locus_tag LOCUS_07730 <1 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404869.1:cytochrome c assembly protein >Feature sequence0371 1052 183 gene locus_tag LOCUS_07740 1052 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_07740 <1986 1132 gene locus_tag LOCUS_07750 <1986 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962315.1:ATPase AAA >Feature sequence0372 1667 813 gene locus_tag LOCUS_07760 1667 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence0373 205 537 gene locus_tag LOCUS_07770 205 537 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767692.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence0374 1012 1866 gene locus_tag LOCUS_07780 1012 1866 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ30 protein_id gnl|my_center|LOCUS_07780 >Feature sequence0375 260 1720 gene locus_tag LOCUS_07790 260 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 1977 1726 gene locus_tag LOCUS_07800 1977 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence0376 1501 140 gene locus_tag LOCUS_07810 1501 140 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794226.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence0377 864 1592 gene locus_tag LOCUS_07820 864 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 1968 1585 gene locus_tag LOCUS_07830 1968 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence0378 >Feature sequence0379 <1 949 gene locus_tag LOCUS_07840 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWI1:DNA-directed DNA polymerase 1051 1371 gene locus_tag LOCUS_07850 1051 1371 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence0380 <1967 792 gene locus_tag LOCUS_07860 <1967 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E847:glucose-6-phosphate isomerase >Feature sequence0381 <1 679 gene locus_tag LOCUS_07870 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962913.1:Fe-S oxidoreductase 691 1128 gene locus_tag LOCUS_07880 691 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_07880 1125 1718 gene locus_tag LOCUS_07890 1125 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence0382 195 893 gene locus_tag LOCUS_07900 195 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 896 1318 gene locus_tag LOCUS_07910 896 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence0383 <1957 1082 gene locus_tag LOCUS_07920 <1957 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545448.1:lipid A 1-phosphatase >Feature sequence0384 878 630 gene locus_tag LOCUS_07930 878 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 1729 1079 gene locus_tag LOCUS_07940 1729 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence0385 154 726 gene locus_tag LOCUS_07950 154 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962571.1 protein_id gnl|my_center|LOCUS_07950 856 1503 gene locus_tag LOCUS_07960 gene rpe 856 1503 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_07960 >Feature sequence0386 912 391 gene locus_tag LOCUS_07970 912 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1392 991 gene locus_tag LOCUS_07980 1392 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence0387 537 1484 gene locus_tag LOCUS_07990 537 1484 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107826.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence0388 >Feature sequence0389 528 19 gene locus_tag LOCUS_08000 528 19 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_08000 623 1603 gene locus_tag LOCUS_08010 623 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence0390 <1 679 gene locus_tag LOCUS_08020 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWU5:ribonucleoside-diphosphate reductase 791 1270 gene locus_tag LOCUS_08030 791 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 1313 1717 gene locus_tag LOCUS_08040 1313 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence0391 >Feature sequence0392 >Feature sequence0393 248 490 gene locus_tag LOCUS_08050 248 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 953 456 gene locus_tag LOCUS_08060 953 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 1394 957 gene locus_tag LOCUS_08070 1394 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence0394 >Feature sequence0395 50 664 gene locus_tag LOCUS_08080 50 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence0396 1618 1187 gene locus_tag LOCUS_08090 1618 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence0397 >Feature sequence0398 >Feature sequence0399 <1 1091 gene locus_tag LOCUS_08100 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYR1:DNA mismatch repair protein MutL 1091 1852 gene locus_tag LOCUS_08110 1091 1852 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence0400 <1 749 gene locus_tag LOCUS_08120 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYM2:UvrABC system protein A 981 754 gene locus_tag LOCUS_08130 981 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1063 1560 gene locus_tag LOCUS_08140 gene ybcL 1063 1560 CDS product kinase inhibitor Raf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963151.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence0401 >Feature sequence0402 50 499 gene locus_tag LOCUS_08150 50 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1167 493 gene locus_tag LOCUS_08160 1167 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 <1932 1205 gene locus_tag LOCUS_08170 <1932 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963826.1:peptidase M48 >Feature sequence0403 568 134 gene locus_tag LOCUS_08180 568 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 691 1356 gene locus_tag LOCUS_08190 691 1356 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence0404 >Feature sequence0405 1676 177 gene locus_tag LOCUS_08200 gene dnaB 1676 177 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_08200 >Feature sequence0406 1007 1702 gene locus_tag LOCUS_08210 1007 1702 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence0407 1475 120 gene locus_tag LOCUS_08220 gene gatA 1475 120 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 protein_id gnl|my_center|LOCUS_08220 1750 1550 gene locus_tag LOCUS_08230 1750 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence0408 1283 441 gene locus_tag LOCUS_08240 1283 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_707456.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence0409 1853 564 gene locus_tag LOCUS_08250 gene purA 1853 564 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_08250 >Feature sequence0410 1439 666 gene locus_tag LOCUS_08260 1439 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 >Feature sequence0411 486 1673 gene locus_tag LOCUS_08270 gene kbl 486 1673 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_08270 >Feature sequence0412 >Feature sequence0413 87 248 gene locus_tag LOCUS_08280 87 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence0414 <1895 920 gene locus_tag LOCUS_08290 <1895 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002376144.1:AraC family transcriptional regulator >Feature sequence0415 <1 1720 gene locus_tag LOCUS_08300 <1 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:nuclease >Feature sequence0416 513 1 gene locus_tag LOCUS_08310 513 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 563 1639 gene locus_tag LOCUS_08320 563 1639 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_08320 >Feature sequence0417 422 772 gene locus_tag LOCUS_08330 422 772 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence0418 <1 1110 gene locus_tag LOCUS_08340 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943350.1:fibronectin type III <1882 1135 gene locus_tag LOCUS_08350 <1882 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962462.1:DNA polymerase I >Feature sequence0419 1328 693 gene locus_tag LOCUS_08360 gene sdhC 1328 693 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence0420 >Feature sequence0421 <1 538 gene locus_tag LOCUS_08370 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765597.1:AraC family transcriptional regulator 627 1178 gene locus_tag LOCUS_08380 627 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence0422 549 974 gene locus_tag LOCUS_08390 549 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_08390 916 1164 gene locus_tag LOCUS_08400 916 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1161 1574 gene locus_tag LOCUS_08410 1161 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence0423 >Feature sequence0424 >Feature sequence0425 1225 1004 gene locus_tag LOCUS_08420 1225 1004 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_08420 1564 1280 gene locus_tag LOCUS_08430 1564 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence0426 1092 601 gene locus_tag LOCUS_08440 1092 601 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_08440 >Feature sequence0427 <1 555 gene locus_tag LOCUS_08450 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962915.1:Fe-S oxidoreductase 603 1097 gene locus_tag LOCUS_08460 603 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_08460 1739 1101 gene locus_tag LOCUS_08470 1739 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence0428 <1866 290 gene locus_tag LOCUS_08480 <1866 290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899363.1:amino acid decarboxylase >Feature sequence0429 <1 1170 gene locus_tag LOCUS_08490 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337472.1:ATP-dependent DNA ligase <1865 1223 gene locus_tag LOCUS_08500 <1865 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974604.1:cell division protein Fic >Feature sequence0430 945 1427 gene locus_tag LOCUS_08510 945 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence0431 1679 177 gene locus_tag LOCUS_08520 1679 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence0432 >Feature sequence0433 802 416 gene locus_tag LOCUS_08530 802 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_08530 <1860 837 gene locus_tag LOCUS_08540 <1860 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931920.1:UDP-glucose/GDP-mannose dehydrogenase >Feature sequence0434 144 581 gene locus_tag LOCUS_08550 144 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence0435 1582 479 gene locus_tag LOCUS_08560 gene irpA 1582 479 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence0436 1397 1020 gene locus_tag LOCUS_08570 1397 1020 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence0437 >Feature sequence0438 >Feature sequence0439 380 1405 gene locus_tag LOCUS_08580 380 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence0440 <1847 48 gene locus_tag LOCUS_08590 <1847 48 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962278.1:membrane protein >Feature sequence0441 <1 1202 gene locus_tag LOCUS_08600 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011069661.1:guanylate cyclase >Feature sequence0442 >Feature sequence0443 >Feature sequence0444 1228 518 gene locus_tag LOCUS_08610 1228 518 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence0445 204 58 gene locus_tag LOCUS_08620 204 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 863 276 gene locus_tag LOCUS_08630 863 276 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence0446 3 794 gene locus_tag LOCUS_08640 3 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence0447 1418 369 gene locus_tag LOCUS_08650 gene rlmN 1418 369 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_08650 >Feature sequence0448 500 87 gene locus_tag LOCUS_08660 500 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1156 611 gene locus_tag LOCUS_08670 1156 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence0449 97 993 gene locus_tag LOCUS_08680 97 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993022.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence0450 1140 445 gene locus_tag LOCUS_08690 1140 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence0451 <1 717 gene locus_tag LOCUS_08700 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120056.1:oxidoreductase 898 1410 gene locus_tag LOCUS_08710 898 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence0452 <1812 495 gene locus_tag LOCUS_08720 <1812 495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74D37:protein CyaE >Feature sequence0453 <1 653 gene locus_tag LOCUS_08730 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A6A7:Holliday junction ATP-dependent DNA helicase RuvA >Feature sequence0454 <1 587 gene locus_tag LOCUS_08740 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001042743.1:oxidoreductase 1174 584 gene locus_tag LOCUS_08750 1174 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 <1807 1207 gene locus_tag LOCUS_08760 <1807 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962792.1:TIGR02757 family protein >Feature sequence0455 162 611 gene locus_tag LOCUS_08770 162 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_08770 608 874 gene locus_tag LOCUS_08780 608 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08780 868 1386 gene locus_tag LOCUS_08790 868 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08790 1402 1614 gene locus_tag LOCUS_08800 1402 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence0456 482 201 gene locus_tag LOCUS_08810 482 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 558 1154 gene locus_tag LOCUS_08820 558 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1247 1480 gene locus_tag LOCUS_08830 1247 1480 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence0457 57 500 gene locus_tag LOCUS_08840 57 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 <1801 578 gene locus_tag LOCUS_08850 <1801 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203460.1:ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent >Feature sequence0458 272 1795 gene locus_tag LOCUS_08860 272 1795 CDS product selenocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence0459 1798 578 gene locus_tag LOCUS_08870 gene hsdM 1798 578 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence0460 >Feature sequence0461 <1798 606 gene locus_tag LOCUS_08880 <1798 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WEM0:glutamate dehydrogenase >Feature sequence0462 540 1502 gene locus_tag LOCUS_08890 540 1502 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682158.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence0463 <1 938 gene locus_tag LOCUS_08900 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962405.1:peptidase M23 <1794 940 gene locus_tag LOCUS_08910 <1794 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963032.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence0464 >Feature sequence0465 282 1055 gene locus_tag LOCUS_08920 gene sufC 282 1055 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence0466 <1 1162 gene locus_tag LOCUS_08930 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_085984875.1:cell surface protein 1168 1506 gene locus_tag LOCUS_08940 1168 1506 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I508 protein_id gnl|my_center|LOCUS_08940 >Feature sequence0467 <1 1254 gene locus_tag LOCUS_08950 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962810.1:DNA topoisomerase IV subunit A >Feature sequence0468 628 182 gene locus_tag LOCUS_08960 628 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 1357 770 gene locus_tag LOCUS_08970 1357 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence0469 1561 1040 gene locus_tag LOCUS_08980 1561 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence0470 <1777 229 gene locus_tag LOCUS_08990 <1777 229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III >Feature sequence0471 1205 441 gene locus_tag LOCUS_09000 1205 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence0472 >Feature sequence0473 1556 1750 gene locus_tag LOCUS_09010 1556 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence0474 >Feature sequence0475 298 684 gene locus_tag LOCUS_09020 298 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1175 681 gene locus_tag LOCUS_09030 1175 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1174 1662 gene locus_tag LOCUS_09040 1174 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264684.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence0476 1396 560 gene locus_tag LOCUS_09050 gene gldN 1396 560 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence0477 >Feature sequence0478 >Feature sequence0479 112 345 gene locus_tag LOCUS_09060 112 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence0480 >Feature sequence0481 <1 1307 gene locus_tag LOCUS_09070 <1 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963259.1:methylmalonyl-CoA mutase >Feature sequence0482 915 1643 gene locus_tag LOCUS_09080 915 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence0483 349 1596 gene locus_tag LOCUS_09090 349 1596 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence0484 302 1750 gene locus_tag LOCUS_09100 302 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence0485 1288 905 gene locus_tag LOCUS_09110 1288 905 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_09110 1623 1285 gene locus_tag LOCUS_09120 1623 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence0486 1006 80 gene locus_tag LOCUS_09130 1006 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence0487 <1751 586 gene locus_tag LOCUS_09140 <1751 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583129.1:MATE efflux family protein >Feature sequence0488 264 1091 gene locus_tag LOCUS_09150 264 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence0489 661 1650 gene locus_tag LOCUS_09160 661 1650 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence0490 >Feature sequence0491 1065 40 gene locus_tag LOCUS_09170 1065 40 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_09170 1142 1468 gene locus_tag LOCUS_09180 1142 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence0492 >Feature sequence0493 524 1696 gene locus_tag LOCUS_09190 gene ftsW 524 1696 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence0494 <1 955 gene locus_tag LOCUS_09200 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962544.1:quinol:cytochrome C oxidoreductase >Feature sequence0495 566 1621 gene locus_tag LOCUS_09210 gene queA 566 1621 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_09210 >Feature sequence0496 765 196 gene locus_tag LOCUS_09220 765 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1329 907 gene locus_tag LOCUS_09230 1329 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence0497 193 825 gene locus_tag LOCUS_09240 193 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_09240 1461 841 gene locus_tag LOCUS_09250 1461 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence0498 >Feature sequence0499 >Feature sequence0500 >Feature sequence0501 1 552 gene locus_tag LOCUS_09260 1 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence0502 <1723 1079 gene locus_tag LOCUS_09270 <1723 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108917.1:competence protein ComEA >Feature sequence0503 >Feature sequence0504 738 989 gene locus_tag LOCUS_09280 738 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1208 1492 gene locus_tag LOCUS_09290 1208 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence0505 <1 1040 gene locus_tag LOCUS_09300 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947913.1:alginate O-acetyltransferase >Feature sequence0506 203 799 gene locus_tag LOCUS_09310 203 799 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_09310 1388 1179 gene locus_tag LOCUS_09320 1388 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence0507 1441 440 gene locus_tag LOCUS_09330 1441 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence0508 >Feature sequence0509 <1 646 gene locus_tag LOCUS_09340 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393573.1:DNA polymerase domain-containing protein 1130 1498 gene locus_tag LOCUS_09350 1130 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence0510 700 20 gene locus_tag LOCUS_09360 700 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence0511 1381 479 gene locus_tag LOCUS_09370 1381 479 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence0512 >Feature sequence0513 >Feature sequence0514 1175 207 gene locus_tag LOCUS_09380 1175 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence0515 370 1275 gene locus_tag LOCUS_09390 gene hemF 370 1275 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_09390 >Feature sequence0516 1109 330 gene locus_tag LOCUS_09400 1109 330 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266913.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence0517 618 851 gene locus_tag LOCUS_09410 618 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_09410 859 1086 gene locus_tag LOCUS_09420 859 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence0518 818 1522 gene locus_tag LOCUS_09430 818 1522 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785272.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence0519 954 427 gene locus_tag LOCUS_09440 954 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_09440 <1680 947 gene locus_tag LOCUS_09450 <1680 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933083.1:glycosyl hydrolase >Feature sequence0520 >Feature sequence0521 91 402 gene locus_tag LOCUS_09460 91 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 468 698 gene locus_tag LOCUS_09470 468 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 777 1031 gene locus_tag LOCUS_09480 777 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1302 1024 gene locus_tag LOCUS_09490 1302 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence0522 573 893 gene locus_tag LOCUS_09500 573 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09500 906 1265 gene locus_tag LOCUS_09510 906 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09510 >Feature sequence0523 1084 1539 gene locus_tag LOCUS_09520 1084 1539 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence0524 1200 283 gene locus_tag LOCUS_09530 1200 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1502 1200 gene locus_tag LOCUS_09540 1502 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence0525 >Feature sequence0526 1115 420 gene locus_tag LOCUS_09550 1115 420 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_09550 1551 1144 gene locus_tag LOCUS_09560 gene ygcM 1551 1144 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_09560 >Feature sequence0527 585 1028 gene locus_tag LOCUS_09570 585 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 <1666 1018 gene locus_tag LOCUS_09580 <1666 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963933.1:transcriptional regulator >Feature sequence0528 >Feature sequence0529 297 929 gene locus_tag LOCUS_09590 297 929 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_09590 1051 1608 gene locus_tag LOCUS_09600 1051 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence0530 220 876 gene locus_tag LOCUS_09610 gene tal 220 876 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_09610 946 1569 gene locus_tag LOCUS_09620 946 1569 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence0531 1040 561 gene locus_tag LOCUS_09630 1040 561 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence0532 >Feature sequence0533 <1 963 gene locus_tag LOCUS_09640 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011069661.1:guanylate cyclase >Feature sequence0534 <1 1455 gene locus_tag LOCUS_09650 <1 1455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963634.1:histidine kinase >Feature sequence0535 >Feature sequence0536 434 1153 gene locus_tag LOCUS_09660 434 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence0537 >Feature sequence0538 1595 957 gene locus_tag LOCUS_09670 1595 957 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence0539 >Feature sequence0540 767 1462 gene locus_tag LOCUS_09680 767 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence0541 1342 368 gene locus_tag LOCUS_09690 gene purC 1342 368 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A004 protein_id gnl|my_center|LOCUS_09690 >Feature sequence0542 >Feature sequence0543 262 792 gene locus_tag LOCUS_09700 gene rplJ 262 792 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU2 protein_id gnl|my_center|LOCUS_09700 863 1243 gene locus_tag LOCUS_09710 gene rplL 863 1243 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A468 protein_id gnl|my_center|LOCUS_09710 >Feature sequence0544 1169 423 gene locus_tag LOCUS_09720 1169 423 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence0545 >Feature sequence0546 <1 1065 gene locus_tag LOCUS_09730 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P54157:putative chalcone synthase >Feature sequence0547 <1 675 gene locus_tag LOCUS_09740 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962491.1:membrane protein >Feature sequence0548 >Feature sequence0549 1146 457 gene locus_tag LOCUS_09750 1146 457 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence0550 882 433 gene locus_tag LOCUS_09760 882 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence0551 <1 1611 gene locus_tag LOCUS_09770 <1 1611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963365.1:ATP-dependent DNA helicase RecQ >Feature sequence0552 83 877 gene locus_tag LOCUS_09780 83 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence0553 1159 101 gene locus_tag LOCUS_09790 1159 101 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789721.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence0554 596 1621 gene locus_tag LOCUS_09800 gene rsmB 596 1621 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence0555 361 1014 gene locus_tag LOCUS_09810 361 1014 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765911.1 protein_id gnl|my_center|LOCUS_09810 1097 1402 gene locus_tag LOCUS_09820 1097 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence0556 >Feature sequence0557 <1 622 gene locus_tag LOCUS_09830 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963533.1:sugar O-acetyltransferase >Feature sequence0558 743 1129 gene locus_tag LOCUS_09840 743 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence0559 154 723 gene locus_tag LOCUS_09850 154 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 903 1235 gene locus_tag LOCUS_09860 903 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence0560 >Feature sequence0561 979 383 gene locus_tag LOCUS_09870 gene coaE 979 383 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence0562 1037 1333 gene locus_tag LOCUS_09880 1037 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963991.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence0563 >Feature sequence0564 <1 559 gene locus_tag LOCUS_09890 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964414.1:aldehyde dehydrogenase 1294 563 gene locus_tag LOCUS_09900 1294 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence0565 >Feature sequence0566 >Feature sequence0567 >Feature sequence0568 1046 219 gene locus_tag LOCUS_09910 1046 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 <1609 1081 gene locus_tag LOCUS_09920 <1609 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108995.1:peptidylprolyl isomerase >Feature sequence0569 >Feature sequence0570 509 868 gene locus_tag LOCUS_09930 509 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence0571 425 1525 gene locus_tag LOCUS_09940 425 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence0572 >Feature sequence0573 <1 537 gene locus_tag LOCUS_09950 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY97:acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase 543 1166 gene locus_tag LOCUS_09960 543 1166 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403557.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence0574 >Feature sequence0575 <1 522 gene locus_tag LOCUS_09970 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009291961.1:siderophore biosynthesis protein 593 1336 gene locus_tag LOCUS_09980 gene pcrB 593 1336 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_09980 >Feature sequence0576 >Feature sequence0577 149 502 gene locus_tag LOCUS_09990 149 502 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_09990 550 819 gene locus_tag LOCUS_10000 550 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 819 1202 gene locus_tag LOCUS_10010 819 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1503 1231 gene locus_tag LOCUS_10020 1503 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence0578 129 854 gene locus_tag LOCUS_10030 129 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence0579 575 285 gene locus_tag LOCUS_10040 gene atpC 575 285 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAC8 protein_id gnl|my_center|LOCUS_10040 <1599 660 gene locus_tag LOCUS_10050 <1599 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVV9:ATP synthase subunit beta >Feature sequence0580 842 216 gene locus_tag LOCUS_10060 842 216 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 protein_id gnl|my_center|LOCUS_10060 <1599 867 gene locus_tag LOCUS_10070 <1599 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947902.1:membrane protein >Feature sequence0581 >Feature sequence0582 >Feature sequence0583 1024 521 gene locus_tag LOCUS_10080 1024 521 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108357.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence0584 >Feature sequence0585 156 1202 gene locus_tag LOCUS_10090 gene lpxK 156 1202 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_10090 >Feature sequence0586 1254 595 gene locus_tag LOCUS_10100 1254 595 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966222.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence0587 488 790 gene locus_tag LOCUS_10110 488 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1030 866 gene locus_tag LOCUS_10120 1030 866 CDS product UPF0391 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY71 protein_id gnl|my_center|LOCUS_10120 >Feature sequence0588 <1 685 gene locus_tag LOCUS_10130 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963026.1:oligopeptidase B >Feature sequence0589 <1 1471 gene locus_tag LOCUS_10140 <1 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881359.1:sodium:calcium symporter >Feature sequence0590 1 417 gene locus_tag LOCUS_10150 1 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence0591 98 622 gene locus_tag LOCUS_10160 98 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 797 1243 gene locus_tag LOCUS_10170 797 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence0592 <1577 315 gene locus_tag LOCUS_10180 <1577 315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964503.1:ABC transporter permease >Feature sequence0593 1431 1084 gene locus_tag LOCUS_10190 1431 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121877.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence0594 497 312 gene locus_tag LOCUS_10200 497 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence0595 3 164 gene locus_tag LOCUS_10210 3 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 157 906 gene locus_tag LOCUS_10220 157 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence0596 1315 716 gene locus_tag LOCUS_10230 gene hisH 1315 716 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW0 protein_id gnl|my_center|LOCUS_10230 >Feature sequence0597 >Feature sequence0598 >Feature sequence0599 <1 1120 gene locus_tag LOCUS_10240 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2G8:ribonuclease R >Feature sequence0600 <1563 639 gene locus_tag LOCUS_10250 <1563 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962301.1:acyltransferase >Feature sequence0601 1067 810 gene locus_tag LOCUS_10260 gene rpmA 1067 810 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P8 protein_id gnl|my_center|LOCUS_10260 1226 1089 gene locus_tag LOCUS_10270 1226 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence0602 >Feature sequence0603 172 1164 gene locus_tag LOCUS_10280 gene asd 172 1164 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_10280 >Feature sequence0604 >Feature sequence0605 <1555 590 gene locus_tag LOCUS_10290 <1555 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002292875.1:polysaccharide biosynthesis protein >Feature sequence0606 >Feature sequence0607 >Feature sequence0608 229 1020 gene locus_tag LOCUS_10300 229 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890439.1 protein_id gnl|my_center|LOCUS_10300 1127 1438 gene locus_tag LOCUS_10310 1127 1438 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963681.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence0609 786 1259 gene locus_tag LOCUS_10320 786 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence0610 1310 114 gene locus_tag LOCUS_10330 1310 114 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189296.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence0611 1131 280 gene locus_tag LOCUS_10340 1131 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence0612 909 586 gene locus_tag LOCUS_10350 909 586 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263864.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence0613 1311 7 gene locus_tag LOCUS_10360 gene der 1311 7 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_10360 >Feature sequence0614 <1 965 gene locus_tag LOCUS_10370 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962627.1:ribonucleoside-diphosphate reductase >Feature sequence0615 499 53 gene locus_tag LOCUS_10380 gene tadA 499 53 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_10380 >Feature sequence0616 <1539 354 gene locus_tag LOCUS_10390 <1539 354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963494.1:peptidase M3 >Feature sequence0617 125 421 gene locus_tag LOCUS_10400 125 421 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_10400 439 999 gene locus_tag LOCUS_10410 439 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1496 1047 gene locus_tag LOCUS_10420 1496 1047 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence0618 >Feature sequence0619 <1534 483 gene locus_tag LOCUS_10430 <1534 483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022311.1:cell surface protein >Feature sequence0620 433 200 gene locus_tag LOCUS_10440 433 200 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_10440 1094 504 gene locus_tag LOCUS_10450 1094 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence0621 >Feature sequence0622 >Feature sequence0623 <1 601 gene locus_tag LOCUS_10460 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962549.1:cytochrome c oxidase subunit II >Feature sequence0624 954 616 gene locus_tag LOCUS_10470 954 616 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_10470 1252 947 gene locus_tag LOCUS_10480 1252 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870896.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence0625 1488 379 gene locus_tag LOCUS_10490 gene wbpG 1488 379 CDS product LPS biosynthesis protein WbpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence0626 <1 667 gene locus_tag LOCUS_10500 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263020.1:LruC domain-containing protein >Feature sequence0627 593 1477 gene locus_tag LOCUS_10510 593 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107505.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence0628 861 649 gene locus_tag LOCUS_10520 861 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 860 1267 gene locus_tag LOCUS_10530 860 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence0629 512 1279 gene locus_tag LOCUS_10540 512 1279 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence0630 196 591 gene locus_tag LOCUS_10550 196 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413574.1 protein_id gnl|my_center|LOCUS_10550 636 989 gene locus_tag LOCUS_10560 636 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence0631 <1506 762 gene locus_tag LOCUS_10570 <1506 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964490.1:RND transporter >Feature sequence0632 >Feature sequence0633 >Feature sequence0634 >Feature sequence0635 >Feature sequence0636 >Feature sequence0637 >Feature sequence0638 <1 1009 gene locus_tag LOCUS_10580 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259615.1:glycosyl transferase family 1 >Feature sequence0639 <1 1130 gene locus_tag LOCUS_10590 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202760.1:sensor histidine kinase >Feature sequence0640 701 516 gene locus_tag LOCUS_10600 701 516 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391853.1 protein_id gnl|my_center|LOCUS_10600 1489 809 gene locus_tag LOCUS_10610 1489 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence0641 833 231 gene locus_tag LOCUS_10620 833 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 999 820 gene locus_tag LOCUS_10630 999 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 >Feature sequence0642 <1 803 gene locus_tag LOCUS_10640 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXC8:DNA topoisomerase (ATP-hydrolyzing) 800 1279 gene locus_tag LOCUS_10650 800 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence0643 886 470 gene locus_tag LOCUS_10660 886 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1258 887 gene locus_tag LOCUS_10670 gene trxA 1258 887 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51088 protein_id gnl|my_center|LOCUS_10670 >Feature sequence0644 >Feature sequence0645 489 905 gene locus_tag LOCUS_10680 489 905 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963099.1 protein_id gnl|my_center|LOCUS_10680 <1487 915 gene locus_tag LOCUS_10690 <1487 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962485.1:ubiquinone biosynthesis protein UbiA >Feature sequence0646 212 577 gene locus_tag LOCUS_10700 212 577 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_10700 1223 564 gene locus_tag LOCUS_10710 1223 564 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence0647 <1 750 gene locus_tag LOCUS_10720 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963410.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence0648 59 481 gene locus_tag LOCUS_10730 59 481 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence0649 <1481 404 gene locus_tag LOCUS_10740 <1481 404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108842.1:dehydrogenase >Feature sequence0650 >Feature sequence0651 >Feature sequence0652 326 201 gene locus_tag LOCUS_10750 326 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 424 1101 gene locus_tag LOCUS_10760 gene ung2 424 1101 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_10760 >Feature sequence0653 593 1321 gene locus_tag LOCUS_10770 593 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence0654 1437 673 gene locus_tag LOCUS_10780 1437 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence0655 >Feature sequence0656 1373 849 gene locus_tag LOCUS_10790 1373 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence0657 1140 241 gene locus_tag LOCUS_10800 1140 241 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence0658 <1 509 gene locus_tag LOCUS_10810 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968528.1:oxidoreductase 607 1071 gene locus_tag LOCUS_10820 607 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 >Feature sequence0659 >Feature sequence0660 >Feature sequence0661 >Feature sequence0662 >Feature sequence0663 >Feature sequence0664 >Feature sequence0665 222 788 gene locus_tag LOCUS_10830 222 788 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_10830 785 1171 gene locus_tag LOCUS_10840 785 1171 CDS product camphor resistance protein CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867782.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence0666 <1449 938 gene locus_tag LOCUS_10850 <1449 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964508.1:penicillin-binding protein 2 >Feature sequence0667 <1 782 gene locus_tag LOCUS_10860 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RXQ3:acetyltransferase component of pyruvate dehydrogenase complex >Feature sequence0668 496 627 gene locus_tag LOCUS_10870 496 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence0669 >Feature sequence0670 <1 911 gene locus_tag LOCUS_10880 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein >Feature sequence0671 751 894 gene locus_tag LOCUS_10890 751 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence0672 >Feature sequence0673 <1 556 gene locus_tag LOCUS_10900 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068606.1:voltage-gated potassium channel >Feature sequence0674 <1 637 gene locus_tag LOCUS_10910 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963177.1:phosphorylase <1437 645 gene locus_tag LOCUS_10920 <1437 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWW1:1,4-dihydroxy-2-naphthoyl-CoA synthase >Feature sequence0675 3 398 gene locus_tag LOCUS_10930 3 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence0676 <1 576 gene locus_tag LOCUS_10940 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963775.1:gliding motility lipoprotein GldD 555 761 gene locus_tag LOCUS_10950 555 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence0677 1352 621 gene locus_tag LOCUS_10960 1352 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence0678 >Feature sequence0679 <1 882 gene locus_tag LOCUS_10970 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H125:60 kDa chaperonin >Feature sequence0680 909 517 gene locus_tag LOCUS_10980 909 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence0681 <1432 249 gene locus_tag LOCUS_10990 <1432 249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYW4:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence0682 1197 619 gene locus_tag LOCUS_11000 1197 619 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence0683 287 574 gene locus_tag LOCUS_11010 gene rpsR 287 574 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_11010 586 1041 gene locus_tag LOCUS_11020 gene rplI 586 1041 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence0684 >Feature sequence0685 851 1381 gene locus_tag LOCUS_11030 851 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence0686 796 41 gene locus_tag LOCUS_11040 796 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 946 1128 gene locus_tag LOCUS_11050 946 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence0687 <1 1407 gene locus_tag LOCUS_11060 <1 1407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74AE8:pyruvate carboxylase >Feature sequence0688 >Feature sequence0689 287 508 gene locus_tag LOCUS_11070 287 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence0690 1379 375 gene locus_tag LOCUS_11080 1379 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence0691 179 406 gene locus_tag LOCUS_11090 179 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence0692 >Feature sequence0693 >Feature sequence0694 271 1299 gene locus_tag LOCUS_11100 gene porQ 271 1299 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence0695 523 1137 gene locus_tag LOCUS_11110 523 1137 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence0696 844 125 gene locus_tag LOCUS_11120 844 125 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence0697 >Feature sequence0698 1016 612 gene locus_tag LOCUS_11130 1016 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence0699 >Feature sequence0700 >Feature sequence0701 >Feature sequence0702 286 798 gene locus_tag LOCUS_11140 286 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence0703 >Feature sequence0704 302 910 gene locus_tag LOCUS_11150 302 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence0705 <1 1229 gene locus_tag LOCUS_11160 <1 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964215.1:RND transporter >Feature sequence0706 >Feature sequence0707 >Feature sequence0708 >Feature sequence0709 <1 947 gene locus_tag LOCUS_11170 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021725.1:magnesium and cobalt transport protein CorA >Feature sequence0710 >Feature sequence0711 <1 966 gene locus_tag LOCUS_11180 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005794515.1:glycosyl transferase >Feature sequence0712 899 186 gene locus_tag LOCUS_11190 899 186 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence0713 <1397 361 gene locus_tag LOCUS_11200 <1397 361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW07:dihydroorotase >Feature sequence0714 >Feature sequence0715 726 427 gene locus_tag LOCUS_11210 726 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11210 <1395 781 gene locus_tag LOCUS_11220 <1395 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962273.1:succinate dehydrogenase >Feature sequence0716 <1 516 gene locus_tag LOCUS_11230 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222452.1:drug:proton antiporter >Feature sequence0717 >Feature sequence0718 1137 565 gene locus_tag LOCUS_11240 1137 565 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence0719 >Feature sequence0720 >Feature sequence0721 >Feature sequence0722 <1 521 gene locus_tag LOCUS_11250 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:membrane protein 1109 591 gene locus_tag LOCUS_11260 1109 591 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence0723 >Feature sequence0724 <1387 816 gene locus_tag LOCUS_11270 <1387 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O32197:transcriptional regulatory protein LiaR >Feature sequence0725 >Feature sequence0726 >Feature sequence0727 >Feature sequence0728 >Feature sequence0729 >Feature sequence0730 >Feature sequence0731 >Feature sequence0732 377 928 gene locus_tag LOCUS_11280 gene rplF 377 928 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 protein_id gnl|my_center|LOCUS_11280 935 1288 gene locus_tag LOCUS_11290 gene rplR 935 1288 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7J0 protein_id gnl|my_center|LOCUS_11290 >Feature sequence0733 207 1262 gene locus_tag LOCUS_11300 207 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence0734 1171 14 gene locus_tag LOCUS_11310 1171 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1142 1330 gene locus_tag LOCUS_11320 1142 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence0735 652 125 gene locus_tag LOCUS_11330 gene ompH 652 125 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931946.1 protein_id gnl|my_center|LOCUS_11330 1227 682 gene locus_tag LOCUS_11340 1227 682 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence0736 >Feature sequence0737 <1 964 gene locus_tag LOCUS_11350 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963634.1:histidine kinase >Feature sequence0738 654 947 gene locus_tag LOCUS_11360 654 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993398.1 protein_id gnl|my_center|LOCUS_11360 940 1242 gene locus_tag LOCUS_11370 940 1242 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 protein_id gnl|my_center|LOCUS_11370 >Feature sequence0739 >Feature sequence0740 1284 640 gene locus_tag LOCUS_11380 gene nth 1284 640 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_11380 >Feature sequence0741 836 108 gene locus_tag LOCUS_11390 836 108 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_11390 >Feature sequence0742 <1361 821 gene locus_tag LOCUS_11400 <1361 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962213.1:3'-5' exonuclease >Feature sequence0743 >Feature sequence0744 >Feature sequence0745 >Feature sequence0746 176 652 gene locus_tag LOCUS_11410 176 652 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793753.1 protein_id gnl|my_center|LOCUS_11410 698 1267 gene locus_tag LOCUS_11420 698 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence0747 285 749 gene locus_tag LOCUS_11430 285 749 CDS product ligand-binding protein SH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879192.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence0748 <1 1106 gene locus_tag LOCUS_11440 <1 1106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877378.1:cryptochrome/photolyase family protein 1306 1103 gene locus_tag LOCUS_11450 1306 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence0749 1314 25 gene locus_tag LOCUS_11460 gene mntC 1314 25 CDS product manganese transport system membrane protein MntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35024 protein_id gnl|my_center|LOCUS_11460 >Feature sequence0750 >Feature sequence0751 129 1073 gene locus_tag LOCUS_11470 129 1073 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence0752 <1 909 gene locus_tag LOCUS_11480 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8AA31:Na(+)/H(+) antiporter NhaA >Feature sequence0753 <1 788 gene locus_tag LOCUS_11490 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031223.1:monooxygenase >Feature sequence0754 >Feature sequence0755 >Feature sequence0756 <1 1029 gene locus_tag LOCUS_11500 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963430.1:sugar transporter >Feature sequence0757 1171 1293 gene locus_tag LOCUS_11510 1171 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence0758 <1336 192 gene locus_tag LOCUS_11520 <1336 192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962491.1:membrane protein >Feature sequence0759 >Feature sequence0760 >Feature sequence0761 476 3 gene locus_tag LOCUS_11530 476 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence0762 <1333 287 gene locus_tag LOCUS_11540 <1333 287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2S5:tyrosine--tRNA ligase >Feature sequence0763 899 222 gene locus_tag LOCUS_11550 gene trmD 899 222 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_11550 1332 913 gene locus_tag LOCUS_11560 1332 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence0764 >Feature sequence0765 >Feature sequence0766 >Feature sequence0767 112 38 gene locus_tag LOCUS_t00120 112 38 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 514 209 gene locus_tag LOCUS_11570 514 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_11570 <1329 520 gene locus_tag LOCUS_11580 <1329 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64NI8:tyrosine recombinase XerC >Feature sequence0768 204 596 gene locus_tag LOCUS_11590 204 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence0769 1274 702 gene locus_tag LOCUS_11600 1274 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence0770 1146 1 gene locus_tag LOCUS_11610 1146 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence0771 <1 977 gene locus_tag LOCUS_11620 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765755.1:prevent-host-death protein >Feature sequence0772 <1323 672 gene locus_tag LOCUS_11630 <1323 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791185.1:rhomboid family intramembrane serine protease >Feature sequence0773 <1320 377 gene locus_tag LOCUS_11640 <1320 377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYG2:phenylalanine--tRNA ligase beta subunit >Feature sequence0774 >Feature sequence0775 >Feature sequence0776 <1 654 gene locus_tag LOCUS_11650 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0P8T1:N,N'-diacetyllegionaminic acid synthase >Feature sequence0777 <1 804 gene locus_tag LOCUS_11660 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963213.1:alanine dehydrogenase 829 1212 gene locus_tag LOCUS_11670 829 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963214.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence0778 <1 1026 gene locus_tag LOCUS_11680 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815003.1:endonuclease >Feature sequence0779 >Feature sequence0780 <1 1136 gene locus_tag LOCUS_11690 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003426252.1:Na+/H+ antiporter NhaC >Feature sequence0781 480 94 gene locus_tag LOCUS_11700 480 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1221 793 gene locus_tag LOCUS_11710 1221 793 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404521.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence0782 715 374 gene locus_tag LOCUS_11720 715 374 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976375.1 protein_id gnl|my_center|LOCUS_11720 1298 819 gene locus_tag LOCUS_11730 1298 819 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence0783 3 869 gene locus_tag LOCUS_11740 3 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence0784 >Feature sequence0785 >Feature sequence0786 >Feature sequence0787 1105 1019 gene locus_tag LOCUS_t00130 1105 1019 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1230 1155 gene locus_tag LOCUS_t00140 1230 1155 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0788 <1 699 gene locus_tag LOCUS_11750 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001288614.1:histidine kinase <1299 689 gene locus_tag LOCUS_11760 <1299 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963957.1:DNA-binding response regulator >Feature sequence0789 <1 587 gene locus_tag LOCUS_11770 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783748.1:sigma factor regulator FecR >Feature sequence0790 541 723 gene locus_tag LOCUS_11780 541 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence0791 1098 181 gene locus_tag LOCUS_11790 1098 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144116.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence0792 217 426 gene locus_tag LOCUS_11800 217 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence0793 1110 310 gene locus_tag LOCUS_11810 1110 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence0794 934 356 gene locus_tag LOCUS_11820 gene gldL 934 356 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence0795 >Feature sequence0796 1030 89 gene locus_tag LOCUS_11830 gene fmt 1030 89 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0S6 protein_id gnl|my_center|LOCUS_11830 >Feature sequence0797 >Feature sequence0798 144 506 gene locus_tag LOCUS_11840 144 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44075 protein_id gnl|my_center|LOCUS_11840 >Feature sequence0799 3 716 gene locus_tag LOCUS_11850 3 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence0800 >Feature sequence0801 <1 594 gene locus_tag LOCUS_11860 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1R7:3-hydroxyanthranilate 3,4-dioxygenase 767 1255 gene locus_tag LOCUS_11870 767 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence0802 >Feature sequence0803 >Feature sequence0804 >Feature sequence0805 4 693 gene locus_tag LOCUS_11880 4 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence0806 >Feature sequence0807 <1281 225 gene locus_tag LOCUS_11890 <1281 225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037887.1:peptidase >Feature sequence0808 1279 1028 gene locus_tag LOCUS_11900 1279 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence0809 <1 548 gene locus_tag LOCUS_11910 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964406.1:general secretion pathway protein GspF >Feature sequence0810 <1280 393 gene locus_tag LOCUS_11920 <1280 393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119189.1:cytochrome-c peroxidase >Feature sequence0811 500 69 gene locus_tag LOCUS_11930 500 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence0812 353 1216 gene locus_tag LOCUS_11940 353 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence0813 376 26 gene locus_tag LOCUS_11950 376 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_11950 1042 383 gene locus_tag LOCUS_11960 1042 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence0814 829 323 gene locus_tag LOCUS_11970 829 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence0815 >Feature sequence0816 <1 1071 gene locus_tag LOCUS_11980 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403922.1:amidohydrolase >Feature sequence0817 <1269 648 gene locus_tag LOCUS_11990 <1269 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403341.1:peptidase S8 >Feature sequence0818 <1 750 gene locus_tag LOCUS_12000 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962998.1:peptidase M14 >Feature sequence0819 <1267 408 gene locus_tag LOCUS_12010 <1267 408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122926.1:type I restriction-modification system deoxyribonuclease >Feature sequence0820 417 28 gene locus_tag LOCUS_12020 417 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence0821 >Feature sequence0822 >Feature sequence0823 899 603 gene locus_tag LOCUS_12030 899 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence0824 978 202 gene locus_tag LOCUS_12040 978 202 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XK7 protein_id gnl|my_center|LOCUS_12040 >Feature sequence0825 >Feature sequence0826 <1 587 gene locus_tag LOCUS_12050 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120931.1:aggregation factor core protein MAFp3, isoform E <1253 584 gene locus_tag LOCUS_12060 <1253 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082772.1:alkaline phosphatase >Feature sequence0827 >Feature sequence0828 <1251 599 gene locus_tag LOCUS_12070 <1251 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582958.1:glycosyltransferase WbuB >Feature sequence0829 >Feature sequence0830 >Feature sequence0831 797 411 gene locus_tag LOCUS_12080 797 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence0832 <1 690 gene locus_tag LOCUS_12090 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964185.1:peptidylprolyl isomerase >Feature sequence0833 <1248 104 gene locus_tag LOCUS_12100 <1248 104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXZ5:DNA helicase >Feature sequence0834 >Feature sequence0835 1181 642 gene locus_tag LOCUS_12110 1181 642 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence0836 <1242 265 gene locus_tag LOCUS_12120 <1242 265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964437.1:FAD-dependent oxidoreductase >Feature sequence0837 >Feature sequence0838 <1 767 gene locus_tag LOCUS_12130 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029259.1:3-hydroxyacyl-CoA dehydrogenase 1009 860 gene locus_tag LOCUS_12140 1009 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence0839 >Feature sequence0840 >Feature sequence0841 >Feature sequence0842 >Feature sequence0843 862 500 gene locus_tag LOCUS_12150 862 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence0844 1161 553 gene locus_tag LOCUS_12160 gene cysC 1161 553 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HLD2 protein_id gnl|my_center|LOCUS_12160 >Feature sequence0845 >Feature sequence0846 >Feature sequence0847 662 81 gene locus_tag LOCUS_12170 662 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 742 1062 gene locus_tag LOCUS_12180 742 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence0848 <1225 614 gene locus_tag LOCUS_12190 <1225 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963328.1:cystathionine beta-synthase >Feature sequence0849 <1222 680 gene locus_tag LOCUS_12200 <1222 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TX8:Lon protease >Feature sequence0850 101 604 gene locus_tag LOCUS_12210 gene mreD 101 604 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence0851 >Feature sequence0852 1158 784 gene locus_tag LOCUS_12220 1158 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence0853 1219 452 gene locus_tag LOCUS_12230 1219 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence0854 >Feature sequence0855 300 1130 gene locus_tag LOCUS_12240 300 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence0856 77 919 gene locus_tag LOCUS_12250 gene oxyR 77 919 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence0857 >Feature sequence0858 <1 562 gene locus_tag LOCUS_12260 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXG2:serine hydroxymethyltransferase >Feature sequence0859 >Feature sequence0860 <1211 532 gene locus_tag LOCUS_12270 <1211 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530516.1:amidohydrolase >Feature sequence0861 563 69 gene locus_tag LOCUS_12280 563 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence0862 >Feature sequence0863 1203 43 gene locus_tag LOCUS_12290 1203 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence0864 >Feature sequence0865 >Feature sequence0866 >Feature sequence0867 <1200 330 gene locus_tag LOCUS_12300 <1200 330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYT6:peptide chain release factor 3 >Feature sequence0868 759 923 gene locus_tag LOCUS_12310 759 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence0869 >Feature sequence0870 >Feature sequence0871 1117 437 gene locus_tag LOCUS_12320 1117 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence0872 >Feature sequence0873 297 725 gene locus_tag LOCUS_12330 297 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence0874 <1191 145 gene locus_tag LOCUS_12340 <1191 145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073784.1:TonB-dependent receptor >Feature sequence0875 >Feature sequence0876 1060 419 gene locus_tag LOCUS_12350 1060 419 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence0877 <1190 398 gene locus_tag LOCUS_12360 <1190 398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1A2:ribosomal RNA small subunit methyltransferase H >Feature sequence0878 >Feature sequence0879 804 418 gene locus_tag LOCUS_12370 804 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence0880 <1187 644 gene locus_tag LOCUS_12380 <1187 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963532.1:O-acyltransferase >Feature sequence0881 676 912 gene locus_tag LOCUS_12390 676 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence0882 <1 607 gene locus_tag LOCUS_12400 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788730.1:capsular polysaccharide biosynthesis protein >Feature sequence0883 >Feature sequence0884 >Feature sequence0885 >Feature sequence0886 1159 125 gene locus_tag LOCUS_12410 gene mvaD 1159 125 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence0887 >Feature sequence0888 317 156 gene locus_tag LOCUS_12420 317 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1125 394 gene locus_tag LOCUS_12430 1125 394 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence0889 124 753 gene locus_tag LOCUS_12440 gene rplD 124 753 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_12440 756 1046 gene locus_tag LOCUS_12450 gene rplW 756 1046 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A478 protein_id gnl|my_center|LOCUS_12450 >Feature sequence0890 >Feature sequence0891 1 693 gene locus_tag LOCUS_12460 1 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence0892 <1174 375 gene locus_tag LOCUS_12470 <1174 375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962484.1:mevalonate kinase >Feature sequence0893 >Feature sequence0894 >Feature sequence0895 >Feature sequence0896 >Feature sequence0897 >Feature sequence0898 <1171 132 gene locus_tag LOCUS_12480 <1171 132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706045.1:hybrid sensor histidine kinase/response regulator >Feature sequence0899 <1167 130 gene locus_tag LOCUS_12490 <1167 130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963483.1:peptidoglycan synthetase >Feature sequence0900 <1166 195 gene locus_tag LOCUS_12500 <1166 195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2D7:ATP synthase subunit alpha >Feature sequence0901 >Feature sequence0902 >Feature sequence0903 >Feature sequence0904 237 527 gene locus_tag LOCUS_12510 237 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 594 1049 gene locus_tag LOCUS_12520 594 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence0905 >Feature sequence0906 >Feature sequence0907 <1159 455 gene locus_tag LOCUS_12530 <1159 455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763956.1:TonB-dependent receptor >Feature sequence0908 >Feature sequence0909 >Feature sequence0910 >Feature sequence0911 116 913 gene locus_tag LOCUS_12540 116 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence0912 1082 723 gene locus_tag LOCUS_12550 1082 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence0913 >Feature sequence0914 >Feature sequence0915 478 293 gene locus_tag LOCUS_12560 478 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence0916 >Feature sequence0917 >Feature sequence0918 >Feature sequence0919 <1150 209 gene locus_tag LOCUS_12570 <1150 209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964304.1:agmatinase >Feature sequence0920 >Feature sequence0921 >Feature sequence0922 127 585 gene locus_tag LOCUS_12580 127 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence0923 314 33 gene locus_tag LOCUS_12590 314 33 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_12590 525 1064 gene locus_tag LOCUS_12600 525 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522515.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence0924 620 901 gene locus_tag LOCUS_12610 620 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085796.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence0925 >Feature sequence0926 <1 584 gene locus_tag LOCUS_12620 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964472.1:riboflavin synthase subunit alpha <1144 570 gene locus_tag LOCUS_12630 <1144 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0C2:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence0927 1113 193 gene locus_tag LOCUS_12640 1113 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence0928 >Feature sequence0929 >Feature sequence0930 >Feature sequence0931 473 847 gene locus_tag LOCUS_12650 473 847 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141564.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence0932 <1139 580 gene locus_tag LOCUS_12660 <1139 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004291480.1:ATPase >Feature sequence0933 48 464 gene locus_tag LOCUS_12670 gene mrpB 48 464 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 protein_id gnl|my_center|LOCUS_12670 468 806 gene locus_tag LOCUS_12680 gene mrpC 468 806 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_12680 803 1102 gene locus_tag LOCUS_12690 803 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence0934 46 549 gene locus_tag LOCUS_12700 46 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence0935 >Feature sequence0936 <1137 400 gene locus_tag LOCUS_12710 <1137 400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXI6:dihydrolipoyl dehydrogenase >Feature sequence0937 348 1067 gene locus_tag LOCUS_12720 gene recO 348 1067 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A275 protein_id gnl|my_center|LOCUS_12720 >Feature sequence0938 >Feature sequence0939 >Feature sequence0940 <1 1019 gene locus_tag LOCUS_12730 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009873739.1:MFS transporter >Feature sequence0941 >Feature sequence0942 <1130 106 gene locus_tag LOCUS_12740 <1130 106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228608.1:peptide ABC transporter permease >Feature sequence0943 556 95 gene locus_tag LOCUS_12750 556 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 622 1086 gene locus_tag LOCUS_12760 622 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence0944 <1128 303 gene locus_tag LOCUS_12770 <1128 303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0W0:malate dehydrogenase >Feature sequence0945 1 288 gene locus_tag LOCUS_12780 1 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence0946 920 429 gene locus_tag LOCUS_12790 920 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence0947 >Feature sequence0948 >Feature sequence0949 >Feature sequence0950 >Feature sequence0951 >Feature sequence0952 1092 589 gene locus_tag LOCUS_12800 1092 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence0953 440 57 gene locus_tag LOCUS_12810 440 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence0954 >Feature sequence0955 >Feature sequence0956 >Feature sequence0957 >Feature sequence0958 75 236 gene locus_tag LOCUS_12820 75 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 <1116 287 gene locus_tag LOCUS_12830 <1116 287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962776.1:thioredoxin-disulfide reductase >Feature sequence0959 >Feature sequence0960 1114 275 gene locus_tag LOCUS_12840 1114 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence0961 >Feature sequence0962 >Feature sequence0963 2 406 gene locus_tag LOCUS_12850 2 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence0964 >Feature sequence0965 73 897 gene locus_tag LOCUS_12860 73 897 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 protein_id gnl|my_center|LOCUS_12860 >Feature sequence0966 >Feature sequence0967 1024 716 gene locus_tag LOCUS_12870 1024 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence0968 >Feature sequence0969 >Feature sequence0970 <1 825 gene locus_tag LOCUS_12880 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89YQ1:endonuclease MutS2 >Feature sequence0971 749 381 gene locus_tag LOCUS_12890 749 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence0972 229 666 gene locus_tag LOCUS_12900 229 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence0973 >Feature sequence0974 >Feature sequence0975 >Feature sequence0976 >Feature sequence0977 >Feature sequence0978 893 186 gene locus_tag LOCUS_12910 893 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence0979 <1 657 gene locus_tag LOCUS_12920 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962233.1:1-acyl-sn-glycerol-3-phosphate acyltransferase >Feature sequence0980 >Feature sequence0981 335 1030 gene locus_tag LOCUS_12930 335 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence0982 <1 996 gene locus_tag LOCUS_12940 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H289:dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex >Feature sequence0983 2 493 gene locus_tag LOCUS_12950 2 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence0984 >Feature sequence0985 >Feature sequence0986 >Feature sequence0987 >Feature sequence0988 237 713 gene locus_tag LOCUS_12960 237 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 710 1039 gene locus_tag LOCUS_12970 710 1039 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence0989 975 403 gene locus_tag LOCUS_12980 gene ppa 975 403 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZ21 protein_id gnl|my_center|LOCUS_12980 >Feature sequence0990 3 152 gene locus_tag LOCUS_12990 3 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence0991 428 970 gene locus_tag LOCUS_13000 428 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence0992 651 466 gene locus_tag LOCUS_13010 651 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 958 884 gene locus_tag LOCUS_t00150 958 884 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0993 >Feature sequence0994 <1082 389 gene locus_tag LOCUS_13020 <1082 389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87T22:1,4-dihydroxy-2-naphthoate octaprenyltransferase >Feature sequence0995 1037 378 gene locus_tag LOCUS_13030 1037 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence0996 >Feature sequence0997 >Feature sequence0998 105 632 gene locus_tag LOCUS_13040 105 632 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence0999 >Feature sequence1000 >Feature sequence1001 778 527 gene locus_tag LOCUS_13050 778 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1009 860 gene locus_tag LOCUS_13060 1009 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence1002 1009 260 gene locus_tag LOCUS_13070 1009 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence1003 >Feature sequence1004 <1 828 gene locus_tag LOCUS_13080 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H090:aminotransferase >Feature sequence1005 >Feature sequence1006 >Feature sequence1007 2 1036 gene locus_tag LOCUS_13090 2 1036 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence1008 >Feature sequence1009 >Feature sequence1010 >Feature sequence1011 >Feature sequence1012 1062 601 gene locus_tag LOCUS_13100 1062 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence1013 <1 770 gene locus_tag LOCUS_13110 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097455.1:multidrug export protein EmrA >Feature sequence1014 >Feature sequence1015 908 297 gene locus_tag LOCUS_13120 908 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence1016 1062 814 gene locus_tag LOCUS_13130 1062 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence1017 >Feature sequence1018 <1 714 gene locus_tag LOCUS_13140 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YFY7:glutamate racemase >Feature sequence1019 >Feature sequence1020 >Feature sequence1021 191 730 gene locus_tag LOCUS_13150 191 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence1022 <1058 459 gene locus_tag LOCUS_13160 <1058 459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXC2:phosphoserine aminotransferase >Feature sequence1023 819 64 gene locus_tag LOCUS_13170 819 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence1024 >Feature sequence1025 >Feature sequence1026 <1 765 gene locus_tag LOCUS_13180 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963268.1:chromosome partitioning protein ParB >Feature sequence1027 <1 579 gene locus_tag LOCUS_13190 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2E8:ribonuclease 3 589 1029 gene locus_tag LOCUS_13200 589 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence1028 >Feature sequence1029 >Feature sequence1030 >Feature sequence1031 <1052 233 gene locus_tag LOCUS_13210 <1052 233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H070:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase >Feature sequence1032 >Feature sequence1033 >Feature sequence1034 502 182 gene locus_tag LOCUS_13220 502 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence1035 >Feature sequence1036 >Feature sequence1037 >Feature sequence1038 >Feature sequence1039 >Feature sequence1040 996 592 gene locus_tag LOCUS_13230 996 592 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978012.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence1041 >Feature sequence1042 >Feature sequence1043 >Feature sequence1044 394 609 gene locus_tag LOCUS_13240 394 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence1045 >Feature sequence1046 >Feature sequence1047 1040 363 gene locus_tag LOCUS_13250 1040 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence1048 <1041 526 gene locus_tag LOCUS_13260 <1041 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015643.1:phosphatidylinositol-4-phosphate 5-kinase >Feature sequence1049 >Feature sequence1050 >Feature sequence1051 >Feature sequence1052 >Feature sequence1053 >Feature sequence1054 >Feature sequence1055 141 419 gene locus_tag LOCUS_13270 141 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence1056 >Feature sequence1057 >Feature sequence1058 >Feature sequence1059 <1031 134 gene locus_tag LOCUS_13280 <1031 134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZD2:glycine dehydrogenase (aminomethyl-transferring) >Feature sequence1060 <1031 17 gene locus_tag LOCUS_13290 <1031 17 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963233.1:dihydroorotase >Feature sequence1061 >Feature sequence1062 >Feature sequence1063 >Feature sequence1064 1016 276 gene locus_tag LOCUS_13300 1016 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence1065 <1 964 gene locus_tag LOCUS_13310 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:membrane protein >Feature sequence1066 55 432 gene locus_tag LOCUS_13320 gene rpsM 55 432 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A499 protein_id gnl|my_center|LOCUS_13320 445 840 gene locus_tag LOCUS_13330 gene rpsK 445 840 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 protein_id gnl|my_center|LOCUS_13330 >Feature sequence1067 198 1007 gene locus_tag LOCUS_13340 198 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence1068 >Feature sequence1069 <1 622 gene locus_tag LOCUS_13350 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964207.1:cytochrome oxidase subunit III 650 997 gene locus_tag LOCUS_13360 650 997 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence1070 >Feature sequence1071 >Feature sequence1072 22 519 gene locus_tag LOCUS_13370 22 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 647 781 gene locus_tag LOCUS_13380 647 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence1073 >Feature sequence1074 >Feature sequence1075 >Feature sequence1076 269 853 gene locus_tag LOCUS_13390 269 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence1077 >Feature sequence1078 122 706 gene locus_tag LOCUS_13400 122 706 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_13400 >Feature sequence1079 >Feature sequence1080 <1019 100 gene locus_tag LOCUS_13410 <1019 100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791032.1:chloride channel protein >Feature sequence1081 >Feature sequence1082 >Feature sequence1083 <1018 491 gene locus_tag LOCUS_13420 <1018 491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035292.1:DNA topoisomerase >Feature sequence1084 >Feature sequence1085 >Feature sequence1086 >Feature sequence1087 406 837 gene locus_tag LOCUS_13430 406 837 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706204.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence1088 >Feature sequence1089 1 921 gene locus_tag LOCUS_13440 1 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence1090 >Feature sequence1091 >Feature sequence1092 >Feature sequence1093 547 296 gene locus_tag LOCUS_13450 gene rpsT 547 296 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_13450 643 571 gene locus_tag LOCUS_t00160 643 571 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1094 >Feature sequence1095 <1 687 gene locus_tag LOCUS_13460 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZA1:elongation factor G >Feature sequence1096 >Feature sequence1097 <1 526 gene locus_tag LOCUS_13470 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H136:UDP-N-acetylenolpyruvoylglucosamine reductase 550 762 gene locus_tag LOCUS_13480 550 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence1098 409 678 gene locus_tag LOCUS_13490 gene rpsO 409 678 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A418 protein_id gnl|my_center|LOCUS_13490 >Feature sequence1099 828 505 gene locus_tag LOCUS_13500 828 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence1100 >Feature sequence1101 >Feature sequence1102