>Feature sequence001 300 995 gene locus_tag LOCUS_00010 300 995 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083661.1 protein_id gnl|my_center|LOCUS_00010 1009 1872 gene locus_tag LOCUS_00020 1009 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031741.1 protein_id gnl|my_center|LOCUS_00020 1904 3106 gene locus_tag LOCUS_00030 1904 3106 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKF6 protein_id gnl|my_center|LOCUS_00030 3113 3691 gene locus_tag LOCUS_00040 gene yceF 3113 3691 CDS product Maf-like protein YceF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32B92 protein_id gnl|my_center|LOCUS_00040 4481 3699 gene locus_tag LOCUS_00050 gene yjkA 4481 3699 CDS product UPF0014 membrane protein YjkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34684 protein_id gnl|my_center|LOCUS_00050 4571 5623 gene locus_tag LOCUS_00060 4571 5623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057332.1 protein_id gnl|my_center|LOCUS_00060 5688 6704 gene locus_tag LOCUS_00070 5688 6704 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385771.1 protein_id gnl|my_center|LOCUS_00070 6832 8340 gene locus_tag LOCUS_00080 6832 8340 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141015.1 protein_id gnl|my_center|LOCUS_00080 9022 8354 gene locus_tag LOCUS_00090 9022 8354 CDS product iron-dependent repressor IdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703761.1 protein_id gnl|my_center|LOCUS_00090 9115 10590 gene locus_tag LOCUS_00100 9115 10590 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729200.1 protein_id gnl|my_center|LOCUS_00100 10605 11750 gene locus_tag LOCUS_00110 10605 11750 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 protein_id gnl|my_center|LOCUS_00110 12601 11771 gene locus_tag LOCUS_00120 gene rnz 12601 11771 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TYN1 protein_id gnl|my_center|LOCUS_00120 13379 12609 gene locus_tag LOCUS_00130 13379 12609 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_00130 15001 13445 gene locus_tag LOCUS_00140 15001 13445 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_00140 15083 16123 gene locus_tag LOCUS_00150 15083 16123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16450 16148 gene locus_tag LOCUS_00160 16450 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16526 17140 gene locus_tag LOCUS_00170 gene tag 16526 17140 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968813.1 protein_id gnl|my_center|LOCUS_00170 17137 19719 gene locus_tag LOCUS_00180 17137 19719 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222778.1 protein_id gnl|my_center|LOCUS_00180 <20759 19770 gene locus_tag LOCUS_00190 <20759 19770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223417.1:dimethylallyltransferase >Feature sequence002 137 50 gene locus_tag LOCUS_t00010 137 50 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 201 294 gene locus_tag LOCUS_t00020 201 294 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 342 416 gene locus_tag LOCUS_t00030 342 416 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4371 454 gene locus_tag LOCUS_00200 4371 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 4817 4371 gene locus_tag LOCUS_00210 4817 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 5389 4904 gene locus_tag LOCUS_00220 5389 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 5917 5492 gene locus_tag LOCUS_00230 5917 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 6379 8634 gene locus_tag LOCUS_00240 6379 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 9675 8866 gene locus_tag LOCUS_00250 9675 8866 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096171.1 protein_id gnl|my_center|LOCUS_00250 10396 9707 gene locus_tag LOCUS_00260 10396 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 11492 10497 gene locus_tag LOCUS_00270 11492 10497 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530364.1 protein_id gnl|my_center|LOCUS_00270 11541 12329 gene locus_tag LOCUS_00280 11541 12329 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118358.1 protein_id gnl|my_center|LOCUS_00280 12880 12326 gene locus_tag LOCUS_00290 12880 12326 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028218.1 protein_id gnl|my_center|LOCUS_00290 13862 12867 gene locus_tag LOCUS_00300 13862 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 14077 14003 gene locus_tag LOCUS_t00040 14077 14003 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 14507 14103 gene locus_tag LOCUS_00310 14507 14103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 17563 15092 gene locus_tag LOCUS_00320 gene gyrA 17563 15092 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CU92 protein_id gnl|my_center|LOCUS_00320 19500 17563 gene locus_tag LOCUS_00330 gene gyrB 19500 17563 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CT81 protein_id gnl|my_center|LOCUS_00330 19998 19672 gene locus_tag LOCUS_00340 19998 19672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 >Feature sequence003 362 1603 gene locus_tag LOCUS_00350 362 1603 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089277.1 protein_id gnl|my_center|LOCUS_00350 2782 1622 gene locus_tag LOCUS_00360 2782 1622 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728240.1 protein_id gnl|my_center|LOCUS_00360 3822 2782 gene locus_tag LOCUS_00370 3822 2782 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728239.1 protein_id gnl|my_center|LOCUS_00370 3864 4691 gene locus_tag LOCUS_00380 gene paaG 3864 4691 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_00380 5636 4707 gene locus_tag LOCUS_00390 5636 4707 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225234.1 protein_id gnl|my_center|LOCUS_00390 7026 5713 gene locus_tag LOCUS_00400 7026 5713 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_00400 9492 7048 gene locus_tag LOCUS_00410 9492 7048 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_00410 11062 9515 gene locus_tag LOCUS_00420 11062 9515 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_00420 12289 11063 gene locus_tag LOCUS_00430 12289 11063 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_00430 13377 12286 gene locus_tag LOCUS_00440 13377 12286 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_00440 14478 13468 gene locus_tag LOCUS_00450 14478 13468 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730894.1 protein_id gnl|my_center|LOCUS_00450 14648 16747 gene locus_tag LOCUS_00460 14648 16747 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_00460 <17405 16755 gene locus_tag LOCUS_00470 <17405 16755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029178.1:ABC transporter ATP-binding protein >Feature sequence004 886 188 gene locus_tag LOCUS_00480 886 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 2469 1267 gene locus_tag LOCUS_00490 2469 1267 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900647.1 protein_id gnl|my_center|LOCUS_00490 2631 3158 gene locus_tag LOCUS_00500 2631 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 3178 3651 gene locus_tag LOCUS_00510 3178 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143438.1 protein_id gnl|my_center|LOCUS_00510 3642 4055 gene locus_tag LOCUS_00520 3642 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 4048 5031 gene locus_tag LOCUS_00530 4048 5031 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729469.1 protein_id gnl|my_center|LOCUS_00530 6051 5056 gene locus_tag LOCUS_00540 6051 5056 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097237.1 protein_id gnl|my_center|LOCUS_00540 6104 7474 gene locus_tag LOCUS_00550 6104 7474 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703659.1 protein_id gnl|my_center|LOCUS_00550 8527 7484 gene locus_tag LOCUS_00560 8527 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 9912 8524 gene locus_tag LOCUS_00570 gene mtaD 9912 8524 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJW1 protein_id gnl|my_center|LOCUS_00570 11012 9909 gene locus_tag LOCUS_00580 11012 9909 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393222.1 protein_id gnl|my_center|LOCUS_00580 12054 11020 gene locus_tag LOCUS_00590 12054 11020 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_00590 13018 12086 gene locus_tag LOCUS_00600 13018 12086 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964024.1 protein_id gnl|my_center|LOCUS_00600 14073 13021 gene locus_tag LOCUS_00610 14073 13021 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088890.1 protein_id gnl|my_center|LOCUS_00610 15730 14132 gene locus_tag LOCUS_00620 15730 14132 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970667.1 protein_id gnl|my_center|LOCUS_00620 >Feature sequence005 41 1240 gene locus_tag LOCUS_00630 41 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 1240 2250 gene locus_tag LOCUS_00640 1240 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 2301 2795 gene locus_tag LOCUS_00650 2301 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 2795 3400 gene locus_tag LOCUS_00660 gene nuoB1 2795 3400 CDS product NADH-quinone oxidoreductase subunit B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAQ5 protein_id gnl|my_center|LOCUS_00660 3397 3861 gene locus_tag LOCUS_00670 3397 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 3861 5195 gene locus_tag LOCUS_00680 gene nuoD 3861 5195 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVN5 protein_id gnl|my_center|LOCUS_00680 5195 5842 gene locus_tag LOCUS_00690 5195 5842 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_00690 5835 7259 gene locus_tag LOCUS_00700 5835 7259 CDS product NADH-quinone oxidoreductase, F subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702874.1 protein_id gnl|my_center|LOCUS_00700 7256 9730 gene locus_tag LOCUS_00710 gene nuoG 7256 9730 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAR0 protein_id gnl|my_center|LOCUS_00710 9730 10947 gene locus_tag LOCUS_00720 gene nuoH 9730 10947 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QU29 protein_id gnl|my_center|LOCUS_00720 10947 11564 gene locus_tag LOCUS_00730 gene nuoI1 10947 11564 CDS product NADH-quinone oxidoreductase subunit I 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAR2 protein_id gnl|my_center|LOCUS_00730 11564 12175 gene locus_tag LOCUS_00740 11564 12175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 12172 12477 gene locus_tag LOCUS_00750 gene nuoK 12172 12477 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWD6 protein_id gnl|my_center|LOCUS_00750 12482 14407 gene locus_tag LOCUS_00760 12482 14407 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258759.1 protein_id gnl|my_center|LOCUS_00760 >Feature sequence006 55 1380 gene locus_tag LOCUS_00770 55 1380 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085724.1 protein_id gnl|my_center|LOCUS_00770 1400 3322 gene locus_tag LOCUS_00780 1400 3322 CDS product beta-lactamase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702054.1 protein_id gnl|my_center|LOCUS_00780 4133 3345 gene locus_tag LOCUS_00790 4133 3345 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892291.1 protein_id gnl|my_center|LOCUS_00790 4277 5224 gene locus_tag LOCUS_00800 4277 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 5221 5640 gene locus_tag LOCUS_00810 gene cdd 5221 5640 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPH3 protein_id gnl|my_center|LOCUS_00810 5640 6914 gene locus_tag LOCUS_00820 gene deoA 5640 6914 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222773.1 protein_id gnl|my_center|LOCUS_00820 7772 6927 gene locus_tag LOCUS_00830 7772 6927 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_00830 9259 7772 gene locus_tag LOCUS_00840 9259 7772 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_00840 10192 9263 gene locus_tag LOCUS_00850 10192 9263 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_00850 11880 10189 gene locus_tag LOCUS_00860 11880 10189 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029947.1 protein_id gnl|my_center|LOCUS_00860 12701 11877 gene locus_tag LOCUS_00870 gene punA 12701 11877 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QT39 protein_id gnl|my_center|LOCUS_00870 12863 13801 gene locus_tag LOCUS_00880 gene psuG 12863 13801 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEI6 protein_id gnl|my_center|LOCUS_00880 <14761 13886 gene locus_tag LOCUS_00890 <14761 13886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537770.1:nitrate ABC transporter substrate-binding protein >Feature sequence007 458 844 gene locus_tag LOCUS_00900 458 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 1511 846 gene locus_tag LOCUS_00910 gene purQ 1511 846 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3S5 protein_id gnl|my_center|LOCUS_00910 1771 1511 gene locus_tag LOCUS_00920 gene purS 1771 1511 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG9 protein_id gnl|my_center|LOCUS_00920 2674 1775 gene locus_tag LOCUS_00930 gene purC 2674 1775 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF0 protein_id gnl|my_center|LOCUS_00930 4119 2704 gene locus_tag LOCUS_00940 4119 2704 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CK34 protein_id gnl|my_center|LOCUS_00940 4590 4135 gene locus_tag LOCUS_00950 gene purE 4590 4135 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G587 protein_id gnl|my_center|LOCUS_00950 5839 4613 gene locus_tag LOCUS_00960 gene purD 5839 4613 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP5 protein_id gnl|my_center|LOCUS_00960 7137 5857 gene locus_tag LOCUS_00970 gene purA 7137 5857 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8P6 protein_id gnl|my_center|LOCUS_00970 7792 7409 gene locus_tag LOCUS_00980 7792 7409 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230871.1 protein_id gnl|my_center|LOCUS_00980 8945 7833 gene locus_tag LOCUS_00990 gene dnaJ 8945 7833 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKX7 protein_id gnl|my_center|LOCUS_00990 9506 8970 gene locus_tag LOCUS_01000 gene grpE 9506 8970 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R45 protein_id gnl|my_center|LOCUS_01000 11326 9503 gene locus_tag LOCUS_01010 gene dnaK 11326 9503 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q05558 protein_id gnl|my_center|LOCUS_01010 11572 12324 gene locus_tag LOCUS_01020 gene gpmA 11572 12324 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MAI3 protein_id gnl|my_center|LOCUS_01020 >Feature sequence008 538 278 gene locus_tag LOCUS_01030 538 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 1791 628 gene locus_tag LOCUS_01040 1791 628 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_01040 3042 1798 gene locus_tag LOCUS_01050 gene glyA 3042 1798 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E008 protein_id gnl|my_center|LOCUS_01050 3118 4422 gene locus_tag LOCUS_01060 3118 4422 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_01060 6126 4435 gene locus_tag LOCUS_01070 6126 4435 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090531.1 protein_id gnl|my_center|LOCUS_01070 6080 9238 gene locus_tag LOCUS_01080 6080 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 9231 12509 gene locus_tag LOCUS_01090 9231 12509 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BR0 protein_id gnl|my_center|LOCUS_01090 12633 13577 gene locus_tag LOCUS_01100 12633 13577 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728665.1 protein_id gnl|my_center|LOCUS_01100 >Feature sequence009 794 183 gene locus_tag LOCUS_01110 794 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 813 1529 gene locus_tag LOCUS_01120 813 1529 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720869.1 protein_id gnl|my_center|LOCUS_01120 2116 1559 gene locus_tag LOCUS_01130 2116 1559 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RXR9 protein_id gnl|my_center|LOCUS_01130 2909 2418 gene locus_tag LOCUS_01140 2909 2418 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921241.1 protein_id gnl|my_center|LOCUS_01140 2957 3703 gene locus_tag LOCUS_01150 2957 3703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027531.1 protein_id gnl|my_center|LOCUS_01150 3708 6461 gene locus_tag LOCUS_01160 3708 6461 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_01160 8571 6481 gene locus_tag LOCUS_01170 8571 6481 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZ13 protein_id gnl|my_center|LOCUS_01170 8677 9666 gene locus_tag LOCUS_01180 8677 9666 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222197.1 protein_id gnl|my_center|LOCUS_01180 9725 10798 gene locus_tag LOCUS_01190 gene hemE 9725 10798 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69861 protein_id gnl|my_center|LOCUS_01190 10795 12177 gene locus_tag LOCUS_01200 gene hemY 10795 12177 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_01200 >Feature sequence010 974 435 gene locus_tag LOCUS_01210 974 435 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5I6 protein_id gnl|my_center|LOCUS_01210 1672 971 gene locus_tag LOCUS_01220 1672 971 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_01220 2172 1675 gene locus_tag LOCUS_01230 2172 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 2737 2180 gene locus_tag LOCUS_01240 2737 2180 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_01240 3674 2787 gene locus_tag LOCUS_01250 3674 2787 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228182.1 protein_id gnl|my_center|LOCUS_01250 5128 4001 gene locus_tag LOCUS_01260 5128 4001 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_01260 6232 5135 gene locus_tag LOCUS_01270 6232 5135 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI3 protein_id gnl|my_center|LOCUS_01270 7593 6232 gene locus_tag LOCUS_01280 7593 6232 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CV79 protein_id gnl|my_center|LOCUS_01280 7993 7628 gene locus_tag LOCUS_01290 7993 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 11412 7990 gene locus_tag LOCUS_01300 11412 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 <12590 11502 gene locus_tag LOCUS_01310 <12590 11502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CW62:phosphoglucosamine mutase >Feature sequence011 1121 444 gene locus_tag LOCUS_01320 1121 444 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_01320 2370 1261 gene locus_tag LOCUS_01330 gene prfB 2370 1261 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MEU8 protein_id gnl|my_center|LOCUS_01330 5136 2446 gene locus_tag LOCUS_01340 gene secA 5136 2446 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4G6 protein_id gnl|my_center|LOCUS_01340 5716 5189 gene locus_tag LOCUS_01350 5716 5189 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_01350 6519 5860 gene locus_tag LOCUS_01360 6519 5860 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MN40 protein_id gnl|my_center|LOCUS_01360 7661 6561 gene locus_tag LOCUS_01370 gene dnaJ2 7661 6561 CDS product chaperone protein DnaJ 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDD7 protein_id gnl|my_center|LOCUS_01370 8669 7665 gene locus_tag LOCUS_01380 gene hrcA 8669 7665 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MN38 protein_id gnl|my_center|LOCUS_01380 10502 8718 gene locus_tag LOCUS_01390 gene lepA 10502 8718 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WK97 protein_id gnl|my_center|LOCUS_01390 10611 10865 gene locus_tag LOCUS_01400 gene rpsT 10611 10865 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCH7 protein_id gnl|my_center|LOCUS_01400 11890 10922 gene locus_tag LOCUS_01410 11890 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 >Feature sequence012 <1 1116 gene locus_tag LOCUS_01420 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706804.1:sodium:phosphate symporter 1145 1810 gene locus_tag LOCUS_01430 1145 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 1827 2609 gene locus_tag LOCUS_01440 gene surE 1827 2609 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731558.1 protein_id gnl|my_center|LOCUS_01440 2788 4092 gene locus_tag LOCUS_01450 2788 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 5264 4089 gene locus_tag LOCUS_01460 5264 4089 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_01460 5350 6393 gene locus_tag LOCUS_01470 5350 6393 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226131.1 protein_id gnl|my_center|LOCUS_01470 6620 6372 gene locus_tag LOCUS_01480 6620 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 6642 7202 gene locus_tag LOCUS_01490 6642 7202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 7431 8435 gene locus_tag LOCUS_01500 7431 8435 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976188.1 protein_id gnl|my_center|LOCUS_01500 9075 8443 gene locus_tag LOCUS_01510 9075 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 9510 9079 gene locus_tag LOCUS_01520 9510 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 9608 10609 gene locus_tag LOCUS_01530 9608 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 protein_id gnl|my_center|LOCUS_01530 >Feature sequence013 159 980 gene locus_tag LOCUS_01540 159 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 984 3302 gene locus_tag LOCUS_01550 984 3302 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KY67 protein_id gnl|my_center|LOCUS_01550 3357 3431 gene locus_tag LOCUS_t00050 3357 3431 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3522 3656 gene locus_tag LOCUS_01560 3522 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 3674 4777 gene locus_tag LOCUS_01570 3674 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_01570 4774 5670 gene locus_tag LOCUS_01580 4774 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 5682 6248 gene locus_tag LOCUS_01590 gene hpt 5682 6248 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A5T1 protein_id gnl|my_center|LOCUS_01590 6375 6899 gene locus_tag LOCUS_01600 6375 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 6919 7707 gene locus_tag LOCUS_01610 gene coaX 6919 7707 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8N6 protein_id gnl|my_center|LOCUS_01610 7711 9120 gene locus_tag LOCUS_01620 gene lysS 7711 9120 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9Q0 protein_id gnl|my_center|LOCUS_01620 10128 9139 gene locus_tag LOCUS_01630 10128 9139 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222468.1 protein_id gnl|my_center|LOCUS_01630 >Feature sequence014 2 223 gene locus_tag LOCUS_01640 2 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 213 659 gene locus_tag LOCUS_01650 213 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 656 1636 gene locus_tag LOCUS_01660 656 1636 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029094.1 protein_id gnl|my_center|LOCUS_01660 1667 3760 gene locus_tag LOCUS_01670 gene cat5 1667 3760 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404999.1 protein_id gnl|my_center|LOCUS_01670 3781 5031 gene locus_tag LOCUS_01680 3781 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 5940 5017 gene locus_tag LOCUS_01690 5940 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 6599 5937 gene locus_tag LOCUS_01700 6599 5937 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222235.1 protein_id gnl|my_center|LOCUS_01700 7428 6622 gene locus_tag LOCUS_01710 gene paaG 7428 6622 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225682.1 protein_id gnl|my_center|LOCUS_01710 8603 7440 gene locus_tag LOCUS_01720 8603 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416097.1 protein_id gnl|my_center|LOCUS_01720 8765 9217 gene locus_tag LOCUS_01730 8765 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence015 280 759 gene locus_tag LOCUS_01740 gene coaD 280 759 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CSZ5 protein_id gnl|my_center|LOCUS_01740 756 1358 gene locus_tag LOCUS_01750 756 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 1355 1930 gene locus_tag LOCUS_01760 1355 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 2041 2220 gene locus_tag LOCUS_01770 gene rpmF 2041 2220 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTT0 protein_id gnl|my_center|LOCUS_01770 2274 3257 gene locus_tag LOCUS_01780 gene plsX 2274 3257 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Y4 protein_id gnl|my_center|LOCUS_01780 3400 3690 gene locus_tag LOCUS_01790 3400 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 3668 4420 gene locus_tag LOCUS_01800 gene rnc 3668 4420 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBQ7 protein_id gnl|my_center|LOCUS_01800 4417 5259 gene locus_tag LOCUS_01810 4417 5259 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_01810 5352 8849 gene locus_tag LOCUS_01820 gene smc 5352 8849 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QV25 protein_id gnl|my_center|LOCUS_01820 8922 9614 gene locus_tag LOCUS_01830 8922 9614 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224495.1 protein_id gnl|my_center|LOCUS_01830 >Feature sequence016 2536 899 gene locus_tag LOCUS_01840 2536 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 2730 2533 gene locus_tag LOCUS_01850 2730 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 3004 3237 gene locus_tag LOCUS_01860 3004 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 5272 3248 gene locus_tag LOCUS_01870 5272 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460248.1 protein_id gnl|my_center|LOCUS_01870 6122 5529 gene locus_tag LOCUS_01880 gene leuD 6122 5529 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86535 protein_id gnl|my_center|LOCUS_01880 7547 6144 gene locus_tag LOCUS_01890 gene leuC 7547 6144 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUY9 protein_id gnl|my_center|LOCUS_01890 9152 7578 gene locus_tag LOCUS_01900 gene leuA 9152 7578 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG97 protein_id gnl|my_center|LOCUS_01900 <10487 9355 gene locus_tag LOCUS_01910 <10487 9355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141470.1:peptidase >Feature sequence017 459 386 gene locus_tag LOCUS_t00060 459 386 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 618 546 gene locus_tag LOCUS_t00070 618 546 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2054 687 gene locus_tag LOCUS_01920 gene gltX 2054 687 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86528 protein_id gnl|my_center|LOCUS_01920 2783 2112 gene locus_tag LOCUS_01930 2783 2112 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 protein_id gnl|my_center|LOCUS_01930 4052 2814 gene locus_tag LOCUS_01940 4052 2814 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228966.1 protein_id gnl|my_center|LOCUS_01940 4167 4475 gene locus_tag LOCUS_01950 4167 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896282.1 protein_id gnl|my_center|LOCUS_01950 4504 6051 gene locus_tag LOCUS_01960 4504 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 6059 7039 gene locus_tag LOCUS_01970 6059 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 8203 7049 gene locus_tag LOCUS_01980 gene atoB 8203 7049 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_01980 9488 8277 gene locus_tag LOCUS_01990 9488 8277 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225242.1 protein_id gnl|my_center|LOCUS_01990 10084 9545 gene locus_tag LOCUS_02000 10084 9545 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869574.1 protein_id gnl|my_center|LOCUS_02000 >Feature sequence018 877 632 gene locus_tag LOCUS_02010 877 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 1170 2006 gene locus_tag LOCUS_02020 gene scpA 1170 2006 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408432.1 protein_id gnl|my_center|LOCUS_02020 1999 2673 gene locus_tag LOCUS_02030 1999 2673 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S231 protein_id gnl|my_center|LOCUS_02030 2677 3450 gene locus_tag LOCUS_02040 2677 3450 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_02040 3557 4564 gene locus_tag LOCUS_02050 3557 4564 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_02050 4561 5814 gene locus_tag LOCUS_02060 gene aroA 4561 5814 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIU4 protein_id gnl|my_center|LOCUS_02060 5828 6460 gene locus_tag LOCUS_02070 gene cmk 5828 6460 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPA9 protein_id gnl|my_center|LOCUS_02070 6481 7152 gene locus_tag LOCUS_02080 6481 7152 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_02080 8231 7176 gene locus_tag LOCUS_02090 gene ispH 8231 7176 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULU1 protein_id gnl|my_center|LOCUS_02090 8283 9647 gene locus_tag LOCUS_02100 8283 9647 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142769.1 protein_id gnl|my_center|LOCUS_02100 >Feature sequence019 1703 2839 gene locus_tag LOCUS_02110 1703 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 2863 3540 gene locus_tag LOCUS_02120 2863 3540 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896555.1 protein_id gnl|my_center|LOCUS_02120 3904 3578 gene locus_tag LOCUS_02130 3904 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 4012 4863 gene locus_tag LOCUS_02140 4012 4863 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411201.1 protein_id gnl|my_center|LOCUS_02140 4898 6625 gene locus_tag LOCUS_02150 4898 6625 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_02150 7462 6629 gene locus_tag LOCUS_02160 7462 6629 CDS product protein involved in biosynthesis of mitomycin antibiotics/polyketide fumonisin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_02160 9127 7481 gene locus_tag LOCUS_02170 9127 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 9093 9365 gene locus_tag LOCUS_02180 9093 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 <10233 9526 gene locus_tag LOCUS_02190 <10233 9526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090654.1:ABC transporter ATP-binding protein >Feature sequence020 1224 34 gene locus_tag LOCUS_02200 gene cysS 1224 34 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG64 protein_id gnl|my_center|LOCUS_02200 2169 1270 gene locus_tag LOCUS_02210 2169 1270 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726959.1 protein_id gnl|my_center|LOCUS_02210 2245 2171 gene locus_tag LOCUS_t00080 2245 2171 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3106 2351 gene locus_tag LOCUS_02220 3106 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 protein_id gnl|my_center|LOCUS_02220 3270 3836 gene locus_tag LOCUS_02230 3270 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 4853 3873 gene locus_tag LOCUS_02240 4853 3873 CDS product putative luciferase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703166.1 protein_id gnl|my_center|LOCUS_02240 4975 6564 gene locus_tag LOCUS_02250 4975 6564 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227966.1 protein_id gnl|my_center|LOCUS_02250 7890 6586 gene locus_tag LOCUS_02260 7890 6586 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_02260 7944 9197 gene locus_tag LOCUS_02270 7944 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 >Feature sequence021 2231 1239 gene locus_tag LOCUS_02280 2231 1239 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 protein_id gnl|my_center|LOCUS_02280 4096 2228 gene locus_tag LOCUS_02290 4096 2228 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039705.1 protein_id gnl|my_center|LOCUS_02290 4223 5413 gene locus_tag LOCUS_02300 gene xseA 4223 5413 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CA7 protein_id gnl|my_center|LOCUS_02300 5410 5637 gene locus_tag LOCUS_02310 5410 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 5665 6486 gene locus_tag LOCUS_02320 5665 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 6561 6636 gene locus_tag LOCUS_t00090 6561 6636 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7166 6645 gene locus_tag LOCUS_02330 7166 6645 CDS product doxX subfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896605.1 protein_id gnl|my_center|LOCUS_02330 7257 7508 gene locus_tag LOCUS_02340 7257 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 7888 7625 gene locus_tag LOCUS_02350 7888 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 7942 8529 gene locus_tag LOCUS_02360 7942 8529 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_02360 <9911 8547 gene locus_tag LOCUS_02370 <9911 8547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392429.1:serine/threonine protein kinase >Feature sequence022 521 1189 gene locus_tag LOCUS_02380 521 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 1232 1993 gene locus_tag LOCUS_02390 1232 1993 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705311.1 protein_id gnl|my_center|LOCUS_02390 2424 2002 gene locus_tag LOCUS_02400 2424 2002 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763493.1 protein_id gnl|my_center|LOCUS_02400 2894 2421 gene locus_tag LOCUS_02410 2894 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 3369 2914 gene locus_tag LOCUS_02420 3369 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 5074 3443 gene locus_tag LOCUS_02430 5074 3443 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_02430 6339 5095 gene locus_tag LOCUS_02440 6339 5095 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228841.1 protein_id gnl|my_center|LOCUS_02440 6969 6361 gene locus_tag LOCUS_02450 6969 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 9002 6966 gene locus_tag LOCUS_02460 9002 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 <9768 8999 gene locus_tag LOCUS_02470 <9768 8999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8NQE5:Sec-independent protein translocase protein TatC >Feature sequence023 2136 1837 gene locus_tag LOCUS_02480 gene ndhE 2136 1837 CDS product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMW3 protein_id gnl|my_center|LOCUS_02480 2694 2140 gene locus_tag LOCUS_02490 2694 2140 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_02490 3200 2691 gene locus_tag LOCUS_02500 gene nuoI2 3200 2691 CDS product NADH-quinone oxidoreductase subunit I 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2V8 protein_id gnl|my_center|LOCUS_02500 4237 3200 gene locus_tag LOCUS_02510 gene nuoH 4237 3200 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAY9 protein_id gnl|my_center|LOCUS_02510 5406 4234 gene locus_tag LOCUS_02520 gene nuoD1 5406 4234 CDS product NADH-quinone oxidoreductase subunit D 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X853 protein_id gnl|my_center|LOCUS_02520 6119 5403 gene locus_tag LOCUS_02530 6119 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 6606 6106 gene locus_tag LOCUS_02540 6606 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 6992 6627 gene locus_tag LOCUS_02550 gene nuoA 6992 6627 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAY5 protein_id gnl|my_center|LOCUS_02550 8621 7128 gene locus_tag LOCUS_02560 gene nuoN 8621 7128 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAR7 protein_id gnl|my_center|LOCUS_02560 <9625 8618 gene locus_tag LOCUS_02570 <9625 8618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941018.1:NADH:ubiquinone oxidoreductase subunit M >Feature sequence024 2215 1346 gene locus_tag LOCUS_02580 2215 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 5701 2228 gene locus_tag LOCUS_02590 gene mfd 5701 2228 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2P1 protein_id gnl|my_center|LOCUS_02590 6341 5715 gene locus_tag LOCUS_02600 gene pth 6341 5715 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS1 protein_id gnl|my_center|LOCUS_02600 7067 6357 gene locus_tag LOCUS_02610 7067 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 8130 7150 gene locus_tag LOCUS_02620 gene prs 8130 7150 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3U0 protein_id gnl|my_center|LOCUS_02620 9069 8221 gene locus_tag LOCUS_02630 9069 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 >Feature sequence025 2401 839 gene locus_tag LOCUS_02640 gene guaA 2401 839 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGP2 protein_id gnl|my_center|LOCUS_02640 3589 2426 gene locus_tag LOCUS_02650 3589 2426 CDS product guanosine monophosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_02650 5125 3716 gene locus_tag LOCUS_02660 5125 3716 CDS product aromatic-L-amino-acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_02660 5937 5149 gene locus_tag LOCUS_02670 5937 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 7587 5947 gene locus_tag LOCUS_02680 gene groL1 7587 5947 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40171 protein_id gnl|my_center|LOCUS_02680 7886 7596 gene locus_tag LOCUS_02690 gene groE 7886 7596 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVA7 protein_id gnl|my_center|LOCUS_02690 9083 8052 gene locus_tag LOCUS_02700 gene tsaD 9083 8052 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGJ3 protein_id gnl|my_center|LOCUS_02700 >Feature sequence026 782 1663 gene locus_tag LOCUS_02710 782 1663 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186835.1 protein_id gnl|my_center|LOCUS_02710 1759 1998 gene locus_tag LOCUS_02720 1759 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02720 2140 3651 gene locus_tag LOCUS_02730 2140 3651 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972418.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02730 3644 5434 gene locus_tag LOCUS_02740 gene nuoF 3644 5434 CDS product NADH dehydrogenase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_02740 5431 6294 gene locus_tag LOCUS_02750 5431 6294 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226418.1 protein_id gnl|my_center|LOCUS_02750 8031 6415 gene locus_tag LOCUS_02760 gene groL2 8031 6415 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXU5 protein_id gnl|my_center|LOCUS_02760 8501 8220 gene locus_tag LOCUS_02770 8501 8220 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920730.1 protein_id gnl|my_center|LOCUS_02770 <9401 8511 gene locus_tag LOCUS_02780 <9401 8511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702692.1:putative glycerate kinase >Feature sequence027 <1 1810 gene locus_tag LOCUS_02790 <1 1810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730132.1:CoA transferase 2990 1776 gene locus_tag LOCUS_02800 gene cyp142 2990 1776 CDS product putative cytochrome P450 142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPL5 protein_id gnl|my_center|LOCUS_02800 3618 3052 gene locus_tag LOCUS_02810 3618 3052 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729004.1 protein_id gnl|my_center|LOCUS_02810 3702 4652 gene locus_tag LOCUS_02820 3702 4652 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400489.1 protein_id gnl|my_center|LOCUS_02820 5188 4649 gene locus_tag LOCUS_02830 5188 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 5272 6273 gene locus_tag LOCUS_02840 gene gpsA2 5272 6273 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QRJ6 protein_id gnl|my_center|LOCUS_02840 6427 7125 gene locus_tag LOCUS_02850 gene rnhB 6427 7125 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69989 protein_id gnl|my_center|LOCUS_02850 7180 7602 gene locus_tag LOCUS_02860 7180 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 7615 7950 gene locus_tag LOCUS_02870 7615 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 7969 8628 gene locus_tag LOCUS_02880 7969 8628 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853622.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence028 294 530 gene locus_tag LOCUS_02890 294 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 530 808 gene locus_tag LOCUS_02900 gene rpsQ 530 808 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYY9 protein_id gnl|my_center|LOCUS_02900 809 1177 gene locus_tag LOCUS_02910 gene rplN 809 1177 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CV29 protein_id gnl|my_center|LOCUS_02910 1179 1493 gene locus_tag LOCUS_02920 gene rplX 1179 1493 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38513 protein_id gnl|my_center|LOCUS_02920 1486 2052 gene locus_tag LOCUS_02930 gene rplE 1486 2052 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0C8 protein_id gnl|my_center|LOCUS_02930 2052 2237 gene locus_tag LOCUS_02940 gene rpsZ 2052 2237 CDS product 30S ribosomal protein S14 type Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSG2 protein_id gnl|my_center|LOCUS_02940 2251 2655 gene locus_tag LOCUS_02950 gene rpsH 2251 2655 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NSX8 protein_id gnl|my_center|LOCUS_02950 2671 3210 gene locus_tag LOCUS_02960 gene rplF 2671 3210 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CV34 protein_id gnl|my_center|LOCUS_02960 3207 3566 gene locus_tag LOCUS_02970 gene rplR 3207 3566 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH82 protein_id gnl|my_center|LOCUS_02970 3566 4153 gene locus_tag LOCUS_02980 gene rpsE 3566 4153 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSG6 protein_id gnl|my_center|LOCUS_02980 4155 4349 gene locus_tag LOCUS_02990 gene rpmD 4155 4349 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NSX3 protein_id gnl|my_center|LOCUS_02990 4351 4836 gene locus_tag LOCUS_03000 gene rplO 4351 4836 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88XW7 protein_id gnl|my_center|LOCUS_03000 4892 6202 gene locus_tag LOCUS_03010 gene secY 4892 6202 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A5Z3 protein_id gnl|my_center|LOCUS_03010 6226 6804 gene locus_tag LOCUS_03020 gene adk 6226 6804 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5P5 protein_id gnl|my_center|LOCUS_03020 6974 7168 gene locus_tag LOCUS_03030 gene infA 6974 7168 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD14 protein_id gnl|my_center|LOCUS_03030 7316 7693 gene locus_tag LOCUS_03040 gene rpsM 7316 7693 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5U9 protein_id gnl|my_center|LOCUS_03040 7693 8091 gene locus_tag LOCUS_03050 gene rpsK 7693 8091 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X7A0 protein_id gnl|my_center|LOCUS_03050 8091 8708 gene locus_tag LOCUS_03060 gene rpsD 8091 8708 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CV49 protein_id gnl|my_center|LOCUS_03060 >Feature sequence029 1831 665 gene locus_tag LOCUS_03070 1831 665 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900647.1 protein_id gnl|my_center|LOCUS_03070 3351 1828 gene locus_tag LOCUS_03080 3351 1828 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064569.1 protein_id gnl|my_center|LOCUS_03080 4922 3348 gene locus_tag LOCUS_03090 4922 3348 CDS product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229601.1 protein_id gnl|my_center|LOCUS_03090 7009 4919 gene locus_tag LOCUS_03100 7009 4919 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709911.1 protein_id gnl|my_center|LOCUS_03100 7389 7006 gene locus_tag LOCUS_03110 7389 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 8129 7398 gene locus_tag LOCUS_03120 8129 7398 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438650.1 protein_id gnl|my_center|LOCUS_03120 8627 8133 gene locus_tag LOCUS_03130 8627 8133 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226958.1 protein_id gnl|my_center|LOCUS_03130 8664 8798 gene locus_tag LOCUS_03140 8664 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 >Feature sequence030 45 154 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgccgaggcaacggtcgagg 274 468 gene locus_tag LOCUS_03150 gene rpmI 274 468 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEI4 protein_id gnl|my_center|LOCUS_03150 550 906 gene locus_tag LOCUS_03160 gene rplT 550 906 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DDU8 protein_id gnl|my_center|LOCUS_03160 954 1748 gene locus_tag LOCUS_03170 954 1748 CDS product tRNA/rRNA methyltransferase SpoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 protein_id gnl|my_center|LOCUS_03170 1847 2845 gene locus_tag LOCUS_03180 gene pheS 1847 2845 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7Z5 protein_id gnl|my_center|LOCUS_03180 2892 5243 gene locus_tag LOCUS_03190 gene pheT 2892 5243 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ9 protein_id gnl|my_center|LOCUS_03190 5292 6269 gene locus_tag LOCUS_03200 5292 6269 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_03200 6349 7395 gene locus_tag LOCUS_03210 gene argC 6349 7395 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748X6 protein_id gnl|my_center|LOCUS_03210 7392 8555 gene locus_tag LOCUS_03220 gene argJ 7392 8555 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63572 protein_id gnl|my_center|LOCUS_03220 >Feature sequence031 <1 2432 gene locus_tag LOCUS_03230 <1 2432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0A523:putative ATP-dependent Clp protease ATP-binding subunit 2521 4023 gene locus_tag LOCUS_03240 2521 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 4035 4691 gene locus_tag LOCUS_03250 4035 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 5391 4732 gene locus_tag LOCUS_03260 gene crp 5391 4732 CDS product transcriptional regulator Crp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614181.1 protein_id gnl|my_center|LOCUS_03260 5493 6170 gene locus_tag LOCUS_03270 5493 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03270 6163 6639 gene locus_tag LOCUS_03280 gene ispF 6163 6639 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJT5 protein_id gnl|my_center|LOCUS_03280 6705 7484 gene locus_tag LOCUS_03290 6705 7484 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_03290 7577 7503 gene locus_tag LOCUS_t00100 7577 7503 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7658 7918 gene locus_tag LOCUS_03300 7658 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 7915 8541 gene locus_tag LOCUS_03310 7915 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 >Feature sequence032 <1 2943 gene locus_tag LOCUS_03320 <1 2943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7TWL9:error-prone DNA polymerase 2968 4215 gene locus_tag LOCUS_03330 2968 4215 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_03330 4313 5530 gene locus_tag LOCUS_03340 4313 5530 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_03340 6542 5553 gene locus_tag LOCUS_03350 6542 5553 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876331.1 protein_id gnl|my_center|LOCUS_03350 7041 6583 gene locus_tag LOCUS_03360 7041 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 7169 8065 gene locus_tag LOCUS_03370 gene mca 7169 8065 CDS product mycothiol S-conjugate amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DI54 protein_id gnl|my_center|LOCUS_03370 8065 8463 gene locus_tag LOCUS_03380 8065 8463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence033 844 2016 gene locus_tag LOCUS_03390 844 2016 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_03390 2013 6248 gene locus_tag LOCUS_03400 2013 6248 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908966.1 protein_id gnl|my_center|LOCUS_03400 7629 6250 gene locus_tag LOCUS_03410 7629 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 7694 8380 gene locus_tag LOCUS_03420 7694 8380 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104401.1 protein_id gnl|my_center|LOCUS_03420 >Feature sequence034 592 1806 gene locus_tag LOCUS_03430 592 1806 CDS product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701958.1 protein_id gnl|my_center|LOCUS_03430 1803 2684 gene locus_tag LOCUS_03440 1803 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 2677 3072 gene locus_tag LOCUS_03450 2677 3072 CDS product putative 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701963.1 protein_id gnl|my_center|LOCUS_03450 3137 4312 gene locus_tag LOCUS_03460 3137 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 4367 5149 gene locus_tag LOCUS_03470 4367 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030273.1 protein_id gnl|my_center|LOCUS_03470 6181 5189 gene locus_tag LOCUS_03480 gene fbpC 6181 5189 CDS product Fe(3+) ions import ATP-binding protein FbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86751 protein_id gnl|my_center|LOCUS_03480 7755 6178 gene locus_tag LOCUS_03490 7755 6178 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030361.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence035 380 1162 gene locus_tag LOCUS_03500 380 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 1214 2476 gene locus_tag LOCUS_03510 1214 2476 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_03510 2558 4207 gene locus_tag LOCUS_03520 gene pgi 2558 4207 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTL8 protein_id gnl|my_center|LOCUS_03520 5509 4238 gene locus_tag LOCUS_03530 gene hemL 5509 4238 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P812 protein_id gnl|my_center|LOCUS_03530 6512 5517 gene locus_tag LOCUS_03540 gene hemB 6512 5517 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYF5 protein_id gnl|my_center|LOCUS_03540 7282 6512 gene locus_tag LOCUS_03550 7282 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 <8154 7279 gene locus_tag LOCUS_03560 <8154 7279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KKN2:porphobilinogen deaminase >Feature sequence036 1001 639 gene locus_tag LOCUS_03570 1001 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 1819 980 gene locus_tag LOCUS_03580 1819 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 protein_id gnl|my_center|LOCUS_03580 3759 1816 gene locus_tag LOCUS_03590 3759 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 4166 3756 gene locus_tag LOCUS_03600 4166 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 4083 4352 gene locus_tag LOCUS_03610 4083 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 4598 5638 gene locus_tag LOCUS_03620 4598 5638 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_03620 5643 6908 gene locus_tag LOCUS_03630 gene pcnB 5643 6908 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231051.1 protein_id gnl|my_center|LOCUS_03630 7035 7403 gene locus_tag LOCUS_03640 7035 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705624.1 protein_id gnl|my_center|LOCUS_03640 7608 7973 gene locus_tag LOCUS_03650 7608 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence037 1085 477 gene locus_tag LOCUS_03660 1085 477 CDS product GCN5-like N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_03660 3214 1082 gene locus_tag LOCUS_03670 gene recG 3214 1082 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW6 protein_id gnl|my_center|LOCUS_03670 4863 3223 gene locus_tag LOCUS_03680 4863 3223 CDS product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028485.1 protein_id gnl|my_center|LOCUS_03680 5036 5260 gene locus_tag LOCUS_03690 5036 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 5341 7134 gene locus_tag LOCUS_03700 gene pckG 5341 7134 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93JL5 protein_id gnl|my_center|LOCUS_03700 7540 7148 gene locus_tag LOCUS_03710 7540 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 >Feature sequence038 1280 105 gene locus_tag LOCUS_03720 gene atoB 1280 105 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224421.1 protein_id gnl|my_center|LOCUS_03720 1397 2266 gene locus_tag LOCUS_03730 1397 2266 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 protein_id gnl|my_center|LOCUS_03730 2352 2549 gene locus_tag LOCUS_03740 2352 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 2554 3807 gene locus_tag LOCUS_03750 2554 3807 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_03750 4537 3815 gene locus_tag LOCUS_03760 4537 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 5966 4563 gene locus_tag LOCUS_03770 5966 4563 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404528.1 protein_id gnl|my_center|LOCUS_03770 6548 6000 gene locus_tag LOCUS_03780 gene pyrE 6548 6000 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8R7 protein_id gnl|my_center|LOCUS_03780 7595 6558 gene locus_tag LOCUS_03790 gene purM 7595 6558 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY2 protein_id gnl|my_center|LOCUS_03790 >Feature sequence039 1490 30 gene locus_tag LOCUS_03800 gene gltD 1490 30 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_03800 6152 1500 gene locus_tag LOCUS_03810 6152 1500 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731294.1 protein_id gnl|my_center|LOCUS_03810 <7904 6363 gene locus_tag LOCUS_03820 <7904 6363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870209.1:Trk system potassium transporter TrkH >Feature sequence040 <1 1035 gene locus_tag LOCUS_03830 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919198.1:fatty acid--CoA ligase 1065 2408 gene locus_tag LOCUS_03840 1065 2408 CDS product carotenoid cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228506.1 protein_id gnl|my_center|LOCUS_03840 2447 3571 gene locus_tag LOCUS_03850 2447 3571 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 protein_id gnl|my_center|LOCUS_03850 4948 3578 gene locus_tag LOCUS_03860 4948 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 6216 4945 gene locus_tag LOCUS_03870 6216 4945 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089770.1 protein_id gnl|my_center|LOCUS_03870 6307 7206 gene locus_tag LOCUS_03880 6307 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 7318 7563 gene locus_tag LOCUS_03890 7318 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence041 455 360 gene locus_tag LOCUS_t00110 455 360 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1418 639 gene locus_tag LOCUS_03900 1418 639 CDS product morphological differentiation-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975378.1 protein_id gnl|my_center|LOCUS_03900 1528 1881 gene locus_tag LOCUS_03910 gene rsbV 1528 1881 CDS product anti-sigma-B factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WVX8 protein_id gnl|my_center|LOCUS_03910 1953 2318 gene locus_tag LOCUS_03920 1953 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 2574 5222 gene locus_tag LOCUS_03930 gene topA 2574 5222 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJV1 protein_id gnl|my_center|LOCUS_03930 5336 6742 gene locus_tag LOCUS_03940 5336 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03940 6739 7344 gene locus_tag LOCUS_03950 6739 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence042 <1 621 gene locus_tag LOCUS_03960 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704890.1:putative fatty-acid-CoA ligase FadD 1487 627 gene locus_tag LOCUS_03970 1487 627 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950459.1 protein_id gnl|my_center|LOCUS_03970 2875 1529 gene locus_tag LOCUS_03980 gene gor 2875 1529 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_03980 3971 2892 gene locus_tag LOCUS_03990 3971 2892 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730884.1 protein_id gnl|my_center|LOCUS_03990 5167 3983 gene locus_tag LOCUS_04000 5167 3983 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_04000 6420 5188 gene locus_tag LOCUS_04010 6420 5188 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_04010 7578 6478 gene locus_tag LOCUS_04020 7578 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence043 1408 506 gene locus_tag LOCUS_04030 1408 506 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808030.1 protein_id gnl|my_center|LOCUS_04030 2205 1408 gene locus_tag LOCUS_04040 2205 1408 CDS product nitrate ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384438.1 protein_id gnl|my_center|LOCUS_04040 2319 2243 gene locus_tag LOCUS_t00120 2319 2243 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3116 2370 gene locus_tag LOCUS_04050 3116 2370 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820134.1 protein_id gnl|my_center|LOCUS_04050 3859 3113 gene locus_tag LOCUS_04060 3859 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 4025 6460 gene locus_tag LOCUS_04070 4025 6460 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533447.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence044 1010 255 gene locus_tag LOCUS_04080 1010 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_04080 1786 989 gene locus_tag LOCUS_04090 1786 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04090 2626 1790 gene locus_tag LOCUS_04100 2626 1790 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_04100 3939 2611 gene locus_tag LOCUS_04110 3939 2611 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897229.1 protein_id gnl|my_center|LOCUS_04110 6863 3942 gene locus_tag LOCUS_04120 6863 3942 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088902.1 protein_id gnl|my_center|LOCUS_04120 7591 6863 gene locus_tag LOCUS_04130 7591 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 >Feature sequence045 <1 1263 gene locus_tag LOCUS_04140 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225314.1:D-glutamate deacylase 1260 2525 gene locus_tag LOCUS_04150 1260 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 2629 3723 gene locus_tag LOCUS_04160 gene serC 2629 3723 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHV7 protein_id gnl|my_center|LOCUS_04160 3826 4137 gene locus_tag LOCUS_04170 3826 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 4259 4720 gene locus_tag LOCUS_04180 4259 4720 CDS product histone acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028081.1 protein_id gnl|my_center|LOCUS_04180 5297 4809 gene locus_tag LOCUS_04190 5297 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614581.1 protein_id gnl|my_center|LOCUS_04190 7275 5485 gene locus_tag LOCUS_04200 7275 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 >Feature sequence046 2408 885 gene locus_tag LOCUS_04210 2408 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 3686 2580 gene locus_tag LOCUS_04220 3686 2580 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_04220 5372 3840 gene locus_tag LOCUS_04230 5372 3840 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_04230 5530 5829 gene locus_tag LOCUS_04240 5530 5829 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804583.1 protein_id gnl|my_center|LOCUS_04240 7063 5903 gene locus_tag LOCUS_04250 7063 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence047 170 439 gene locus_tag LOCUS_04260 170 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 548 745 gene locus_tag LOCUS_04270 548 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04270 1646 780 gene locus_tag LOCUS_04280 1646 780 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_04280 2081 1671 gene locus_tag LOCUS_04290 2081 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 3342 2074 gene locus_tag LOCUS_04300 3342 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709437.1 protein_id gnl|my_center|LOCUS_04300 3959 3351 gene locus_tag LOCUS_04310 3959 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 6022 4055 gene locus_tag LOCUS_04320 6022 4055 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_04320 7097 6027 gene locus_tag LOCUS_04330 gene mtnA 7097 6027 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKL8 protein_id gnl|my_center|LOCUS_04330 >Feature sequence048 2366 897 gene locus_tag LOCUS_04340 2366 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 2948 3301 gene locus_tag LOCUS_04350 2948 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 3602 4783 gene locus_tag LOCUS_04360 3602 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 5351 5821 gene locus_tag LOCUS_04370 gene jag 5351 5821 CDS product SpoIIIJ-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231067.1 protein_id gnl|my_center|LOCUS_04370 6007 6456 gene locus_tag LOCUS_04380 6007 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence049 2375 1230 gene locus_tag LOCUS_04390 2375 1230 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0L5 protein_id gnl|my_center|LOCUS_04390 2912 2535 gene locus_tag LOCUS_04400 2912 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 4029 2956 gene locus_tag LOCUS_04410 4029 2956 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_04410 4847 4137 gene locus_tag LOCUS_04420 gene hlyI 4847 4137 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229810.1 protein_id gnl|my_center|LOCUS_04420 5193 4897 gene locus_tag LOCUS_04430 5193 4897 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804664.1 protein_id gnl|my_center|LOCUS_04430 5864 5190 gene locus_tag LOCUS_04440 5864 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 6379 5861 gene locus_tag LOCUS_04450 6379 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 7008 6376 gene locus_tag LOCUS_04460 7008 6376 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence050 274 1086 gene locus_tag LOCUS_04470 gene mutM 274 1086 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX22 protein_id gnl|my_center|LOCUS_04470 1150 2616 gene locus_tag LOCUS_04480 1150 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 2613 3791 gene locus_tag LOCUS_04490 2613 3791 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_04490 3847 5589 gene locus_tag LOCUS_04500 3847 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 6474 5608 gene locus_tag LOCUS_04510 gene map 6474 5608 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKR2 protein_id gnl|my_center|LOCUS_04510 >Feature sequence051 2084 798 gene locus_tag LOCUS_04520 gene hisD 2084 798 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 protein_id gnl|my_center|LOCUS_04520 2172 2381 gene locus_tag LOCUS_04530 2172 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 3206 2565 gene locus_tag LOCUS_04540 gene nth 3206 2565 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NTL4 protein_id gnl|my_center|LOCUS_04540 3259 4008 gene locus_tag LOCUS_04550 3259 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 4078 4398 gene locus_tag LOCUS_04560 4078 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 4464 5099 gene locus_tag LOCUS_04570 gene menG 4464 5099 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB34 protein_id gnl|my_center|LOCUS_04570 5969 5106 gene locus_tag LOCUS_04580 gene menA 5969 5106 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIP3 protein_id gnl|my_center|LOCUS_04580 >Feature sequence052 66 356 gene locus_tag LOCUS_04590 66 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 2994 397 gene locus_tag LOCUS_04600 2994 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 3434 3000 gene locus_tag LOCUS_04610 3434 3000 CDS product MxaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416053.1 protein_id gnl|my_center|LOCUS_04610 4979 3447 gene locus_tag LOCUS_04620 4979 3447 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_04620 5083 6000 gene locus_tag LOCUS_04630 5083 6000 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 protein_id gnl|my_center|LOCUS_04630 5997 6506 gene locus_tag LOCUS_04640 5997 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_04640 >Feature sequence053 1551 271 gene locus_tag LOCUS_04650 gene ugd 1551 271 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222056.1 protein_id gnl|my_center|LOCUS_04650 2789 1614 gene locus_tag LOCUS_04660 2789 1614 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_04660 3633 2857 gene locus_tag LOCUS_04670 gene cobB2 3633 2857 CDS product NAD-dependent protein deacetylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJM9 protein_id gnl|my_center|LOCUS_04670 5109 3649 gene locus_tag LOCUS_04680 gene pepA 5109 3649 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67868 protein_id gnl|my_center|LOCUS_04680 5687 5145 gene locus_tag LOCUS_04690 5687 5145 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_04690 6497 5739 gene locus_tag LOCUS_04700 6497 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence054 88 15 gene locus_tag LOCUS_t00130 88 15 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 989 273 gene locus_tag LOCUS_04710 gene ispE 989 273 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5K7 protein_id gnl|my_center|LOCUS_04710 1828 986 gene locus_tag LOCUS_04720 gene ksgA 1828 986 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGV9 protein_id gnl|my_center|LOCUS_04720 2612 1836 gene locus_tag LOCUS_04730 2612 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 3468 2707 gene locus_tag LOCUS_04740 3468 2707 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528321.1 protein_id gnl|my_center|LOCUS_04740 5143 3476 gene locus_tag LOCUS_04750 gene metG 5143 3476 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKM1 protein_id gnl|my_center|LOCUS_04750 6036 5197 gene locus_tag LOCUS_04760 gene rsmI 6036 5197 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SGW7 protein_id gnl|my_center|LOCUS_04760 6362 6033 gene locus_tag LOCUS_04770 6362 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 >Feature sequence055 1355 573 gene locus_tag LOCUS_04780 1355 573 CDS product cobalamin/Fe3+-siderophore ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856445.1 protein_id gnl|my_center|LOCUS_04780 2419 1352 gene locus_tag LOCUS_04790 2419 1352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 protein_id gnl|my_center|LOCUS_04790 3274 2435 gene locus_tag LOCUS_04800 3274 2435 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_04800 3159 3536 gene locus_tag LOCUS_04810 3159 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 3529 4173 gene locus_tag LOCUS_04820 gene coaE 3529 4173 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2K7 protein_id gnl|my_center|LOCUS_04820 4918 4178 gene locus_tag LOCUS_04830 4918 4178 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_04830 5044 5979 gene locus_tag LOCUS_04840 gene fabH 5044 5979 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDA9 protein_id gnl|my_center|LOCUS_04840 >Feature sequence056 1225 644 gene locus_tag LOCUS_04850 gene ctaE 1225 644 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AEL8 protein_id gnl|my_center|LOCUS_04850 2829 1225 gene locus_tag LOCUS_04860 2829 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 3922 3038 gene locus_tag LOCUS_04870 gene cyoE 3922 3038 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1T2 protein_id gnl|my_center|LOCUS_04870 4794 3970 gene locus_tag LOCUS_04880 4794 3970 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_04880 4922 5221 gene locus_tag LOCUS_04890 gene clpS 4922 5221 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DET2 protein_id gnl|my_center|LOCUS_04890 5218 5712 gene locus_tag LOCUS_04900 5218 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 5784 5857 gene locus_tag LOCUS_t00140 5784 5857 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5919 5996 gene locus_tag LOCUS_t00150 5919 5996 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6029 6102 gene locus_tag LOCUS_t00160 6029 6102 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence057 38 1669 gene locus_tag LOCUS_04910 gene argS 38 1669 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9D1 protein_id gnl|my_center|LOCUS_04910 1669 2940 gene locus_tag LOCUS_04920 gene lysA 1669 2940 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HLD5 protein_id gnl|my_center|LOCUS_04920 3020 4315 gene locus_tag LOCUS_04930 3020 4315 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIW9 protein_id gnl|my_center|LOCUS_04930 4338 5729 gene locus_tag LOCUS_04940 4338 5729 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_04940 >Feature sequence058 <1 1302 gene locus_tag LOCUS_04950 <1 1302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DH77:ATP synthase subunit beta 1312 1689 gene locus_tag LOCUS_04960 1312 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2696 1707 gene locus_tag LOCUS_04970 gene glpX 2696 1707 CDS product fructose-1,6-bisphosphatase class 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN21 protein_id gnl|my_center|LOCUS_04970 2785 3555 gene locus_tag LOCUS_04980 2785 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 4587 3574 gene locus_tag LOCUS_04990 4587 3574 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038646.1 protein_id gnl|my_center|LOCUS_04990 4632 5240 gene locus_tag LOCUS_05000 4632 5240 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888117.1 protein_id gnl|my_center|LOCUS_05000 >Feature sequence059 1535 510 gene locus_tag LOCUS_05010 1535 510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_05010 2629 1535 gene locus_tag LOCUS_05020 2629 1535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_05020 3536 2631 gene locus_tag LOCUS_05030 3536 2631 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083811.1 protein_id gnl|my_center|LOCUS_05030 4533 3526 gene locus_tag LOCUS_05040 4533 3526 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811980.1 protein_id gnl|my_center|LOCUS_05040 <6684 4626 gene locus_tag LOCUS_05050 <6684 4626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974099.1:peptide ABC transporter substrate-binding protein >Feature sequence060 1565 357 gene locus_tag LOCUS_05060 1565 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 1700 2338 gene locus_tag LOCUS_05070 1700 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3082 2369 gene locus_tag LOCUS_05080 3082 2369 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223702.1 protein_id gnl|my_center|LOCUS_05080 3777 3079 gene locus_tag LOCUS_05090 3777 3079 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 protein_id gnl|my_center|LOCUS_05090 3888 5114 gene locus_tag LOCUS_05100 3888 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 5962 5111 gene locus_tag LOCUS_05110 5962 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 >Feature sequence061 2766 2026 gene locus_tag LOCUS_05120 2766 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3214 2774 gene locus_tag LOCUS_05130 3214 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893800.1 protein_id gnl|my_center|LOCUS_05130 4219 3302 gene locus_tag LOCUS_05140 4219 3302 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939109.1 protein_id gnl|my_center|LOCUS_05140 4313 5242 gene locus_tag LOCUS_05150 4313 5242 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 protein_id gnl|my_center|LOCUS_05150 5254 6036 gene locus_tag LOCUS_05160 gene fabG 5254 6036 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence062 1198 248 gene locus_tag LOCUS_05170 gene rpsC 1198 248 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGE4 protein_id gnl|my_center|LOCUS_05170 1770 1198 gene locus_tag LOCUS_05180 1770 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 2045 1770 gene locus_tag LOCUS_05190 gene rpsS 2045 1770 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYY4 protein_id gnl|my_center|LOCUS_05190 2885 2052 gene locus_tag LOCUS_05200 gene rplB 2885 2052 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGE7 protein_id gnl|my_center|LOCUS_05200 3180 2890 gene locus_tag LOCUS_05210 3180 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 3845 3177 gene locus_tag LOCUS_05220 gene rplD 3845 3177 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSD2 protein_id gnl|my_center|LOCUS_05220 4486 3845 gene locus_tag LOCUS_05230 gene rplC 4486 3845 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WH87 protein_id gnl|my_center|LOCUS_05230 4810 5991 gene locus_tag LOCUS_05240 4810 5991 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_05240 6312 5992 gene locus_tag LOCUS_05250 gene rpsJ 6312 5992 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66337 protein_id gnl|my_center|LOCUS_05250 >Feature sequence063 <1 1512 gene locus_tag LOCUS_05260 <1 1512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706372.1:N-methylhydantoinase B 1509 2702 gene locus_tag LOCUS_05270 1509 2702 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706369.1 protein_id gnl|my_center|LOCUS_05270 3459 2719 gene locus_tag LOCUS_05280 3459 2719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_05280 4250 3456 gene locus_tag LOCUS_05290 4250 3456 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089635.1 protein_id gnl|my_center|LOCUS_05290 6040 4247 gene locus_tag LOCUS_05300 6040 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 >Feature sequence064 443 1210 gene locus_tag LOCUS_05310 443 1210 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_05310 1197 2261 gene locus_tag LOCUS_05320 1197 2261 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_05320 2917 2279 gene locus_tag LOCUS_05330 2917 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_05330 3422 2925 gene locus_tag LOCUS_05340 3422 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 4435 3470 gene locus_tag LOCUS_05350 4435 3470 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_05350 4814 4398 gene locus_tag LOCUS_05360 4814 4398 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879708.1 protein_id gnl|my_center|LOCUS_05360 <6402 4811 gene locus_tag LOCUS_05370 <6402 4811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878783.1:methylmalonyl-CoA mutase >Feature sequence065 332 3202 gene locus_tag LOCUS_05380 332 3202 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228917.1 protein_id gnl|my_center|LOCUS_05380 4331 3216 gene locus_tag LOCUS_05390 4331 3216 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978023.1 protein_id gnl|my_center|LOCUS_05390 4595 4392 gene locus_tag LOCUS_05400 4595 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 5922 4609 gene locus_tag LOCUS_05410 5922 4609 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8U7 protein_id gnl|my_center|LOCUS_05410 >Feature sequence066 1285 983 gene locus_tag LOCUS_05420 gene gatC 1285 983 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z581 protein_id gnl|my_center|LOCUS_05420 3251 1326 gene locus_tag LOCUS_05430 3251 1326 CDS product putative serine/threonine-protein kinase PknB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700789.1 protein_id gnl|my_center|LOCUS_05430 3284 3697 gene locus_tag LOCUS_05440 3284 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 3701 4474 gene locus_tag LOCUS_05450 gene echA5 3701 4474 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403433.1 protein_id gnl|my_center|LOCUS_05450 <6285 4499 gene locus_tag LOCUS_05460 <6285 4499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WCA1:DNA ligase >Feature sequence067 1456 332 gene locus_tag LOCUS_05470 gene fabH 1456 332 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH32 protein_id gnl|my_center|LOCUS_05470 1639 2550 gene locus_tag LOCUS_05480 1639 2550 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727427.1 protein_id gnl|my_center|LOCUS_05480 2558 3382 gene locus_tag LOCUS_05490 2558 3382 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902223.1 protein_id gnl|my_center|LOCUS_05490 3514 3807 gene locus_tag LOCUS_05500 3514 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 4027 5859 gene locus_tag LOCUS_05510 4027 5859 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence068 277 1716 gene locus_tag LOCUS_05520 277 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 3200 1800 gene locus_tag LOCUS_05530 gene bam 3200 1800 CDS product indoleacetamide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59385 protein_id gnl|my_center|LOCUS_05530 3237 4166 gene locus_tag LOCUS_05540 3237 4166 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_05540 5605 4181 gene locus_tag LOCUS_05550 5605 4181 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727728.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence069 1948 1229 gene locus_tag LOCUS_05560 gene recO 1948 1229 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCB6 protein_id gnl|my_center|LOCUS_05560 2667 1945 gene locus_tag LOCUS_05570 2667 1945 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MD77 protein_id gnl|my_center|LOCUS_05570 3621 2719 gene locus_tag LOCUS_05580 gene era 3621 2719 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYT3 protein_id gnl|my_center|LOCUS_05580 4490 3618 gene locus_tag LOCUS_05590 4490 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 4962 4477 gene locus_tag LOCUS_05600 4962 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 5938 4967 gene locus_tag LOCUS_05610 5938 4967 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence070 6 920 gene locus_tag LOCUS_05620 6 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2253 955 gene locus_tag LOCUS_05630 2253 955 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971260.1 protein_id gnl|my_center|LOCUS_05630 3131 2235 gene locus_tag LOCUS_05640 3131 2235 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038831.1 protein_id gnl|my_center|LOCUS_05640 4854 3154 gene locus_tag LOCUS_05650 4854 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence071 714 268 gene locus_tag LOCUS_05660 714 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227124.1 protein_id gnl|my_center|LOCUS_05660 2056 740 gene locus_tag LOCUS_05670 2056 740 CDS product ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230981.1 protein_id gnl|my_center|LOCUS_05670 2279 3028 gene locus_tag LOCUS_05680 2279 3028 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709700.1 protein_id gnl|my_center|LOCUS_05680 3018 3758 gene locus_tag LOCUS_05690 3018 3758 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860947.1 protein_id gnl|my_center|LOCUS_05690 3828 4913 gene locus_tag LOCUS_05700 gene add 3828 4913 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVL3 protein_id gnl|my_center|LOCUS_05700 4950 5591 gene locus_tag LOCUS_05710 4950 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 >Feature sequence072 283 876 gene locus_tag LOCUS_05720 283 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05720 2597 897 gene locus_tag LOCUS_05730 2597 897 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_05730 2663 3286 gene locus_tag LOCUS_05740 2663 3286 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918133.1 protein_id gnl|my_center|LOCUS_05740 3313 4098 gene locus_tag LOCUS_05750 gene xthA 3313 4098 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224644.1 protein_id gnl|my_center|LOCUS_05750 6126 4105 gene locus_tag LOCUS_05760 6126 4105 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXI4 protein_id gnl|my_center|LOCUS_05760 >Feature sequence073 636 385 gene locus_tag LOCUS_05770 636 385 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564132.1 protein_id gnl|my_center|LOCUS_05770 826 1803 gene locus_tag LOCUS_05780 826 1803 CDS product desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975103.1 protein_id gnl|my_center|LOCUS_05780 1829 3025 gene locus_tag LOCUS_05790 1829 3025 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105511.1 protein_id gnl|my_center|LOCUS_05790 3060 3470 gene locus_tag LOCUS_05800 3060 3470 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223396.1 protein_id gnl|my_center|LOCUS_05800 3592 4062 gene locus_tag LOCUS_05810 3592 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705064.1 protein_id gnl|my_center|LOCUS_05810 5293 4103 gene locus_tag LOCUS_05820 5293 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 5175 5402 gene locus_tag LOCUS_05830 5175 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 5395 6201 gene locus_tag LOCUS_05840 5395 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 >Feature sequence074 <1 1086 gene locus_tag LOCUS_05850 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O86769:phosphatidate cytidylyltransferase 1127 2284 gene locus_tag LOCUS_05860 gene dxr 1127 2284 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJN4 protein_id gnl|my_center|LOCUS_05860 2281 3708 gene locus_tag LOCUS_05870 2281 3708 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414610.1 protein_id gnl|my_center|LOCUS_05870 3773 4999 gene locus_tag LOCUS_05880 gene ispG 3773 4999 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NP12 protein_id gnl|my_center|LOCUS_05880 5198 5713 gene locus_tag LOCUS_05890 gene rimP 5198 5713 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJM9 protein_id gnl|my_center|LOCUS_05890 >Feature sequence075 <1 876 gene locus_tag LOCUS_05900 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MBZ9:acetyl-coenzyme A synthetase 953 1375 gene locus_tag LOCUS_05910 953 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 1440 2324 gene locus_tag LOCUS_05920 1440 2324 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460068.1 protein_id gnl|my_center|LOCUS_05920 2843 2355 gene locus_tag LOCUS_05930 2843 2355 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHA5 protein_id gnl|my_center|LOCUS_05930 2924 3006 gene locus_tag LOCUS_t00170 2924 3006 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3597 3040 gene locus_tag LOCUS_05940 3597 3040 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383066.1 protein_id gnl|my_center|LOCUS_05940 3626 3699 gene locus_tag LOCUS_t00180 3626 3699 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3702 3776 gene locus_tag LOCUS_t00190 3702 3776 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3860 4150 gene locus_tag LOCUS_05950 gene rpmB 3860 4150 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS15 protein_id gnl|my_center|LOCUS_05950 4158 4319 gene locus_tag LOCUS_05960 gene rpmG 4158 4319 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS16 protein_id gnl|my_center|LOCUS_05960 4463 4538 gene locus_tag LOCUS_t00200 4463 4538 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4627 4926 gene locus_tag LOCUS_05970 4627 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 4926 5762 gene locus_tag LOCUS_05980 gene nusG 4926 5762 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWV9 protein_id gnl|my_center|LOCUS_05980 >Feature sequence076 1318 281 gene locus_tag LOCUS_05990 gene ruvB 1318 281 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHT7 protein_id gnl|my_center|LOCUS_05990 1924 1322 gene locus_tag LOCUS_06000 gene ruvA 1924 1322 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A0 protein_id gnl|my_center|LOCUS_06000 2418 1921 gene locus_tag LOCUS_06010 gene ruvC 2418 1921 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAF2 protein_id gnl|my_center|LOCUS_06010 3230 2478 gene locus_tag LOCUS_06020 3230 2478 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62036 protein_id gnl|my_center|LOCUS_06020 3843 3265 gene locus_tag LOCUS_06030 gene pdxT 3843 3265 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCJ8 protein_id gnl|my_center|LOCUS_06030 4750 3860 gene locus_tag LOCUS_06040 gene pdxS 4750 3860 CDS product pyridoxal 5'-phosphate synthase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WII9 protein_id gnl|my_center|LOCUS_06040 6006 4834 gene locus_tag LOCUS_06050 6006 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 >Feature sequence077 2590 1373 gene locus_tag LOCUS_06060 2590 1373 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_06060 4905 2590 gene locus_tag LOCUS_06070 4905 2590 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_06070 4972 5577 gene locus_tag LOCUS_06080 4972 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence078 116 433 gene locus_tag LOCUS_06090 116 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 1458 430 gene locus_tag LOCUS_06100 1458 430 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893406.1 protein_id gnl|my_center|LOCUS_06100 1622 2704 gene locus_tag LOCUS_06110 1622 2704 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027929.1 protein_id gnl|my_center|LOCUS_06110 2746 3192 gene locus_tag LOCUS_06120 2746 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06120 3200 3781 gene locus_tag LOCUS_06130 3200 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06130 3774 4847 gene locus_tag LOCUS_06140 3774 4847 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730896.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence079 694 323 gene locus_tag LOCUS_06150 694 323 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896874.1 protein_id gnl|my_center|LOCUS_06150 805 1398 gene locus_tag LOCUS_06160 gene plsY 805 1398 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182W4 protein_id gnl|my_center|LOCUS_06160 1426 2625 gene locus_tag LOCUS_06170 1426 2625 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_06170 2661 3644 gene locus_tag LOCUS_06180 gene moaA 2661 3644 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJ31 protein_id gnl|my_center|LOCUS_06180 3656 4138 gene locus_tag LOCUS_06190 gene moaC 3656 4138 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG82 protein_id gnl|my_center|LOCUS_06190 4276 4728 gene locus_tag LOCUS_06200 4276 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 4790 4865 gene locus_tag LOCUS_t00210 4790 4865 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5418 4948 gene locus_tag LOCUS_06210 5418 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence080 265 867 gene locus_tag LOCUS_06220 265 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 1403 864 gene locus_tag LOCUS_06230 1403 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 4027 1400 gene locus_tag LOCUS_06240 4027 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 4078 5439 gene locus_tag LOCUS_06250 gene tyrS 4078 5439 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM14 protein_id gnl|my_center|LOCUS_06250 >Feature sequence081 1032 241 gene locus_tag LOCUS_06260 gene trpA 1032 241 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68816 protein_id gnl|my_center|LOCUS_06260 2183 1029 gene locus_tag LOCUS_06270 2183 1029 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877267.1 protein_id gnl|my_center|LOCUS_06270 2845 2180 gene locus_tag LOCUS_06280 gene trpF 2845 2180 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56320 protein_id gnl|my_center|LOCUS_06280 3668 2856 gene locus_tag LOCUS_06290 gene trpC 3668 2856 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAS8 protein_id gnl|my_center|LOCUS_06290 4650 3811 gene locus_tag LOCUS_06300 4650 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44000 protein_id gnl|my_center|LOCUS_06300 <5726 4647 gene locus_tag LOCUS_06310 <5726 4647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943019.1:anthranilate synthase component I >Feature sequence082 278 1558 gene locus_tag LOCUS_06320 gene eno 278 1558 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NRS1 protein_id gnl|my_center|LOCUS_06320 1555 1881 gene locus_tag LOCUS_06330 1555 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 2005 4290 gene locus_tag LOCUS_06340 gene cutL 2005 4290 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_06340 4307 5260 gene locus_tag LOCUS_06350 4307 5260 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229982.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence083 106 372 gene locus_tag LOCUS_06360 106 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 1602 379 gene locus_tag LOCUS_06370 1602 379 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_06370 1697 2470 gene locus_tag LOCUS_06380 1697 2470 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730027.1 protein_id gnl|my_center|LOCUS_06380 3096 2497 gene locus_tag LOCUS_06390 3096 2497 CDS product ribosomal-protein-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532763.1 protein_id gnl|my_center|LOCUS_06390 4296 3202 gene locus_tag LOCUS_06400 4296 3202 CDS product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 protein_id gnl|my_center|LOCUS_06400 <5676 4321 gene locus_tag LOCUS_06410 <5676 4321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975718.1:hydrolase >Feature sequence084 <1 714 gene locus_tag LOCUS_06420 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013330.1:ABC transporter permease 1658 711 gene locus_tag LOCUS_06430 1658 711 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06430 1726 2901 gene locus_tag LOCUS_06440 1726 2901 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972086.1 protein_id gnl|my_center|LOCUS_06440 3808 2921 gene locus_tag LOCUS_06450 3808 2921 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014377.1 protein_id gnl|my_center|LOCUS_06450 4605 3805 gene locus_tag LOCUS_06460 4605 3805 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014378.1 protein_id gnl|my_center|LOCUS_06460 5411 4602 gene locus_tag LOCUS_06470 gene phnC 5411 4602 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFB5 protein_id gnl|my_center|LOCUS_06470 >Feature sequence085 734 1117 gene locus_tag LOCUS_06480 gene rsfS 734 1117 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182L0 protein_id gnl|my_center|LOCUS_06480 1114 2130 gene locus_tag LOCUS_06490 1114 2130 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088453.1 protein_id gnl|my_center|LOCUS_06490 2243 2168 gene locus_tag LOCUS_t00220 2243 2168 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2355 4829 gene locus_tag LOCUS_06500 gene leuS 2355 4829 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence086 1838 525 gene locus_tag LOCUS_06510 1838 525 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_06510 2575 1829 gene locus_tag LOCUS_06520 2575 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 2691 3191 gene locus_tag LOCUS_06530 2691 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3210 3593 gene locus_tag LOCUS_06540 3210 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 3603 4535 gene locus_tag LOCUS_06550 3603 4535 CDS product acetylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_06550 <5653 4554 gene locus_tag LOCUS_06560 <5653 4554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920184.1:alpha-methylacyl-CoA racemase >Feature sequence087 <1 1101 gene locus_tag LOCUS_06570 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DFK4:glutamate 5-kinase 2776 1112 gene locus_tag LOCUS_06580 gene mviN 2776 1112 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403272.1 protein_id gnl|my_center|LOCUS_06580 2838 4094 gene locus_tag LOCUS_06590 gene proA 2838 4094 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ6 protein_id gnl|my_center|LOCUS_06590 4132 5046 gene locus_tag LOCUS_06600 4132 5046 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence088 827 63 gene locus_tag LOCUS_06610 gene echA7 827 63 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404949.1 protein_id gnl|my_center|LOCUS_06610 1624 827 gene locus_tag LOCUS_06620 1624 827 CDS product TIGR03084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029616.1 protein_id gnl|my_center|LOCUS_06620 2300 1611 gene locus_tag LOCUS_06630 2300 1611 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230155.1 protein_id gnl|my_center|LOCUS_06630 3520 2297 gene locus_tag LOCUS_06640 3520 2297 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703853.1 protein_id gnl|my_center|LOCUS_06640 5416 3653 gene locus_tag LOCUS_06650 5416 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702796.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence089 1081 227 gene locus_tag LOCUS_06660 1081 227 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030706.1 protein_id gnl|my_center|LOCUS_06660 1088 1510 gene locus_tag LOCUS_06670 1088 1510 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972719.1 protein_id gnl|my_center|LOCUS_06670 1540 3006 gene locus_tag LOCUS_06680 1540 3006 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886881.1 protein_id gnl|my_center|LOCUS_06680 3520 3017 gene locus_tag LOCUS_06690 3520 3017 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230535.1 protein_id gnl|my_center|LOCUS_06690 5170 3569 gene locus_tag LOCUS_06700 5170 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222726.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence090 308 583 gene locus_tag LOCUS_06710 308 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 872 1480 gene locus_tag LOCUS_06720 872 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 2113 2808 gene locus_tag LOCUS_06730 2113 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 2955 3362 gene locus_tag LOCUS_06740 2955 3362 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222101.1 protein_id gnl|my_center|LOCUS_06740 4015 3359 gene locus_tag LOCUS_06750 4015 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 4444 4064 gene locus_tag LOCUS_06760 4444 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 4361 4753 gene locus_tag LOCUS_06770 4361 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 5515 4883 gene locus_tag LOCUS_06780 5515 4883 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258927.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence091 553 1992 gene locus_tag LOCUS_06790 gene pykA 553 1992 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3S2 protein_id gnl|my_center|LOCUS_06790 2333 2028 gene locus_tag LOCUS_06800 2333 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2390 2836 gene locus_tag LOCUS_06810 2390 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029140.1 protein_id gnl|my_center|LOCUS_06810 2848 3447 gene locus_tag LOCUS_06820 2848 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3484 3819 gene locus_tag LOCUS_06830 3484 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3879 4982 gene locus_tag LOCUS_06840 gene rnd 3879 4982 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM2 protein_id gnl|my_center|LOCUS_06840 5059 5379 gene locus_tag LOCUS_06850 5059 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence092 1491 193 gene locus_tag LOCUS_06860 1491 193 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727577.1 protein_id gnl|my_center|LOCUS_06860 2489 1488 gene locus_tag LOCUS_06870 2489 1488 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_06870 3579 2530 gene locus_tag LOCUS_06880 3579 2530 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869175.1 protein_id gnl|my_center|LOCUS_06880 <5471 3576 gene locus_tag LOCUS_06890 <5471 3576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869184.1:selenium-dependent xanthine dehydrogenase >Feature sequence093 2672 1146 gene locus_tag LOCUS_06900 2672 1146 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974636.1 protein_id gnl|my_center|LOCUS_06900 2718 3992 gene locus_tag LOCUS_06910 gene kynU 2718 3992 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK35 protein_id gnl|my_center|LOCUS_06910 5215 4007 gene locus_tag LOCUS_06920 5215 4007 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029442.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence094 42 118 gene locus_tag LOCUS_t00230 42 118 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 719 282 gene locus_tag LOCUS_06930 719 282 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229401.1 protein_id gnl|my_center|LOCUS_06930 821 1159 gene locus_tag LOCUS_06940 821 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 1229 2038 gene locus_tag LOCUS_06950 1229 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_06950 2121 2513 gene locus_tag LOCUS_06960 2121 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 2565 2885 gene locus_tag LOCUS_06970 2565 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 2947 3804 gene locus_tag LOCUS_06980 2947 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 3885 5099 gene locus_tag LOCUS_06990 3885 5099 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014146.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence095 2090 435 gene locus_tag LOCUS_07000 gene rnj 2090 435 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86842 protein_id gnl|my_center|LOCUS_07000 3003 2116 gene locus_tag LOCUS_07010 gene dapA 3003 2116 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJK7 protein_id gnl|my_center|LOCUS_07010 3711 3031 gene locus_tag LOCUS_07020 3711 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 4439 3708 gene locus_tag LOCUS_07030 4439 3708 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC66 protein_id gnl|my_center|LOCUS_07030 5231 4449 gene locus_tag LOCUS_07040 gene dapB 5231 4449 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WP23 protein_id gnl|my_center|LOCUS_07040 >Feature sequence096 510 2372 gene locus_tag LOCUS_07050 510 2372 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030783.1 protein_id gnl|my_center|LOCUS_07050 2365 3390 gene locus_tag LOCUS_07060 2365 3390 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_07060 3422 4165 gene locus_tag LOCUS_07070 3422 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868725.1 protein_id gnl|my_center|LOCUS_07070 4162 4974 gene locus_tag LOCUS_07080 4162 4974 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence097 894 2072 gene locus_tag LOCUS_07090 894 2072 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225002.1 protein_id gnl|my_center|LOCUS_07090 2128 3108 gene locus_tag LOCUS_07100 2128 3108 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_07100 4389 3121 gene locus_tag LOCUS_07110 gene gltA 4389 3121 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBF3 protein_id gnl|my_center|LOCUS_07110 <5372 4584 gene locus_tag LOCUS_07120 <5372 4584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973461.1:methylmalonyl-CoA carboxyltransferase >Feature sequence098 1987 1103 gene locus_tag LOCUS_07130 1987 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 3441 1984 gene locus_tag LOCUS_07140 3441 1984 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 protein_id gnl|my_center|LOCUS_07140 3539 5287 gene locus_tag LOCUS_07150 3539 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence099 1516 3528 gene locus_tag LOCUS_07160 1516 3528 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730604.1 protein_id gnl|my_center|LOCUS_07160 4330 3554 gene locus_tag LOCUS_07170 4330 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4395 5195 gene locus_tag LOCUS_07180 4395 5195 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705355.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence100 614 135 gene locus_tag LOCUS_07190 614 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 1303 812 gene locus_tag LOCUS_07200 1303 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_07200 1928 1320 gene locus_tag LOCUS_07210 1928 1320 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_07210 2646 1933 gene locus_tag LOCUS_07220 2646 1933 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226818.1 protein_id gnl|my_center|LOCUS_07220 3075 2653 gene locus_tag LOCUS_07230 3075 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3454 3068 gene locus_tag LOCUS_07240 gene gcvH 3454 3068 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D905 protein_id gnl|my_center|LOCUS_07240 4162 3605 gene locus_tag LOCUS_07250 gene pgsA 4162 3605 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226820.1 protein_id gnl|my_center|LOCUS_07250 4277 4696 gene locus_tag LOCUS_07260 4277 4696 CDS product diadenosine tetraphosphate (Ap4A) hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601801.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence101 768 692 gene locus_tag LOCUS_t00240 768 692 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1404 823 gene locus_tag LOCUS_07270 1404 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 1540 1465 gene locus_tag LOCUS_t00250 1540 1465 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2071 1619 gene locus_tag LOCUS_07280 2071 1619 CDS product putative phenylacetic acid degradation-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702780.1 protein_id gnl|my_center|LOCUS_07280 2669 2064 gene locus_tag LOCUS_07290 2669 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702776.1 protein_id gnl|my_center|LOCUS_07290 2738 3856 gene locus_tag LOCUS_07300 gene adh 2738 3856 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_07300 3862 4917 gene locus_tag LOCUS_07310 3862 4917 CDS product FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence102 334 122 gene locus_tag LOCUS_07320 334 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 1321 434 gene locus_tag LOCUS_07330 gene folD 1321 434 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1I0 protein_id gnl|my_center|LOCUS_07330 2037 1384 gene locus_tag LOCUS_07340 2037 1384 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897687.1 protein_id gnl|my_center|LOCUS_07340 2124 2762 gene locus_tag LOCUS_07350 gene upp 2124 2762 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXY9 protein_id gnl|my_center|LOCUS_07350 2785 3771 gene locus_tag LOCUS_07360 2785 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 3804 4463 gene locus_tag LOCUS_07370 3804 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 4969 4478 gene locus_tag LOCUS_07380 4969 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence103 <1 726 gene locus_tag LOCUS_07390 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228058.1:chromosome partitioning protein ParA 726 1049 gene locus_tag LOCUS_07400 726 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 1888 1061 gene locus_tag LOCUS_07410 1888 1061 CDS product recombinase RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027903.1 protein_id gnl|my_center|LOCUS_07410 4076 1923 gene locus_tag LOCUS_07420 4076 1923 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69998 protein_id gnl|my_center|LOCUS_07420 5188 4079 gene locus_tag LOCUS_07430 5188 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence104 1061 654 gene locus_tag LOCUS_07440 1061 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1753 1148 gene locus_tag LOCUS_07450 1753 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2523 1777 gene locus_tag LOCUS_07460 2523 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 <5131 2588 gene locus_tag LOCUS_07470 <5131 2588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WNT7:DNA polymerase III subunit alpha >Feature sequence105 <1 542 gene locus_tag LOCUS_07480 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053376.1:ABC transporter ATP-binding protein 556 849 gene locus_tag LOCUS_07490 556 849 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC0 protein_id gnl|my_center|LOCUS_07490 1333 866 gene locus_tag LOCUS_07500 1333 866 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228878.1 protein_id gnl|my_center|LOCUS_07500 2598 1357 gene locus_tag LOCUS_07510 2598 1357 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKN9 protein_id gnl|my_center|LOCUS_07510 3361 2609 gene locus_tag LOCUS_07520 3361 2609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228949.1 protein_id gnl|my_center|LOCUS_07520 3823 3413 gene locus_tag LOCUS_07530 3823 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 4512 3820 gene locus_tag LOCUS_07540 4512 3820 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895255.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence106 2200 539 gene locus_tag LOCUS_07550 2200 539 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D269 protein_id gnl|my_center|LOCUS_07550 3308 2277 gene locus_tag LOCUS_07560 3308 2277 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_07560 3357 3995 gene locus_tag LOCUS_07570 3357 3995 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_07570 <5040 3977 gene locus_tag LOCUS_07580 <5040 3977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530253.1:acetoacetate-CoA ligase >Feature sequence107 1094 159 gene locus_tag LOCUS_07590 gene atpG 1094 159 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R201 protein_id gnl|my_center|LOCUS_07590 2795 1173 gene locus_tag LOCUS_07600 gene atpA 2795 1173 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R202 protein_id gnl|my_center|LOCUS_07600 3357 2827 gene locus_tag LOCUS_07610 3357 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 3940 3350 gene locus_tag LOCUS_07620 3940 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 3890 4111 gene locus_tag LOCUS_07630 3890 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 4349 4092 gene locus_tag LOCUS_07640 4349 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 <5017 4463 gene locus_tag LOCUS_07650 <5017 4463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MDS8:ATP synthase subunit a >Feature sequence108 3190 1442 gene locus_tag LOCUS_07660 3190 1442 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 protein_id gnl|my_center|LOCUS_07660 4430 3234 gene locus_tag LOCUS_07670 gene icd 4430 3234 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CNX4 protein_id gnl|my_center|LOCUS_07670 <5005 4478 gene locus_tag LOCUS_07680 <5005 4478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MG21:bifunctional protein FolD >Feature sequence109 1178 114 gene locus_tag LOCUS_07690 1178 114 CDS product putative aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705632.1 protein_id gnl|my_center|LOCUS_07690 1284 2123 gene locus_tag LOCUS_07700 gene htdY 1284 2123 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 protein_id gnl|my_center|LOCUS_07700 3589 2147 gene locus_tag LOCUS_07710 3589 2147 CDS product Mg-chelatase subunit ChlI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600285.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence110 <1 615 gene locus_tag LOCUS_07720 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704240.1:putative dienelactone hydrolase 1763 636 gene locus_tag LOCUS_07730 1763 636 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3HAG6 protein_id gnl|my_center|LOCUS_07730 2650 1760 gene locus_tag LOCUS_07740 gene fmt 2650 1760 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G3H1 protein_id gnl|my_center|LOCUS_07740 3201 2647 gene locus_tag LOCUS_07750 gene def2 3201 2647 CDS product peptide deformylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G487 protein_id gnl|my_center|LOCUS_07750 <4984 3254 gene locus_tag LOCUS_07760 <4984 3254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89X69:primosomal protein N' >Feature sequence111 2226 730 gene locus_tag LOCUS_07770 2226 730 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXU3 protein_id gnl|my_center|LOCUS_07770 2360 3610 gene locus_tag LOCUS_07780 2360 3610 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191282.1 protein_id gnl|my_center|LOCUS_07780 3607 4398 gene locus_tag LOCUS_07790 gene bdhA 3607 4398 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084310.1 protein_id gnl|my_center|LOCUS_07790 4935 4462 gene locus_tag LOCUS_07800 4935 4462 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence112 2222 1332 gene locus_tag LOCUS_07810 2222 1332 CDS product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975922.1 protein_id gnl|my_center|LOCUS_07810 2577 2272 gene locus_tag LOCUS_07820 2577 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337732.1 protein_id gnl|my_center|LOCUS_07820 3239 2577 gene locus_tag LOCUS_07830 3239 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530684.1 protein_id gnl|my_center|LOCUS_07830 3956 3243 gene locus_tag LOCUS_07840 3956 3243 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 protein_id gnl|my_center|LOCUS_07840 4172 4924 gene locus_tag LOCUS_07850 4172 4924 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256009.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence113 1133 495 gene locus_tag LOCUS_07860 1133 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1642 1133 gene locus_tag LOCUS_07870 1642 1133 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_07870 1943 1653 gene locus_tag LOCUS_07880 1943 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 2803 1940 gene locus_tag LOCUS_07890 2803 1940 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727626.1 protein_id gnl|my_center|LOCUS_07890 3217 2819 gene locus_tag LOCUS_07900 3217 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 4631 3351 gene locus_tag LOCUS_07910 gene dinB 4631 3351 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAG1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence114 120 761 gene locus_tag LOCUS_07920 120 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 795 1187 gene locus_tag LOCUS_07930 795 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 1184 1516 gene locus_tag LOCUS_07940 1184 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2819 1539 gene locus_tag LOCUS_07950 2819 1539 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903523.1 protein_id gnl|my_center|LOCUS_07950 3642 2830 gene locus_tag LOCUS_07960 3642 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 4120 3779 gene locus_tag LOCUS_07970 4120 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 4743 4138 gene locus_tag LOCUS_07980 4743 4138 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061308.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence115 552 190 gene locus_tag LOCUS_07990 552 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1285 584 gene locus_tag LOCUS_08000 1285 584 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_08000 1284 1925 gene locus_tag LOCUS_08010 1284 1925 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600286.1 protein_id gnl|my_center|LOCUS_08010 1951 3339 gene locus_tag LOCUS_08020 1951 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 3352 3852 gene locus_tag LOCUS_08030 3352 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_08030 3842 4615 gene locus_tag LOCUS_08040 3842 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence116 3 152 gene locus_tag LOCUS_08050 3 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 157 435 gene locus_tag LOCUS_08060 157 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 530 1699 gene locus_tag LOCUS_08070 530 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08070 1710 3476 gene locus_tag LOCUS_08080 1710 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence117 1668 1141 gene locus_tag LOCUS_08090 gene bpa 1668 1141 CDS product bacterial proteasome activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65092 protein_id gnl|my_center|LOCUS_08090 2823 1699 gene locus_tag LOCUS_08100 2823 1699 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_08100 2873 3313 gene locus_tag LOCUS_08110 2873 3313 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_08110 4239 3310 gene locus_tag LOCUS_08120 gene rluD 4239 3310 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WE71 protein_id gnl|my_center|LOCUS_08120 4700 4236 gene locus_tag LOCUS_08130 4700 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence118 960 343 gene locus_tag LOCUS_08140 960 343 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_08140 1228 926 gene locus_tag LOCUS_08150 1228 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1326 1796 gene locus_tag LOCUS_08160 1326 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 2245 2060 gene locus_tag LOCUS_08170 2245 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 2359 2273 gene locus_tag LOCUS_t00260 2359 2273 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2485 3669 gene locus_tag LOCUS_08180 gene fabD 2485 3669 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAP1 protein_id gnl|my_center|LOCUS_08180 3732 4445 gene locus_tag LOCUS_08190 3732 4445 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_08190 4536 4772 gene locus_tag LOCUS_08200 gene acpP 4536 4772 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKH6 protein_id gnl|my_center|LOCUS_08200 >Feature sequence119 657 2105 gene locus_tag LOCUS_08210 657 2105 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222825.1 protein_id gnl|my_center|LOCUS_08210 2105 4261 gene locus_tag LOCUS_08220 2105 4261 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence120 102 365 gene locus_tag LOCUS_08230 102 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 635 562 gene locus_tag LOCUS_t00270 635 562 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2530 731 gene locus_tag LOCUS_08240 gene dnaG 2530 731 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S1N4 protein_id gnl|my_center|LOCUS_08240 4183 2591 gene locus_tag LOCUS_08250 4183 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 <4735 4143 gene locus_tag LOCUS_08260 <4735 4143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DBH4:glycine--tRNA ligase >Feature sequence121 <1 1296 gene locus_tag LOCUS_08270 <1 1296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393450.1:ABC transporter 1293 2378 gene locus_tag LOCUS_08280 1293 2378 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_08280 2375 3307 gene locus_tag LOCUS_08290 2375 3307 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564218.1 protein_id gnl|my_center|LOCUS_08290 4542 3304 gene locus_tag LOCUS_08300 4542 3304 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902360.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence122 2905 50 gene locus_tag LOCUS_08310 gene soxA 2905 50 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140189.1 protein_id gnl|my_center|LOCUS_08310 3150 2905 gene locus_tag LOCUS_08320 3150 2905 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531142.1 protein_id gnl|my_center|LOCUS_08320 4364 3150 gene locus_tag LOCUS_08330 gene soxB-2 4364 3150 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246879.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence123 1890 718 gene locus_tag LOCUS_08340 1890 718 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728587.1 protein_id gnl|my_center|LOCUS_08340 2008 2895 gene locus_tag LOCUS_08350 2008 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_08350 2930 3631 gene locus_tag LOCUS_08360 2930 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031612.1 protein_id gnl|my_center|LOCUS_08360 <4679 3639 gene locus_tag LOCUS_08370 <4679 3639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040046.1:thiolase >Feature sequence124 949 377 gene locus_tag LOCUS_08380 949 377 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976167.1 protein_id gnl|my_center|LOCUS_08380 2456 1029 gene locus_tag LOCUS_08390 2456 1029 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_08390 2978 2547 gene locus_tag LOCUS_08400 2978 2547 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708231.1 protein_id gnl|my_center|LOCUS_08400 3786 2986 gene locus_tag LOCUS_08410 3786 2986 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551516.1 protein_id gnl|my_center|LOCUS_08410 <4634 3830 gene locus_tag LOCUS_08420 <4634 3830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122835.1:glucan biosynthesis protein >Feature sequence125 1074 100 gene locus_tag LOCUS_08430 1074 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1928 1098 gene locus_tag LOCUS_08440 1928 1098 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_08440 2719 1940 gene locus_tag LOCUS_08450 gene paaG 2719 1940 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 protein_id gnl|my_center|LOCUS_08450 3930 2743 gene locus_tag LOCUS_08460 3930 2743 CDS product putative lipid-transfer protein Ltp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703354.1 protein_id gnl|my_center|LOCUS_08460 4363 3944 gene locus_tag LOCUS_08470 4363 3944 CDS product benzoylsuccinyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729363.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence126 942 265 gene locus_tag LOCUS_08480 gene psmA 942 265 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAT2 protein_id gnl|my_center|LOCUS_08480 1765 974 gene locus_tag LOCUS_08490 gene prcB 1765 974 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKQ5 protein_id gnl|my_center|LOCUS_08490 1999 1796 gene locus_tag LOCUS_08500 gene pup 1999 1796 CDS product prokaryotic ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D7N4 protein_id gnl|my_center|LOCUS_08500 3544 2009 gene locus_tag LOCUS_08510 3544 2009 CDS product proteasome accessory factor PafA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_08510 <4604 3609 gene locus_tag LOCUS_08520 <4604 3609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RJ58:proteasome-associated ATPase >Feature sequence127 <1 778 gene locus_tag LOCUS_08530 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391201.1:ABC transporter permease 775 1563 gene locus_tag LOCUS_08540 775 1563 CDS product sulfonate ABC transporter ATP-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066592.1 protein_id gnl|my_center|LOCUS_08540 1608 2366 gene locus_tag LOCUS_08550 1608 2366 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709003.1 protein_id gnl|my_center|LOCUS_08550 2363 3493 gene locus_tag LOCUS_08560 2363 3493 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383812.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence128 816 2480 gene locus_tag LOCUS_08570 816 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 3587 2520 gene locus_tag LOCUS_08580 3587 2520 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085431.1 protein_id gnl|my_center|LOCUS_08580 3975 3604 gene locus_tag LOCUS_08590 3975 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 <4585 3980 gene locus_tag LOCUS_08600 <4585 3980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97LQ6:cell division protein FtsX >Feature sequence129 <1 909 gene locus_tag LOCUS_08610 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KMM4:isocitrate dehydrogenase kinase/phosphatase 920 1591 gene locus_tag LOCUS_08620 920 1591 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9K4 protein_id gnl|my_center|LOCUS_08620 1634 2257 gene locus_tag LOCUS_08630 gene clpP 1634 2257 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67357 protein_id gnl|my_center|LOCUS_08630 2312 2394 gene locus_tag LOCUS_t00280 2312 2394 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence130 <1 1437 gene locus_tag LOCUS_08640 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028569.1:ABC transporter ATP-binding protein 1437 3365 gene locus_tag LOCUS_08650 1437 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08650 3362 4078 gene locus_tag LOCUS_08660 3362 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967724.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence131 125 1693 gene locus_tag LOCUS_08670 gene fadD3 125 1693 CDS product 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96843 protein_id gnl|my_center|LOCUS_08670 1721 3271 gene locus_tag LOCUS_08680 1721 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879694.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence132 <1 723 gene locus_tag LOCUS_08690 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118296.1:NADH:flavin oxidoreductase 865 2388 gene locus_tag LOCUS_08700 865 2388 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706287.1 protein_id gnl|my_center|LOCUS_08700 <4504 2450 gene locus_tag LOCUS_08710 <4504 2450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228295.1:alpha/beta hydrolase >Feature sequence133 1781 765 gene locus_tag LOCUS_08720 1781 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 2061 2145 gene locus_tag LOCUS_t00290 2061 2145 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3163 2177 gene locus_tag LOCUS_08730 3163 2177 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390710.1 protein_id gnl|my_center|LOCUS_08730 3943 3212 gene locus_tag LOCUS_08740 3943 3212 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence134 324 1589 gene locus_tag LOCUS_08750 324 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2293 1622 gene locus_tag LOCUS_08760 2293 1622 CDS product glycerol uptake transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888242.1 protein_id gnl|my_center|LOCUS_08760 3940 2345 gene locus_tag LOCUS_08770 gene cimA 3940 2345 CDS product (R)-citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86511 protein_id gnl|my_center|LOCUS_08770 4451 3951 gene locus_tag LOCUS_08780 4451 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence135 <1 753 gene locus_tag LOCUS_08790 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225237.1:CoA-transferase 750 1808 gene locus_tag LOCUS_08800 750 1808 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225238.1 protein_id gnl|my_center|LOCUS_08800 1820 2986 gene locus_tag LOCUS_08810 1820 2986 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_08810 3003 4028 gene locus_tag LOCUS_08820 gene fadE32 3003 4028 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950910.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence136 <1 507 gene locus_tag LOCUS_08830 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CN48:pyrimidine-specific ribonucleoside hydrolase RihA 974 504 gene locus_tag LOCUS_08840 974 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1076 2863 gene locus_tag LOCUS_08850 1076 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 3220 2864 gene locus_tag LOCUS_08860 3220 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259291.1 protein_id gnl|my_center|LOCUS_08860 3606 3220 gene locus_tag LOCUS_08870 3606 3220 CDS product low molecular weight phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892530.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence137 <1 768 gene locus_tag LOCUS_08880 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084053.1:O-acetylhomoserine aminocarboxypropyltransferase 776 1573 gene locus_tag LOCUS_08890 776 1573 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_08890 2852 1599 gene locus_tag LOCUS_08900 2852 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence138 <1 731 gene locus_tag LOCUS_08910 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225715.1:acyl-CoA dehydrogenase 798 1253 gene locus_tag LOCUS_08920 798 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1263 2213 gene locus_tag LOCUS_08930 gene fcl 1263 2213 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 protein_id gnl|my_center|LOCUS_08930 2817 2230 gene locus_tag LOCUS_08940 2817 2230 CDS product (Fe-S)-cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_08940 2924 3367 gene locus_tag LOCUS_08950 gene rnhA 2924 3367 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E89 protein_id gnl|my_center|LOCUS_08950 3697 3900 gene locus_tag LOCUS_08960 3697 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 <4416 3913 gene locus_tag LOCUS_08970 <4416 3913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000863308.1:aconitate hydratase >Feature sequence139 <1 702 gene locus_tag LOCUS_08980 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969369.1:membrane dipeptidase 699 1280 gene locus_tag LOCUS_08990 699 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1273 2508 gene locus_tag LOCUS_09000 1273 2508 CDS product creatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 protein_id gnl|my_center|LOCUS_09000 2782 3624 gene locus_tag LOCUS_09010 2782 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 <4399 3644 gene locus_tag LOCUS_09020 <4399 3644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226839.1:aspartate aminotransferase family protein >Feature sequence140 <1 521 gene locus_tag LOCUS_09030 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532888.1:ABC transporter 1068 2078 gene locus_tag LOCUS_09040 1068 2078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence141 1267 647 gene locus_tag LOCUS_09050 gene nadD 1267 647 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EAR4 protein_id gnl|my_center|LOCUS_09050 1559 2389 gene locus_tag LOCUS_09060 gene hrdD 1559 2389 CDS product RNA polymerase principal sigma factor HrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18249 protein_id gnl|my_center|LOCUS_09060 2472 3851 gene locus_tag LOCUS_09070 2472 3851 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK8 protein_id gnl|my_center|LOCUS_09070 >Feature sequence142 2465 1218 gene locus_tag LOCUS_09080 2465 1218 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063669.1 protein_id gnl|my_center|LOCUS_09080 2611 4011 gene locus_tag LOCUS_09090 2611 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930739.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence143 1783 758 gene locus_tag LOCUS_09100 1783 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2435 1899 gene locus_tag LOCUS_09110 gene orn 2435 1899 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 protein_id gnl|my_center|LOCUS_09110 2523 2960 gene locus_tag LOCUS_09120 gene dut 2523 2960 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2A4 protein_id gnl|my_center|LOCUS_09120 3260 2991 gene locus_tag LOCUS_09130 3260 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 3349 3888 gene locus_tag LOCUS_09140 3349 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence144 282 1448 gene locus_tag LOCUS_09150 282 1448 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404246.1 protein_id gnl|my_center|LOCUS_09150 1691 1410 gene locus_tag LOCUS_09160 1691 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1605 2504 gene locus_tag LOCUS_09170 1605 2504 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726719.1 protein_id gnl|my_center|LOCUS_09170 3379 2537 gene locus_tag LOCUS_09180 3379 2537 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_09180 3951 3511 gene locus_tag LOCUS_09190 3951 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703277.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence145 1663 239 gene locus_tag LOCUS_09200 1663 239 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272490.1 protein_id gnl|my_center|LOCUS_09200 3521 1665 gene locus_tag LOCUS_09210 gene ftsI 3521 1665 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_09210 3956 3576 gene locus_tag LOCUS_09220 3956 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 4279 4067 gene locus_tag LOCUS_09230 4279 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence146 1495 1420 gene locus_tag LOCUS_t00300 1495 1420 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1769 1545 gene locus_tag LOCUS_09240 1769 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 2087 1785 gene locus_tag LOCUS_09250 2087 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 2906 2127 gene locus_tag LOCUS_09260 gene mutM 2906 2127 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228777.1 protein_id gnl|my_center|LOCUS_09260 4116 2914 gene locus_tag LOCUS_09270 gene metZ 4116 2914 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55218 protein_id gnl|my_center|LOCUS_09270 >Feature sequence147 1374 244 gene locus_tag LOCUS_09280 gene queG 1374 244 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HNR6 protein_id gnl|my_center|LOCUS_09280 1626 1405 gene locus_tag LOCUS_09290 1626 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1872 3245 gene locus_tag LOCUS_09300 1872 3245 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918241.1 protein_id gnl|my_center|LOCUS_09300 <4260 3253 gene locus_tag LOCUS_09310 <4260 3253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O68608:anthranilate phosphoribosyltransferase 1 >Feature sequence148 606 235 gene locus_tag LOCUS_09320 606 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 664 1359 gene locus_tag LOCUS_09330 664 1359 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704421.1 protein_id gnl|my_center|LOCUS_09330 2123 1380 gene locus_tag LOCUS_09340 2123 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2939 2256 gene locus_tag LOCUS_09350 2939 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 4119 3013 gene locus_tag LOCUS_09360 4119 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence149 1819 506 gene locus_tag LOCUS_09370 gene pdhC 1819 506 CDS product dihydrolipoamide S-acetyltransferase component of pyruvate dehydrogenase complex E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863439.1 protein_id gnl|my_center|LOCUS_09370 2823 1825 gene locus_tag LOCUS_09380 2823 1825 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068168.1 protein_id gnl|my_center|LOCUS_09380 3824 2823 gene locus_tag LOCUS_09390 3824 2823 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228310.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence150 2219 1206 gene locus_tag LOCUS_09400 2219 1206 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKP2 protein_id gnl|my_center|LOCUS_09400 2557 2378 gene locus_tag LOCUS_09410 2557 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2999 2625 gene locus_tag LOCUS_09420 2999 2625 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence151 1841 615 gene locus_tag LOCUS_09430 gene codA 1841 615 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223886.1 protein_id gnl|my_center|LOCUS_09430 1986 1822 gene locus_tag LOCUS_09440 1986 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2091 2687 gene locus_tag LOCUS_09450 gene ubiX 2091 2687 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNP2 protein_id gnl|my_center|LOCUS_09450 2728 3498 gene locus_tag LOCUS_09460 2728 3498 CDS product creatinine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223881.1 protein_id gnl|my_center|LOCUS_09460 3540 3773 gene locus_tag LOCUS_09470 3540 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972720.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence152 449 129 gene locus_tag LOCUS_09480 449 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1171 470 gene locus_tag LOCUS_09490 1171 470 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230619.1 protein_id gnl|my_center|LOCUS_09490 2147 1212 gene locus_tag LOCUS_09500 2147 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2494 2144 gene locus_tag LOCUS_09510 2494 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2547 3413 gene locus_tag LOCUS_09520 2547 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence153 87 467 gene locus_tag LOCUS_09530 gene rplL 87 467 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EE75 protein_id gnl|my_center|LOCUS_09530 >Feature sequence154 1128 2864 gene locus_tag LOCUS_09540 1128 2864 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_09540 4214 2892 gene locus_tag LOCUS_09550 4214 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence155 3149 1944 gene locus_tag LOCUS_09560 3149 1944 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLI2 protein_id gnl|my_center|LOCUS_09560 3934 3146 gene locus_tag LOCUS_09570 3934 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence156 2681 1140 gene locus_tag LOCUS_09580 2681 1140 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_09580 <4170 2678 gene locus_tag LOCUS_09590 <4170 2678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003530667.1:drug:proton antiporter >Feature sequence157 661 2271 gene locus_tag LOCUS_09600 661 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 2329 2580 gene locus_tag LOCUS_09610 gene rpmE2 2329 2580 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JU1 protein_id gnl|my_center|LOCUS_09610 2599 3633 gene locus_tag LOCUS_09620 2599 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence158 416 793 gene locus_tag LOCUS_09630 416 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 872 1351 gene locus_tag LOCUS_09640 872 1351 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_09640 1416 1871 gene locus_tag LOCUS_09650 1416 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1984 2523 gene locus_tag LOCUS_09660 1984 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 2549 3337 gene locus_tag LOCUS_09670 2549 3337 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064414.1 protein_id gnl|my_center|LOCUS_09670 <4087 3359 gene locus_tag LOCUS_09680 <4087 3359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730669.1:cyclohexanecarboxylate-CoA ligase >Feature sequence159 1156 1992 gene locus_tag LOCUS_09690 1156 1992 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GN7 protein_id gnl|my_center|LOCUS_09690 1994 3226 gene locus_tag LOCUS_09700 1994 3226 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence160 22 1008 gene locus_tag LOCUS_09710 22 1008 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969988.1 protein_id gnl|my_center|LOCUS_09710 1678 1025 gene locus_tag LOCUS_09720 gene hlyI 1678 1025 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229810.1 protein_id gnl|my_center|LOCUS_09720 1787 2236 gene locus_tag LOCUS_09730 1787 2236 CDS product putative enoyl-CoA hydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNP3 protein_id gnl|my_center|LOCUS_09730 2233 3795 gene locus_tag LOCUS_09740 2233 3795 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064448.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence161 3 311 gene locus_tag LOCUS_09750 3 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 469 1146 gene locus_tag LOCUS_09760 gene regX 469 1146 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_09760 1225 2640 gene locus_tag LOCUS_09770 gene mtrB 1225 2640 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_09770 2667 3308 gene locus_tag LOCUS_09780 2667 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence162 133 1323 gene locus_tag LOCUS_09790 gene cysS 133 1323 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG64 protein_id gnl|my_center|LOCUS_09790 1395 2774 gene locus_tag LOCUS_09800 gene cysS 1395 2774 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQZ9 protein_id gnl|my_center|LOCUS_09800 4010 2802 gene locus_tag LOCUS_09810 4010 2802 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence163 704 351 gene locus_tag LOCUS_09820 704 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 889 1935 gene locus_tag LOCUS_09830 889 1935 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726789.1 protein_id gnl|my_center|LOCUS_09830 3164 1953 gene locus_tag LOCUS_09840 gene mct 3164 1953 CDS product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC36 protein_id gnl|my_center|LOCUS_09840 3463 3182 gene locus_tag LOCUS_09850 3463 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence164 1551 463 gene locus_tag LOCUS_09860 gene aroC 1551 463 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_09860 1623 3245 gene locus_tag LOCUS_09870 1623 3245 CDS product putative fatty-acid-CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704890.1 protein_id gnl|my_center|LOCUS_09870 <4030 3251 gene locus_tag LOCUS_09880 <4030 3251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950459.1:short-chain dehydrogenase >Feature sequence165 221 382 gene locus_tag LOCUS_09890 gene rpmG 221 382 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS16 protein_id gnl|my_center|LOCUS_09890 526 601 gene locus_tag LOCUS_t00310 526 601 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 690 989 gene locus_tag LOCUS_09900 690 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 989 1786 gene locus_tag LOCUS_09910 gene nusG 989 1786 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWV9 protein_id gnl|my_center|LOCUS_09910 1897 2322 gene locus_tag LOCUS_09920 gene rplK 1897 2322 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLP6 protein_id gnl|my_center|LOCUS_09920 2442 3137 gene locus_tag LOCUS_09930 gene rlpA 2442 3137 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EB95 protein_id gnl|my_center|LOCUS_09930 >Feature sequence166 1603 686 gene locus_tag LOCUS_09940 1603 686 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230083.1 protein_id gnl|my_center|LOCUS_09940 1758 3203 gene locus_tag LOCUS_09950 1758 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence167 <1 1683 gene locus_tag LOCUS_09960 <1 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339159.1:peptide ABC transporter substrate-binding protein 1828 2871 gene locus_tag LOCUS_09970 1828 2871 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811980.1 protein_id gnl|my_center|LOCUS_09970 2871 3791 gene locus_tag LOCUS_09980 2871 3791 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538031.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence168 136 846 gene locus_tag LOCUS_09990 136 846 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267293.1 protein_id gnl|my_center|LOCUS_09990 890 1918 gene locus_tag LOCUS_10000 gene hemH 890 1918 CDS product putative ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50533 protein_id gnl|my_center|LOCUS_10000 2023 2337 gene locus_tag LOCUS_10010 2023 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence169 <1 2334 gene locus_tag LOCUS_10020 <1 2334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RNU9:phosphoenolpyruvate carboxylase 3390 2350 gene locus_tag LOCUS_10030 3390 2350 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_10030 <4001 3474 gene locus_tag LOCUS_10040 <4001 3474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223759.1:MoxR-like ATPase >Feature sequence170 <1 1748 gene locus_tag LOCUS_10050 <1 1748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NJR3:carbamoyl-phosphate synthase (glutamine-hydrolyzing) 1745 2677 gene locus_tag LOCUS_10060 gene pyrD 1745 2677 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66461 protein_id gnl|my_center|LOCUS_10060 2670 3425 gene locus_tag LOCUS_10070 gene pyrF 2670 3425 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK39 protein_id gnl|my_center|LOCUS_10070 3499 3813 gene locus_tag LOCUS_10080 3499 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence171 206 1144 gene locus_tag LOCUS_10090 gene rpoA 206 1144 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MG99 protein_id gnl|my_center|LOCUS_10090 1212 1502 gene locus_tag LOCUS_10100 1212 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1544 2293 gene locus_tag LOCUS_10110 gene truA 1544 2293 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEW9 protein_id gnl|my_center|LOCUS_10110 2460 3167 gene locus_tag LOCUS_10120 2460 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 3181 3573 gene locus_tag LOCUS_10130 3181 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence172 1751 576 gene locus_tag LOCUS_10140 1751 576 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730272.1 protein_id gnl|my_center|LOCUS_10140 1876 3528 gene locus_tag LOCUS_10150 gene betA 1876 3528 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGN2 protein_id gnl|my_center|LOCUS_10150 >Feature sequence173 627 1346 gene locus_tag LOCUS_10160 627 1346 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434123.1 protein_id gnl|my_center|LOCUS_10160 1413 1889 gene locus_tag LOCUS_10170 1413 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3160 1910 gene locus_tag LOCUS_10180 3160 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3687 3157 gene locus_tag LOCUS_10190 3687 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence174 43 741 gene locus_tag LOCUS_10200 43 741 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256704.1 protein_id gnl|my_center|LOCUS_10200 1716 748 gene locus_tag LOCUS_10210 1716 748 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_10210 1738 1890 gene locus_tag LOCUS_10220 1738 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1891 2238 gene locus_tag LOCUS_10230 1891 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2313 3092 gene locus_tag LOCUS_10240 gene fixA 2313 3092 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence175 1166 30 gene locus_tag LOCUS_10250 1166 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 2081 1194 gene locus_tag LOCUS_10260 2081 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 3039 2170 gene locus_tag LOCUS_10270 3039 2170 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence176 1223 1420 gene locus_tag LOCUS_10280 1223 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1570 1839 gene locus_tag LOCUS_10290 1570 1839 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_10290 1796 3538 gene locus_tag LOCUS_10300 1796 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence177 1152 139 gene locus_tag LOCUS_10310 1152 139 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405050.1 protein_id gnl|my_center|LOCUS_10310 2618 1662 gene locus_tag LOCUS_10320 gene gbuA 2618 1662 CDS product guanidinobutyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3S3 protein_id gnl|my_center|LOCUS_10320 2780 3475 gene locus_tag LOCUS_10330 2780 3475 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence178 604 1398 gene locus_tag LOCUS_10340 604 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2258 1482 gene locus_tag LOCUS_10350 2258 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816329.1 protein_id gnl|my_center|LOCUS_10350 2707 2414 gene locus_tag LOCUS_10360 2707 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3186 2764 gene locus_tag LOCUS_10370 3186 2764 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222322.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence179 1308 226 gene locus_tag LOCUS_10380 1308 226 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_10380 3165 1402 gene locus_tag LOCUS_10390 3165 1402 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence180 1821 661 gene locus_tag LOCUS_10400 1821 661 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528296.1 protein_id gnl|my_center|LOCUS_10400 3372 1873 gene locus_tag LOCUS_10410 gene lcdH 3372 1873 CDS product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBH7 protein_id gnl|my_center|LOCUS_10410 >Feature sequence181 2879 141 gene locus_tag LOCUS_10420 gene nrdA 2879 141 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence182 515 1807 gene locus_tag LOCUS_10430 515 1807 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_10430 1873 3285 gene locus_tag LOCUS_10440 gene hydA 1873 3285 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895004.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence183 <1 1468 gene locus_tag LOCUS_10450 <1 1468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460435.1:NADH-quinone oxidoreductase subunit N 1494 2510 gene locus_tag LOCUS_10460 1494 2510 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918379.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence184 <1 798 gene locus_tag LOCUS_10470 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WIW3:formate--tetrahydrofolate ligase 800 1681 gene locus_tag LOCUS_10480 800 1681 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDX6 protein_id gnl|my_center|LOCUS_10480 >Feature sequence185 984 25 gene locus_tag LOCUS_10490 984 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1019 1330 gene locus_tag LOCUS_10500 1019 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1418 1505 gene locus_tag LOCUS_t00320 1418 1505 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1569 2726 gene locus_tag LOCUS_10510 1569 2726 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028803.1 protein_id gnl|my_center|LOCUS_10510 3765 2752 gene locus_tag LOCUS_10520 3765 2752 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence186 <1 1776 gene locus_tag LOCUS_10530 <1 1776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P17889:translation initiation factor IF-2 2554 1799 gene locus_tag LOCUS_10540 2554 1799 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257442.1 protein_id gnl|my_center|LOCUS_10540 2639 2983 gene locus_tag LOCUS_10550 gene rbfA 2639 2983 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV56 protein_id gnl|my_center|LOCUS_10550 >Feature sequence187 <1 863 gene locus_tag LOCUS_10560 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086677.1:arylsulfatase 3273 883 gene locus_tag LOCUS_10570 3273 883 CDS product putative CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95149 protein_id gnl|my_center|LOCUS_10570 >Feature sequence188 37 1446 gene locus_tag LOCUS_10580 37 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1491 2561 gene locus_tag LOCUS_10590 1491 2561 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_10590 2562 3134 gene locus_tag LOCUS_10600 gene rfbC 2562 3134 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261024.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence189 <3757 2396 gene locus_tag LOCUS_10610 <3757 2396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228917.1:ABC transporter >Feature sequence190 2394 1252 gene locus_tag LOCUS_10620 gene recA 2394 1252 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBC8 protein_id gnl|my_center|LOCUS_10620 2573 2977 gene locus_tag LOCUS_10630 gene msrB 2573 2977 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLI3 protein_id gnl|my_center|LOCUS_10630 3487 2981 gene locus_tag LOCUS_10640 gene ligT 3487 2981 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DEJ6 protein_id gnl|my_center|LOCUS_10640 >Feature sequence191 <1 1147 gene locus_tag LOCUS_10650 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461688.1:phosphoenolpyruvate synthase 1232 2476 gene locus_tag LOCUS_10660 1232 2476 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143424.1 protein_id gnl|my_center|LOCUS_10660 3324 2473 gene locus_tag LOCUS_10670 3324 2473 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087376.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence192 1408 266 gene locus_tag LOCUS_10680 1408 266 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975045.1 protein_id gnl|my_center|LOCUS_10680 1470 2654 gene locus_tag LOCUS_10690 1470 2654 CDS product amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384563.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence193 2515 227 gene locus_tag LOCUS_10700 gene cutL 2515 227 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_10700 3669 2512 gene locus_tag LOCUS_10710 3669 2512 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728223.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence194 416 1351 gene locus_tag LOCUS_10720 416 1351 CDS product putative chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705671.1 protein_id gnl|my_center|LOCUS_10720 2173 1379 gene locus_tag LOCUS_10730 2173 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2736 2410 gene locus_tag LOCUS_10740 2736 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10740 3617 2847 gene locus_tag LOCUS_10750 3617 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence195 901 425 gene locus_tag LOCUS_10760 901 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1035 2183 gene locus_tag LOCUS_10770 gene sucC 1035 2183 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJJ0 protein_id gnl|my_center|LOCUS_10770 2188 3075 gene locus_tag LOCUS_10780 gene sucD 2188 3075 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67547 protein_id gnl|my_center|LOCUS_10780 3098 3667 gene locus_tag LOCUS_10790 gene purN 3098 3667 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS22 protein_id gnl|my_center|LOCUS_10790 >Feature sequence196 <1 1224 gene locus_tag LOCUS_10800 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000554395.1:serine protease >Feature sequence197 <1 1080 gene locus_tag LOCUS_10810 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9L0L0:DNA-directed RNA polymerase subunit beta >Feature sequence198 659 369 gene locus_tag LOCUS_10820 659 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2161 797 gene locus_tag LOCUS_10830 2161 797 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538186.1 protein_id gnl|my_center|LOCUS_10830 3164 2166 gene locus_tag LOCUS_10840 3164 2166 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533002.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence199 609 262 gene locus_tag LOCUS_10850 609 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 915 610 gene locus_tag LOCUS_10860 915 610 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867825.1 protein_id gnl|my_center|LOCUS_10860 1388 912 gene locus_tag LOCUS_10870 gene mrpE 1388 912 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 protein_id gnl|my_center|LOCUS_10870 2926 1385 gene locus_tag LOCUS_10880 gene mrpD 2926 1385 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 protein_id gnl|my_center|LOCUS_10880 3345 2926 gene locus_tag LOCUS_10890 3345 2926 CDS product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461653.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence200 390 977 gene locus_tag LOCUS_10900 390 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531333.1 protein_id gnl|my_center|LOCUS_10900 974 1756 gene locus_tag LOCUS_10910 974 1756 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267659.1 protein_id gnl|my_center|LOCUS_10910 1753 3228 gene locus_tag LOCUS_10920 1753 3228 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527057.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence201 734 354 gene locus_tag LOCUS_10930 734 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 854 2281 gene locus_tag LOCUS_10940 854 2281 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_10940 2284 3624 gene locus_tag LOCUS_10950 2284 3624 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence202 277 948 gene locus_tag LOCUS_10960 277 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 941 1615 gene locus_tag LOCUS_10970 941 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1629 2441 gene locus_tag LOCUS_10980 1629 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 2438 2596 gene locus_tag LOCUS_10990 2438 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 2586 3110 gene locus_tag LOCUS_11000 2586 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence203 1049 2050 gene locus_tag LOCUS_11010 1049 2050 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256434.1 protein_id gnl|my_center|LOCUS_11010 2050 3072 gene locus_tag LOCUS_11020 2050 3072 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259763.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence204 1371 391 gene locus_tag LOCUS_11030 1371 391 CDS product protein pafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_11030 2279 1368 gene locus_tag LOCUS_11040 gene pafB 2279 1368 CDS product protein PafB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIM1 protein_id gnl|my_center|LOCUS_11040 <3566 2310 gene locus_tag LOCUS_11050 <3566 2310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RJ61:Pup--protein ligase >Feature sequence205 1456 623 gene locus_tag LOCUS_11060 1456 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172618.1 protein_id gnl|my_center|LOCUS_11060 3107 1500 gene locus_tag LOCUS_11070 gene agpS 3107 1500 CDS product alkyldihydroxyacetonephosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence206 <1 522 gene locus_tag LOCUS_11080 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P67427:UvrABC system protein C 1354 527 gene locus_tag LOCUS_11090 1354 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701168.1 protein_id gnl|my_center|LOCUS_11090 1376 2152 gene locus_tag LOCUS_11100 1376 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2193 3041 gene locus_tag LOCUS_11110 2193 3041 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z513 protein_id gnl|my_center|LOCUS_11110 >Feature sequence207 246 1178 gene locus_tag LOCUS_11120 246 1178 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_11120 1261 3324 gene locus_tag LOCUS_11130 1261 3324 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028547.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence208 213 656 gene locus_tag LOCUS_11140 gene aroQ 213 656 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ7 protein_id gnl|my_center|LOCUS_11140 677 1744 gene locus_tag LOCUS_11150 677 1744 CDS product X-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728770.1 protein_id gnl|my_center|LOCUS_11150 1790 2353 gene locus_tag LOCUS_11160 gene efp 1790 2353 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2U0 protein_id gnl|my_center|LOCUS_11160 2388 2831 gene locus_tag LOCUS_11170 2388 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2849 3418 gene locus_tag LOCUS_11180 2849 3418 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027890.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence209 89 2047 gene locus_tag LOCUS_11190 gene tkt 89 2047 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_11190 2085 3182 gene locus_tag LOCUS_11200 gene tal2 2085 3182 CDS product transaldolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAC0 protein_id gnl|my_center|LOCUS_11200 3484 3287 gene locus_tag LOCUS_11210 3484 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence210 255 926 gene locus_tag LOCUS_11220 255 926 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_11220 994 1872 gene locus_tag LOCUS_11230 994 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2307 1885 gene locus_tag LOCUS_11240 2307 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 2417 3187 gene locus_tag LOCUS_11250 2417 3187 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143495.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence211 126 953 gene locus_tag LOCUS_11260 126 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1041 1337 gene locus_tag LOCUS_11270 1041 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1342 1659 gene locus_tag LOCUS_11280 1342 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2570 1686 gene locus_tag LOCUS_11290 2570 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 2605 2994 gene locus_tag LOCUS_11300 2605 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence212 1407 838 gene locus_tag LOCUS_11310 1407 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1321 1521 gene locus_tag LOCUS_11320 1321 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1502 2263 gene locus_tag LOCUS_11330 1502 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 2305 2379 gene locus_tag LOCUS_t00330 2305 2379 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2479 3255 gene locus_tag LOCUS_11340 2479 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence213 1167 289 gene locus_tag LOCUS_11350 1167 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1656 1183 gene locus_tag LOCUS_11360 gene greA 1656 1183 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEV2 protein_id gnl|my_center|LOCUS_11360 1903 2880 gene locus_tag LOCUS_11370 gene leuB 1903 2880 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94631 protein_id gnl|my_center|LOCUS_11370 >Feature sequence214 596 2122 gene locus_tag LOCUS_11380 596 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2119 3228 gene locus_tag LOCUS_11390 2119 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence215 1656 604 gene locus_tag LOCUS_11400 1656 604 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226804.1 protein_id gnl|my_center|LOCUS_11400 2954 1653 gene locus_tag LOCUS_11410 2954 1653 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence216 >Feature sequence217 478 1998 gene locus_tag LOCUS_11420 478 1998 CDS product substrate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807754.1 protein_id gnl|my_center|LOCUS_11420 2992 2003 gene locus_tag LOCUS_11430 gene rsgA 2992 2003 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A60 protein_id gnl|my_center|LOCUS_11430 3404 3057 gene locus_tag LOCUS_11440 3404 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence218 1462 1013 gene locus_tag LOCUS_11450 1462 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1482 2642 gene locus_tag LOCUS_11460 1482 2642 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977776.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence219 1510 254 gene locus_tag LOCUS_11470 1510 254 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_11470 <3386 1507 gene locus_tag LOCUS_11480 <3386 1507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223814.1:carbon-monoxide dehydrogenase large subunit >Feature sequence220 >Feature sequence221 485 69 gene locus_tag LOCUS_11490 485 69 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_11490 819 607 gene locus_tag LOCUS_11500 819 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1788 889 gene locus_tag LOCUS_11510 1788 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704613.1 protein_id gnl|my_center|LOCUS_11510 1842 2204 gene locus_tag LOCUS_11520 1842 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 2962 2222 gene locus_tag LOCUS_11530 2962 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence222 1618 830 gene locus_tag LOCUS_11540 gene fwdC 1618 830 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973661.1 protein_id gnl|my_center|LOCUS_11540 2535 1606 gene locus_tag LOCUS_11550 2535 1606 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_11550 <3343 2570 gene locus_tag LOCUS_11560 <3343 2570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731465.1:glutamine synthetase >Feature sequence223 420 49 gene locus_tag LOCUS_11570 gene fxsA 420 49 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941471.1 protein_id gnl|my_center|LOCUS_11570 488 1777 gene locus_tag LOCUS_11580 gene selA 488 1777 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIF3 protein_id gnl|my_center|LOCUS_11580 >Feature sequence224 357 1040 gene locus_tag LOCUS_11590 gene ywfI 357 1040 CDS product putative heme-dependent peroxidase YwfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39645 protein_id gnl|my_center|LOCUS_11590 1043 1387 gene locus_tag LOCUS_11600 1043 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1406 2140 gene locus_tag LOCUS_11610 1406 2140 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206301.1 protein_id gnl|my_center|LOCUS_11610 3051 2143 gene locus_tag LOCUS_11620 3051 2143 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411060.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence225 <1 513 gene locus_tag LOCUS_11630 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028261.1:bifunctional RNase H/acid phosphatase 753 532 gene locus_tag LOCUS_11640 753 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 2151 808 gene locus_tag LOCUS_11650 2151 808 CDS product L-gulonolactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222034.1 protein_id gnl|my_center|LOCUS_11650 3173 2157 gene locus_tag LOCUS_11660 3173 2157 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929812.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence226 93 866 gene locus_tag LOCUS_11670 gene cobA 93 866 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022972.1 protein_id gnl|my_center|LOCUS_11670 863 2653 gene locus_tag LOCUS_11680 863 2653 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence227 <1 540 gene locus_tag LOCUS_11690 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228698.1:long-chain-fatty-acid--CoA ligase 533 1234 gene locus_tag LOCUS_11700 533 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLE7 protein_id gnl|my_center|LOCUS_11700 1271 2089 gene locus_tag LOCUS_11710 1271 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416111.1 protein_id gnl|my_center|LOCUS_11710 2147 2857 gene locus_tag LOCUS_11720 gene msrA 2147 2857 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_11720 >Feature sequence228 1395 1469 gene locus_tag LOCUS_t00340 1395 1469 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1666 2310 gene locus_tag LOCUS_11730 1666 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_11730 <3221 2332 gene locus_tag LOCUS_11740 <3221 2332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229859.1:beta-glucosidase >Feature sequence229 826 754 gene locus_tag LOCUS_t00350 826 754 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 930 2366 gene locus_tag LOCUS_11750 gene tig 930 2366 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DE09 protein_id gnl|my_center|LOCUS_11750 2366 3010 gene locus_tag LOCUS_11760 gene clpP 2366 3010 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E290 protein_id gnl|my_center|LOCUS_11760 >Feature sequence230 <1 1239 gene locus_tag LOCUS_11770 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730960.1:cytochrome P450 steroid C27-monooxygenase 1963 1259 gene locus_tag LOCUS_11780 1963 1259 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_11780 2744 2016 gene locus_tag LOCUS_11790 2744 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3212 3063 gene locus_tag LOCUS_11800 3212 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence231 159 1598 gene locus_tag LOCUS_11810 gene murA 159 1598 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DH73 protein_id gnl|my_center|LOCUS_11810 1792 1595 gene locus_tag LOCUS_11820 1792 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1826 2164 gene locus_tag LOCUS_11830 1826 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2176 2793 gene locus_tag LOCUS_11840 2176 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence232 1244 426 gene locus_tag LOCUS_11850 1244 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11850 1568 1251 gene locus_tag LOCUS_11860 1568 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2492 1614 gene locus_tag LOCUS_11870 2492 1614 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MH96 protein_id gnl|my_center|LOCUS_11870 <3170 2497 gene locus_tag LOCUS_11880 <3170 2497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MH95:succinate--CoA ligase [ADP-forming] subunit beta >Feature sequence233 1046 1795 gene locus_tag LOCUS_11890 1046 1795 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229715.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence234 424 14 gene locus_tag LOCUS_11900 424 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 706 1068 gene locus_tag LOCUS_11910 706 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1369 1160 gene locus_tag LOCUS_11920 1369 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1958 1389 gene locus_tag LOCUS_11930 1958 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2443 1958 gene locus_tag LOCUS_11940 2443 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 3160 2447 gene locus_tag LOCUS_11950 3160 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence235 388 978 gene locus_tag LOCUS_11960 gene hisB 388 978 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33564 protein_id gnl|my_center|LOCUS_11960 975 1613 gene locus_tag LOCUS_11970 gene hisH 975 1613 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX89 protein_id gnl|my_center|LOCUS_11970 1610 2344 gene locus_tag LOCUS_11980 gene hisA 1610 2344 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA6 protein_id gnl|my_center|LOCUS_11980 2341 3114 gene locus_tag LOCUS_11990 gene hisF 2341 3114 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA7 protein_id gnl|my_center|LOCUS_11990 >Feature sequence236 2074 422 gene locus_tag LOCUS_12000 2074 422 CDS product putative acetyl/propionyl-CoA carboxylase beta subunit AccD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702802.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence237 1303 161 gene locus_tag LOCUS_12010 1303 161 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_12010 2173 1337 gene locus_tag LOCUS_12020 2173 1337 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085668.1 protein_id gnl|my_center|LOCUS_12020 2072 2674 gene locus_tag LOCUS_12030 2072 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 3031 2687 gene locus_tag LOCUS_12040 3031 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence238 2624 1494 gene locus_tag LOCUS_12050 2624 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence239 <1 574 gene locus_tag LOCUS_12060 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387910.1:adenosine kinase 622 1470 gene locus_tag LOCUS_12070 622 1470 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_12070 2114 1500 gene locus_tag LOCUS_12080 2114 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 <3113 2163 gene locus_tag LOCUS_12090 <3113 2163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031021.1:CoA-binding protein >Feature sequence240 987 685 gene locus_tag LOCUS_12100 987 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2180 1071 gene locus_tag LOCUS_12110 gene tgt 2180 1071 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183P1 protein_id gnl|my_center|LOCUS_12110 <3097 2177 gene locus_tag LOCUS_12120 <3097 2177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SMH0:S-adenosylmethionine:tRNA ribosyltransferase-isomerase >Feature sequence241 1572 481 gene locus_tag LOCUS_12130 gene nrdB 1572 481 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3C2 protein_id gnl|my_center|LOCUS_12130 <3086 1572 gene locus_tag LOCUS_12140 <3086 1572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9K496:ribonucleoside-diphosphate reductase >Feature sequence242 761 51 gene locus_tag LOCUS_12150 761 51 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267293.1 protein_id gnl|my_center|LOCUS_12150 823 1467 gene locus_tag LOCUS_12160 gene nfuA 823 1467 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_12160 <3082 1499 gene locus_tag LOCUS_12170 <3082 1499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QW19:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence243 1 294 gene locus_tag LOCUS_12180 1 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 357 1316 gene locus_tag LOCUS_12190 gene cysK 357 1316 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_12190 1345 2064 gene locus_tag LOCUS_12200 gene rph 1345 2064 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEJ1 protein_id gnl|my_center|LOCUS_12200 2069 2656 gene locus_tag LOCUS_12210 2069 2656 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHP2 protein_id gnl|my_center|LOCUS_12210 >Feature sequence244 <1 896 gene locus_tag LOCUS_12220 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028216.1:NAD+ synthase 995 1933 gene locus_tag LOCUS_12230 gene sigA 995 1933 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGV1 protein_id gnl|my_center|LOCUS_12230 2053 1958 gene locus_tag LOCUS_t00360 2053 1958 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 3015 2236 gene locus_tag LOCUS_12240 3015 2236 CDS product morphological differentiation-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975378.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence245 <1 611 gene locus_tag LOCUS_12250 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0A529:ATP-dependent Clp protease ATP-binding subunit ClpX 624 1943 gene locus_tag LOCUS_12260 624 1943 CDS product dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028454.1 protein_id gnl|my_center|LOCUS_12260 1988 2395 gene locus_tag LOCUS_12270 gene ndk 1988 2395 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NN43 protein_id gnl|my_center|LOCUS_12270 >Feature sequence246 2689 227 gene locus_tag LOCUS_12280 2689 227 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12280 2834 2907 gene locus_tag LOCUS_t00370 2834 2907 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence247 1196 129 gene locus_tag LOCUS_12290 gene adh 1196 129 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_12290 2401 1223 gene locus_tag LOCUS_12300 gene atoB 2401 1223 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225687.1 protein_id gnl|my_center|LOCUS_12300 <3009 2459 gene locus_tag LOCUS_12310 <3009 2459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229261.1:acyl-CoA dehydrogenase >Feature sequence248 1559 1098 gene locus_tag LOCUS_12320 gene argR 1559 1098 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MB01 protein_id gnl|my_center|LOCUS_12320 2455 1556 gene locus_tag LOCUS_12330 gene arcB 2455 1556 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB17 protein_id gnl|my_center|LOCUS_12330 <2982 2452 gene locus_tag LOCUS_12340 <2982 2452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MAZ9:acetylornithine aminotransferase >Feature sequence249 2049 916 gene locus_tag LOCUS_12350 2049 916 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_12350 <2969 2049 gene locus_tag LOCUS_12360 <2969 2049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707027.1:penicillin-binding protein 2 >Feature sequence250 1027 131 gene locus_tag LOCUS_12370 1027 131 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_12370 912 1883 gene locus_tag LOCUS_12380 912 1883 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 protein_id gnl|my_center|LOCUS_12380 2160 1897 gene locus_tag LOCUS_12390 2160 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 2293 2940 gene locus_tag LOCUS_12400 2293 2940 CDS product precorrin-2 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256584.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence251 1583 762 gene locus_tag LOCUS_12410 gene surE 1583 762 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJX0 protein_id gnl|my_center|LOCUS_12410 <2946 1675 gene locus_tag LOCUS_12420 <2946 1675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941590.1:ABC transporter ATP-binding protein >Feature sequence252 1707 892 gene locus_tag LOCUS_12430 gene cutM 1707 892 CDS product carbon-monoxide dehydrogenase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_12430 <2929 1704 gene locus_tag LOCUS_12440 <2929 1704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223764.1:carbon-monoxide dehydrogenase large subunit >Feature sequence253 38 985 gene locus_tag LOCUS_12450 38 985 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267509.1 protein_id gnl|my_center|LOCUS_12450 1039 1986 gene locus_tag LOCUS_12460 1039 1986 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_12460 2003 2914 gene locus_tag LOCUS_12470 gene rbsK 2003 2914 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCE6 protein_id gnl|my_center|LOCUS_12470 >Feature sequence254 1965 1099 gene locus_tag LOCUS_12480 1965 1099 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence255 <1 1479 gene locus_tag LOCUS_12490 <1 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256433.1:ABC transporter <2904 1493 gene locus_tag LOCUS_12500 <2904 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903648.1:dihydrolipoamide dehydrogenase >Feature sequence256 718 1116 gene locus_tag LOCUS_12510 718 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1137 1568 gene locus_tag LOCUS_12520 1137 1568 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 protein_id gnl|my_center|LOCUS_12520 2585 1596 gene locus_tag LOCUS_12530 gene mdh 2585 1596 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3J3 protein_id gnl|my_center|LOCUS_12530 >Feature sequence257 85 1086 gene locus_tag LOCUS_12540 85 1086 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972697.1 protein_id gnl|my_center|LOCUS_12540 1083 1826 gene locus_tag LOCUS_12550 1083 1826 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975393.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence258 <1 780 gene locus_tag LOCUS_12560 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084029.1:ABC transporter permease 777 1652 gene locus_tag LOCUS_12570 777 1652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970497.1 protein_id gnl|my_center|LOCUS_12570 1652 2500 gene locus_tag LOCUS_12580 1652 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12580 >Feature sequence259 <1 1125 gene locus_tag LOCUS_12590 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729152.1:linalool 8-monooxygenase 2790 1168 gene locus_tag LOCUS_12600 2790 1168 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225847.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence260 1019 135 gene locus_tag LOCUS_12610 1019 135 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814620.1 protein_id gnl|my_center|LOCUS_12610 1975 1040 gene locus_tag LOCUS_12620 1975 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12620 >Feature sequence261 970 1716 gene locus_tag LOCUS_12630 970 1716 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878686.1 protein_id gnl|my_center|LOCUS_12630 <2805 1732 gene locus_tag LOCUS_12640 <2805 1732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIS7:putative K(+)-stimulated pyrophosphate-energized sodium pump >Feature sequence262 <1 795 gene locus_tag LOCUS_12650 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RFW0:peptide chain release factor 1 785 1693 gene locus_tag LOCUS_12660 gene prmC 785 1693 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBM9 protein_id gnl|my_center|LOCUS_12660 1690 2319 gene locus_tag LOCUS_12670 1690 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2329 2769 gene locus_tag LOCUS_12680 2329 2769 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389581.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence263 869 327 gene locus_tag LOCUS_12690 869 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1367 945 gene locus_tag LOCUS_12700 1367 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2587 1364 gene locus_tag LOCUS_12710 2587 1364 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709686.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence264 <1 843 gene locus_tag LOCUS_12720 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225678.1:acyl-CoA dehydrogenase 863 2026 gene locus_tag LOCUS_12730 863 2026 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_12730 2023 2553 gene locus_tag LOCUS_12740 2023 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702792.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence265 <1 996 gene locus_tag LOCUS_12750 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D6F1:glycerol-3-phosphate dehydrogenase 2298 1006 gene locus_tag LOCUS_12760 2298 1006 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383234.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence266 <1 929 gene locus_tag LOCUS_12770 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701360.1:putative short-chain dehydrogenase/reductase 2057 945 gene locus_tag LOCUS_12780 2057 945 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730884.1 protein_id gnl|my_center|LOCUS_12780 <2752 2075 gene locus_tag LOCUS_12790 <2752 2075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003897303.1:acyl-CoA dehydrogenase >Feature sequence267 1617 2516 gene locus_tag LOCUS_12800 gene menB 1617 2516 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHD8 protein_id gnl|my_center|LOCUS_12800 >Feature sequence268 572 2104 gene locus_tag LOCUS_12810 gene pnbA 572 2104 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37967 protein_id gnl|my_center|LOCUS_12810 >Feature sequence269 >Feature sequence270 752 381 gene locus_tag LOCUS_12820 752 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1046 792 gene locus_tag LOCUS_12830 1046 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 2157 1111 gene locus_tag LOCUS_12840 2157 1111 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950930.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence271 1666 137 gene locus_tag LOCUS_12850 1666 137 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_12850 <2679 1663 gene locus_tag LOCUS_12860 <2679 1663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003107053.1:potassium transporter inner membrane associated protein >Feature sequence272 <1 1299 gene locus_tag LOCUS_12870 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGU5:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence273 1578 2264 gene locus_tag LOCUS_12880 1578 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence274 <1 630 gene locus_tag LOCUS_12890 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029150.1:aminotransferase 630 1394 gene locus_tag LOCUS_12900 630 1394 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103550.1 protein_id gnl|my_center|LOCUS_12900 1394 2404 gene locus_tag LOCUS_12910 1394 2404 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031165.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12910 >Feature sequence275 <1 928 gene locus_tag LOCUS_12920 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGY5:aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B 2232 925 gene locus_tag LOCUS_12930 2232 925 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029304.1 protein_id gnl|my_center|LOCUS_12930 2455 2243 gene locus_tag LOCUS_12940 2455 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence276 1927 413 gene locus_tag LOCUS_12950 1927 413 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942949.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence277 311 2443 gene locus_tag LOCUS_12960 311 2443 CDS product N-methylhydantoinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706373.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence278 1035 484 gene locus_tag LOCUS_12970 1035 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2201 996 gene locus_tag LOCUS_12980 2201 996 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228991.1 protein_id gnl|my_center|LOCUS_12980 2570 2271 gene locus_tag LOCUS_12990 2570 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence279 387 1 gene locus_tag LOCUS_tm00010 387 1 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 550 1821 gene locus_tag LOCUS_13000 550 1821 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889381.1 protein_id gnl|my_center|LOCUS_13000 2312 1839 gene locus_tag LOCUS_13010 gene smpB 2312 1839 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228068.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence280 917 24 gene locus_tag LOCUS_13020 917 24 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_13020 1440 922 gene locus_tag LOCUS_13030 1440 922 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_13030 1928 1440 gene locus_tag LOCUS_13040 gene mmyF 1928 1440 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_13040 2040 2411 gene locus_tag LOCUS_13050 2040 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence281 456 1331 gene locus_tag LOCUS_13060 456 1331 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 protein_id gnl|my_center|LOCUS_13060 1328 2182 gene locus_tag LOCUS_13070 1328 2182 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence282 >Feature sequence283 306 590 gene locus_tag LOCUS_13080 306 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1361 777 gene locus_tag LOCUS_13090 1361 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1466 1993 gene locus_tag LOCUS_13100 1466 1993 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931814.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence284 1528 503 gene locus_tag LOCUS_13110 1528 503 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_13110 1575 1961 gene locus_tag LOCUS_13120 1575 1961 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038817.1 protein_id gnl|my_center|LOCUS_13120 <2580 1975 gene locus_tag LOCUS_13130 <2580 1975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223884.1:nitrate ABC transporter permease >Feature sequence285 2030 984 gene locus_tag LOCUS_13140 2030 984 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_13140 2279 2043 gene locus_tag LOCUS_13150 2279 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895208.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence286 47 1522 gene locus_tag LOCUS_13160 47 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1519 2325 gene locus_tag LOCUS_13170 1519 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence287 2550 1312 gene locus_tag LOCUS_13180 2550 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence288 1642 428 gene locus_tag LOCUS_13190 1642 428 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_13190 <2526 1718 gene locus_tag LOCUS_13200 <2526 1718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015415.1:peptidase >Feature sequence289 473 1540 gene locus_tag LOCUS_13210 gene pimA 473 1540 CDS product phosphatidyl-myo-inositol mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07147 protein_id gnl|my_center|LOCUS_13210 1646 2371 gene locus_tag LOCUS_13220 1646 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence290 469 1413 gene locus_tag LOCUS_13230 469 1413 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706670.1 protein_id gnl|my_center|LOCUS_13230 1424 1591 gene locus_tag LOCUS_13240 1424 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1588 2379 gene locus_tag LOCUS_13250 1588 2379 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142000.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence291 366 698 gene locus_tag LOCUS_13260 366 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 822 1256 gene locus_tag LOCUS_13270 gene fabZ 822 1256 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLY7 protein_id gnl|my_center|LOCUS_13270 2439 1267 gene locus_tag LOCUS_13280 gene fabF 2439 1267 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67612 protein_id gnl|my_center|LOCUS_13280 >Feature sequence292 254 685 gene locus_tag LOCUS_13290 254 685 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224891.1 protein_id gnl|my_center|LOCUS_13290 787 1767 gene locus_tag LOCUS_13300 gene trpS1 787 1767 CDS product tryptophan--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJX0 protein_id gnl|my_center|LOCUS_13300 2317 1793 gene locus_tag LOCUS_13310 2317 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence293 <1 1458 gene locus_tag LOCUS_13320 <1 1458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D0M8:UPF0182 protein 1902 1504 gene locus_tag LOCUS_13330 1902 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence294 515 775 gene locus_tag LOCUS_13340 515 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 824 1417 gene locus_tag LOCUS_13350 824 1417 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_13350 1931 1440 gene locus_tag LOCUS_13360 1931 1440 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973393.1 protein_id gnl|my_center|LOCUS_13360 2419 1964 gene locus_tag LOCUS_13370 2419 1964 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015007.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence295 <1 1853 gene locus_tag LOCUS_13380 <1 1853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DC86:UvrABC system protein A >Feature sequence296 748 984 gene locus_tag LOCUS_13390 748 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1660 1001 gene locus_tag LOCUS_13400 1660 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 <2465 1783 gene locus_tag LOCUS_13410 <2465 1783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583949.1:tRNA (adenine-N1)-methyltransferase >Feature sequence297 1595 891 gene locus_tag LOCUS_13420 1595 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082974.1 protein_id gnl|my_center|LOCUS_13420 1713 2231 gene locus_tag LOCUS_13430 1713 2231 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730387.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence298 565 1539 gene locus_tag LOCUS_13440 gene mer 565 1539 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence299 <1 1122 gene locus_tag LOCUS_13450 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258124.1:ABC transporter ATP-binding protein 1122 2144 gene locus_tag LOCUS_13460 1122 2144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence300 <1 771 gene locus_tag LOCUS_13470 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775991.1:glycine cleavage system protein T 890 1948 gene locus_tag LOCUS_13480 890 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_13480 1967 2260 gene locus_tag LOCUS_13490 1967 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence301 <1 624 gene locus_tag LOCUS_13500 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229260.1:dihydrodipicolinate reductase 646 1650 gene locus_tag LOCUS_13510 646 1650 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337253.1 protein_id gnl|my_center|LOCUS_13510 <2418 1683 gene locus_tag LOCUS_13520 <2418 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705205.1:putative phosphotransferase >Feature sequence302 1444 371 gene locus_tag LOCUS_13530 1444 371 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_13530 1548 2369 gene locus_tag LOCUS_13540 1548 2369 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804409.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence303 <1 1209 gene locus_tag LOCUS_13550 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CW71:D-inositol-3-phosphate glycosyltransferase 1213 1701 gene locus_tag LOCUS_13560 1213 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence304 1007 750 gene locus_tag LOCUS_13570 1007 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1551 1030 gene locus_tag LOCUS_13580 gene sepF 1551 1030 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK63 protein_id gnl|my_center|LOCUS_13580 2331 1654 gene locus_tag LOCUS_13590 2331 1654 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870007.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence305 816 1562 gene locus_tag LOCUS_13600 816 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1634 2056 gene locus_tag LOCUS_13610 1634 2056 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222322.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence306 461 1159 gene locus_tag LOCUS_13620 461 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1501 1280 gene locus_tag LOCUS_13630 1501 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1807 1523 gene locus_tag LOCUS_13640 1807 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 2337 1804 gene locus_tag LOCUS_13650 2337 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence307 523 212 gene locus_tag LOCUS_13660 523 212 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_13660 1770 520 gene locus_tag LOCUS_13670 1770 520 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_13670 2168 1932 gene locus_tag LOCUS_13680 2168 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence308 1259 261 gene locus_tag LOCUS_13690 gene hmd 1259 261 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228421.1 protein_id gnl|my_center|LOCUS_13690 2362 1280 gene locus_tag LOCUS_13700 2362 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence309 222 1046 gene locus_tag LOCUS_13710 222 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1839 1639 gene locus_tag LOCUS_13720 gene cspLB 1839 1639 CDS product cold shock-like protein CspLB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A357 protein_id gnl|my_center|LOCUS_13720 >Feature sequence310 523 206 gene locus_tag LOCUS_13730 523 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1589 753 gene locus_tag LOCUS_13740 1589 753 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 protein_id gnl|my_center|LOCUS_13740 1979 1641 gene locus_tag LOCUS_13750 gene glnB 1979 1641 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64250 protein_id gnl|my_center|LOCUS_13750 2050 2205 gene locus_tag LOCUS_13760 2050 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence311 30 482 gene locus_tag LOCUS_13770 gene rimP 30 482 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJM9 protein_id gnl|my_center|LOCUS_13770 479 1639 gene locus_tag LOCUS_13780 479 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence312 <1 1575 gene locus_tag LOCUS_13790 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D1V7:acetolactate synthase 1572 2084 gene locus_tag LOCUS_13800 gene ilvH 1572 2084 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054813.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence313 <1 1769 gene locus_tag LOCUS_13810 <1 1769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P52560:GTP pyrophosphokinase >Feature sequence314 1349 414 gene locus_tag LOCUS_13820 1349 414 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MIN3 protein_id gnl|my_center|LOCUS_13820 1419 2189 gene locus_tag LOCUS_13830 1419 2189 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence315 842 1165 gene locus_tag LOCUS_13840 842 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_13840 2063 1182 gene locus_tag LOCUS_13850 2063 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence316 2248 254 gene locus_tag LOCUS_13860 2248 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730584.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence317 1409 462 gene locus_tag LOCUS_13870 1409 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2031 1441 gene locus_tag LOCUS_13880 2031 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence318 1746 82 gene locus_tag LOCUS_13890 1746 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence319 840 1517 gene locus_tag LOCUS_13900 840 1517 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728638.1 protein_id gnl|my_center|LOCUS_13900 1908 1588 gene locus_tag LOCUS_13910 1908 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence320 860 2230 gene locus_tag LOCUS_13920 860 2230 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803953.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence321 630 1010 gene locus_tag LOCUS_13930 630 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1013 1828 gene locus_tag LOCUS_13940 1013 1828 CDS product inositol phosphorylceramide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028214.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence322 58 825 gene locus_tag LOCUS_13950 58 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1130 777 gene locus_tag LOCUS_13960 1130 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 <2278 1182 gene locus_tag LOCUS_13970 <2278 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXE3:FAD-dependent catabolic D-arginine dehydrogenase DauA >Feature sequence323 <2254 195 gene locus_tag LOCUS_13980 <2254 195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P9X0:alanine--tRNA ligase >Feature sequence324 445 2085 gene locus_tag LOCUS_13990 445 2085 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence325 3 530 gene locus_tag LOCUS_14000 3 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1393 488 gene locus_tag LOCUS_14010 1393 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence326 1288 542 gene locus_tag LOCUS_14020 gene tatC 1288 542 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MAJ8 protein_id gnl|my_center|LOCUS_14020 1612 1319 gene locus_tag LOCUS_14030 1612 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence327 <1 1581 gene locus_tag LOCUS_14040 <1 1581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CV04:DNA-directed RNA polymerase subunit beta' 1709 2080 gene locus_tag LOCUS_14050 gene rpsL 1709 2080 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4A3 protein_id gnl|my_center|LOCUS_14050 >Feature sequence328 72 638 gene locus_tag LOCUS_14060 gene pyrR 72 638 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDU6 protein_id gnl|my_center|LOCUS_14060 635 1609 gene locus_tag LOCUS_14070 gene pyrB 635 1609 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXR2 protein_id gnl|my_center|LOCUS_14070 >Feature sequence329 696 274 gene locus_tag LOCUS_14080 696 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 970 710 gene locus_tag LOCUS_14090 970 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1128 2159 gene locus_tag LOCUS_14100 1128 2159 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence330 306 1073 gene locus_tag LOCUS_14110 306 1073 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_14110 1070 2044 gene locus_tag LOCUS_14120 1070 2044 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence331 766 341 gene locus_tag LOCUS_14130 766 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1006 1248 gene locus_tag LOCUS_14140 1006 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1655 1362 gene locus_tag LOCUS_14150 1655 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1937 1743 gene locus_tag LOCUS_14160 1937 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence332 >Feature sequence333 123 785 gene locus_tag LOCUS_14170 gene coaE 123 785 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58897 protein_id gnl|my_center|LOCUS_14170 >Feature sequence334 1493 393 gene locus_tag LOCUS_14180 1493 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1963 1490 gene locus_tag LOCUS_14190 1963 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence335 <1 624 gene locus_tag LOCUS_14200 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QYP9:GTPase Der 679 1785 gene locus_tag LOCUS_14210 679 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1807 2019 gene locus_tag LOCUS_14220 1807 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2065 2140 gene locus_tag LOCUS_t00380 2065 2140 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence336 1159 1560 gene locus_tag LOCUS_14230 1159 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 <2144 1576 gene locus_tag LOCUS_14240 <2144 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q88U24:phosphoribosylformylglycinamidine synthase subunit PurQ >Feature sequence337 1106 27 gene locus_tag LOCUS_14250 gene ftsZ 1106 27 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45500 protein_id gnl|my_center|LOCUS_14250 2042 1350 gene locus_tag LOCUS_14260 2042 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence338 1372 131 gene locus_tag LOCUS_14270 gene obg 1372 131 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ8 protein_id gnl|my_center|LOCUS_14270 1782 1528 gene locus_tag LOCUS_14280 gene rpmA 1782 1528 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCJ5 protein_id gnl|my_center|LOCUS_14280 >Feature sequence339 >Feature sequence340 <1 837 gene locus_tag LOCUS_14290 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WNX3:D-3-phosphoglycerate dehydrogenase 899 1468 gene locus_tag LOCUS_14300 899 1468 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_14300 <2120 1494 gene locus_tag LOCUS_14310 <2120 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728241.1:amidohydrolase >Feature sequence341 581 15 gene locus_tag LOCUS_14320 581 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 668 1132 gene locus_tag LOCUS_14330 668 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226024.1 protein_id gnl|my_center|LOCUS_14330 1142 1774 gene locus_tag LOCUS_14340 1142 1774 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528866.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence342 >Feature sequence343 <1 940 gene locus_tag LOCUS_14350 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229001.1:MFS transporter >Feature sequence344 159 1409 gene locus_tag LOCUS_14360 gene nfeD 159 1409 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975947.1 protein_id gnl|my_center|LOCUS_14360 1522 1782 gene locus_tag LOCUS_14370 1522 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence345 493 1761 gene locus_tag LOCUS_14380 gene gdhA 493 1761 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96110 protein_id gnl|my_center|LOCUS_14380 >Feature sequence346 947 153 gene locus_tag LOCUS_14390 947 153 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D7T0 protein_id gnl|my_center|LOCUS_14390 >Feature sequence347 >Feature sequence348 1371 19 gene locus_tag LOCUS_14400 1371 19 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888403.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence349 1875 346 gene locus_tag LOCUS_14410 1875 346 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence350 <1 798 gene locus_tag LOCUS_14420 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228339.1:phenylacetate-CoA oxygenase subunit PaaA 825 1274 gene locus_tag LOCUS_14430 825 1274 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889009.1 protein_id gnl|my_center|LOCUS_14430 1278 1553 gene locus_tag LOCUS_14440 1278 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence351 67 687 gene locus_tag LOCUS_14450 67 687 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229194.1 protein_id gnl|my_center|LOCUS_14450 1919 702 gene locus_tag LOCUS_14460 gene lldD 1919 702 CDS product putative L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WND5 protein_id gnl|my_center|LOCUS_14460 >Feature sequence352 <1 1011 gene locus_tag LOCUS_14470 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004534727.1:acetylornithine deacetylase 1182 1027 gene locus_tag LOCUS_14480 1182 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1536 1324 gene locus_tag LOCUS_14490 1536 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1535 1822 gene locus_tag LOCUS_14500 1535 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence353 1967 558 gene locus_tag LOCUS_14510 1967 558 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640158.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence354 1279 479 gene locus_tag LOCUS_14520 gene caiD 1279 479 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59395 protein_id gnl|my_center|LOCUS_14520 <2009 1299 gene locus_tag LOCUS_14530 <2009 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976306.1:acyl-CoA synthetase >Feature sequence355 1354 446 gene locus_tag LOCUS_14540 1354 446 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405405.1 protein_id gnl|my_center|LOCUS_14540 1764 1354 gene locus_tag LOCUS_14550 1764 1354 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223132.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence356 402 1307 gene locus_tag LOCUS_14560 402 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence357 688 458 gene locus_tag LOCUS_14570 688 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1851 712 gene locus_tag LOCUS_14580 gene mrp 1851 712 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX37 protein_id gnl|my_center|LOCUS_14580 >Feature sequence358 1782 646 gene locus_tag LOCUS_14590 1782 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14590 >Feature sequence359 876 211 gene locus_tag LOCUS_14600 876 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 <1974 905 gene locus_tag LOCUS_14610 <1974 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000609761.1:sodium:phosphate symporter >Feature sequence360 96 1958 gene locus_tag LOCUS_14620 gene uvrC 96 1958 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MC92 protein_id gnl|my_center|LOCUS_14620 >Feature sequence361 1673 951 gene locus_tag LOCUS_14630 1673 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence362 337 143 gene locus_tag LOCUS_14640 gene rpmI 337 143 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6L6 protein_id gnl|my_center|LOCUS_14640 1034 387 gene locus_tag LOCUS_14650 1034 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1424 1834 gene locus_tag LOCUS_14660 1424 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence363 1060 1746 gene locus_tag LOCUS_14670 1060 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence364 >Feature sequence365 1015 539 gene locus_tag LOCUS_14680 1015 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1542 1012 gene locus_tag LOCUS_14690 1542 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702792.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence366 377 667 gene locus_tag LOCUS_14700 377 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 <1937 705 gene locus_tag LOCUS_14710 <1937 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257464.1:MFS transporter >Feature sequence367 281 565 gene locus_tag LOCUS_14720 281 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 596 668 gene locus_tag LOCUS_t00390 596 668 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence368 1052 306 gene locus_tag LOCUS_14730 1052 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1357 1166 gene locus_tag LOCUS_14740 1357 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1813 1412 gene locus_tag LOCUS_14750 1813 1412 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729021.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence369 1064 123 gene locus_tag LOCUS_14760 gene rsmH 1064 123 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK87 protein_id gnl|my_center|LOCUS_14760 1705 1289 gene locus_tag LOCUS_14770 gene mraZ 1705 1289 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MP28 protein_id gnl|my_center|LOCUS_14770 >Feature sequence370 1262 540 gene locus_tag LOCUS_14780 1262 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 <1917 1334 gene locus_tag LOCUS_14790 <1917 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001219926.1:antibiotic ABC transporter permease >Feature sequence371 >Feature sequence372 >Feature sequence373 787 1353 gene locus_tag LOCUS_14800 gene dcd 787 1353 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQ98 protein_id gnl|my_center|LOCUS_14800 <1907 1350 gene locus_tag LOCUS_14810 <1907 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029156.1:Fe-S oxidoreductase >Feature sequence374 1901 1665 gene locus_tag LOCUS_14820 1901 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence375 1649 1203 gene locus_tag LOCUS_14830 gene rplI 1649 1203 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM68 protein_id gnl|my_center|LOCUS_14830 >Feature sequence376 >Feature sequence377 80 6 gene locus_tag LOCUS_t00400 80 6 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 713 120 gene locus_tag LOCUS_14840 713 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 <1862 754 gene locus_tag LOCUS_14850 <1862 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DAF0:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence378 1810 479 gene locus_tag LOCUS_14860 1810 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702368.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence379 1537 479 gene locus_tag LOCUS_14870 gene dapE 1537 479 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2G4 protein_id gnl|my_center|LOCUS_14870 >Feature sequence380 <1 773 gene locus_tag LOCUS_14880 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943778.1:alpha/beta hydrolase 1264 845 gene locus_tag LOCUS_14890 1264 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence381 1402 698 gene locus_tag LOCUS_14900 gene modA 1402 698 CDS product molybdate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 protein_id gnl|my_center|LOCUS_14900 1804 1412 gene locus_tag LOCUS_14910 1804 1412 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230241.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence382 <1 1626 gene locus_tag LOCUS_14920 <1 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919198.1:fatty acid--CoA ligase 1763 1689 gene locus_tag LOCUS_t00410 1763 1689 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence383 <1837 491 gene locus_tag LOCUS_14930 <1837 491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RFU8:CTP synthase >Feature sequence384 1402 1112 gene locus_tag LOCUS_14940 1402 1112 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence385 >Feature sequence386 2 487 gene locus_tag LOCUS_14950 2 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 510 767 gene locus_tag LOCUS_14960 510 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 820 1602 gene locus_tag LOCUS_14970 820 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence387 21 326 gene locus_tag LOCUS_14980 21 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 526 696 gene locus_tag LOCUS_14990 526 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 781 1197 gene locus_tag LOCUS_15000 781 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1383 1715 gene locus_tag LOCUS_15010 1383 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence388 1416 157 gene locus_tag LOCUS_15020 gene hemA 1416 157 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ25 protein_id gnl|my_center|LOCUS_15020 >Feature sequence389 >Feature sequence390 748 467 gene locus_tag LOCUS_15030 748 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391319.1 protein_id gnl|my_center|LOCUS_15030 861 1703 gene locus_tag LOCUS_15040 861 1703 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence391 >Feature sequence392 1040 195 gene locus_tag LOCUS_15050 gene rmlD 1040 195 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTF8 protein_id gnl|my_center|LOCUS_15050 <1792 1037 gene locus_tag LOCUS_15060 <1792 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CXP4:dTDP-glucose 4,6-dehydratase >Feature sequence393 198 1112 gene locus_tag LOCUS_15070 gene ilvE2 198 1112 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence394 >Feature sequence395 1773 832 gene locus_tag LOCUS_15080 1773 832 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence396 <1 877 gene locus_tag LOCUS_15090 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392412.1:peptidase ClpP >Feature sequence397 1485 385 gene locus_tag LOCUS_15100 gene secF 1485 385 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53956 protein_id gnl|my_center|LOCUS_15100 >Feature sequence398 <1 669 gene locus_tag LOCUS_15110 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224557.1:LLM class F420-dependent oxidoreductase 797 988 gene locus_tag LOCUS_15120 797 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1618 1019 gene locus_tag LOCUS_15130 1618 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence399 >Feature sequence400 <1751 951 gene locus_tag LOCUS_15140 <1751 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081573.1:spermidine/putrescine ABC transporter substrate-binding protein >Feature sequence401 1458 79 gene locus_tag LOCUS_15150 gene argH 1458 79 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG68 protein_id gnl|my_center|LOCUS_15150 >Feature sequence402 217 68 gene locus_tag LOCUS_15160 217 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 <1745 282 gene locus_tag LOCUS_15170 <1745 282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086717.1:propionyl-CoA carboxylase subunit beta >Feature sequence403 <1745 632 gene locus_tag LOCUS_15180 <1745 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256433.1:ABC transporter >Feature sequence404 1219 185 gene locus_tag LOCUS_15190 1219 185 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence405 1199 456 gene locus_tag LOCUS_15200 1199 456 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968528.1 protein_id gnl|my_center|LOCUS_15200 <1734 1207 gene locus_tag LOCUS_15210 <1734 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728081.1:fumarylacetoacetate hydrolase >Feature sequence406 256 714 gene locus_tag LOCUS_15220 256 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 <1729 821 gene locus_tag LOCUS_15230 <1729 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K0MIU5:glycerol kinase >Feature sequence407 1271 60 gene locus_tag LOCUS_15240 1271 60 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089770.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence408 <1722 791 gene locus_tag LOCUS_15250 <1722 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WB45:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase >Feature sequence409 721 1128 gene locus_tag LOCUS_15260 721 1128 CDS product similarity with Glyoxalase/Bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705435.1 protein_id gnl|my_center|LOCUS_15260 1297 1139 gene locus_tag LOCUS_15270 1297 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence410 687 250 gene locus_tag LOCUS_15280 gene dtd 687 250 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4F6 protein_id gnl|my_center|LOCUS_15280 >Feature sequence411 <1705 992 gene locus_tag LOCUS_15290 <1705 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D2T0:dihydroorotase >Feature sequence412 1452 1012 gene locus_tag LOCUS_15300 1452 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701975.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence413 315 1220 gene locus_tag LOCUS_15310 315 1220 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897193.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence414 2 232 gene locus_tag LOCUS_15320 2 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1688 249 gene locus_tag LOCUS_15330 1688 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence415 1262 450 gene locus_tag LOCUS_15340 gene paaG 1262 450 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228963.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence416 770 33 gene locus_tag LOCUS_15350 770 33 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_15350 <1664 774 gene locus_tag LOCUS_15360 <1664 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WG00:riboflavin biosynthesis protein >Feature sequence417 <1 933 gene locus_tag LOCUS_15370 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P56833:phospho-N-acetylmuramoyl-pentapeptide-transferase >Feature sequence418 >Feature sequence419 >Feature sequence420 <1 654 gene locus_tag LOCUS_15380 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027606.1:aminodeoxychorismate lyase 647 1537 gene locus_tag LOCUS_15390 gene aroE 647 1537 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI72 protein_id gnl|my_center|LOCUS_15390 >Feature sequence421 <1 588 gene locus_tag LOCUS_15400 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q831V1:uridylate kinase 602 1171 gene locus_tag LOCUS_15410 gene frr 602 1171 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P81101 protein_id gnl|my_center|LOCUS_15410 >Feature sequence422 761 90 gene locus_tag LOCUS_15420 761 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1284 790 gene locus_tag LOCUS_15430 1284 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence423 133 1497 gene locus_tag LOCUS_15440 133 1497 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence424 >Feature sequence425 <1 828 gene locus_tag LOCUS_15450 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085362.1:N-carbamoyl-D-amino-acid hydrolase >Feature sequence426 1048 827 gene locus_tag LOCUS_15460 1048 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1594 1124 gene locus_tag LOCUS_15470 1594 1124 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975651.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence427 828 1598 gene locus_tag LOCUS_15480 gene ptr1 828 1598 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence428 >Feature sequence429 <1616 795 gene locus_tag LOCUS_15490 <1616 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8NQQ7:UvrABC system protein B >Feature sequence430 >Feature sequence431 >Feature sequence432 1395 391 gene locus_tag LOCUS_15500 gene rifG 1395 391 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWY6 protein_id gnl|my_center|LOCUS_15500 >Feature sequence433 1010 90 gene locus_tag LOCUS_15510 1010 90 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence434 1 681 gene locus_tag LOCUS_15520 gene paaG 1 681 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_15520 1376 693 gene locus_tag LOCUS_15530 1376 693 CDS product putative 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD41 protein_id gnl|my_center|LOCUS_15530 >Feature sequence435 942 616 gene locus_tag LOCUS_15540 942 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 <1554 1039 gene locus_tag LOCUS_15550 <1554 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B9R5:guanylate kinase >Feature sequence436 >Feature sequence437 <1 579 gene locus_tag LOCUS_15560 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392361.1:cell division protein FtsW >Feature sequence438 >Feature sequence439 1 705 gene locus_tag LOCUS_15570 1 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 <1532 741 gene locus_tag LOCUS_15580 <1532 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIS6:ketol-acid reductoisomerase (NADP(+)) >Feature sequence440 <1522 683 gene locus_tag LOCUS_15590 <1522 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023637.1:5,10-methylenetetrahydromethanopterin reductase >Feature sequence441 <1521 541 gene locus_tag LOCUS_15600 <1521 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D3M4:isoleucine--tRNA ligase >Feature sequence442 >Feature sequence443 276 815 gene locus_tag LOCUS_15610 276 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence444 1330 536 gene locus_tag LOCUS_15620 gene lgt1 1330 536 CDS product prolipoprotein diacylglyceryl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2U8 protein_id gnl|my_center|LOCUS_15620 >Feature sequence445 125 373 gene locus_tag LOCUS_15630 125 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 380 904 gene locus_tag LOCUS_15640 gene rimM 380 904 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q833P4 protein_id gnl|my_center|LOCUS_15640 >Feature sequence446 <1 640 gene locus_tag LOCUS_15650 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973732.1:histidine kinase 637 1335 gene locus_tag LOCUS_15660 637 1335 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887187.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence447 >Feature sequence448 123 1151 gene locus_tag LOCUS_15670 123 1151 CDS product chloromuconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289275.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence449 <1486 617 gene locus_tag LOCUS_15680 <1486 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MCI0:histidine--tRNA ligase >Feature sequence450 <1476 296 gene locus_tag LOCUS_15690 <1476 296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974131.1:ectoine hydrolase DoeA >Feature sequence451 <1 940 gene locus_tag LOCUS_15700 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KZM1:adenosylhomocysteinase >Feature sequence452 >Feature sequence453 <1453 476 gene locus_tag LOCUS_15710 <1453 476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DEU0:dihydroxy-acid dehydratase >Feature sequence454 >Feature sequence455 >Feature sequence456 990 475 gene locus_tag LOCUS_15720 990 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence457 <1 987 gene locus_tag LOCUS_15730 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229312.1:(2Fe-2S) ferredoxin >Feature sequence458 1123 365 gene locus_tag LOCUS_15740 1123 365 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537900.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence459 <1438 83 gene locus_tag LOCUS_15750 <1438 83 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896012.1:ammonium transporter >Feature sequence460 97 456 gene locus_tag LOCUS_15760 97 456 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZQ4 protein_id gnl|my_center|LOCUS_15760 510 881 gene locus_tag LOCUS_15770 510 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence461 <1 594 gene locus_tag LOCUS_15780 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9X908:dTMP kinase >Feature sequence462 934 122 gene locus_tag LOCUS_15790 gene tesB 934 122 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence463 <1415 747 gene locus_tag LOCUS_15800 <1415 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QTI1:selenide, water dikinase >Feature sequence464 >Feature sequence465 <1 654 gene locus_tag LOCUS_15810 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9K4C3:endonuclease NucS >Feature sequence466 955 452 gene locus_tag LOCUS_15820 955 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15820 >Feature sequence467 >Feature sequence468 >Feature sequence469 <1 612 gene locus_tag LOCUS_15830 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RG64:acetylglutamate kinase >Feature sequence470 <1376 178 gene locus_tag LOCUS_15840 <1376 178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118806.1:arylsulfatase >Feature sequence471 381 1148 gene locus_tag LOCUS_15850 381 1148 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence472 <1366 278 gene locus_tag LOCUS_15860 <1366 278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222574.1:luciferase >Feature sequence473 >Feature sequence474 83 430 gene locus_tag LOCUS_15870 83 430 CDS product putative anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1F5 protein_id gnl|my_center|LOCUS_15870 >Feature sequence475 936 334 gene locus_tag LOCUS_15880 936 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence476 <1 1077 gene locus_tag LOCUS_15890 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256492.1:amidase >Feature sequence477 >Feature sequence478 <1335 559 gene locus_tag LOCUS_15900 <1335 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392412.1:peptidase ClpP >Feature sequence479 >Feature sequence480 >Feature sequence481 >Feature sequence482 >Feature sequence483 1243 797 gene locus_tag LOCUS_15910 1243 797 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728059.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence484 466 930 gene locus_tag LOCUS_15920 466 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence485 <1321 593 gene locus_tag LOCUS_15930 <1321 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009873435.1:serine protease >Feature sequence486 <1320 185 gene locus_tag LOCUS_15940 <1320 185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898921.1:monooxygenase >Feature sequence487 >Feature sequence488 >Feature sequence489 >Feature sequence490 <1300 153 gene locus_tag LOCUS_15950 <1300 153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257128.1:thioredoxin domain-containing protein >Feature sequence491 1104 301 gene locus_tag LOCUS_15960 1104 301 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530480.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence492 >Feature sequence493 51 479 gene locus_tag LOCUS_15970 51 479 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383881.1 protein_id gnl|my_center|LOCUS_15970 490 1035 gene locus_tag LOCUS_15980 490 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886848.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence494 >Feature sequence495 291 761 gene locus_tag LOCUS_15990 gene rpsG 291 761 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WH29 protein_id gnl|my_center|LOCUS_15990 >Feature sequence496 >Feature sequence497 734 1270 gene locus_tag LOCUS_16000 734 1270 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence498 >Feature sequence499 >Feature sequence500 <1 961 gene locus_tag LOCUS_16010 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256961.1:beta-glucosidase >Feature sequence501 >Feature sequence502 >Feature sequence503 703 203 gene locus_tag LOCUS_16020 703 203 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223824.1 protein_id gnl|my_center|LOCUS_16020 <1240 700 gene locus_tag LOCUS_16030 <1240 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223825.1:O-acetylhomoserine (thiol)-lyase >Feature sequence504 <1235 383 gene locus_tag LOCUS_16040 <1235 383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030077.1:succinyldiaminopimelate transaminase >Feature sequence505 >Feature sequence506 <1 726 gene locus_tag LOCUS_16050 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532911.1:aminomethyltransferase >Feature sequence507 >Feature sequence508 1 1038 gene locus_tag LOCUS_16060 1 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence509 <1 849 gene locus_tag LOCUS_16070 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265923.1:serine hydrolase >Feature sequence510 255 58 gene locus_tag LOCUS_16080 255 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 547 248 gene locus_tag LOCUS_16090 547 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence511 1149 28 gene locus_tag LOCUS_16100 1149 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence512 51 1040 gene locus_tag LOCUS_16110 51 1040 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776595.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence513 >Feature sequence514 >Feature sequence515 >Feature sequence516 106 897 gene locus_tag LOCUS_16120 gene tsf 106 897 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RU80 protein_id gnl|my_center|LOCUS_16120 >Feature sequence517 977 228 gene locus_tag LOCUS_16130 977 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence518 >Feature sequence519 >Feature sequence520 >Feature sequence521 <1 666 gene locus_tag LOCUS_16140 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977406.1:glycerophosphoryl diester phosphodiesterase >Feature sequence522 >Feature sequence523 >Feature sequence524 299 904 gene locus_tag LOCUS_16150 299 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence525 >Feature sequence526 1090 506 gene locus_tag LOCUS_16160 1090 506 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F82 protein_id gnl|my_center|LOCUS_16160 >Feature sequence527 >Feature sequence528 876 250 gene locus_tag LOCUS_16170 876 250 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730864.1 protein_id gnl|my_center|LOCUS_16170 1136 867 gene locus_tag LOCUS_16180 1136 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence529 >Feature sequence530 >Feature sequence531 >Feature sequence532 1050 1126 gene locus_tag LOCUS_t00420 1050 1126 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence533 >Feature sequence534 <1 943 gene locus_tag LOCUS_16190 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765451.1:alginate O-acetyltransferase >Feature sequence535 63 638 gene locus_tag LOCUS_16200 63 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence536 >Feature sequence537 819 424 gene locus_tag LOCUS_16210 819 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704310.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence538 >Feature sequence539 <1 522 gene locus_tag LOCUS_16220 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535190.1:potassium channel subunit 782 558 gene locus_tag LOCUS_16230 gene secG 782 558 CDS product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z469 protein_id gnl|my_center|LOCUS_16230 >Feature sequence540 >Feature sequence541 >Feature sequence542 <1094 75 gene locus_tag LOCUS_16240 <1094 75 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228941.1:amidohydrolase >Feature sequence543 >Feature sequence544 <1 996 gene locus_tag LOCUS_16250 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WJ72:GDP-mannose 4,6-dehydratase >Feature sequence545 >Feature sequence546 >Feature sequence547 664 287 gene locus_tag LOCUS_16260 664 287 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974697.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence548 <1 842 gene locus_tag LOCUS_16270 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938366.1:BMP family ABC transporter substrate-binding protein >Feature sequence549 <1071 96 gene locus_tag LOCUS_16280 <1071 96 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974981.1:prephenate dehydratase >Feature sequence550 >Feature sequence551 >Feature sequence552 <1060 449 gene locus_tag LOCUS_16290 <1060 449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730228.1:adenylyl-sulfate kinase note possible pseudo, internal stop codon, frameshifted >Feature sequence553 >Feature sequence554 <1057 146 gene locus_tag LOCUS_16300 <1057 146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775856.1:ribonuclease E >Feature sequence555 >Feature sequence556 >Feature sequence557 781 278 gene locus_tag LOCUS_16310 781 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence558 1042 404 gene locus_tag LOCUS_16320 gene tdk 1042 404 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50519 protein_id gnl|my_center|LOCUS_16320 >Feature sequence559 542 174 gene locus_tag LOCUS_16330 542 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1042 590 gene locus_tag LOCUS_16340 1042 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence560 220 642 gene locus_tag LOCUS_16350 220 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence561 >Feature sequence562 861 346 gene locus_tag LOCUS_16360 861 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1034 858 gene locus_tag LOCUS_16370 1034 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence563 >Feature sequence564 >Feature sequence565 <1 543 gene locus_tag LOCUS_16380 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MC96:NAD kinase >Feature sequence566 >Feature sequence567 6 1001 gene locus_tag LOCUS_16390 6 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence568 614 462 gene locus_tag LOCUS_16400 614 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 834 607 gene locus_tag LOCUS_16410 834 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence569 >Feature sequence570 <1 667 gene locus_tag LOCUS_16420 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086677.1:arylsulfatase >Feature sequence571 >Feature sequence572 >Feature sequence573 >Feature sequence574 1005 673 gene locus_tag LOCUS_16430 1005 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430