>Feature sequence1 1392 160 gene locus_tag LOCUS_00010 1392 160 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_00010 1498 2631 gene locus_tag LOCUS_00020 1498 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_00020 2624 3070 gene locus_tag LOCUS_00030 2624 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3689 3192 gene locus_tag LOCUS_00040 3689 3192 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_00040 3780 4520 gene locus_tag LOCUS_00050 3780 4520 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_00050 5289 4657 gene locus_tag LOCUS_00060 gene queE 5289 4657 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_00060 5412 5771 gene locus_tag LOCUS_00070 5412 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7139 5796 gene locus_tag LOCUS_00080 gene kmo 7139 5796 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_00080 7820 7248 gene locus_tag LOCUS_00090 7820 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8972 7887 gene locus_tag LOCUS_00100 gene speB 8972 7887 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_00100 10373 9093 gene locus_tag LOCUS_00110 gene kynU 10373 9093 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_00110 11544 10495 gene locus_tag LOCUS_00120 gene queA 11544 10495 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_00120 12936 11677 gene locus_tag LOCUS_00130 gene aroA 12936 11677 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW83 protein_id gnl|my_center|LOCUS_00130 13265 12939 gene locus_tag LOCUS_00140 13265 12939 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_00140 13717 13265 gene locus_tag LOCUS_00150 gene dtd 13717 13265 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 protein_id gnl|my_center|LOCUS_00150 14703 13720 gene locus_tag LOCUS_00160 gene rsgA 14703 13720 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 protein_id gnl|my_center|LOCUS_00160 15800 14718 gene locus_tag LOCUS_00170 15800 14718 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_00170 16661 15837 gene locus_tag LOCUS_00180 gene pheA 16661 15837 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_00180 16901 17800 gene locus_tag LOCUS_00190 gene gldA 16901 17800 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_00190 18244 17852 gene locus_tag LOCUS_00200 18244 17852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19559 18603 gene locus_tag LOCUS_00210 19559 18603 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU8 protein_id gnl|my_center|LOCUS_00210 22303 19634 gene locus_tag LOCUS_00220 22303 19634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23421 22432 gene locus_tag LOCUS_00230 23421 22432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24892 23720 gene locus_tag LOCUS_00240 gene metZ 24892 23720 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI7 protein_id gnl|my_center|LOCUS_00240 27308 24894 gene locus_tag LOCUS_00250 gene thrA 27308 24894 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_00250 28278 27316 gene locus_tag LOCUS_00260 gene metX 28278 27316 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW98 protein_id gnl|my_center|LOCUS_00260 28791 30077 gene locus_tag LOCUS_00270 gene metK 28791 30077 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_00270 32932 30176 gene locus_tag LOCUS_00280 32932 30176 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_00280 33828 32932 gene locus_tag LOCUS_00290 33828 32932 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_00290 33951 34739 gene locus_tag LOCUS_00300 33951 34739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962437.1 protein_id gnl|my_center|LOCUS_00300 34739 35353 gene locus_tag LOCUS_00310 34739 35353 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_00310 35429 36019 gene locus_tag LOCUS_00320 35429 36019 CDS product fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121856.1 protein_id gnl|my_center|LOCUS_00320 36560 36054 gene locus_tag LOCUS_00330 36560 36054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36689 37399 gene locus_tag LOCUS_00340 gene nucA 36689 37399 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_00340 38656 37400 gene locus_tag LOCUS_00350 gene rodA 38656 37400 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_00350 40585 38657 gene locus_tag LOCUS_00360 gene pbpA 40585 38657 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_00360 41085 40582 gene locus_tag LOCUS_00370 gene mreD 41085 40582 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_00370 41850 41086 gene locus_tag LOCUS_00380 gene mreC 41850 41086 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 protein_id gnl|my_center|LOCUS_00380 42948 41920 gene locus_tag LOCUS_00390 gene mreB 42948 41920 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_00390 44587 43007 gene locus_tag LOCUS_00400 gene purH 44587 43007 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_00400 44676 45926 gene locus_tag LOCUS_00410 44676 45926 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_00410 46867 46013 gene locus_tag LOCUS_00420 gene accD 46867 46013 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_00420 47985 46918 gene locus_tag LOCUS_00430 gene fbaA 47985 46918 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_00430 50477 48030 gene locus_tag LOCUS_00440 50477 48030 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_00440 50607 51335 gene locus_tag LOCUS_00450 50607 51335 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_00450 52030 51338 gene locus_tag LOCUS_00460 gene porT 52030 51338 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_00460 52763 52032 gene locus_tag LOCUS_00470 gene menG 52763 52032 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_00470 53302 52817 gene locus_tag LOCUS_00480 gene dfrA 53302 52817 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_00480 53756 53304 gene locus_tag LOCUS_00490 53756 53304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 54589 53765 gene locus_tag LOCUS_00500 gene thyA 54589 53765 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 protein_id gnl|my_center|LOCUS_00500 56312 54654 gene locus_tag LOCUS_00510 gene yeiM 56312 54654 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_00510 56962 56333 gene locus_tag LOCUS_00520 56962 56333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_00520 58122 57154 gene locus_tag LOCUS_00530 gene etfA 58122 57154 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_00530 58966 58220 gene locus_tag LOCUS_00540 gene etfB 58966 58220 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_00540 59176 60153 gene locus_tag LOCUS_00550 gene pdhB 59176 60153 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_00550 60232 62709 gene locus_tag LOCUS_00560 60232 62709 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_00560 62712 63317 gene locus_tag LOCUS_00570 gene alkA 62712 63317 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653302.1 protein_id gnl|my_center|LOCUS_00570 63396 63926 gene locus_tag LOCUS_00580 gene ppa 63396 63926 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH9 protein_id gnl|my_center|LOCUS_00580 64093 66609 gene locus_tag LOCUS_00590 64093 66609 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_00590 66745 68961 gene locus_tag LOCUS_00600 66745 68961 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107277.1 protein_id gnl|my_center|LOCUS_00600 68961 69950 gene locus_tag LOCUS_00610 gene aspG 68961 69950 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_00610 69950 70624 gene locus_tag LOCUS_00620 69950 70624 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016415.1 protein_id gnl|my_center|LOCUS_00620 70635 73094 gene locus_tag LOCUS_00630 70635 73094 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_00630 75302 73134 gene locus_tag LOCUS_00640 75302 73134 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_00640 75450 76208 gene locus_tag LOCUS_00650 gene surE 75450 76208 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_00650 76211 76486 gene locus_tag LOCUS_00660 76211 76486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964420.1 protein_id gnl|my_center|LOCUS_00660 76486 77601 gene locus_tag LOCUS_00670 gene lpxB 76486 77601 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_00670 77606 78247 gene locus_tag LOCUS_00680 77606 78247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 78256 78882 gene locus_tag LOCUS_00690 78256 78882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 79044 78889 gene locus_tag LOCUS_00700 79044 78889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 79094 80914 gene locus_tag LOCUS_00710 79094 80914 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_00710 81377 80916 gene locus_tag LOCUS_00720 81377 80916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 83238 81433 gene locus_tag LOCUS_00730 83238 81433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 84813 83269 gene locus_tag LOCUS_00740 gene yclF 84813 83269 CDS product putative transporter YclF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94408 protein_id gnl|my_center|LOCUS_00740 86986 84815 gene locus_tag LOCUS_00750 gene pepX1 86986 84815 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_00750 87110 91492 gene locus_tag LOCUS_00760 87110 91492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 91529 92845 gene locus_tag LOCUS_00770 gene mvaA 91529 92845 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_00770 92959 93873 gene locus_tag LOCUS_00780 92959 93873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_00780 94275 93880 gene locus_tag LOCUS_00790 94275 93880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 94426 94353 gene locus_tag LOCUS_t00010 94426 94353 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 94526 95263 gene locus_tag LOCUS_00800 gene coaX 94526 95263 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B4 protein_id gnl|my_center|LOCUS_00800 95256 96524 gene locus_tag LOCUS_00810 95256 96524 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_00810 96546 97910 gene locus_tag LOCUS_00820 96546 97910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785453.1 protein_id gnl|my_center|LOCUS_00820 97911 98468 gene locus_tag LOCUS_00830 97911 98468 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 protein_id gnl|my_center|LOCUS_00830 98523 98711 gene locus_tag LOCUS_00840 98523 98711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 98711 99979 gene locus_tag LOCUS_00850 98711 99979 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_00850 100067 102169 gene locus_tag LOCUS_00860 100067 102169 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_00860 103373 102213 gene locus_tag LOCUS_00870 103373 102213 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964416.1 protein_id gnl|my_center|LOCUS_00870 104687 103416 gene locus_tag LOCUS_00880 gene bioA 104687 103416 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_00880 105376 104759 gene locus_tag LOCUS_00890 gene bioD 105376 104759 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_00890 106513 105380 gene locus_tag LOCUS_00900 gene bioF 106513 105380 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_00900 106857 106576 gene locus_tag LOCUS_00910 106857 106576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 108416 106905 gene locus_tag LOCUS_00920 gene atpD 108416 106905 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_00920 110416 108569 gene locus_tag LOCUS_00930 gene glmS 110416 108569 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_00930 112191 110428 gene locus_tag LOCUS_00940 112191 110428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962289.1 protein_id gnl|my_center|LOCUS_00940 113049 112207 gene locus_tag LOCUS_00950 113049 112207 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_00950 113122 113973 gene locus_tag LOCUS_00960 gene panC 113122 113973 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 protein_id gnl|my_center|LOCUS_00960 114047 114397 gene locus_tag LOCUS_00970 gene panD 114047 114397 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 protein_id gnl|my_center|LOCUS_00970 114399 115361 gene locus_tag LOCUS_00980 114399 115361 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_00980 115403 116614 gene locus_tag LOCUS_00990 115403 116614 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962284.1 protein_id gnl|my_center|LOCUS_00990 116621 117982 gene locus_tag LOCUS_01000 gene radA 116621 117982 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_01000 118063 118557 gene locus_tag LOCUS_01010 118063 118557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 118700 119407 gene locus_tag LOCUS_01020 118700 119407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 119436 121247 gene locus_tag LOCUS_01030 119436 121247 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_01030 122359 121325 gene locus_tag LOCUS_01040 gene tas 122359 121325 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962241.1 protein_id gnl|my_center|LOCUS_01040 123429 122464 gene locus_tag LOCUS_01050 123429 122464 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_01050 124213 123452 gene locus_tag LOCUS_01060 gene xth 124213 123452 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_01060 124398 126191 gene locus_tag LOCUS_01070 124398 126191 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_01070 126584 126192 gene locus_tag LOCUS_01080 126584 126192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 127014 126631 gene locus_tag LOCUS_01090 127014 126631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 128389 127031 gene locus_tag LOCUS_01100 128389 127031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 129953 128601 gene locus_tag LOCUS_01110 gene mgtE 129953 128601 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_01110 130719 129943 gene locus_tag LOCUS_01120 gene rsmA 130719 129943 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_01120 131061 130735 gene locus_tag LOCUS_01130 131061 130735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_01130 132834 131080 gene locus_tag LOCUS_01140 132834 131080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_01140 134203 132932 gene locus_tag LOCUS_01150 gene serS 134203 132932 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_01150 134403 136250 gene locus_tag LOCUS_01160 134403 136250 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_01160 136326 137651 gene locus_tag LOCUS_01170 136326 137651 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVS7 protein_id gnl|my_center|LOCUS_01170 137724 137798 gene locus_tag LOCUS_t00020 137724 137798 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 137861 137935 gene locus_tag LOCUS_t00030 137861 137935 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 138016 138522 gene locus_tag LOCUS_01180 138016 138522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_01180 139472 138519 gene locus_tag LOCUS_01190 gene ltd 139472 138519 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_01190 139627 140250 gene locus_tag LOCUS_01200 139627 140250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 140252 141898 gene locus_tag LOCUS_01210 140252 141898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 141947 145339 gene locus_tag LOCUS_01220 gene mfd 141947 145339 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_01220 146845 145619 gene locus_tag LOCUS_01230 146845 145619 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_01230 147651 146884 gene locus_tag LOCUS_01240 147651 146884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 protein_id gnl|my_center|LOCUS_01240 149003 147648 gene locus_tag LOCUS_01250 149003 147648 CDS product cytochrome c biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964529.1 protein_id gnl|my_center|LOCUS_01250 150031 149009 gene locus_tag LOCUS_01260 150031 149009 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_01260 150583 150149 gene locus_tag LOCUS_01270 gene dut 150583 150149 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_01270 151923 150583 gene locus_tag LOCUS_01280 151923 150583 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_01280 152509 152066 gene locus_tag LOCUS_01290 152509 152066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 152658 154742 gene locus_tag LOCUS_01300 152658 154742 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_01300 155690 154884 gene locus_tag LOCUS_01310 gene atpG 155690 154884 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_01310 157388 155814 gene locus_tag LOCUS_01320 gene atpA 157388 155814 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_01320 157965 157432 gene locus_tag LOCUS_01330 gene atpH 157965 157432 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_01330 158472 157972 gene locus_tag LOCUS_01340 gene atpF 158472 157972 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_01340 158756 158562 gene locus_tag LOCUS_01350 158756 158562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 159884 158796 gene locus_tag LOCUS_01360 gene atpB 159884 158796 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_01360 160444 160055 gene locus_tag LOCUS_01370 160444 160055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 160655 160437 gene locus_tag LOCUS_01380 160655 160437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 161025 160630 gene locus_tag LOCUS_01390 161025 160630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_01390 163675 161045 gene locus_tag LOCUS_01400 gene sprE 163675 161045 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_01400 164443 163778 gene locus_tag LOCUS_01410 164443 163778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 164857 164498 gene locus_tag LOCUS_01420 164857 164498 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_01420 165781 164882 gene locus_tag LOCUS_01430 165781 164882 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_01430 166010 166387 gene locus_tag LOCUS_01440 166010 166387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_01440 166479 168542 gene locus_tag LOCUS_01450 gene metG 166479 168542 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_01450 168544 169233 gene locus_tag LOCUS_01460 168544 169233 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_01460 169697 169278 gene locus_tag LOCUS_01470 169697 169278 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_01470 169848 171374 gene locus_tag LOCUS_01480 169848 171374 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107456.1 protein_id gnl|my_center|LOCUS_01480 171384 171863 gene locus_tag LOCUS_01490 171384 171863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 171867 172301 gene locus_tag LOCUS_01500 171867 172301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 172361 172906 gene locus_tag LOCUS_01510 gene yfiT 172361 172906 CDS product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 protein_id gnl|my_center|LOCUS_01510 172899 173249 gene locus_tag LOCUS_01520 172899 173249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_01520 173338 174147 gene locus_tag LOCUS_01530 gene yeeZ 173338 174147 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962265.1 protein_id gnl|my_center|LOCUS_01530 174150 175073 gene locus_tag LOCUS_01540 174150 175073 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_01540 175083 175580 gene locus_tag LOCUS_01550 175083 175580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 177754 175661 gene locus_tag LOCUS_01560 gene pepO 177754 175661 CDS product endothelin-converting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962266.1 protein_id gnl|my_center|LOCUS_01560 177944 181066 gene locus_tag LOCUS_01570 177944 181066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 184997 181620 gene locus_tag LOCUS_01580 184997 181620 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_01580 185130 185789 gene locus_tag LOCUS_01590 185130 185789 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_01590 185866 186102 gene locus_tag LOCUS_01600 gene feoA 185866 186102 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_01600 186107 188209 gene locus_tag LOCUS_01610 gene feoB 186107 188209 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_01610 188737 188339 gene locus_tag LOCUS_01620 188737 188339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 189579 188761 gene locus_tag LOCUS_01630 189579 188761 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_01630 190229 189582 gene locus_tag LOCUS_01640 gene sirR 190229 189582 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_01640 190319 192568 gene locus_tag LOCUS_01650 190319 192568 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765025.1 protein_id gnl|my_center|LOCUS_01650 192657 193067 gene locus_tag LOCUS_01660 gene yqiW 192657 193067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_01660 193186 193890 gene locus_tag LOCUS_01670 gene plsC 193186 193890 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_01670 193890 194885 gene locus_tag LOCUS_01680 193890 194885 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_01680 194947 195594 gene locus_tag LOCUS_01690 194947 195594 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_01690 196275 195595 gene locus_tag LOCUS_01700 196275 195595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 197066 196290 gene locus_tag LOCUS_01710 gene crt 197066 196290 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_01710 198485 197073 gene locus_tag LOCUS_01720 198485 197073 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_01720 199077 198535 gene locus_tag LOCUS_01730 199077 198535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_01730 200419 199067 gene locus_tag LOCUS_01740 200419 199067 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_01740 201448 200420 gene locus_tag LOCUS_01750 gene hemH 201448 200420 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_01750 201733 202401 gene locus_tag LOCUS_01760 201733 202401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 202448 203203 gene locus_tag LOCUS_01770 202448 203203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 203216 204049 gene locus_tag LOCUS_01780 203216 204049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 204925 204053 gene locus_tag LOCUS_01790 204925 204053 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_01790 205153 206400 gene locus_tag LOCUS_01800 gene hemA 205153 206400 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 protein_id gnl|my_center|LOCUS_01800 206411 207331 gene locus_tag LOCUS_01810 gene hemC 206411 207331 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP0 protein_id gnl|my_center|LOCUS_01810 207342 209084 gene locus_tag LOCUS_01820 207342 209084 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_01820 209095 209814 gene locus_tag LOCUS_01830 209095 209814 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760381.1 protein_id gnl|my_center|LOCUS_01830 209814 210485 gene locus_tag LOCUS_01840 gene hemD 209814 210485 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962223.1 protein_id gnl|my_center|LOCUS_01840 210478 211506 gene locus_tag LOCUS_01850 gene hemE 210478 211506 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 protein_id gnl|my_center|LOCUS_01850 211549 212457 gene locus_tag LOCUS_01860 gene hemF 211549 212457 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_01860 212532 213521 gene locus_tag LOCUS_01870 gene hemB 212532 213521 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN2 protein_id gnl|my_center|LOCUS_01870 213565 214314 gene locus_tag LOCUS_01880 213565 214314 CDS product phospholipid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964451.1 protein_id gnl|my_center|LOCUS_01880 214376 215431 gene locus_tag LOCUS_01890 214376 215431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_01890 215526 216590 gene locus_tag LOCUS_01900 gene smf 215526 216590 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_01900 216611 217234 gene locus_tag LOCUS_01910 216611 217234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 218626 217274 gene locus_tag LOCUS_01920 gene accC 218626 217274 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_01920 219203 218721 gene locus_tag LOCUS_01930 gene accB 219203 218721 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_01930 220230 219232 gene locus_tag LOCUS_01940 gene fabH3 220230 219232 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_01940 220588 220394 gene locus_tag LOCUS_01950 gene rpmF 220588 220394 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_01950 221131 220598 gene locus_tag LOCUS_01960 221131 220598 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_01960 222261 221218 gene locus_tag LOCUS_01970 gene pdxA 222261 221218 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_01970 222320 222910 gene locus_tag LOCUS_01980 gene ribE 222320 222910 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_01980 223129 222920 gene locus_tag LOCUS_01990 223129 222920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 224501 223692 gene locus_tag LOCUS_02000 224501 223692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 224696 224502 gene locus_tag LOCUS_02010 224696 224502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 225525 224704 gene locus_tag LOCUS_02020 225525 224704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 225614 225835 gene locus_tag LOCUS_02030 225614 225835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 226416 225832 gene locus_tag LOCUS_02040 226416 225832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 226977 226537 gene locus_tag LOCUS_02050 226977 226537 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108556.1 protein_id gnl|my_center|LOCUS_02050 227556 227056 gene locus_tag LOCUS_02060 227556 227056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 227806 228846 gene locus_tag LOCUS_02070 227806 228846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 228853 229215 gene locus_tag LOCUS_02080 228853 229215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 229216 229809 gene locus_tag LOCUS_02090 229216 229809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 229906 232752 gene locus_tag LOCUS_02100 229906 232752 CDS product type II endonuclease-methyltransferasefusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962421.1 protein_id gnl|my_center|LOCUS_02100 232762 233898 gene locus_tag LOCUS_02110 gene yopC 232762 233898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31935 protein_id gnl|my_center|LOCUS_02110 233904 235163 gene locus_tag LOCUS_02120 233904 235163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 235166 237640 gene locus_tag LOCUS_02130 235166 237640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 237633 238889 gene locus_tag LOCUS_02140 237633 238889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861451.1 protein_id gnl|my_center|LOCUS_02140 238958 239836 gene locus_tag LOCUS_02150 238958 239836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 241007 239985 gene locus_tag LOCUS_02160 241007 239985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203302.1 protein_id gnl|my_center|LOCUS_02160 241836 240982 gene locus_tag LOCUS_02170 241836 240982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098079.1 protein_id gnl|my_center|LOCUS_02170 243124 241892 gene locus_tag LOCUS_02180 243124 241892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 244086 243193 gene locus_tag LOCUS_02190 244086 243193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 244382 244083 gene locus_tag LOCUS_02200 244382 244083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 245796 244507 gene locus_tag LOCUS_02210 245796 244507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 245981 245907 gene locus_tag LOCUS_t00040 245981 245907 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 246448 246044 gene locus_tag LOCUS_02220 246448 246044 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_02220 246559 246951 gene locus_tag LOCUS_02230 gene rbfA 246559 246951 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 protein_id gnl|my_center|LOCUS_02230 247143 246928 gene locus_tag LOCUS_02240 247143 246928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 247061 248149 gene locus_tag LOCUS_02250 247061 248149 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_02250 248536 248856 gene locus_tag LOCUS_02260 248536 248856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 249231 248992 gene locus_tag LOCUS_02270 249231 248992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 250425 249298 gene locus_tag LOCUS_02280 250425 249298 CDS product general secretion pathway protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964406.1 protein_id gnl|my_center|LOCUS_02280 250891 250415 gene locus_tag LOCUS_02290 250891 250415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964405.1 protein_id gnl|my_center|LOCUS_02290 251210 250884 gene locus_tag LOCUS_02300 251210 250884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964404.1 protein_id gnl|my_center|LOCUS_02300 252457 251198 gene locus_tag LOCUS_02310 252457 251198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964403.1 protein_id gnl|my_center|LOCUS_02310 252875 252450 gene locus_tag LOCUS_02320 252875 252450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964402.1 protein_id gnl|my_center|LOCUS_02320 253861 252935 gene locus_tag LOCUS_02330 253861 252935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964401.1 protein_id gnl|my_center|LOCUS_02330 254601 253873 gene locus_tag LOCUS_02340 254601 253873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964400.1 protein_id gnl|my_center|LOCUS_02340 258521 254649 gene locus_tag LOCUS_02350 258521 254649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 259120 258638 gene locus_tag LOCUS_02360 259120 258638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 263440 259127 gene locus_tag LOCUS_02370 263440 259127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 268594 263447 gene locus_tag LOCUS_02380 268594 263447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 269216 268602 gene locus_tag LOCUS_02390 269216 268602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964393.1 protein_id gnl|my_center|LOCUS_02390 269748 269194 gene locus_tag LOCUS_02400 269748 269194 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964392.1 protein_id gnl|my_center|LOCUS_02400 269880 270284 gene locus_tag LOCUS_02410 gene gspG 269880 270284 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964391.1 protein_id gnl|my_center|LOCUS_02410 270762 272168 gene locus_tag LOCUS_02420 gene gspE 270762 272168 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964389.1 protein_id gnl|my_center|LOCUS_02420 272216 274345 gene locus_tag LOCUS_02430 gene gspD 272216 274345 CDS product general secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964388.1 protein_id gnl|my_center|LOCUS_02430 274345 275541 gene locus_tag LOCUS_02440 274345 275541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 275528 276055 gene locus_tag LOCUS_02450 275528 276055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 276899 276066 gene locus_tag LOCUS_02460 276899 276066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 277158 277439 gene locus_tag LOCUS_02470 277158 277439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 277537 279138 gene locus_tag LOCUS_02480 277537 279138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 279142 279807 gene locus_tag LOCUS_02490 279142 279807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 279916 280071 gene locus_tag LOCUS_02500 279916 280071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_003858604.1 protein_id gnl|my_center|LOCUS_02500 280074 280304 gene locus_tag LOCUS_02510 280074 280304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 280336 280590 gene locus_tag LOCUS_02520 280336 280590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 280595 281146 gene locus_tag LOCUS_02530 280595 281146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 281153 281365 gene locus_tag LOCUS_02540 281153 281365 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266187.1 protein_id gnl|my_center|LOCUS_02540 281362 281589 gene locus_tag LOCUS_02550 281362 281589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 281593 284043 gene locus_tag LOCUS_02560 281593 284043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 284048 285037 gene locus_tag LOCUS_02570 284048 285037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 285042 286067 gene locus_tag LOCUS_02580 285042 286067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 286064 286849 gene locus_tag LOCUS_02590 286064 286849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 286855 287658 gene locus_tag LOCUS_02600 286855 287658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 287730 288143 gene locus_tag LOCUS_02610 287730 288143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 288173 288385 gene locus_tag LOCUS_02620 288173 288385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 288644 288456 gene locus_tag LOCUS_02630 288644 288456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 288990 288631 gene locus_tag LOCUS_02640 288990 288631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 289078 289935 gene locus_tag LOCUS_02650 289078 289935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 290001 290165 gene locus_tag LOCUS_02660 290001 290165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 290155 291798 gene locus_tag LOCUS_02670 290155 291798 CDS product serine type site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023062934.1 protein_id gnl|my_center|LOCUS_02670 291831 291751 gene locus_tag LOCUS_t00050 291831 291751 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 292053 292994 gene locus_tag LOCUS_02680 gene prsA 292053 292994 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_02680 293021 293629 gene locus_tag LOCUS_02690 gene rplY 293021 293629 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 protein_id gnl|my_center|LOCUS_02690 293835 294455 gene locus_tag LOCUS_02700 gene pth 293835 294455 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_02700 297850 294506 gene locus_tag LOCUS_02710 gene fpp1 297850 294506 CDS product metalloprotease Fpp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962407.1 protein_id gnl|my_center|LOCUS_02710 300695 297963 gene locus_tag LOCUS_02720 gene fpp1 300695 297963 CDS product metalloprotease Fpp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962407.1 protein_id gnl|my_center|LOCUS_02720 303538 300812 gene locus_tag LOCUS_02730 gene fpp1 303538 300812 CDS product metalloprotease Fpp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962407.1 protein_id gnl|my_center|LOCUS_02730 303669 304604 gene locus_tag LOCUS_02740 gene ribF 303669 304604 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_02740 304601 305899 gene locus_tag LOCUS_02750 304601 305899 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_02750 305957 306400 gene locus_tag LOCUS_02760 305957 306400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 306466 307548 gene locus_tag LOCUS_02770 gene bioB 306466 307548 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_02770 307834 308649 gene locus_tag LOCUS_02780 307834 308649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 310084 308696 gene locus_tag LOCUS_02790 310084 308696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_02790 314407 310187 gene locus_tag LOCUS_02800 314407 310187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 318509 314565 gene locus_tag LOCUS_02810 318509 314565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 323539 318710 gene locus_tag LOCUS_02820 323539 318710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 323657 324136 gene locus_tag LOCUS_02830 gene recX 323657 324136 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_02830 324198 325250 gene locus_tag LOCUS_02840 gene thiL 324198 325250 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_02840 326880 325339 gene locus_tag LOCUS_02850 gene glyS 326880 325339 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2A9 protein_id gnl|my_center|LOCUS_02850 327771 326941 gene locus_tag LOCUS_02860 327771 326941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 327834 328517 gene locus_tag LOCUS_02870 327834 328517 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_02870 328584 330194 gene locus_tag LOCUS_02880 328584 330194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_02880 330951 330181 gene locus_tag LOCUS_02890 330951 330181 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_02890 331716 330979 gene locus_tag LOCUS_02900 331716 330979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 332554 331814 gene locus_tag LOCUS_02910 gene sdhB 332554 331814 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_02910 334637 332637 gene locus_tag LOCUS_02920 gene sdhA 334637 332637 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_02920 335510 334656 gene locus_tag LOCUS_02930 335510 334656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 336560 335655 gene locus_tag LOCUS_02940 336560 335655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 339179 336591 gene locus_tag LOCUS_02950 339179 336591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 339411 340703 gene locus_tag LOCUS_02960 gene pepP 339411 340703 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_02960 340932 341714 gene locus_tag LOCUS_02970 340932 341714 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_02970 342553 341711 gene locus_tag LOCUS_02980 342553 341711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 345342 342562 gene locus_tag LOCUS_02990 345342 342562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_02990 346809 345406 gene locus_tag LOCUS_03000 346809 345406 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_03000 348102 346909 gene locus_tag LOCUS_03010 gene kbl 348102 346909 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_03010 351341 348147 gene locus_tag LOCUS_03020 351341 348147 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_03020 351449 352054 gene locus_tag LOCUS_03030 gene sodA 351449 352054 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_03030 354375 352477 gene locus_tag LOCUS_03040 gene purF 354375 352477 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_03040 355381 354452 gene locus_tag LOCUS_03050 355381 354452 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_03050 355498 355887 gene locus_tag LOCUS_03060 355498 355887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 356336 355857 gene locus_tag LOCUS_03070 gene rnhA 356336 355857 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_03070 356914 356348 gene locus_tag LOCUS_03080 gene purN 356914 356348 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 protein_id gnl|my_center|LOCUS_03080 357090 357326 gene locus_tag LOCUS_03090 gene acpP 357090 357326 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_03090 357523 358776 gene locus_tag LOCUS_03100 gene fabF 357523 358776 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_03100 358783 359523 gene locus_tag LOCUS_03110 gene rnc 358783 359523 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 protein_id gnl|my_center|LOCUS_03110 359581 360054 gene locus_tag LOCUS_03120 359581 360054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962379.1 protein_id gnl|my_center|LOCUS_03120 360066 361490 gene locus_tag LOCUS_03130 gene pykA 360066 361490 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_03130 361535 362293 gene locus_tag LOCUS_03140 361535 362293 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_03140 362675 362346 gene locus_tag LOCUS_03150 362675 362346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 363794 362691 gene locus_tag LOCUS_03160 gene dinB 363794 362691 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8Q2 protein_id gnl|my_center|LOCUS_03160 363861 364328 gene locus_tag LOCUS_03170 363861 364328 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962372.1 protein_id gnl|my_center|LOCUS_03170 364768 364334 gene locus_tag LOCUS_03180 364768 364334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962371.1 protein_id gnl|my_center|LOCUS_03180 365231 364806 gene locus_tag LOCUS_03190 365231 364806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_03190 366904 365267 gene locus_tag LOCUS_03200 gene pgi 366904 365267 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ0 protein_id gnl|my_center|LOCUS_03200 368131 366908 gene locus_tag LOCUS_03210 368131 366908 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_03210 369079 368150 gene locus_tag LOCUS_03220 369079 368150 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_03220 369849 369079 gene locus_tag LOCUS_03230 369849 369079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_03230 371303 370140 gene locus_tag LOCUS_03240 gene hppD 371303 370140 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_03240 372548 371388 gene locus_tag LOCUS_03250 gene hmgA 372548 371388 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_03250 374935 372725 gene locus_tag LOCUS_03260 374935 372725 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_03260 376833 375037 gene locus_tag LOCUS_03270 gene uvrC 376833 375037 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_03270 376908 377873 gene locus_tag LOCUS_03280 376908 377873 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_03280 377936 379168 gene locus_tag LOCUS_03290 377936 379168 CDS product cytochrome d ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047985.1 protein_id gnl|my_center|LOCUS_03290 379161 379724 gene locus_tag LOCUS_03300 gene ygfA 379161 379724 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_03300 380139 379711 gene locus_tag LOCUS_03310 380139 379711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 380784 380149 gene locus_tag LOCUS_03320 gene lspA 380784 380149 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_03320 381247 380867 gene locus_tag LOCUS_03330 gene dksA 381247 380867 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_03330 384727 381305 gene locus_tag LOCUS_03340 gene ileS 384727 381305 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_03340 384881 385981 gene locus_tag LOCUS_03350 384881 385981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 386687 385974 gene locus_tag LOCUS_03360 gene recO 386687 385974 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 protein_id gnl|my_center|LOCUS_03360 388909 386687 gene locus_tag LOCUS_03370 388909 386687 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_03370 390434 389091 gene locus_tag LOCUS_03380 gene gdhA 390434 389091 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_03380 390638 391417 gene locus_tag LOCUS_03390 390638 391417 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962446.1 protein_id gnl|my_center|LOCUS_03390 391952 391494 gene locus_tag LOCUS_03400 391952 391494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_03400 392024 392374 gene locus_tag LOCUS_03410 392024 392374 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_03410 392374 393267 gene locus_tag LOCUS_03420 392374 393267 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_03420 393315 394175 gene locus_tag LOCUS_03430 393315 394175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_03430 394200 394775 gene locus_tag LOCUS_03440 gene gmk 394200 394775 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_03440 394808 395173 gene locus_tag LOCUS_03450 394808 395173 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_03450 395206 395787 gene locus_tag LOCUS_03460 gene nadD 395206 395787 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_03460 395860 397038 gene locus_tag LOCUS_03470 395860 397038 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962321.1 protein_id gnl|my_center|LOCUS_03470 397250 398245 gene locus_tag LOCUS_03480 gene gpsA 397250 398245 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_03480 398418 399395 gene locus_tag LOCUS_03490 398418 399395 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941519.1 protein_id gnl|my_center|LOCUS_03490 400188 399409 gene locus_tag LOCUS_03500 400188 399409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 403092 400288 gene locus_tag LOCUS_03510 403092 400288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 403305 404264 gene locus_tag LOCUS_03520 403305 404264 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968776.1 protein_id gnl|my_center|LOCUS_03520 404264 405331 gene locus_tag LOCUS_03530 404264 405331 CDS product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089975.1 protein_id gnl|my_center|LOCUS_03530 405748 405341 gene locus_tag LOCUS_03540 405748 405341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_03540 406860 405841 gene locus_tag LOCUS_03550 gene pheS 406860 405841 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_03550 407295 406939 gene locus_tag LOCUS_03560 407295 406939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_03560 407437 407982 gene locus_tag LOCUS_03570 407437 407982 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962305.1 protein_id gnl|my_center|LOCUS_03570 407983 408222 gene locus_tag LOCUS_03580 407983 408222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 409042 408278 gene locus_tag LOCUS_03590 gene batE 409042 408278 CDS product BatE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_03590 409488 409108 gene locus_tag LOCUS_03600 409488 409108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_03600 411300 409537 gene locus_tag LOCUS_03610 gene batD 411300 409537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_03610 412068 411319 gene locus_tag LOCUS_03620 412068 411319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 413107 412070 gene locus_tag LOCUS_03630 gene batB 413107 412070 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_03630 414128 413124 gene locus_tag LOCUS_03640 gene batA 414128 413124 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_03640 415786 414128 gene locus_tag LOCUS_03650 415786 414128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 protein_id gnl|my_center|LOCUS_03650 416183 415812 gene locus_tag LOCUS_03660 416183 415812 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405056.1 protein_id gnl|my_center|LOCUS_03660 417103 416237 gene locus_tag LOCUS_03670 417103 416237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_03670 418190 417180 gene locus_tag LOCUS_03680 418190 417180 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_03680 418353 419492 gene locus_tag LOCUS_03690 418353 419492 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962316.1 protein_id gnl|my_center|LOCUS_03690 419710 419489 gene locus_tag LOCUS_03700 419710 419489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 420476 419808 gene locus_tag LOCUS_03710 420476 419808 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088434.1 protein_id gnl|my_center|LOCUS_03710 422528 420489 gene locus_tag LOCUS_03720 422528 420489 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 protein_id gnl|my_center|LOCUS_03720 422778 422551 gene locus_tag LOCUS_03730 422778 422551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 423067 422840 gene locus_tag LOCUS_03740 423067 422840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 423275 424009 gene locus_tag LOCUS_03750 gene pphA 423275 424009 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 protein_id gnl|my_center|LOCUS_03750 424046 424537 gene locus_tag LOCUS_03760 424046 424537 CDS product OmpA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962318.1 protein_id gnl|my_center|LOCUS_03760 424540 425115 gene locus_tag LOCUS_03770 gene phnA 424540 425115 CDS product PhnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 protein_id gnl|my_center|LOCUS_03770 426778 425225 gene locus_tag LOCUS_03780 gene pcd 426778 425225 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_03780 427389 426853 gene locus_tag LOCUS_03790 gene haaO 427389 426853 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_03790 428582 427479 gene locus_tag LOCUS_03800 428582 427479 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_03800 428819 431608 gene locus_tag LOCUS_03810 428819 431608 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_03810 431619 432230 gene locus_tag LOCUS_03820 431619 432230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 432240 433625 gene locus_tag LOCUS_03830 432240 433625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964329.1 protein_id gnl|my_center|LOCUS_03830 433718 434947 gene locus_tag LOCUS_03840 gene hflX 433718 434947 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 protein_id gnl|my_center|LOCUS_03840 435899 434994 gene locus_tag LOCUS_03850 435899 434994 CDS product protein of unknown function precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362027.1 protein_id gnl|my_center|LOCUS_03850 436461 435958 gene locus_tag LOCUS_03860 436461 435958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_03860 436795 436472 gene locus_tag LOCUS_03870 436795 436472 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_03870 437225 436806 gene locus_tag LOCUS_03880 gene sufE 437225 436806 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_03880 437714 437229 gene locus_tag LOCUS_03890 437714 437229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 439029 437815 gene locus_tag LOCUS_03900 gene sufS 439029 437815 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_03900 440256 439099 gene locus_tag LOCUS_03910 440256 439099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 441235 440240 gene locus_tag LOCUS_03920 441235 440240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 442649 441333 gene locus_tag LOCUS_03930 gene sufD 442649 441333 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_03930 443125 442757 gene locus_tag LOCUS_03940 443125 442757 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_03940 443899 443150 gene locus_tag LOCUS_03950 gene sufC 443899 443150 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_03950 444293 443946 gene locus_tag LOCUS_03960 444293 443946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 445776 444328 gene locus_tag LOCUS_03970 gene sufB 445776 444328 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_03970 446115 445786 gene locus_tag LOCUS_03980 gene sufA 446115 445786 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_03980 446281 447141 gene locus_tag LOCUS_03990 446281 447141 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_03990 447220 448812 gene locus_tag LOCUS_04000 447220 448812 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_04000 448888 450765 gene locus_tag LOCUS_04010 448888 450765 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_04010 451208 451035 gene locus_tag LOCUS_04020 451208 451035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 451294 451545 gene locus_tag LOCUS_04030 451294 451545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 451567 451941 gene locus_tag LOCUS_04040 gene rnpA 451567 451941 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 protein_id gnl|my_center|LOCUS_04040 451992 452807 gene locus_tag LOCUS_04050 451992 452807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963736.1 protein_id gnl|my_center|LOCUS_04050 452810 454444 gene locus_tag LOCUS_04060 gene prc 452810 454444 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 protein_id gnl|my_center|LOCUS_04060 454446 455267 gene locus_tag LOCUS_04070 454446 455267 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962202.1 protein_id gnl|my_center|LOCUS_04070 455356 455943 gene locus_tag LOCUS_04080 455356 455943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 456089 456751 gene locus_tag LOCUS_04090 456089 456751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 457243 456800 gene locus_tag LOCUS_04100 gene elaA 457243 456800 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_04100 458321 457335 gene locus_tag LOCUS_04110 458321 457335 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_04110 459831 458332 gene locus_tag LOCUS_04120 459831 458332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 461073 459883 gene locus_tag LOCUS_04130 gene pgk 461073 459883 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_04130 461446 462597 gene locus_tag LOCUS_04140 gene holB 461446 462597 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_04140 462600 462983 gene locus_tag LOCUS_04150 462600 462983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962191.1 protein_id gnl|my_center|LOCUS_04150 463048 465012 gene locus_tag LOCUS_04160 463048 465012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_04160 467285 465009 gene locus_tag LOCUS_04170 467285 465009 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962188.1 protein_id gnl|my_center|LOCUS_04170 468142 467558 gene locus_tag LOCUS_04180 468142 467558 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962186.1 protein_id gnl|my_center|LOCUS_04180 469207 468359 gene locus_tag LOCUS_04190 469207 468359 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_04190 471237 469360 gene locus_tag LOCUS_04200 gene mnmG 471237 469360 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_04200 471692 471273 gene locus_tag LOCUS_04210 gene ybeY 471692 471273 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_04210 474978 471685 gene locus_tag LOCUS_04220 474978 471685 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_04220 475146 476648 gene locus_tag LOCUS_04230 gene gltX 475146 476648 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 protein_id gnl|my_center|LOCUS_04230 477356 476706 gene locus_tag LOCUS_04240 477356 476706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 477460 478443 gene locus_tag LOCUS_04250 477460 478443 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_04250 480628 478946 gene locus_tag LOCUS_04260 gene glnS 480628 478946 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_04260 480710 481066 gene locus_tag LOCUS_04270 gene folB 480710 481066 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_04270 483027 481099 gene locus_tag LOCUS_04280 483027 481099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44135 protein_id gnl|my_center|LOCUS_04280 483162 483235 gene locus_tag LOCUS_t00060 483162 483235 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 483905 483273 gene locus_tag LOCUS_04290 483905 483273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 484592 483909 gene locus_tag LOCUS_04300 484592 483909 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_04300 485310 484642 gene locus_tag LOCUS_04310 485310 484642 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964577.1 protein_id gnl|my_center|LOCUS_04310 485998 485690 gene locus_tag LOCUS_04320 485998 485690 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962418.1 protein_id gnl|my_center|LOCUS_04320 488312 486135 gene locus_tag LOCUS_04330 gene rnr 488312 486135 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_04330 489510 488986 gene locus_tag LOCUS_04340 489510 488986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 489595 490026 gene locus_tag LOCUS_04350 gene rpiB 489595 490026 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_04350 490124 491026 gene locus_tag LOCUS_04360 gene czcD 490124 491026 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964573.1 protein_id gnl|my_center|LOCUS_04360 491056 492111 gene locus_tag LOCUS_04370 491056 492111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 492121 492948 gene locus_tag LOCUS_04380 gene nnrD 492121 492948 CDS product ADP-dependent (S)-NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW4 protein_id gnl|my_center|LOCUS_04380 493164 492910 gene locus_tag LOCUS_04390 493164 492910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 493255 495381 gene locus_tag LOCUS_04400 493255 495381 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964572.1 protein_id gnl|my_center|LOCUS_04400 495669 495463 gene locus_tag LOCUS_04410 495669 495463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 495871 496680 gene locus_tag LOCUS_04420 495871 496680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 496684 498171 gene locus_tag LOCUS_04430 496684 498171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_04430 498179 499015 gene locus_tag LOCUS_04440 498179 499015 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964568.1 protein_id gnl|my_center|LOCUS_04440 499062 500753 gene locus_tag LOCUS_04450 499062 500753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_04450 500756 501727 gene locus_tag LOCUS_04460 500756 501727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 501730 502740 gene locus_tag LOCUS_04470 gene rmlB 501730 502740 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_04470 502771 503634 gene locus_tag LOCUS_04480 gene rfbA 502771 503634 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C714 protein_id gnl|my_center|LOCUS_04480 503634 504185 gene locus_tag LOCUS_04490 gene rmlC 503634 504185 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_04490 504179 505051 gene locus_tag LOCUS_04500 gene rmlD 504179 505051 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_04500 505053 506156 gene locus_tag LOCUS_04510 505053 506156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 506156 506920 gene locus_tag LOCUS_04520 506156 506920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 506923 507984 gene locus_tag LOCUS_04530 506923 507984 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_04530 507986 509878 gene locus_tag LOCUS_04540 507986 509878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 509878 510939 gene locus_tag LOCUS_04550 509878 510939 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_04550 510939 511673 gene locus_tag LOCUS_04560 510939 511673 CDS product polyprenol phosphate mannosyl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_04560 511739 512287 gene locus_tag LOCUS_04570 511739 512287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 512425 512874 gene locus_tag LOCUS_04580 512425 512874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 512875 514161 gene locus_tag LOCUS_04590 512875 514161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 514127 514804 gene locus_tag LOCUS_04600 514127 514804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 515047 516030 gene locus_tag LOCUS_04610 515047 516030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 516030 517187 gene locus_tag LOCUS_04620 gene csp2G 516030 517187 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 protein_id gnl|my_center|LOCUS_04620 517274 518383 gene locus_tag LOCUS_04630 517274 518383 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028306.1 protein_id gnl|my_center|LOCUS_04630 518556 519671 gene locus_tag LOCUS_04640 518556 519671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 519673 520656 gene locus_tag LOCUS_04650 519673 520656 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_04650 521014 522018 gene locus_tag LOCUS_04660 521014 522018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 522018 522770 gene locus_tag LOCUS_04670 gene tuaG 522018 522770 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426498.1 protein_id gnl|my_center|LOCUS_04670 524089 522767 gene locus_tag LOCUS_04680 gene capK 524089 522767 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964561.1 protein_id gnl|my_center|LOCUS_04680 524202 525473 gene locus_tag LOCUS_04690 gene purD 524202 525473 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_04690 525735 525505 gene locus_tag LOCUS_04700 525735 525505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 525781 526710 gene locus_tag LOCUS_04710 525781 526710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964559.1 protein_id gnl|my_center|LOCUS_04710 527358 526705 gene locus_tag LOCUS_04720 gene upp 527358 526705 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_04720 527434 528039 gene locus_tag LOCUS_04730 527434 528039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_04730 528092 529090 gene locus_tag LOCUS_04740 528092 529090 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964556.1 protein_id gnl|my_center|LOCUS_04740 530170 529118 gene locus_tag LOCUS_04750 gene paaE 530170 529118 CDS product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_04750 530287 530622 gene locus_tag LOCUS_04760 gene ywzG 530287 530622 CDS product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 protein_id gnl|my_center|LOCUS_04760 530624 531316 gene locus_tag LOCUS_04770 530624 531316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 531868 531359 gene locus_tag LOCUS_04780 531868 531359 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_04780 532871 531942 gene locus_tag LOCUS_04790 532871 531942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 protein_id gnl|my_center|LOCUS_04790 533018 533401 gene locus_tag LOCUS_04800 533018 533401 CDS product cytochrome c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962215.1 protein_id gnl|my_center|LOCUS_04800 534081 533398 gene locus_tag LOCUS_04810 534081 533398 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_04810 535348 534074 gene locus_tag LOCUS_04820 535348 534074 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963526.1 protein_id gnl|my_center|LOCUS_04820 535464 535883 gene locus_tag LOCUS_04830 535464 535883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963525.1 protein_id gnl|my_center|LOCUS_04830 535960 536430 gene locus_tag LOCUS_04840 gene ogt1 535960 536430 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN0 protein_id gnl|my_center|LOCUS_04840 536552 537649 gene locus_tag LOCUS_04850 536552 537649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 537660 537956 gene locus_tag LOCUS_04860 537660 537956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 537968 538681 gene locus_tag LOCUS_04870 537968 538681 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_04870 541686 538735 gene locus_tag LOCUS_04880 541686 538735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 541802 543241 gene locus_tag LOCUS_04890 541802 543241 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962212.1 protein_id gnl|my_center|LOCUS_04890 543243 543971 gene locus_tag LOCUS_04900 543243 543971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 544065 545666 gene locus_tag LOCUS_04910 544065 545666 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EP31 protein_id gnl|my_center|LOCUS_04910 547184 545754 gene locus_tag LOCUS_04920 547184 545754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 550594 547406 gene locus_tag LOCUS_04930 550594 547406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 551418 550762 gene locus_tag LOCUS_04940 gene atoA 551418 550762 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_04940 552122 551421 gene locus_tag LOCUS_04950 gene atoD 552122 551421 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_04950 554426 552141 gene locus_tag LOCUS_04960 gene mrcA 554426 552141 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_04960 554867 554430 gene locus_tag LOCUS_04970 gene gldH 554867 554430 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_04970 556065 554902 gene locus_tag LOCUS_04980 gene fjo17 556065 554902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_04980 557585 556230 gene locus_tag LOCUS_04990 gene yceA 557585 556230 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL9 protein_id gnl|my_center|LOCUS_04990 557731 558735 gene locus_tag LOCUS_05000 gene recA 557731 558735 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_05000 558808 559239 gene locus_tag LOCUS_05010 558808 559239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 559250 559792 gene locus_tag LOCUS_05020 559250 559792 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_05020 559879 561630 gene locus_tag LOCUS_05030 559879 561630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 562404 561721 gene locus_tag LOCUS_05040 562404 561721 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_05040 562574 563542 gene locus_tag LOCUS_05050 gene trpS 562574 563542 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_05050 565541 563646 gene locus_tag LOCUS_05060 gene pop 565541 563646 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964457.1 protein_id gnl|my_center|LOCUS_05060 565628 566890 gene locus_tag LOCUS_05070 gene gltP 565628 566890 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_05070 566891 567580 gene locus_tag LOCUS_05080 566891 567580 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964128.1 protein_id gnl|my_center|LOCUS_05080 567580 568692 gene locus_tag LOCUS_05090 567580 568692 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_05090 568694 569428 gene locus_tag LOCUS_05100 gene mtgA 568694 569428 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H228 protein_id gnl|my_center|LOCUS_05100 569526 569840 gene locus_tag LOCUS_05110 569526 569840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 570087 571238 gene locus_tag LOCUS_05120 570087 571238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 571242 571658 gene locus_tag LOCUS_05130 571242 571658 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_05130 571858 574716 gene locus_tag LOCUS_05140 571858 574716 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963634.1 protein_id gnl|my_center|LOCUS_05140 574720 575472 gene locus_tag LOCUS_05150 574720 575472 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_05150 575576 577870 gene locus_tag LOCUS_05160 575576 577870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 577983 578783 gene locus_tag LOCUS_05170 577983 578783 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_05170 580959 578860 gene locus_tag LOCUS_05180 580959 578860 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_05180 583217 581016 gene locus_tag LOCUS_05190 gene phuR 583217 581016 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_05190 583594 583301 gene locus_tag LOCUS_05200 583594 583301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 584626 583637 gene locus_tag LOCUS_05210 gene asd 584626 583637 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_05210 585175 584768 gene locus_tag LOCUS_05220 gene mscL 585175 584768 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY4 protein_id gnl|my_center|LOCUS_05220 587675 585234 gene locus_tag LOCUS_05230 gene mur/alr 587675 585234 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_05230 588271 587681 gene locus_tag LOCUS_05240 gene tdk 588271 587681 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_05240 588450 589373 gene locus_tag LOCUS_05250 588450 589373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963207.1 protein_id gnl|my_center|LOCUS_05250 589553 590224 gene locus_tag LOCUS_05260 gene rsmI 589553 590224 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 protein_id gnl|my_center|LOCUS_05260 590230 590817 gene locus_tag LOCUS_05270 590230 590817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 590828 591250 gene locus_tag LOCUS_05280 590828 591250 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_05280 591303 591626 gene locus_tag LOCUS_05290 591303 591626 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962418.1 protein_id gnl|my_center|LOCUS_05290 591619 592023 gene locus_tag LOCUS_05300 591619 592023 CDS product type III effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_05300 592099 593799 gene locus_tag LOCUS_05310 gene recJ 592099 593799 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_05310 593792 595060 gene locus_tag LOCUS_05320 593792 595060 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195122.1 protein_id gnl|my_center|LOCUS_05320 595809 595057 gene locus_tag LOCUS_05330 gene lpxH 595809 595057 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_05330 595970 602140 gene locus_tag LOCUS_05340 gene claF 595970 602140 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964501.1 protein_id gnl|my_center|LOCUS_05340 602200 603120 gene locus_tag LOCUS_05350 gene porP 602200 603120 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_05350 603139 605013 gene locus_tag LOCUS_05360 603139 605013 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_05360 605523 605074 gene locus_tag LOCUS_05370 605523 605074 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_05370 605613 606233 gene locus_tag LOCUS_05380 605613 606233 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022240.1 protein_id gnl|my_center|LOCUS_05380 607005 606253 gene locus_tag LOCUS_05390 607005 606253 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_05390 610498 607007 gene locus_tag LOCUS_05400 610498 607007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 613962 610564 gene locus_tag LOCUS_05410 613962 610564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_05410 614657 614067 gene locus_tag LOCUS_05420 614657 614067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 616019 614766 gene locus_tag LOCUS_05430 gene lysC 616019 614766 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_05430 616531 616058 gene locus_tag LOCUS_05440 616531 616058 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_05440 616653 617657 gene locus_tag LOCUS_05450 gene fbp 616653 617657 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWD9 protein_id gnl|my_center|LOCUS_05450 618131 617700 gene locus_tag LOCUS_05460 618131 617700 CDS product fructose 1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962635.1 protein_id gnl|my_center|LOCUS_05460 618266 618859 gene locus_tag LOCUS_05470 618266 618859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_05470 618859 619287 gene locus_tag LOCUS_05480 618859 619287 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_05480 619290 620858 gene locus_tag LOCUS_05490 619290 620858 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_05490 621469 620861 gene locus_tag LOCUS_05500 621469 620861 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962631.1 protein_id gnl|my_center|LOCUS_05500 621673 621473 gene locus_tag LOCUS_05510 621673 621473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962630.1 protein_id gnl|my_center|LOCUS_05510 622266 621694 gene locus_tag LOCUS_05520 622266 621694 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_05520 622419 622985 gene locus_tag LOCUS_05530 622419 622985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_05530 623254 624231 gene locus_tag LOCUS_05540 gene nrdB 623254 624231 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_05540 624285 626681 gene locus_tag LOCUS_05550 gene nrdA 624285 626681 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_05550 626693 626890 gene locus_tag LOCUS_05560 626693 626890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 626983 627207 gene locus_tag LOCUS_05570 626983 627207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963201.1 protein_id gnl|my_center|LOCUS_05570 627211 627657 gene locus_tag LOCUS_05580 627211 627657 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965831.1 protein_id gnl|my_center|LOCUS_05580 627686 629032 gene locus_tag LOCUS_05590 gene dgt 627686 629032 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_05590 629115 632432 gene locus_tag LOCUS_05600 629115 632432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 632613 635216 gene locus_tag LOCUS_05610 632613 635216 CDS product peptidase M36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962454.1 protein_id gnl|my_center|LOCUS_05610 636223 635282 gene locus_tag LOCUS_05620 636223 635282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_05620 637998 636229 gene locus_tag LOCUS_05630 gene dxs 637998 636229 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWC0 protein_id gnl|my_center|LOCUS_05630 638038 638481 gene locus_tag LOCUS_05640 gene tadA 638038 638481 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_05640 638557 639342 gene locus_tag LOCUS_05650 638557 639342 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_05650 641099 639558 gene locus_tag LOCUS_05660 gene cafA 641099 639558 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_05660 641714 641421 gene locus_tag LOCUS_05670 gene hupA 641714 641421 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_05670 641850 642890 gene locus_tag LOCUS_05680 gene mutY 641850 642890 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_05680 642943 643395 gene locus_tag LOCUS_05690 gene ssb 642943 643395 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H058 protein_id gnl|my_center|LOCUS_05690 643418 644707 gene locus_tag LOCUS_05700 643418 644707 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_05700 644709 645272 gene locus_tag LOCUS_05710 gene gldD 644709 645272 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_05710 645708 645319 gene locus_tag LOCUS_05720 645708 645319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 645893 646690 gene locus_tag LOCUS_05730 gene fjo11 645893 646690 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_05730 648792 646738 gene locus_tag LOCUS_05740 648792 646738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 650128 648803 gene locus_tag LOCUS_05750 650128 648803 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_05750 650259 650786 gene locus_tag LOCUS_05760 650259 650786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 650808 651068 gene locus_tag LOCUS_05770 gene rpmA 650808 651068 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P8 protein_id gnl|my_center|LOCUS_05770 655858 651209 gene locus_tag LOCUS_05780 655858 651209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 655966 656048 gene locus_tag LOCUS_t00070 655966 656048 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 656173 657339 gene locus_tag LOCUS_05790 656173 657339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 658037 657564 gene locus_tag LOCUS_05800 658037 657564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 660558 658054 gene locus_tag LOCUS_05810 660558 658054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 661031 660570 gene locus_tag LOCUS_05820 661031 660570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 661516 661034 gene locus_tag LOCUS_05830 661516 661034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 662064 661522 gene locus_tag LOCUS_05840 662064 661522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 662333 662064 gene locus_tag LOCUS_05850 662333 662064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 664107 662359 gene locus_tag LOCUS_05860 664107 662359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 664627 664166 gene locus_tag LOCUS_05870 664627 664166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 664920 664630 gene locus_tag LOCUS_05880 664920 664630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 665236 664871 gene locus_tag LOCUS_05890 665236 664871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 665669 665238 gene locus_tag LOCUS_05900 665669 665238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 666165 665671 gene locus_tag LOCUS_05910 666165 665671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 666484 666242 gene locus_tag LOCUS_05920 666484 666242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 667286 666489 gene locus_tag LOCUS_05930 667286 666489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 667570 667280 gene locus_tag LOCUS_05940 667570 667280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 667944 667573 gene locus_tag LOCUS_05950 667944 667573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 668580 668020 gene locus_tag LOCUS_05960 668580 668020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 669167 668634 gene locus_tag LOCUS_05970 669167 668634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 669906 669145 gene locus_tag LOCUS_05980 669906 669145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 671313 669910 gene locus_tag LOCUS_05990 671313 669910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 671769 671515 gene locus_tag LOCUS_06000 671769 671515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 672019 671813 gene locus_tag LOCUS_06010 672019 671813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 672447 672190 gene locus_tag LOCUS_06020 672447 672190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 672770 672579 gene locus_tag LOCUS_06030 672770 672579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 673078 672875 gene locus_tag LOCUS_06040 673078 672875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 673466 673215 gene locus_tag LOCUS_06050 673466 673215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 673696 673463 gene locus_tag LOCUS_06060 673696 673463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 673883 673722 gene locus_tag LOCUS_06070 673883 673722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 674107 673895 gene locus_tag LOCUS_06080 674107 673895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 674358 674131 gene locus_tag LOCUS_06090 674358 674131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 677288 674361 gene locus_tag LOCUS_06100 677288 674361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 677475 677275 gene locus_tag LOCUS_06110 677475 677275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 677733 677482 gene locus_tag LOCUS_06120 677733 677482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 677919 677737 gene locus_tag LOCUS_06130 677919 677737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 678137 678640 gene locus_tag LOCUS_06140 678137 678640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 678793 678608 gene locus_tag LOCUS_06150 678793 678608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 679244 678786 gene locus_tag LOCUS_06160 679244 678786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 679407 679237 gene locus_tag LOCUS_06170 679407 679237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 679680 680159 gene locus_tag LOCUS_06180 679680 680159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 681246 680824 gene locus_tag LOCUS_06190 681246 680824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 681894 681457 gene locus_tag LOCUS_06200 681894 681457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 681975 682655 gene locus_tag LOCUS_06210 gene glpQ 681975 682655 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_06210 682652 683860 gene locus_tag LOCUS_06220 682652 683860 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_06220 684491 684015 gene locus_tag LOCUS_06230 684491 684015 CDS product sensory protein TspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962480.1 protein_id gnl|my_center|LOCUS_06230 684576 685691 gene locus_tag LOCUS_06240 gene mvaD 684576 685691 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_06240 685701 686009 gene locus_tag LOCUS_06250 685701 686009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 protein_id gnl|my_center|LOCUS_06250 686058 687026 gene locus_tag LOCUS_06260 gene mvaK 686058 687026 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_06260 687033 687953 gene locus_tag LOCUS_06270 687033 687953 CDS product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_06270 687983 688858 gene locus_tag LOCUS_06280 687983 688858 CDS product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962486.1 protein_id gnl|my_center|LOCUS_06280 693051 688891 gene locus_tag LOCUS_06290 693051 688891 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963617.1 protein_id gnl|my_center|LOCUS_06290 694980 693184 gene locus_tag LOCUS_06300 gene lepA 694980 693184 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_06300 695160 696242 gene locus_tag LOCUS_06310 695160 696242 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_06310 696546 696289 gene locus_tag LOCUS_06320 696546 696289 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_06320 696809 696576 gene locus_tag LOCUS_06330 696809 696576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 698566 696812 gene locus_tag LOCUS_06340 gene aspS 698566 696812 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_06340 698737 699732 gene locus_tag LOCUS_06350 698737 699732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962448.1 protein_id gnl|my_center|LOCUS_06350 699897 700241 gene locus_tag LOCUS_06360 699897 700241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962526.1 protein_id gnl|my_center|LOCUS_06360 703793 700311 gene locus_tag LOCUS_06370 703793 700311 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_06370 704972 703806 gene locus_tag LOCUS_06380 704972 703806 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_06380 706340 704997 gene locus_tag LOCUS_06390 706340 704997 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_06390 706944 706342 gene locus_tag LOCUS_06400 706944 706342 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_06400 707108 708082 gene locus_tag LOCUS_06410 707108 708082 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_06410 708151 708501 gene locus_tag LOCUS_06420 708151 708501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964494.1 protein_id gnl|my_center|LOCUS_06420 708985 708485 gene locus_tag LOCUS_06430 708985 708485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964495.1 protein_id gnl|my_center|LOCUS_06430 709146 711917 gene locus_tag LOCUS_06440 gene sucA 709146 711917 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_06440 711984 713201 gene locus_tag LOCUS_06450 gene sucB 711984 713201 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_06450 713726 713289 gene locus_tag LOCUS_06460 713726 713289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 713799 714578 gene locus_tag LOCUS_06470 713799 714578 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_06470 714642 715781 gene locus_tag LOCUS_06480 714642 715781 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_06480 715768 716799 gene locus_tag LOCUS_06490 gene ansA 715768 716799 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_06490 717042 717836 gene locus_tag LOCUS_06500 717042 717836 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_06500 717862 718281 gene locus_tag LOCUS_06510 717862 718281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 718284 718898 gene locus_tag LOCUS_06520 718284 718898 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_06520 718917 719390 gene locus_tag LOCUS_06530 718917 719390 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404423.1 protein_id gnl|my_center|LOCUS_06530 719462 720142 gene locus_tag LOCUS_06540 719462 720142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_06540 720757 720137 gene locus_tag LOCUS_06550 720757 720137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962552.1 protein_id gnl|my_center|LOCUS_06550 722156 720759 gene locus_tag LOCUS_06560 gene rpoN 722156 720759 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_06560 723774 722341 gene locus_tag LOCUS_06570 gene asnS 723774 722341 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_06570 726126 723841 gene locus_tag LOCUS_06580 726126 723841 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_06580 728806 726323 gene locus_tag LOCUS_06590 728806 726323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962609.1 protein_id gnl|my_center|LOCUS_06590 729444 728881 gene locus_tag LOCUS_06600 gene frr 729444 728881 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_06600 730231 729524 gene locus_tag LOCUS_06610 gene pyrH 730231 729524 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_06610 731077 730298 gene locus_tag LOCUS_06620 731077 730298 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768801.1 protein_id gnl|my_center|LOCUS_06620 731159 731767 gene locus_tag LOCUS_06630 731159 731767 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_06630 732376 731759 gene locus_tag LOCUS_06640 732376 731759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038642.1 protein_id gnl|my_center|LOCUS_06640 733064 732366 gene locus_tag LOCUS_06650 gene truB 733064 732366 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_06650 733849 733064 gene locus_tag LOCUS_06660 gene uppP 733849 733064 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H239 protein_id gnl|my_center|LOCUS_06660 734092 733853 gene locus_tag LOCUS_06670 gene fjo13 734092 733853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_06670 735039 734164 gene locus_tag LOCUS_06680 gene ftsX 735039 734164 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_06680 735183 735935 gene locus_tag LOCUS_06690 735183 735935 CDS product phospholipid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964451.1 protein_id gnl|my_center|LOCUS_06690 735978 739019 gene locus_tag LOCUS_06700 gene leuS 735978 739019 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H244 protein_id gnl|my_center|LOCUS_06700 739025 739816 gene locus_tag LOCUS_06710 739025 739816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 740176 740715 gene locus_tag LOCUS_06720 740176 740715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 740819 741238 gene locus_tag LOCUS_06730 740819 741238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 741247 741432 gene locus_tag LOCUS_06740 741247 741432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 741513 742193 gene locus_tag LOCUS_06750 741513 742193 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_06750 742710 742240 gene locus_tag LOCUS_06760 742710 742240 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_06760 744169 742799 gene locus_tag LOCUS_06770 744169 742799 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_06770 744292 744681 gene locus_tag LOCUS_06780 744292 744681 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_06780 744751 746376 gene locus_tag LOCUS_06790 gene pckA 744751 746376 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H256 protein_id gnl|my_center|LOCUS_06790 747207 746449 gene locus_tag LOCUS_06800 747207 746449 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_06800 747879 747217 gene locus_tag LOCUS_06810 747879 747217 CDS product DUF4271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962358.1 protein_id gnl|my_center|LOCUS_06810 748036 747857 gene locus_tag LOCUS_06820 748036 747857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 747987 748709 gene locus_tag LOCUS_06830 747987 748709 CDS product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962342.1 protein_id gnl|my_center|LOCUS_06830 748709 750052 gene locus_tag LOCUS_06840 gene pyrC1 748709 750052 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_06840 750055 750450 gene locus_tag LOCUS_06850 750055 750450 CDS product lipoprotein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962340.1 protein_id gnl|my_center|LOCUS_06850 751420 750419 gene locus_tag LOCUS_06860 751420 750419 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_06860 751527 752834 gene locus_tag LOCUS_06870 gene tyrS 751527 752834 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 protein_id gnl|my_center|LOCUS_06870 753831 752836 gene locus_tag LOCUS_06880 753831 752836 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_06880 754701 753895 gene locus_tag LOCUS_06890 754701 753895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 755177 754806 gene locus_tag LOCUS_06900 755177 754806 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962299.1 protein_id gnl|my_center|LOCUS_06900 756389 755241 gene locus_tag LOCUS_06910 756389 755241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 759306 756535 gene locus_tag LOCUS_06920 759306 756535 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_06920 759485 760177 gene locus_tag LOCUS_06930 gene phoP 759485 760177 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_06930 760299 761210 gene locus_tag LOCUS_06940 gene phoR 760299 761210 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_06940 762236 761193 gene locus_tag LOCUS_06950 762236 761193 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_06950 763077 762259 gene locus_tag LOCUS_06960 763077 762259 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_06960 763180 763854 gene locus_tag LOCUS_06970 gene trmB 763180 763854 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_06970 763877 764503 gene locus_tag LOCUS_06980 763877 764503 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962540.1 protein_id gnl|my_center|LOCUS_06980 764508 764852 gene locus_tag LOCUS_06990 gene ogt2 764508 764852 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_06990 764863 765720 gene locus_tag LOCUS_07000 764863 765720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 765884 767026 gene locus_tag LOCUS_07010 gene mrp 765884 767026 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 protein_id gnl|my_center|LOCUS_07010 767028 767267 gene locus_tag LOCUS_07020 767028 767267 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_07020 767351 768409 gene locus_tag LOCUS_07030 767351 768409 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_07030 768409 768738 gene locus_tag LOCUS_07040 768409 768738 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_07040 769558 768776 gene locus_tag LOCUS_07050 769558 768776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_07050 770859 769681 gene locus_tag LOCUS_07060 gene gcdH 770859 769681 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_07060 771696 770986 gene locus_tag LOCUS_07070 771696 770986 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI6 protein_id gnl|my_center|LOCUS_07070 772235 771708 gene locus_tag LOCUS_07080 gene rimM 772235 771708 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_07080 772807 772253 gene locus_tag LOCUS_07090 gene rpsP 772807 772253 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI4 protein_id gnl|my_center|LOCUS_07090 772947 773684 gene locus_tag LOCUS_07100 772947 773684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962514.1 protein_id gnl|my_center|LOCUS_07100 773839 778350 gene locus_tag LOCUS_07110 gene dnaE 773839 778350 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_07110 778417 778992 gene locus_tag LOCUS_07120 778417 778992 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962861.1 protein_id gnl|my_center|LOCUS_07120 779104 779421 gene locus_tag LOCUS_07130 779104 779421 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_07130 779650 780576 gene locus_tag LOCUS_07140 779650 780576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_07140 780662 780736 gene locus_tag LOCUS_t00080 780662 780736 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2 266 472 gene locus_tag LOCUS_07150 266 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 707 907 gene locus_tag LOCUS_07160 707 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3405 958 gene locus_tag LOCUS_07170 3405 958 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_07170 3831 3490 gene locus_tag LOCUS_07180 3831 3490 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_07180 3911 4825 gene locus_tag LOCUS_07190 gene yyaK 3911 4825 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_07190 4800 5864 gene locus_tag LOCUS_07200 gene menE 4800 5864 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_07200 6410 5988 gene locus_tag LOCUS_07210 6410 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 8129 6501 gene locus_tag LOCUS_07220 8129 6501 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_07220 9921 8284 gene locus_tag LOCUS_07230 9921 8284 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263346.1 protein_id gnl|my_center|LOCUS_07230 10281 9985 gene locus_tag LOCUS_07240 10281 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 11977 10319 gene locus_tag LOCUS_07250 11977 10319 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_07250 13318 12062 gene locus_tag LOCUS_07260 13318 12062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 14199 13336 gene locus_tag LOCUS_07270 gene prfB 14199 13336 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_07270 14484 15509 gene locus_tag LOCUS_07280 gene ltaE 14484 15509 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_07280 15860 15537 gene locus_tag LOCUS_07290 15860 15537 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY02 protein_id gnl|my_center|LOCUS_07290 15926 18058 gene locus_tag LOCUS_07300 gene ptrB 15926 18058 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_07300 18138 19178 gene locus_tag LOCUS_07310 18138 19178 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963027.1 protein_id gnl|my_center|LOCUS_07310 19289 20239 gene locus_tag LOCUS_07320 19289 20239 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939052.1 protein_id gnl|my_center|LOCUS_07320 20264 20662 gene locus_tag LOCUS_07330 20264 20662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 20746 21216 gene locus_tag LOCUS_07340 20746 21216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 22341 21268 gene locus_tag LOCUS_07350 22341 21268 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_07350 22591 23583 gene locus_tag LOCUS_07360 gene ykfB 22591 23583 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121963.1 protein_id gnl|my_center|LOCUS_07360 23632 24435 gene locus_tag LOCUS_07370 23632 24435 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_07370 24577 25233 gene locus_tag LOCUS_07380 gene tal 24577 25233 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_07380 26694 25291 gene locus_tag LOCUS_07390 26694 25291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963192.1 protein_id gnl|my_center|LOCUS_07390 26838 28457 gene locus_tag LOCUS_07400 26838 28457 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_07400 29302 28511 gene locus_tag LOCUS_07410 29302 28511 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_07410 30416 29421 gene locus_tag LOCUS_07420 30416 29421 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_07420 30819 30424 gene locus_tag LOCUS_07430 30819 30424 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_07430 30931 31935 gene locus_tag LOCUS_07440 gene holA 30931 31935 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_07440 31965 34142 gene locus_tag LOCUS_07450 31965 34142 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_07450 34214 34396 gene locus_tag LOCUS_07460 34214 34396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963197.1 protein_id gnl|my_center|LOCUS_07460 34519 36213 gene locus_tag LOCUS_07470 34519 36213 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 protein_id gnl|my_center|LOCUS_07470 36292 38493 gene locus_tag LOCUS_07480 36292 38493 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_07480 39269 38496 gene locus_tag LOCUS_07490 39269 38496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_07490 40105 39311 gene locus_tag LOCUS_07500 40105 39311 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212588.1 protein_id gnl|my_center|LOCUS_07500 41391 40147 gene locus_tag LOCUS_07510 41391 40147 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963811.1 protein_id gnl|my_center|LOCUS_07510 42456 41434 gene locus_tag LOCUS_07520 42456 41434 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963810.1 protein_id gnl|my_center|LOCUS_07520 42572 43450 gene locus_tag LOCUS_07530 42572 43450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963809.1 protein_id gnl|my_center|LOCUS_07530 44736 43498 gene locus_tag LOCUS_07540 gene hutI 44736 43498 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_07540 44809 45879 gene locus_tag LOCUS_07550 gene corA 44809 45879 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H3 protein_id gnl|my_center|LOCUS_07550 46736 45876 gene locus_tag LOCUS_07560 46736 45876 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963827.1 protein_id gnl|my_center|LOCUS_07560 46904 47680 gene locus_tag LOCUS_07570 46904 47680 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_07570 47745 49061 gene locus_tag LOCUS_07580 47745 49061 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_07580 49091 50056 gene locus_tag LOCUS_07590 49091 50056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 50250 52703 gene locus_tag LOCUS_07600 gene lon 50250 52703 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_07600 52875 53843 gene locus_tag LOCUS_07610 gene porQ 52875 53843 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_07610 53843 54535 gene locus_tag LOCUS_07620 gene cmk 53843 54535 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 protein_id gnl|my_center|LOCUS_07620 54557 55789 gene locus_tag LOCUS_07630 gene nupG 54557 55789 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963821.1 protein_id gnl|my_center|LOCUS_07630 55955 57721 gene locus_tag LOCUS_07640 gene rpsA 55955 57721 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963900.1 protein_id gnl|my_center|LOCUS_07640 57858 58181 gene locus_tag LOCUS_07650 57858 58181 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_07650 58214 58687 gene locus_tag LOCUS_07660 58214 58687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_07660 58689 59306 gene locus_tag LOCUS_07670 58689 59306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_07670 59309 59926 gene locus_tag LOCUS_07680 gene arsC 59309 59926 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_07680 59916 60569 gene locus_tag LOCUS_07690 59916 60569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 62333 60603 gene locus_tag LOCUS_07700 62333 60603 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963841.1 protein_id gnl|my_center|LOCUS_07700 62684 62427 gene locus_tag LOCUS_07710 62684 62427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_07710 63120 62788 gene locus_tag LOCUS_07720 63120 62788 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_07720 63821 63183 gene locus_tag LOCUS_07730 63821 63183 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963839.1 protein_id gnl|my_center|LOCUS_07730 66184 63998 gene locus_tag LOCUS_07740 gene katG1 66184 63998 CDS product catalase-peroxidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E981 protein_id gnl|my_center|LOCUS_07740 67755 66298 gene locus_tag LOCUS_07750 67755 66298 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_07750 69043 67841 gene locus_tag LOCUS_07760 69043 67841 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_07760 69206 69667 gene locus_tag LOCUS_07770 69206 69667 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_07770 69759 71162 gene locus_tag LOCUS_07780 gene lpdA1 69759 71162 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_07780 71396 72706 gene locus_tag LOCUS_07790 gene pabB 71396 72706 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_07790 72771 73127 gene locus_tag LOCUS_07800 72771 73127 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_07800 73179 74489 gene locus_tag LOCUS_07810 gene tilS 73179 74489 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_07810 74486 76537 gene locus_tag LOCUS_07820 gene dsbD 74486 76537 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_07820 77641 76568 gene locus_tag LOCUS_07830 77641 76568 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254505.1 protein_id gnl|my_center|LOCUS_07830 78792 77641 gene locus_tag LOCUS_07840 gene alr 78792 77641 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_07840 79915 78785 gene locus_tag LOCUS_07850 79915 78785 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 protein_id gnl|my_center|LOCUS_07850 80356 79922 gene locus_tag LOCUS_07860 80356 79922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 81803 80337 gene locus_tag LOCUS_07870 gene putP 81803 80337 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_07870 82103 83638 gene locus_tag LOCUS_07880 82103 83638 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_07880 85607 83703 gene locus_tag LOCUS_07890 85607 83703 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_07890 86527 85619 gene locus_tag LOCUS_07900 86527 85619 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_07900 90371 86568 gene locus_tag LOCUS_07910 90371 86568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 90845 90387 gene locus_tag LOCUS_07920 90845 90387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 91192 91710 gene locus_tag LOCUS_07930 gene sixA 91192 91710 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_07930 91676 93763 gene locus_tag LOCUS_07940 gene ppk 91676 93763 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY90 protein_id gnl|my_center|LOCUS_07940 93803 94693 gene locus_tag LOCUS_07950 gene ppx 93803 94693 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_07950 96153 94765 gene locus_tag LOCUS_07960 gene lpdA2 96153 94765 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_07960 97982 96231 gene locus_tag LOCUS_07970 97982 96231 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_07970 98778 98041 gene locus_tag LOCUS_07980 gene truA 98778 98041 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_07980 98932 99426 gene locus_tag LOCUS_07990 98932 99426 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_07990 99917 99507 gene locus_tag LOCUS_08000 99917 99507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_08000 100106 101776 gene locus_tag LOCUS_08010 gene rho 100106 101776 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_08010 102389 101817 gene locus_tag LOCUS_08020 102389 101817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904290.1 protein_id gnl|my_center|LOCUS_08020 102834 102400 gene locus_tag LOCUS_08030 102834 102400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 105409 102857 gene locus_tag LOCUS_08040 gene clpA 105409 102857 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_08040 105670 108231 gene locus_tag LOCUS_08050 gene gyrA 105670 108231 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_08050 108296 109426 gene locus_tag LOCUS_08060 108296 109426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 110216 109455 gene locus_tag LOCUS_08070 110216 109455 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_08070 111462 110284 gene locus_tag LOCUS_08080 111462 110284 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_08080 111747 111831 gene locus_tag LOCUS_t00090 111747 111831 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 111839 111914 gene locus_tag LOCUS_t00100 111839 111914 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 111928 112002 gene locus_tag LOCUS_t00110 111928 112002 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 112616 112050 gene locus_tag LOCUS_08090 112616 112050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963734.1 protein_id gnl|my_center|LOCUS_08090 113805 112627 gene locus_tag LOCUS_08100 113805 112627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 protein_id gnl|my_center|LOCUS_08100 114902 113808 gene locus_tag LOCUS_08110 114902 113808 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_08110 115423 114920 gene locus_tag LOCUS_08120 115423 114920 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_08120 116464 115511 gene locus_tag LOCUS_08130 116464 115511 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963731.1 protein_id gnl|my_center|LOCUS_08130 117613 116663 gene locus_tag LOCUS_08140 117613 116663 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963731.1 protein_id gnl|my_center|LOCUS_08140 118403 117756 gene locus_tag LOCUS_08150 118403 117756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_08150 119100 118393 gene locus_tag LOCUS_08160 119100 118393 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_08160 120127 119105 gene locus_tag LOCUS_08170 gene tsaD 120127 119105 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_08170 120310 124743 gene locus_tag LOCUS_08180 120310 124743 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_08180 124788 125774 gene locus_tag LOCUS_08190 gene pfkA 124788 125774 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_08190 125842 126843 gene locus_tag LOCUS_08200 gene gapA3 125842 126843 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H007 protein_id gnl|my_center|LOCUS_08200 126924 127775 gene locus_tag LOCUS_08210 126924 127775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_08210 127795 128178 gene locus_tag LOCUS_08220 gene mgsA 127795 128178 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51339 protein_id gnl|my_center|LOCUS_08220 128792 128337 gene locus_tag LOCUS_08230 128792 128337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 129555 128989 gene locus_tag LOCUS_08240 129555 128989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 130032 129652 gene locus_tag LOCUS_08250 gene yjgF 130032 129652 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_08250 132748 130061 gene locus_tag LOCUS_08260 132748 130061 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_08260 132798 133943 gene locus_tag LOCUS_08270 132798 133943 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_08270 133978 134928 gene locus_tag LOCUS_08280 133978 134928 CDS product organic solvent ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_08280 134939 136270 gene locus_tag LOCUS_08290 134939 136270 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_08290 136329 136775 gene locus_tag LOCUS_08300 136329 136775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_08300 136802 137593 gene locus_tag LOCUS_08310 136802 137593 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_08310 137596 138207 gene locus_tag LOCUS_08320 137596 138207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 138210 138692 gene locus_tag LOCUS_08330 138210 138692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_08330 138835 139437 gene locus_tag LOCUS_08340 138835 139437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 139544 142438 gene locus_tag LOCUS_08350 139544 142438 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_08350 142464 142919 gene locus_tag LOCUS_08360 142464 142919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_08360 142985 144118 gene locus_tag LOCUS_08370 142985 144118 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_08370 144118 144546 gene locus_tag LOCUS_08380 144118 144546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 145080 144589 gene locus_tag LOCUS_08390 145080 144589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 145913 145131 gene locus_tag LOCUS_08400 145913 145131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 146036 147091 gene locus_tag LOCUS_08410 gene aroC 146036 147091 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_08410 147296 148978 gene locus_tag LOCUS_08420 147296 148978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 149449 149027 gene locus_tag LOCUS_08430 gene yuxK 149449 149027 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_08430 151662 149494 gene locus_tag LOCUS_08440 151662 149494 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG0 protein_id gnl|my_center|LOCUS_08440 151729 152394 gene locus_tag LOCUS_08450 gene ung 151729 152394 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYF9 protein_id gnl|my_center|LOCUS_08450 153333 152401 gene locus_tag LOCUS_08460 153333 152401 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963182.1 protein_id gnl|my_center|LOCUS_08460 154206 153361 gene locus_tag LOCUS_08470 154206 153361 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_08470 154800 154267 gene locus_tag LOCUS_08480 154800 154267 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963178.1 protein_id gnl|my_center|LOCUS_08480 155252 154878 gene locus_tag LOCUS_08490 gene yycE 155252 154878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37479 protein_id gnl|my_center|LOCUS_08490 156204 155338 gene locus_tag LOCUS_08500 gene udp 156204 155338 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_08500 156644 156300 gene locus_tag LOCUS_08510 156644 156300 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963176.1 protein_id gnl|my_center|LOCUS_08510 157194 156796 gene locus_tag LOCUS_08520 157194 156796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_08520 158313 157360 gene locus_tag LOCUS_08530 158313 157360 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_08530 158524 160500 gene locus_tag LOCUS_08540 gene bfmBA 158524 160500 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_08540 160704 161927 gene locus_tag LOCUS_08550 160704 161927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 161928 162428 gene locus_tag LOCUS_08560 161928 162428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 162589 162948 gene locus_tag LOCUS_08570 162589 162948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 163239 163760 gene locus_tag LOCUS_08580 163239 163760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 163932 164303 gene locus_tag LOCUS_08590 163932 164303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 164433 165188 gene locus_tag LOCUS_08600 164433 165188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 165997 165248 gene locus_tag LOCUS_08610 gene maiA 165997 165248 CDS product maleate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFK2 protein_id gnl|my_center|LOCUS_08610 166465 166142 gene locus_tag LOCUS_08620 166465 166142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_08620 167423 166515 gene locus_tag LOCUS_08630 167423 166515 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963171.1 protein_id gnl|my_center|LOCUS_08630 168620 167508 gene locus_tag LOCUS_08640 168620 167508 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086196.1 protein_id gnl|my_center|LOCUS_08640 169680 168700 gene locus_tag LOCUS_08650 169680 168700 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GE3 protein_id gnl|my_center|LOCUS_08650 170165 169743 gene locus_tag LOCUS_08660 170165 169743 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 protein_id gnl|my_center|LOCUS_08660 171743 170166 gene locus_tag LOCUS_08670 171743 170166 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088817.1 protein_id gnl|my_center|LOCUS_08670 172117 171764 gene locus_tag LOCUS_08680 172117 171764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 protein_id gnl|my_center|LOCUS_08680 174444 172141 gene locus_tag LOCUS_08690 174444 172141 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527977.1 protein_id gnl|my_center|LOCUS_08690 174925 174455 gene locus_tag LOCUS_08700 174925 174455 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049451.1 protein_id gnl|my_center|LOCUS_08700 175533 174928 gene locus_tag LOCUS_08710 175533 174928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67071 protein_id gnl|my_center|LOCUS_08710 175660 177567 gene locus_tag LOCUS_08720 gene acsA 175660 177567 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_08720 178172 177564 gene locus_tag LOCUS_08730 178172 177564 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963091.1 protein_id gnl|my_center|LOCUS_08730 180093 178174 gene locus_tag LOCUS_08740 180093 178174 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963092.1 protein_id gnl|my_center|LOCUS_08740 180266 180631 gene locus_tag LOCUS_08750 180266 180631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 180744 181352 gene locus_tag LOCUS_08760 180744 181352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 181349 181621 gene locus_tag LOCUS_08770 gene ydzA 181349 181621 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_08770 181637 182878 gene locus_tag LOCUS_08780 gene mscS2 181637 182878 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_08780 182969 183361 gene locus_tag LOCUS_08790 182969 183361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_08790 184023 183358 gene locus_tag LOCUS_08800 184023 183358 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_08800 184414 184025 gene locus_tag LOCUS_08810 184414 184025 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963098.1 protein_id gnl|my_center|LOCUS_08810 184448 185035 gene locus_tag LOCUS_08820 184448 185035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 185183 186220 gene locus_tag LOCUS_08830 185183 186220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 186841 186242 gene locus_tag LOCUS_08840 gene hisIE 186841 186242 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 protein_id gnl|my_center|LOCUS_08840 187704 186949 gene locus_tag LOCUS_08850 gene hisF 187704 186949 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_08850 188498 187776 gene locus_tag LOCUS_08860 gene hisA 188498 187776 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_08860 189121 188540 gene locus_tag LOCUS_08870 gene hisH 189121 188540 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY77 protein_id gnl|my_center|LOCUS_08870 190342 189203 gene locus_tag LOCUS_08880 gene hisB 190342 189203 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 protein_id gnl|my_center|LOCUS_08880 191381 190344 gene locus_tag LOCUS_08890 gene hisC 191381 190344 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY79 protein_id gnl|my_center|LOCUS_08890 192670 191381 gene locus_tag LOCUS_08900 gene hisD 192670 191381 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY80 protein_id gnl|my_center|LOCUS_08900 193563 192706 gene locus_tag LOCUS_08910 gene hisG 193563 192706 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY81 protein_id gnl|my_center|LOCUS_08910 193976 194434 gene locus_tag LOCUS_08920 193976 194434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 196347 194431 gene locus_tag LOCUS_08930 196347 194431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_08930 197289 196543 gene locus_tag LOCUS_08940 197289 196543 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_08940 197428 198612 gene locus_tag LOCUS_08950 gene mauG 197428 198612 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_08950 199558 198686 gene locus_tag LOCUS_08960 gene sucD 199558 198686 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_08960 200005 199643 gene locus_tag LOCUS_08970 200005 199643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963120.1 protein_id gnl|my_center|LOCUS_08970 200936 200007 gene locus_tag LOCUS_08980 200936 200007 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_08980 201540 200974 gene locus_tag LOCUS_08990 gene efp 201540 200974 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_08990 202364 201579 gene locus_tag LOCUS_09000 gene lpxA 202364 201579 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_09000 203756 202368 gene locus_tag LOCUS_09010 gene fabZ 203756 202368 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_09010 204779 203763 gene locus_tag LOCUS_09020 gene lpxD 204779 203763 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_09020 206046 204811 gene locus_tag LOCUS_09030 206046 204811 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_09030 206202 207755 gene locus_tag LOCUS_09040 gene porX 206202 207755 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_09040 207762 208175 gene locus_tag LOCUS_09050 207762 208175 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_09050 208262 209458 gene locus_tag LOCUS_09060 gene ald 208262 209458 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_09060 209513 209899 gene locus_tag LOCUS_09070 209513 209899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963214.1 protein_id gnl|my_center|LOCUS_09070 209984 210059 gene locus_tag LOCUS_t00120 209984 210059 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 210162 210527 gene locus_tag LOCUS_09080 210162 210527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_09080 211753 210587 gene locus_tag LOCUS_09090 gene putA 211753 210587 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_09090 211849 212916 gene locus_tag LOCUS_09100 gene aroB 211849 212916 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_09100 213210 214610 gene locus_tag LOCUS_09110 gene speA 213210 214610 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_09110 214655 215629 gene locus_tag LOCUS_09120 214655 215629 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_09120 215716 216021 gene locus_tag LOCUS_09130 215716 216021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963820.1 protein_id gnl|my_center|LOCUS_09130 216566 216054 gene locus_tag LOCUS_09140 216566 216054 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_09140 217091 216612 gene locus_tag LOCUS_09150 217091 216612 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 protein_id gnl|my_center|LOCUS_09150 218320 217139 gene locus_tag LOCUS_09160 218320 217139 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_09160 218592 219071 gene locus_tag LOCUS_09170 218592 219071 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_09170 219590 219072 gene locus_tag LOCUS_09180 219590 219072 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_09180 219685 220350 gene locus_tag LOCUS_09190 gene speE 219685 220350 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962995.1 protein_id gnl|my_center|LOCUS_09190 220795 220343 gene locus_tag LOCUS_09200 220795 220343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 221524 220799 gene locus_tag LOCUS_09210 gene kdsB 221524 220799 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_09210 223029 221608 gene locus_tag LOCUS_09220 223029 221608 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_09220 223153 223914 gene locus_tag LOCUS_09230 223153 223914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 223898 224710 gene locus_tag LOCUS_09240 223898 224710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 protein_id gnl|my_center|LOCUS_09240 224707 225264 gene locus_tag LOCUS_09250 224707 225264 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_09250 225933 225265 gene locus_tag LOCUS_09260 225933 225265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 226399 226695 gene locus_tag LOCUS_09270 226399 226695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 226810 227895 gene locus_tag LOCUS_09280 226810 227895 CDS product DNA polymerase III, subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963113.1 protein_id gnl|my_center|LOCUS_09280 228192 228530 gene locus_tag LOCUS_09290 228192 228530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 229083 228589 gene locus_tag LOCUS_09300 229083 228589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 229883 229239 gene locus_tag LOCUS_09310 gene pdxH 229883 229239 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 protein_id gnl|my_center|LOCUS_09310 230843 229935 gene locus_tag LOCUS_09320 gene rnz 230843 229935 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_09320 231222 230890 gene locus_tag LOCUS_09330 231222 230890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963901.1 protein_id gnl|my_center|LOCUS_09330 232187 231261 gene locus_tag LOCUS_09340 gene pyrB 232187 231261 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_09340 232752 232210 gene locus_tag LOCUS_09350 gene pyrR1 232752 232210 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_09350 233721 232873 gene locus_tag LOCUS_09360 233721 232873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_09360 233855 234316 gene locus_tag LOCUS_09370 233855 234316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_09370 234331 235617 gene locus_tag LOCUS_09380 gene phrB1 234331 235617 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_09380 236328 235612 gene locus_tag LOCUS_09390 236328 235612 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962785.1 protein_id gnl|my_center|LOCUS_09390 236392 236934 gene locus_tag LOCUS_09400 236392 236934 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_09400 236965 237378 gene locus_tag LOCUS_09410 236965 237378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 237382 237822 gene locus_tag LOCUS_09420 237382 237822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_09420 238920 237868 gene locus_tag LOCUS_09430 238920 237868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_09430 239077 240240 gene locus_tag LOCUS_09440 239077 240240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 240310 241524 gene locus_tag LOCUS_09450 gene rsmB 240310 241524 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_09450 241529 242620 gene locus_tag LOCUS_09460 241529 242620 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962855.1 protein_id gnl|my_center|LOCUS_09460 243405 242704 gene locus_tag LOCUS_09470 243405 242704 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_09470 243857 243411 gene locus_tag LOCUS_09480 gene ccoH 243857 243411 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_09480 245299 243881 gene locus_tag LOCUS_09490 gene ccoG 245299 243881 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_09490 246262 245348 gene locus_tag LOCUS_09500 gene ccoP 246262 245348 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_09500 246446 246279 gene locus_tag LOCUS_09510 gene ccoQ 246446 246279 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963295.1 protein_id gnl|my_center|LOCUS_09510 248649 246454 gene locus_tag LOCUS_09520 gene ccoN/ccoO 248649 246454 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_09520 248850 248686 gene locus_tag LOCUS_09530 248850 248686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 251305 248927 gene locus_tag LOCUS_09540 gene ccoI 251305 248927 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_09540 251411 252088 gene locus_tag LOCUS_09550 251411 252088 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_09550 252411 252106 gene locus_tag LOCUS_09560 252411 252106 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_09560 252495 252989 gene locus_tag LOCUS_09570 252495 252989 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_09570 252994 253629 gene locus_tag LOCUS_09580 252994 253629 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_09580 253649 254212 gene locus_tag LOCUS_09590 gene yceI 253649 254212 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_09590 254481 255881 gene locus_tag LOCUS_09600 gene trpE 254481 255881 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_09600 255988 256551 gene locus_tag LOCUS_09610 gene pabA 255988 256551 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_09610 256607 257599 gene locus_tag LOCUS_09620 gene trpD 256607 257599 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_09620 257658 258458 gene locus_tag LOCUS_09630 gene trpC 257658 258458 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_09630 258583 259251 gene locus_tag LOCUS_09640 gene trpF 258583 259251 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_09640 259235 260422 gene locus_tag LOCUS_09650 gene trpB 259235 260422 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_09650 260570 261334 gene locus_tag LOCUS_09660 gene trpA 260570 261334 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_09660 261481 262041 gene locus_tag LOCUS_09670 261481 262041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 262061 263599 gene locus_tag LOCUS_09680 262061 263599 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785160.1 protein_id gnl|my_center|LOCUS_09680 263866 264171 gene locus_tag LOCUS_09690 263866 264171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 264256 264705 gene locus_tag LOCUS_09700 264256 264705 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110256.1 protein_id gnl|my_center|LOCUS_09700 264722 265366 gene locus_tag LOCUS_09710 264722 265366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703118.1 protein_id gnl|my_center|LOCUS_09710 265450 266247 gene locus_tag LOCUS_09720 265450 266247 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DYV8 protein_id gnl|my_center|LOCUS_09720 267059 266253 gene locus_tag LOCUS_09730 267059 266253 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ8 protein_id gnl|my_center|LOCUS_09730 267132 267572 gene locus_tag LOCUS_09740 267132 267572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 268098 267604 gene locus_tag LOCUS_09750 268098 267604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963236.1 protein_id gnl|my_center|LOCUS_09750 268891 268109 gene locus_tag LOCUS_09760 gene phnP 268891 268109 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_09760 268978 270450 gene locus_tag LOCUS_09770 268978 270450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_09770 270932 270480 gene locus_tag LOCUS_09780 270932 270480 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_09780 270983 271648 gene locus_tag LOCUS_09790 gene nth 270983 271648 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_09790 271692 272537 gene locus_tag LOCUS_09800 271692 272537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 272758 272579 gene locus_tag LOCUS_09810 272758 272579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 273357 272773 gene locus_tag LOCUS_09820 273357 272773 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_09820 273681 276470 gene locus_tag LOCUS_09830 gene uvrA1 273681 276470 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_09830 276659 277255 gene locus_tag LOCUS_09840 276659 277255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 277252 277725 gene locus_tag LOCUS_09850 gene rlmH 277252 277725 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_09850 277835 278323 gene locus_tag LOCUS_09860 277835 278323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962817.1 protein_id gnl|my_center|LOCUS_09860 279082 278372 gene locus_tag LOCUS_09870 279082 278372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 279900 279079 gene locus_tag LOCUS_09880 gene folP 279900 279079 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_09880 279990 280532 gene locus_tag LOCUS_09890 279990 280532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_09890 280544 281659 gene locus_tag LOCUS_09900 280544 281659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_09900 281758 282258 gene locus_tag LOCUS_09910 gene tlpA 281758 282258 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963549.1 protein_id gnl|my_center|LOCUS_09910 282334 283083 gene locus_tag LOCUS_09920 gene tpiA 282334 283083 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI2 protein_id gnl|my_center|LOCUS_09920 283087 283527 gene locus_tag LOCUS_09930 283087 283527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 283529 283918 gene locus_tag LOCUS_09940 283529 283918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 283932 284297 gene locus_tag LOCUS_09950 283932 284297 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097074.1 protein_id gnl|my_center|LOCUS_09950 284801 284307 gene locus_tag LOCUS_09960 284801 284307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 286349 284847 gene locus_tag LOCUS_09970 gene hutH1 286349 284847 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW5 protein_id gnl|my_center|LOCUS_09970 286514 287596 gene locus_tag LOCUS_09980 gene gcvT 286514 287596 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_09980 287704 288426 gene locus_tag LOCUS_09990 287704 288426 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_09990 289504 288485 gene locus_tag LOCUS_10000 289504 288485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 290017 289517 gene locus_tag LOCUS_10010 290017 289517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 290639 290019 gene locus_tag LOCUS_10020 290639 290019 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_10020 291006 290719 gene locus_tag LOCUS_10030 291006 290719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_10030 293395 291062 gene locus_tag LOCUS_10040 gene uvrD 293395 291062 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_10040 293827 294351 gene locus_tag LOCUS_10050 293827 294351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_10050 294487 294861 gene locus_tag LOCUS_10060 294487 294861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 295857 294949 gene locus_tag LOCUS_10070 295857 294949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 296768 295926 gene locus_tag LOCUS_10080 296768 295926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 298900 296831 gene locus_tag LOCUS_10090 298900 296831 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963153.1 protein_id gnl|my_center|LOCUS_10090 299005 299745 gene locus_tag LOCUS_10100 299005 299745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_10100 299896 301995 gene locus_tag LOCUS_10110 gene recG 299896 301995 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_10110 302018 302944 gene locus_tag LOCUS_10120 302018 302944 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_10120 303030 305459 gene locus_tag LOCUS_10130 gene pheT 303030 305459 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_10130 305471 306220 gene locus_tag LOCUS_10140 305471 306220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 306297 307055 gene locus_tag LOCUS_10150 306297 307055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_10150 307039 307566 gene locus_tag LOCUS_10160 gene kdsC 307039 307566 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_10160 307804 308724 gene locus_tag LOCUS_10170 307804 308724 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_10170 308717 309295 gene locus_tag LOCUS_10180 308717 309295 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_10180 309296 310780 gene locus_tag LOCUS_10190 309296 310780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 310853 313297 gene locus_tag LOCUS_10200 310853 313297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 313407 315092 gene locus_tag LOCUS_10210 313407 315092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 317039 315153 gene locus_tag LOCUS_10220 gene dnaK 317039 315153 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_10220 317288 318709 gene locus_tag LOCUS_10230 gene sdaA 317288 318709 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_10230 319221 318706 gene locus_tag LOCUS_10240 319221 318706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 319609 319202 gene locus_tag LOCUS_10250 319609 319202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 321023 319737 gene locus_tag LOCUS_10260 321023 319737 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_10260 321126 321944 gene locus_tag LOCUS_10270 gene panB 321126 321944 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_10270 321975 322664 gene locus_tag LOCUS_10280 321975 322664 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_10280 322670 323467 gene locus_tag LOCUS_10290 322670 323467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 323478 324836 gene locus_tag LOCUS_10300 323478 324836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 324859 325716 gene locus_tag LOCUS_10310 324859 325716 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962903.1 protein_id gnl|my_center|LOCUS_10310 325806 326228 gene locus_tag LOCUS_10320 325806 326228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 327110 326250 gene locus_tag LOCUS_10330 327110 326250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 328567 327278 gene locus_tag LOCUS_10340 gene rhlE 328567 327278 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FY79 protein_id gnl|my_center|LOCUS_10340 329807 328767 gene locus_tag LOCUS_10350 329807 328767 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_10350 330435 329797 gene locus_tag LOCUS_10360 330435 329797 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962813.1 protein_id gnl|my_center|LOCUS_10360 330530 331498 gene locus_tag LOCUS_10370 gene ddl 330530 331498 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD5 protein_id gnl|my_center|LOCUS_10370 331628 332065 gene locus_tag LOCUS_10380 331628 332065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 332071 332526 gene locus_tag LOCUS_10390 gene coaD 332071 332526 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_10390 332710 334251 gene locus_tag LOCUS_10400 332710 334251 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_10400 334417 334944 gene locus_tag LOCUS_10410 334417 334944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 335759 335124 gene locus_tag LOCUS_10420 335759 335124 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 protein_id gnl|my_center|LOCUS_10420 337311 335911 gene locus_tag LOCUS_10430 gene dbpA 337311 335911 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_10430 337347 337901 gene locus_tag LOCUS_10440 337347 337901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 337898 339607 gene locus_tag LOCUS_10450 337898 339607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_10450 339615 340235 gene locus_tag LOCUS_10460 339615 340235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 340891 340289 gene locus_tag LOCUS_10470 340891 340289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 340899 341546 gene locus_tag LOCUS_10480 gene pyrE 340899 341546 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 protein_id gnl|my_center|LOCUS_10480 341558 341950 gene locus_tag LOCUS_10490 341558 341950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 protein_id gnl|my_center|LOCUS_10490 342144 342070 gene locus_tag LOCUS_t00130 342144 342070 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 342925 342209 gene locus_tag LOCUS_10500 342925 342209 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_10500 343998 342931 gene locus_tag LOCUS_10510 gene menF 343998 342931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 protein_id gnl|my_center|LOCUS_10510 344365 343991 gene locus_tag LOCUS_10520 344365 343991 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_10520 344625 346067 gene locus_tag LOCUS_10530 344625 346067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_10530 346125 346730 gene locus_tag LOCUS_10540 346125 346730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 346868 350524 gene locus_tag LOCUS_10550 gene purL 346868 350524 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXH5 protein_id gnl|my_center|LOCUS_10550 351164 350562 gene locus_tag LOCUS_10560 351164 350562 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963038.1 protein_id gnl|my_center|LOCUS_10560 351453 353225 gene locus_tag LOCUS_10570 gene fadD 351453 353225 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_10570 353345 353797 gene locus_tag LOCUS_10580 353345 353797 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_10580 353845 356235 gene locus_tag LOCUS_10590 353845 356235 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_10590 356285 356647 gene locus_tag LOCUS_10600 356285 356647 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_10600 356697 357884 gene locus_tag LOCUS_10610 356697 357884 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_10610 357988 359778 gene locus_tag LOCUS_10620 357988 359778 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_10620 360791 359844 gene locus_tag LOCUS_10630 gene purC 360791 359844 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_10630 362289 360919 gene locus_tag LOCUS_10640 362289 360919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 363395 362583 gene locus_tag LOCUS_10650 363395 362583 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963219.1 protein_id gnl|my_center|LOCUS_10650 364445 363495 gene locus_tag LOCUS_10660 gene phoH 364445 363495 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_10660 364636 365463 gene locus_tag LOCUS_10670 gene fjo14 364636 365463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_10670 365465 365761 gene locus_tag LOCUS_10680 gene fjo15 365465 365761 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_10680 365853 366578 gene locus_tag LOCUS_10690 gene gldF 365853 366578 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_10690 366578 368260 gene locus_tag LOCUS_10700 gene gldG 366578 368260 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_10700 368345 369466 gene locus_tag LOCUS_10710 gene dnaN 368345 369466 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_10710 370110 371516 gene locus_tag LOCUS_10720 gene mnmE 370110 371516 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_10720 371665 372795 gene locus_tag LOCUS_10730 371665 372795 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361999.1 protein_id gnl|my_center|LOCUS_10730 372798 373517 gene locus_tag LOCUS_10740 372798 373517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 373611 373901 gene locus_tag LOCUS_10750 373611 373901 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004322056.1 protein_id gnl|my_center|LOCUS_10750 373996 375189 gene locus_tag LOCUS_10760 373996 375189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962655.1 protein_id gnl|my_center|LOCUS_10760 375407 376258 gene locus_tag LOCUS_10770 gene traP 375407 376258 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361991.1 protein_id gnl|my_center|LOCUS_10770 376400 377026 gene locus_tag LOCUS_10780 376400 377026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 377583 377023 gene locus_tag LOCUS_10790 377583 377023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 377967 381275 gene locus_tag LOCUS_10800 377967 381275 CDS product type II endonuclease-methyltransferasefusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962421.1 protein_id gnl|my_center|LOCUS_10800 381279 382841 gene locus_tag LOCUS_10810 381279 382841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994769.1 protein_id gnl|my_center|LOCUS_10810 382928 384379 gene locus_tag LOCUS_10820 382928 384379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 384480 384887 gene locus_tag LOCUS_10830 384480 384887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 385006 385530 gene locus_tag LOCUS_10840 385006 385530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 385534 385926 gene locus_tag LOCUS_10850 385534 385926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 385929 386384 gene locus_tag LOCUS_10860 385929 386384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 386439 386933 gene locus_tag LOCUS_10870 386439 386933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 386933 387580 gene locus_tag LOCUS_10880 386933 387580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 387712 388710 gene locus_tag LOCUS_10890 387712 388710 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_10890 388710 389267 gene locus_tag LOCUS_10900 388710 389267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 389282 389713 gene locus_tag LOCUS_10910 389282 389713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 389788 391143 gene locus_tag LOCUS_10920 389788 391143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 391154 391552 gene locus_tag LOCUS_10930 391154 391552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 393177 391567 gene locus_tag LOCUS_10940 393177 391567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 393817 393437 gene locus_tag LOCUS_10950 393817 393437 CDS product preprotein translocase SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963077.1 protein_id gnl|my_center|LOCUS_10950 394041 393817 gene locus_tag LOCUS_10960 394041 393817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 394510 394031 gene locus_tag LOCUS_10970 394510 394031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963203.1 protein_id gnl|my_center|LOCUS_10970 394654 395286 gene locus_tag LOCUS_10980 gene flpA 394654 395286 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549430.1 protein_id gnl|my_center|LOCUS_10980 395283 396062 gene locus_tag LOCUS_10990 395283 396062 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_10990 396133 397542 gene locus_tag LOCUS_11000 396133 397542 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_11000 397667 398791 gene locus_tag LOCUS_11010 397667 398791 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_11010 398962 399044 gene locus_tag LOCUS_t00140 398962 399044 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 399210 400337 gene locus_tag LOCUS_11020 399210 400337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 400334 401761 gene locus_tag LOCUS_11030 400334 401761 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525350.1 protein_id gnl|my_center|LOCUS_11030 401764 402603 gene locus_tag LOCUS_11040 401764 402603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 402576 403007 gene locus_tag LOCUS_11050 402576 403007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 403011 403385 gene locus_tag LOCUS_11060 403011 403385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 404022 403378 gene locus_tag LOCUS_11070 404022 403378 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 protein_id gnl|my_center|LOCUS_11070 404105 404986 gene locus_tag LOCUS_11080 404105 404986 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_11080 406487 405000 gene locus_tag LOCUS_11090 406487 405000 CDS product selenocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_11090 406585 408150 gene locus_tag LOCUS_11100 406585 408150 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 protein_id gnl|my_center|LOCUS_11100 408194 409027 gene locus_tag LOCUS_11110 408194 409027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 409044 409478 gene locus_tag LOCUS_11120 gene phnB 409044 409478 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_11120 409499 409921 gene locus_tag LOCUS_11130 409499 409921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 411152 410025 gene locus_tag LOCUS_11140 411152 410025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 412544 411153 gene locus_tag LOCUS_11150 412544 411153 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_11150 412703 413287 gene locus_tag LOCUS_11160 412703 413287 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_11160 413337 415157 gene locus_tag LOCUS_11170 413337 415157 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963883.1 protein_id gnl|my_center|LOCUS_11170 415150 416163 gene locus_tag LOCUS_11180 415150 416163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 416250 419081 gene locus_tag LOCUS_11190 gene uvrA2 416250 419081 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX6 protein_id gnl|my_center|LOCUS_11190 419115 419840 gene locus_tag LOCUS_11200 419115 419840 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_11200 421107 419881 gene locus_tag LOCUS_11210 421107 419881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 421198 422394 gene locus_tag LOCUS_11220 421198 422394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 423026 422391 gene locus_tag LOCUS_11230 gene cynT 423026 422391 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_11230 423795 423112 gene locus_tag LOCUS_11240 423795 423112 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 protein_id gnl|my_center|LOCUS_11240 425404 423824 gene locus_tag LOCUS_11250 425404 423824 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 protein_id gnl|my_center|LOCUS_11250 425752 425465 gene locus_tag LOCUS_11260 425752 425465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 426066 426995 gene locus_tag LOCUS_11270 gene oxyR 426066 426995 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_11270 427220 427026 gene locus_tag LOCUS_11280 427220 427026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963849.1 protein_id gnl|my_center|LOCUS_11280 428064 427402 gene locus_tag LOCUS_11290 428064 427402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_11290 428510 428073 gene locus_tag LOCUS_11300 428510 428073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 429004 428510 gene locus_tag LOCUS_11310 429004 428510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 429195 430262 gene locus_tag LOCUS_11320 429195 430262 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_11320 430749 430366 gene locus_tag LOCUS_11330 430749 430366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_11330 430807 432210 gene locus_tag LOCUS_11340 430807 432210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 432471 433562 gene locus_tag LOCUS_11350 432471 433562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963854.1 protein_id gnl|my_center|LOCUS_11350 434312 433596 gene locus_tag LOCUS_11360 434312 433596 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963855.1 protein_id gnl|my_center|LOCUS_11360 434993 434352 gene locus_tag LOCUS_11370 434993 434352 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_11370 435241 434993 gene locus_tag LOCUS_11380 435241 434993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11380 435628 435254 gene locus_tag LOCUS_11390 435628 435254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11390 435672 436895 gene locus_tag LOCUS_11400 435672 436895 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_11400 436936 437256 gene locus_tag LOCUS_11410 436936 437256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 437388 437747 gene locus_tag LOCUS_11420 437388 437747 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_11420 437893 439653 gene locus_tag LOCUS_11430 437893 439653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 439716 439856 gene locus_tag LOCUS_11440 439716 439856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962852.1 protein_id gnl|my_center|LOCUS_11440 440365 439853 gene locus_tag LOCUS_11450 gene apt 440365 439853 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183I0 protein_id gnl|my_center|LOCUS_11450 440434 440508 gene locus_tag LOCUS_t00150 440434 440508 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 440628 441479 gene locus_tag LOCUS_11460 440628 441479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 441588 441782 gene locus_tag LOCUS_11470 441588 441782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 441846 442214 gene locus_tag LOCUS_11480 441846 442214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 442211 442405 gene locus_tag LOCUS_11490 442211 442405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 442380 443048 gene locus_tag LOCUS_11500 442380 443048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 443052 443765 gene locus_tag LOCUS_11510 443052 443765 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964385.1 protein_id gnl|my_center|LOCUS_11510 447765 443935 gene locus_tag LOCUS_11520 447765 443935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 448267 447800 gene locus_tag LOCUS_11530 448267 447800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 454814 448311 gene locus_tag LOCUS_11540 454814 448311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 455272 454817 gene locus_tag LOCUS_11550 455272 454817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 455716 456000 gene locus_tag LOCUS_11560 455716 456000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 457047 455950 gene locus_tag LOCUS_11570 457047 455950 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966652.1 protein_id gnl|my_center|LOCUS_11570 457922 457849 gene locus_tag LOCUS_t00160 457922 457849 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 458005 457932 gene locus_tag LOCUS_t00170 458005 457932 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 458094 458012 gene locus_tag LOCUS_t00180 458094 458012 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 458251 458178 gene locus_tag LOCUS_t00190 458251 458178 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 458346 458272 gene locus_tag LOCUS_t00200 458346 458272 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 458435 458349 gene locus_tag LOCUS_t00210 458435 458349 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 459602 459150 gene locus_tag LOCUS_11580 459602 459150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 460747 459689 gene locus_tag LOCUS_11590 460747 459689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 460924 460763 gene locus_tag LOCUS_11600 460924 460763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 464134 461024 gene locus_tag LOCUS_11610 464134 461024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 464890 464144 gene locus_tag LOCUS_11620 464890 464144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208285.1 protein_id gnl|my_center|LOCUS_11620 466380 464959 gene locus_tag LOCUS_11630 gene rtcB 466380 464959 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX85 protein_id gnl|my_center|LOCUS_11630 466737 466949 gene locus_tag LOCUS_11640 466737 466949 CDS product UPF0213 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CQU1 protein_id gnl|my_center|LOCUS_11640 467231 467842 gene locus_tag LOCUS_11650 467231 467842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 467878 468900 gene locus_tag LOCUS_11660 467878 468900 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_11660 469494 468952 gene locus_tag LOCUS_11670 469494 468952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 470990 469701 gene locus_tag LOCUS_11680 470990 469701 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767676.1 protein_id gnl|my_center|LOCUS_11680 471234 471869 gene locus_tag LOCUS_11690 471234 471869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 472379 471870 gene locus_tag LOCUS_11700 472379 471870 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792215.1 protein_id gnl|my_center|LOCUS_11700 472497 473738 gene locus_tag LOCUS_11710 472497 473738 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_11710 474424 473891 gene locus_tag LOCUS_11720 474424 473891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 475059 474478 gene locus_tag LOCUS_11730 gene miaE 475059 474478 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_11730 476170 475121 gene locus_tag LOCUS_11740 gene menC 476170 475121 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_11740 477449 476244 gene locus_tag LOCUS_11750 477449 476244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962663.1 protein_id gnl|my_center|LOCUS_11750 478223 477546 gene locus_tag LOCUS_11760 478223 477546 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0P5 protein_id gnl|my_center|LOCUS_11760 479146 478256 gene locus_tag LOCUS_11770 gene menA 479146 478256 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW2 protein_id gnl|my_center|LOCUS_11770 479571 479185 gene locus_tag LOCUS_11780 479571 479185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 481075 479573 gene locus_tag LOCUS_11790 481075 479573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 481637 481065 gene locus_tag LOCUS_11800 481637 481065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 482480 481641 gene locus_tag LOCUS_11810 gene menB 482480 481641 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_11810 482776 483894 gene locus_tag LOCUS_11820 gene pepC 482776 483894 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_11820 483896 484339 gene locus_tag LOCUS_11830 483896 484339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 484339 485499 gene locus_tag LOCUS_11840 484339 485499 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962646.1 protein_id gnl|my_center|LOCUS_11840 485556 486236 gene locus_tag LOCUS_11850 485556 486236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 486309 487430 gene locus_tag LOCUS_11860 486309 487430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 487515 488093 gene locus_tag LOCUS_11870 487515 488093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 488106 488477 gene locus_tag LOCUS_11880 488106 488477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 488507 489418 gene locus_tag LOCUS_11890 488507 489418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 489713 489426 gene locus_tag LOCUS_11900 489713 489426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 490550 489714 gene locus_tag LOCUS_11910 490550 489714 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_11910 490643 491476 gene locus_tag LOCUS_11920 gene prmA 490643 491476 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_11920 491617 491892 gene locus_tag LOCUS_11930 gene clpS 491617 491892 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_11930 492215 491928 gene locus_tag LOCUS_11940 492215 491928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 492684 492271 gene locus_tag LOCUS_11950 492684 492271 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_11950 493257 492700 gene locus_tag LOCUS_11960 493257 492700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_11960 493353 493829 gene locus_tag LOCUS_11970 493353 493829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 493837 494283 gene locus_tag LOCUS_11980 493837 494283 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963795.1 protein_id gnl|my_center|LOCUS_11980 494385 495203 gene locus_tag LOCUS_11990 gene kdsA 494385 495203 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY4 protein_id gnl|my_center|LOCUS_11990 495220 496065 gene locus_tag LOCUS_12000 495220 496065 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962664.1 protein_id gnl|my_center|LOCUS_12000 496483 496133 gene locus_tag LOCUS_12010 496483 496133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 496559 497167 gene locus_tag LOCUS_12020 496559 497167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107677.1 protein_id gnl|my_center|LOCUS_12020 497130 497834 gene locus_tag LOCUS_12030 497130 497834 CDS product peptidoglycan peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_714690.1 protein_id gnl|my_center|LOCUS_12030 497851 498147 gene locus_tag LOCUS_12040 497851 498147 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_12040 498205 498507 gene locus_tag LOCUS_12050 498205 498507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 498528 499883 gene locus_tag LOCUS_12060 498528 499883 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_12060 501255 500050 gene locus_tag LOCUS_12070 501255 500050 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_12070 501392 501788 gene locus_tag LOCUS_tm00010 501392 501788 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence3 253 2193 gene locus_tag LOCUS_12080 gene thrS 253 2193 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 protein_id gnl|my_center|LOCUS_12080 2432 2773 gene locus_tag LOCUS_12090 2432 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2859 3056 gene locus_tag LOCUS_12100 gene rpmI 2859 3056 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_12100 3155 3499 gene locus_tag LOCUS_12110 gene rplT 3155 3499 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_12110 3630 4601 gene locus_tag LOCUS_12120 gene rlmF 3630 4601 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G2 protein_id gnl|my_center|LOCUS_12120 5509 4598 gene locus_tag LOCUS_12130 gene glsA 5509 4598 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEA1 protein_id gnl|my_center|LOCUS_12130 6712 5519 gene locus_tag LOCUS_12140 6712 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_12140 7749 7072 gene locus_tag LOCUS_12150 7749 7072 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695801.1 protein_id gnl|my_center|LOCUS_12150 8543 7752 gene locus_tag LOCUS_12160 8543 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 9165 8530 gene locus_tag LOCUS_12170 9165 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 9480 9166 gene locus_tag LOCUS_12180 9480 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 9763 11100 gene locus_tag LOCUS_12190 9763 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975770.1 protein_id gnl|my_center|LOCUS_12190 11132 11680 gene locus_tag LOCUS_12200 11132 11680 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_12200 11768 12607 gene locus_tag LOCUS_12210 11768 12607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 14216 12669 gene locus_tag LOCUS_12220 gene dnaB 14216 12669 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_12220 15322 14369 gene locus_tag LOCUS_12230 gene accA 15322 14369 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_12230 16284 15385 gene locus_tag LOCUS_12240 16284 15385 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_12240 17347 16271 gene locus_tag LOCUS_12250 17347 16271 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_12250 18509 17379 gene locus_tag LOCUS_12260 gene tgt 18509 17379 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_12260 18697 19452 gene locus_tag LOCUS_12270 gene tktA 18697 19452 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12270 19564 20517 gene locus_tag LOCUS_12280 gene tktC 19564 20517 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_12280 21629 20577 gene locus_tag LOCUS_12290 21629 20577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963560.1 protein_id gnl|my_center|LOCUS_12290 21707 22096 gene locus_tag LOCUS_12300 21707 22096 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_12300 22083 22661 gene locus_tag LOCUS_12310 gene tpm 22083 22661 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_12310 22679 23173 gene locus_tag LOCUS_12320 gene pyrR2 22679 23173 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_12320 23680 23165 gene locus_tag LOCUS_12330 gene aroK 23680 23165 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 protein_id gnl|my_center|LOCUS_12330 23811 23884 gene locus_tag LOCUS_t00220 23811 23884 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 23914 23987 gene locus_tag LOCUS_t00230 23914 23987 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 24030 24113 gene locus_tag LOCUS_t00240 24030 24113 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25255 24113 gene locus_tag LOCUS_12340 gene crtY 25255 24113 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_12340 25376 26275 gene locus_tag LOCUS_12350 25376 26275 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_12350 26280 27740 gene locus_tag LOCUS_12360 gene crtI 26280 27740 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_12360 27743 28582 gene locus_tag LOCUS_12370 gene crtB 27743 28582 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_12370 28585 29028 gene locus_tag LOCUS_12380 gene crtZ 28585 29028 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_12380 29602 29075 gene locus_tag LOCUS_12390 29602 29075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963570.1 protein_id gnl|my_center|LOCUS_12390 30178 29606 gene locus_tag LOCUS_12400 30178 29606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963571.1 protein_id gnl|my_center|LOCUS_12400 30581 30141 gene locus_tag LOCUS_12410 30581 30141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963572.1 protein_id gnl|my_center|LOCUS_12410 31077 30547 gene locus_tag LOCUS_12420 31077 30547 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_12420 33289 31346 gene locus_tag LOCUS_12430 33289 31346 CDS product outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001005769.2 protein_id gnl|my_center|LOCUS_12430 33753 34892 gene locus_tag LOCUS_12440 33753 34892 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_12440 34998 35945 gene locus_tag LOCUS_12450 34998 35945 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_12450 36025 36432 gene locus_tag LOCUS_12460 36025 36432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_12460 36509 37288 gene locus_tag LOCUS_12470 36509 37288 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 protein_id gnl|my_center|LOCUS_12470 37736 37275 gene locus_tag LOCUS_12480 37736 37275 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H134 protein_id gnl|my_center|LOCUS_12480 38371 37796 gene locus_tag LOCUS_12490 38371 37796 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H133 protein_id gnl|my_center|LOCUS_12490 38494 39861 gene locus_tag LOCUS_12500 gene rmuC 38494 39861 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_12500 39842 40273 gene locus_tag LOCUS_12510 39842 40273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 40273 40824 gene locus_tag LOCUS_12520 40273 40824 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_12520 40896 41996 gene locus_tag LOCUS_12530 40896 41996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 42017 44026 gene locus_tag LOCUS_12540 42017 44026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 44140 44781 gene locus_tag LOCUS_12550 44140 44781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 45798 44842 gene locus_tag LOCUS_12560 gene irk 45798 44842 CDS product inward rectifier potassium channel Irk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_12560 45905 46954 gene locus_tag LOCUS_12570 45905 46954 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_12570 47090 47575 gene locus_tag LOCUS_12580 47090 47575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 47719 48114 gene locus_tag LOCUS_12590 47719 48114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 48282 48734 gene locus_tag LOCUS_12600 48282 48734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 48915 49517 gene locus_tag LOCUS_12610 48915 49517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 49698 50189 gene locus_tag LOCUS_12620 49698 50189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 50364 51158 gene locus_tag LOCUS_12630 50364 51158 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212588.1 protein_id gnl|my_center|LOCUS_12630 51327 51956 gene locus_tag LOCUS_12640 51327 51956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 52127 52645 gene locus_tag LOCUS_12650 52127 52645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 52646 53230 gene locus_tag LOCUS_12660 52646 53230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 53583 54044 gene locus_tag LOCUS_12670 53583 54044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 54330 55922 gene locus_tag LOCUS_12680 54330 55922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 55936 56319 gene locus_tag LOCUS_12690 55936 56319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 56585 57472 gene locus_tag LOCUS_12700 56585 57472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 57642 58847 gene locus_tag LOCUS_12710 57642 58847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 58994 59458 gene locus_tag LOCUS_12720 58994 59458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 59611 60519 gene locus_tag LOCUS_12730 59611 60519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 61014 62210 gene locus_tag LOCUS_12740 61014 62210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 62305 63657 gene locus_tag LOCUS_12750 62305 63657 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962682.1 protein_id gnl|my_center|LOCUS_12750 63664 64179 gene locus_tag LOCUS_12760 63664 64179 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966038.1 protein_id gnl|my_center|LOCUS_12760 64181 64978 gene locus_tag LOCUS_12770 64181 64978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 65119 65580 gene locus_tag LOCUS_12780 65119 65580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 65777 66358 gene locus_tag LOCUS_12790 65777 66358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 66541 67755 gene locus_tag LOCUS_12800 66541 67755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 70720 67865 gene locus_tag LOCUS_12810 gene carB 70720 67865 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_12810 71044 70883 gene locus_tag LOCUS_12820 gene rpmH 71044 70883 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H127 protein_id gnl|my_center|LOCUS_12820 71211 71726 gene locus_tag LOCUS_12830 71211 71726 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 protein_id gnl|my_center|LOCUS_12830 71862 72560 gene locus_tag LOCUS_12840 71862 72560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 72953 72561 gene locus_tag LOCUS_12850 72953 72561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 73842 72940 gene locus_tag LOCUS_12860 73842 72940 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_12860 74497 73835 gene locus_tag LOCUS_12870 74497 73835 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_12870 74707 75057 gene locus_tag LOCUS_12880 74707 75057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 75167 75643 gene locus_tag LOCUS_12890 75167 75643 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107186.1 protein_id gnl|my_center|LOCUS_12890 75650 76306 gene locus_tag LOCUS_12900 75650 76306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 77699 76371 gene locus_tag LOCUS_12910 77699 76371 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_12910 77831 78109 gene locus_tag LOCUS_12920 77831 78109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 79288 78113 gene locus_tag LOCUS_12930 79288 78113 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_12930 79662 79408 gene locus_tag LOCUS_12940 gene rpmE 79662 79408 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_12940 79895 80425 gene locus_tag LOCUS_12950 79895 80425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963274.1 protein_id gnl|my_center|LOCUS_12950 80426 81367 gene locus_tag LOCUS_12960 80426 81367 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_12960 81387 83114 gene locus_tag LOCUS_12970 81387 83114 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 protein_id gnl|my_center|LOCUS_12970 83114 84943 gene locus_tag LOCUS_12980 gene msbA 83114 84943 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_12980 85028 85726 gene locus_tag LOCUS_12990 85028 85726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963278.1 protein_id gnl|my_center|LOCUS_12990 86459 85824 gene locus_tag LOCUS_13000 86459 85824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 87248 86529 gene locus_tag LOCUS_13010 87248 86529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963279.1 protein_id gnl|my_center|LOCUS_13010 89757 87298 gene locus_tag LOCUS_13020 89757 87298 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_13020 91453 89768 gene locus_tag LOCUS_13030 91453 89768 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_13030 91645 91935 gene locus_tag LOCUS_13040 91645 91935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963282.1 protein_id gnl|my_center|LOCUS_13040 91940 92233 gene locus_tag LOCUS_13050 91940 92233 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 protein_id gnl|my_center|LOCUS_13050 92443 94005 gene locus_tag LOCUS_13060 gene rny 92443 94005 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 protein_id gnl|my_center|LOCUS_13060 95020 94121 gene locus_tag LOCUS_13070 gene xerD 95020 94121 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_13070 95082 95699 gene locus_tag LOCUS_13080 95082 95699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 96389 95796 gene locus_tag LOCUS_13090 gene fspA 96389 95796 CDS product flavo-specific protein antigen FspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964119.1 protein_id gnl|my_center|LOCUS_13090 96695 97237 gene locus_tag LOCUS_13100 96695 97237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 97310 97723 gene locus_tag LOCUS_13110 gene aroQ 97310 97723 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_13110 97779 100244 gene locus_tag LOCUS_13120 97779 100244 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_13120 100300 100728 gene locus_tag LOCUS_13130 100300 100728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 101539 100772 gene locus_tag LOCUS_13140 101539 100772 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFX6 protein_id gnl|my_center|LOCUS_13140 102912 101602 gene locus_tag LOCUS_13150 gene murA 102912 101602 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 protein_id gnl|my_center|LOCUS_13150 103608 102922 gene locus_tag LOCUS_13160 103608 102922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_13160 103897 103613 gene locus_tag LOCUS_13170 103897 103613 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403995.1 protein_id gnl|my_center|LOCUS_13170 104026 104559 gene locus_tag LOCUS_13180 104026 104559 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_13180 104574 106460 gene locus_tag LOCUS_13190 gene recQ2 104574 106460 CDS product ATP-dependent DNA helicase RecQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 protein_id gnl|my_center|LOCUS_13190 106460 107407 gene locus_tag LOCUS_13200 gene fmt 106460 107407 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H148 protein_id gnl|my_center|LOCUS_13200 107584 107862 gene locus_tag LOCUS_13210 gene hupB 107584 107862 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_13210 107979 108539 gene locus_tag LOCUS_13220 107979 108539 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_13220 109374 108532 gene locus_tag LOCUS_13230 109374 108532 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_13230 109819 109427 gene locus_tag LOCUS_13240 109819 109427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_13240 109968 110042 gene locus_tag LOCUS_t00250 109968 110042 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 110440 115356 gene locus_tag LOCUS_13250 110440 115356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 115428 117401 gene locus_tag LOCUS_13260 115428 117401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 117471 118418 gene locus_tag LOCUS_13270 117471 118418 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZL8 protein_id gnl|my_center|LOCUS_13270 119239 118436 gene locus_tag LOCUS_13280 119239 118436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 120687 119317 gene locus_tag LOCUS_13290 gene hisS 120687 119317 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H160 protein_id gnl|my_center|LOCUS_13290 121001 122242 gene locus_tag LOCUS_13300 121001 122242 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_13300 122661 122293 gene locus_tag LOCUS_13310 122661 122293 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_13310 123640 122729 gene locus_tag LOCUS_13320 gene prmC 123640 122729 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_13320 124117 123641 gene locus_tag LOCUS_13330 gene yjgM 124117 123641 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_13330 124199 125242 gene locus_tag LOCUS_13340 gene ribD 124199 125242 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_13340 125235 125846 gene locus_tag LOCUS_13350 125235 125846 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_13350 126311 125967 gene locus_tag LOCUS_13360 126311 125967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 126277 126696 gene locus_tag LOCUS_13370 126277 126696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 126698 127315 gene locus_tag LOCUS_13380 126698 127315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_13380 127717 127316 gene locus_tag LOCUS_13390 127717 127316 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_13390 127918 129345 gene locus_tag LOCUS_13400 gene dnaA 127918 129345 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_13400 129346 129804 gene locus_tag LOCUS_13410 129346 129804 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 protein_id gnl|my_center|LOCUS_13410 131788 129812 gene locus_tag LOCUS_13420 131788 129812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 132088 131858 gene locus_tag LOCUS_13430 132088 131858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 132000 132722 gene locus_tag LOCUS_13440 132000 132722 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_13440 133407 132727 gene locus_tag LOCUS_13450 133407 132727 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963343.1 protein_id gnl|my_center|LOCUS_13450 134368 133478 gene locus_tag LOCUS_13460 134368 133478 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_13460 135497 134457 gene locus_tag LOCUS_13470 gene pabC 135497 134457 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_13470 136034 135510 gene locus_tag LOCUS_13480 136034 135510 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_13480 136819 136034 gene locus_tag LOCUS_13490 gene dapF 136819 136034 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_13490 136947 138329 gene locus_tag LOCUS_13500 gene degP/Q 136947 138329 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_13500 138460 139908 gene locus_tag LOCUS_13510 gene gapA2 138460 139908 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX7 protein_id gnl|my_center|LOCUS_13510 140499 139960 gene locus_tag LOCUS_13520 140499 139960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 141238 140573 gene locus_tag LOCUS_13530 141238 140573 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776602.1 protein_id gnl|my_center|LOCUS_13530 141392 142057 gene locus_tag LOCUS_13540 141392 142057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 144379 142115 gene locus_tag LOCUS_13550 gene acnA 144379 142115 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_13550 145743 144634 gene locus_tag LOCUS_13560 145743 144634 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962920.1 protein_id gnl|my_center|LOCUS_13560 145778 146911 gene locus_tag LOCUS_13570 145778 146911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 147252 146908 gene locus_tag LOCUS_13580 147252 146908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 148237 147284 gene locus_tag LOCUS_13590 148237 147284 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_13590 149713 148334 gene locus_tag LOCUS_13600 gene surA 149713 148334 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT1 protein_id gnl|my_center|LOCUS_13600 150524 149673 gene locus_tag LOCUS_13610 150524 149673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 152488 150524 gene locus_tag LOCUS_13620 152488 150524 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_13620 152659 154254 gene locus_tag LOCUS_13630 gene prfC 152659 154254 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT6 protein_id gnl|my_center|LOCUS_13630 154307 154510 gene locus_tag LOCUS_13640 154307 154510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 155432 154551 gene locus_tag LOCUS_13650 gene folD 155432 154551 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 protein_id gnl|my_center|LOCUS_13650 156830 155493 gene locus_tag LOCUS_13660 gene ffh 156830 155493 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 protein_id gnl|my_center|LOCUS_13660 157149 156943 gene locus_tag LOCUS_13670 157149 156943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 158768 157254 gene locus_tag LOCUS_13680 158768 157254 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203595.1 protein_id gnl|my_center|LOCUS_13680 160179 158770 gene locus_tag LOCUS_13690 160179 158770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 161584 160169 gene locus_tag LOCUS_13700 161584 160169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 protein_id gnl|my_center|LOCUS_13700 163430 161643 gene locus_tag LOCUS_13710 gene argS 163430 161643 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 protein_id gnl|my_center|LOCUS_13710 164602 163595 gene locus_tag LOCUS_13720 gene fabH2 164602 163595 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_13720 164789 167200 gene locus_tag LOCUS_13730 164789 167200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_13730 168166 167237 gene locus_tag LOCUS_13740 168166 167237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_13740 168301 168903 gene locus_tag LOCUS_13750 168301 168903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 169660 168977 gene locus_tag LOCUS_13760 gene yiaD 169660 168977 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963625.1 protein_id gnl|my_center|LOCUS_13760 170148 169672 gene locus_tag LOCUS_13770 170148 169672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963626.1 protein_id gnl|my_center|LOCUS_13770 170298 172184 gene locus_tag LOCUS_13780 gene htpG 170298 172184 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_13780 172273 173049 gene locus_tag LOCUS_13790 172273 173049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 173107 174030 gene locus_tag LOCUS_13800 173107 174030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 174032 174532 gene locus_tag LOCUS_13810 174032 174532 CDS product putative acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702324.1 protein_id gnl|my_center|LOCUS_13810 174639 175472 gene locus_tag LOCUS_13820 174639 175472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 175580 176344 gene locus_tag LOCUS_13830 175580 176344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 177004 176393 gene locus_tag LOCUS_13840 177004 176393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 177133 178032 gene locus_tag LOCUS_13850 gene fjo20 177133 178032 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963631.1 protein_id gnl|my_center|LOCUS_13850 178075 178431 gene locus_tag LOCUS_13860 178075 178431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281604.1 protein_id gnl|my_center|LOCUS_13860 178433 179035 gene locus_tag LOCUS_13870 178433 179035 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_13870 179121 179402 gene locus_tag LOCUS_13880 179121 179402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 179495 181351 gene locus_tag LOCUS_13890 179495 181351 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_13890 181441 182745 gene locus_tag LOCUS_13900 181441 182745 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_13900 182764 183474 gene locus_tag LOCUS_13910 182764 183474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963060.1 protein_id gnl|my_center|LOCUS_13910 183660 183586 gene locus_tag LOCUS_t00260 183660 183586 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 184007 183738 gene locus_tag LOCUS_13920 184007 183738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963895.1 protein_id gnl|my_center|LOCUS_13920 185025 184066 gene locus_tag LOCUS_13930 gene manA 185025 184066 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 protein_id gnl|my_center|LOCUS_13930 185490 185080 gene locus_tag LOCUS_13940 gene ygcM 185490 185080 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_13940 186093 185566 gene locus_tag LOCUS_13950 gene idi 186093 185566 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_13950 186378 186818 gene locus_tag LOCUS_13960 186378 186818 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_13960 188427 186871 gene locus_tag LOCUS_13970 188427 186871 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_13970 188497 188784 gene locus_tag LOCUS_13980 188497 188784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 protein_id gnl|my_center|LOCUS_13980 189286 188795 gene locus_tag LOCUS_13990 189286 188795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 191520 189325 gene locus_tag LOCUS_14000 gene recQ1 191520 189325 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 protein_id gnl|my_center|LOCUS_14000 191605 192570 gene locus_tag LOCUS_14010 gene kdsD 191605 192570 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_14010 192570 193382 gene locus_tag LOCUS_14020 gene tatC 192570 193382 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_14020 193385 193735 gene locus_tag LOCUS_14030 193385 193735 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_14030 193844 194584 gene locus_tag LOCUS_14040 gene lptB 193844 194584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_14040 195465 194617 gene locus_tag LOCUS_14050 gene yegX 195465 194617 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963370.1 protein_id gnl|my_center|LOCUS_14050 196209 195472 gene locus_tag LOCUS_14060 gene pssA 196209 195472 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_14060 196511 197503 gene locus_tag LOCUS_14070 196511 197503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_14070 197513 198649 gene locus_tag LOCUS_14080 197513 198649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963373.1 protein_id gnl|my_center|LOCUS_14080 200040 198658 gene locus_tag LOCUS_14090 200040 198658 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_14090 201121 200108 gene locus_tag LOCUS_14100 201121 200108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 202448 201114 gene locus_tag LOCUS_14110 202448 201114 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_14110 203542 202439 gene locus_tag LOCUS_14120 203542 202439 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963378.1 protein_id gnl|my_center|LOCUS_14120 204687 203563 gene locus_tag LOCUS_14130 204687 203563 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963379.1 protein_id gnl|my_center|LOCUS_14130 205240 204689 gene locus_tag LOCUS_14140 205240 204689 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ08 protein_id gnl|my_center|LOCUS_14140 206386 205244 gene locus_tag LOCUS_14150 206386 205244 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963384.1 protein_id gnl|my_center|LOCUS_14150 207475 206387 gene locus_tag LOCUS_14160 207475 206387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 207779 207444 gene locus_tag LOCUS_14170 207779 207444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 208814 207789 gene locus_tag LOCUS_14180 208814 207789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 209047 208811 gene locus_tag LOCUS_14190 209047 208811 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802828.1 protein_id gnl|my_center|LOCUS_14190 209952 209050 gene locus_tag LOCUS_14200 209952 209050 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857912.1 protein_id gnl|my_center|LOCUS_14200 211686 209962 gene locus_tag LOCUS_14210 211686 209962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291950.1 protein_id gnl|my_center|LOCUS_14210 212629 211721 gene locus_tag LOCUS_14220 212629 211721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 213509 212613 gene locus_tag LOCUS_14230 213509 212613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 214789 213509 gene locus_tag LOCUS_14240 214789 213509 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_14240 215992 215039 gene locus_tag LOCUS_14250 215992 215039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 217447 215996 gene locus_tag LOCUS_14260 217447 215996 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_14260 218571 217447 gene locus_tag LOCUS_14270 gene neuC 218571 217447 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963387.1 protein_id gnl|my_center|LOCUS_14270 219111 218785 gene locus_tag LOCUS_14280 219111 218785 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377064.1 protein_id gnl|my_center|LOCUS_14280 220209 219169 gene locus_tag LOCUS_14290 gene neuB 220209 219169 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963388.1 protein_id gnl|my_center|LOCUS_14290 221013 220354 gene locus_tag LOCUS_14300 gene neuA 221013 220354 CDS product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963389.1 protein_id gnl|my_center|LOCUS_14300 222899 221016 gene locus_tag LOCUS_14310 gene wbpQ 222899 221016 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073062.1 protein_id gnl|my_center|LOCUS_14310 224021 222906 gene locus_tag LOCUS_14320 224021 222906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 224920 224021 gene locus_tag LOCUS_14330 224920 224021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 225999 224980 gene locus_tag LOCUS_14340 225999 224980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 227144 225990 gene locus_tag LOCUS_14350 227144 225990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 228314 227145 gene locus_tag LOCUS_14360 228314 227145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 229305 228316 gene locus_tag LOCUS_14370 229305 228316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 230257 229316 gene locus_tag LOCUS_14380 230257 229316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 231198 230260 gene locus_tag LOCUS_14390 231198 230260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 232068 231202 gene locus_tag LOCUS_14400 232068 231202 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202924.1 protein_id gnl|my_center|LOCUS_14400 233114 232113 gene locus_tag LOCUS_14410 gene fnlA 233114 232113 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963420.1 protein_id gnl|my_center|LOCUS_14410 234393 233107 gene locus_tag LOCUS_14420 gene rfbB 234393 233107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_14420 235484 234603 gene locus_tag LOCUS_14430 235484 234603 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ30 protein_id gnl|my_center|LOCUS_14430 235621 236355 gene locus_tag LOCUS_14440 235621 236355 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_14440 238721 236358 gene locus_tag LOCUS_14450 238721 236358 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_14450 239496 238726 gene locus_tag LOCUS_14460 239496 238726 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_14460 241499 239535 gene locus_tag LOCUS_14470 gene wbpM 241499 239535 CDS product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963409.1 protein_id gnl|my_center|LOCUS_14470 242713 241583 gene locus_tag LOCUS_14480 242713 241583 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_14480 243357 242713 gene locus_tag LOCUS_14490 243357 242713 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986573.1 protein_id gnl|my_center|LOCUS_14490 243973 243368 gene locus_tag LOCUS_14500 gene wcgN 243973 243368 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963415.1 protein_id gnl|my_center|LOCUS_14500 245159 243966 gene locus_tag LOCUS_14510 245159 243966 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202263.1 protein_id gnl|my_center|LOCUS_14510 246299 245160 gene locus_tag LOCUS_14520 gene fnlC 246299 245160 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963417.1 protein_id gnl|my_center|LOCUS_14520 247439 246321 gene locus_tag LOCUS_14530 gene fnlB 247439 246321 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963418.1 protein_id gnl|my_center|LOCUS_14530 248541 247441 gene locus_tag LOCUS_14540 248541 247441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 249803 248538 gene locus_tag LOCUS_14550 249803 248538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 250092 249805 gene locus_tag LOCUS_14560 250092 249805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 250954 250079 gene locus_tag LOCUS_14570 250954 250079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 252162 250954 gene locus_tag LOCUS_14580 252162 250954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 252541 252155 gene locus_tag LOCUS_14590 252541 252155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 253418 252684 gene locus_tag LOCUS_14600 253418 252684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901984.1 protein_id gnl|my_center|LOCUS_14600 254697 253420 gene locus_tag LOCUS_14610 254697 253420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 256003 254726 gene locus_tag LOCUS_14620 gene wbpO 256003 254726 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_14620 257401 256013 gene locus_tag LOCUS_14630 gene ugd 257401 256013 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_14630 258391 257408 gene locus_tag LOCUS_14640 258391 257408 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_14640 260856 258394 gene locus_tag LOCUS_14650 gene wzc 260856 258394 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_14650 261656 260862 gene locus_tag LOCUS_14660 gene wza 261656 260862 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 protein_id gnl|my_center|LOCUS_14660 262351 261731 gene locus_tag LOCUS_14670 gene recR 262351 261731 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_14670 262428 263870 gene locus_tag LOCUS_14680 262428 263870 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767085.1 protein_id gnl|my_center|LOCUS_14680 264203 263847 gene locus_tag LOCUS_14690 264203 263847 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_14690 264309 264935 gene locus_tag LOCUS_14700 264309 264935 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ63 protein_id gnl|my_center|LOCUS_14700 265941 265003 gene locus_tag LOCUS_14710 265941 265003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_14710 266903 265941 gene locus_tag LOCUS_14720 266903 265941 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25949 protein_id gnl|my_center|LOCUS_14720 268317 267034 gene locus_tag LOCUS_14730 gene gltA 268317 267034 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_14730 269771 268476 gene locus_tag LOCUS_14740 gene eno 269771 268476 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_14740 270891 269782 gene locus_tag LOCUS_14750 gene carA 270891 269782 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_14750 271481 271002 gene locus_tag LOCUS_14760 gene rplQ 271481 271002 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ72 protein_id gnl|my_center|LOCUS_14760 272535 271543 gene locus_tag LOCUS_14770 gene rpoA 272535 271543 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_14770 273161 272556 gene locus_tag LOCUS_14780 gene rpsD 273161 272556 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ74 protein_id gnl|my_center|LOCUS_14780 273669 273286 gene locus_tag LOCUS_14790 gene rpsK 273669 273286 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 protein_id gnl|my_center|LOCUS_14790 274053 273679 gene locus_tag LOCUS_14800 gene rpsM 274053 273679 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ76 protein_id gnl|my_center|LOCUS_14800 274398 274183 gene locus_tag LOCUS_14810 gene infA 274398 274183 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ78 protein_id gnl|my_center|LOCUS_14810 275753 274404 gene locus_tag LOCUS_14820 gene secY 275753 274404 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ79 protein_id gnl|my_center|LOCUS_14820 276219 275767 gene locus_tag LOCUS_14830 gene rplO 276219 275767 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ80 protein_id gnl|my_center|LOCUS_14830 276413 276231 gene locus_tag LOCUS_14840 gene rpmD 276413 276231 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ81 protein_id gnl|my_center|LOCUS_14840 276951 276427 gene locus_tag LOCUS_14850 gene rpsE 276951 276427 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ82 protein_id gnl|my_center|LOCUS_14850 277308 276958 gene locus_tag LOCUS_14860 gene rplR 277308 276958 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ83 protein_id gnl|my_center|LOCUS_14860 277862 277320 gene locus_tag LOCUS_14870 gene rplF 277862 277320 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 protein_id gnl|my_center|LOCUS_14870 278276 277878 gene locus_tag LOCUS_14880 gene rpsH 278276 277878 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_14880 278649 278380 gene locus_tag LOCUS_14890 gene rpsN 278649 278380 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_14890 279204 278653 gene locus_tag LOCUS_14900 gene rplE 279204 278653 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_14900 279524 279207 gene locus_tag LOCUS_14910 gene rplX 279524 279207 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ88 protein_id gnl|my_center|LOCUS_14910 279901 279533 gene locus_tag LOCUS_14920 gene rplN 279901 279533 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_14920 280161 279904 gene locus_tag LOCUS_14930 gene rpsQ 280161 279904 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_14930 280370 280179 gene locus_tag LOCUS_14940 gene rpmC 280370 280179 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ91 protein_id gnl|my_center|LOCUS_14940 280808 280383 gene locus_tag LOCUS_14950 gene rplP 280808 280383 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ92 protein_id gnl|my_center|LOCUS_14950 281547 280828 gene locus_tag LOCUS_14960 gene rpsC 281547 280828 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_14960 281966 281556 gene locus_tag LOCUS_14970 gene rplV 281966 281556 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 protein_id gnl|my_center|LOCUS_14970 282250 281972 gene locus_tag LOCUS_14980 gene rpsS 282250 281972 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ95 protein_id gnl|my_center|LOCUS_14980 283083 282259 gene locus_tag LOCUS_14990 gene rplB 283083 282259 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ96 protein_id gnl|my_center|LOCUS_14990 283380 283090 gene locus_tag LOCUS_15000 gene rplW 283380 283090 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ97 protein_id gnl|my_center|LOCUS_15000 284018 283389 gene locus_tag LOCUS_15010 gene rplD 284018 283389 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_15010 284635 284018 gene locus_tag LOCUS_15020 gene rplC 284635 284018 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ99 protein_id gnl|my_center|LOCUS_15020 285167 284862 gene locus_tag LOCUS_15030 gene rpsJ 285167 284862 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_15030 287335 285179 gene locus_tag LOCUS_15040 gene fusA 287335 285179 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 protein_id gnl|my_center|LOCUS_15040 287821 287345 gene locus_tag LOCUS_15050 gene rpsG 287821 287345 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_15050 288229 287846 gene locus_tag LOCUS_15060 gene rpsL 288229 287846 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 protein_id gnl|my_center|LOCUS_15060 288515 290110 gene locus_tag LOCUS_15070 288515 290110 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963474.1 protein_id gnl|my_center|LOCUS_15070 290207 290941 gene locus_tag LOCUS_15080 290207 290941 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_15080 291645 291007 gene locus_tag LOCUS_15090 291645 291007 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963478.1 protein_id gnl|my_center|LOCUS_15090 291903 292466 gene locus_tag LOCUS_15100 291903 292466 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766588.1 protein_id gnl|my_center|LOCUS_15100 292552 293022 gene locus_tag LOCUS_15110 gene yiaA 292552 293022 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038893.1 protein_id gnl|my_center|LOCUS_15110 293109 294386 gene locus_tag LOCUS_15120 293109 294386 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_15120 295176 294430 gene locus_tag LOCUS_15130 295176 294430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963480.1 protein_id gnl|my_center|LOCUS_15130 295982 295272 gene locus_tag LOCUS_15140 295982 295272 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_15140 296457 295972 gene locus_tag LOCUS_15150 296457 295972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 297703 296450 gene locus_tag LOCUS_15160 297703 296450 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769004.1 protein_id gnl|my_center|LOCUS_15160 298337 297705 gene locus_tag LOCUS_15170 298337 297705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_15170 299269 298586 gene locus_tag LOCUS_15180 gene radC 299269 298586 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_15180 299367 300035 gene locus_tag LOCUS_15190 gene yijF 299367 300035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32668 protein_id gnl|my_center|LOCUS_15190 300322 300131 gene locus_tag LOCUS_15200 300322 300131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15200 301763 300408 gene locus_tag LOCUS_15210 301763 300408 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_15210 302513 301827 gene locus_tag LOCUS_15220 302513 301827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963484.1 protein_id gnl|my_center|LOCUS_15220 302628 303413 gene locus_tag LOCUS_15230 302628 303413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 304487 303486 gene locus_tag LOCUS_15240 gene obg 304487 303486 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB7 protein_id gnl|my_center|LOCUS_15240 305648 304527 gene locus_tag LOCUS_15250 305648 304527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 305738 306271 gene locus_tag LOCUS_15260 305738 306271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963491.1 protein_id gnl|my_center|LOCUS_15260 306395 307549 gene locus_tag LOCUS_15270 gene purK 306395 307549 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_15270 307563 307970 gene locus_tag LOCUS_15280 307563 307970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 307967 308446 gene locus_tag LOCUS_15290 gene purE 307967 308446 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_15290 308596 310623 gene locus_tag LOCUS_15300 gene dcp1 308596 310623 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_15300 310823 310957 gene locus_tag LOCUS_15310 310823 310957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 311045 311551 gene locus_tag LOCUS_15320 311045 311551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404561.1 protein_id gnl|my_center|LOCUS_15320 311607 311930 gene locus_tag LOCUS_15330 311607 311930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 311914 312735 gene locus_tag LOCUS_15340 311914 312735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 312738 313646 gene locus_tag LOCUS_15350 312738 313646 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033982.1 protein_id gnl|my_center|LOCUS_15350 313643 314095 gene locus_tag LOCUS_15360 313643 314095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 314896 314081 gene locus_tag LOCUS_15370 314896 314081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362021.1 protein_id gnl|my_center|LOCUS_15370 315043 317886 gene locus_tag LOCUS_15380 gene gcvP 315043 317886 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_15380 317980 318348 gene locus_tag LOCUS_15390 317980 318348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963501.1 protein_id gnl|my_center|LOCUS_15390 318464 319522 gene locus_tag LOCUS_15400 gene fabH1 318464 319522 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_15400 320978 319497 gene locus_tag LOCUS_15410 320978 319497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963503.1 protein_id gnl|my_center|LOCUS_15410 321859 320978 gene locus_tag LOCUS_15420 321859 320978 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963504.1 protein_id gnl|my_center|LOCUS_15420 321949 322797 gene locus_tag LOCUS_15430 321949 322797 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963505.1 protein_id gnl|my_center|LOCUS_15430 322933 323841 gene locus_tag LOCUS_15440 322933 323841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 324037 324786 gene locus_tag LOCUS_15450 324037 324786 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_15450 324783 325553 gene locus_tag LOCUS_15460 324783 325553 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_15460 326925 325555 gene locus_tag LOCUS_15470 326925 325555 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170201.1 protein_id gnl|my_center|LOCUS_15470 327987 326929 gene locus_tag LOCUS_15480 gene manC 327987 326929 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_15480 328637 328035 gene locus_tag LOCUS_15490 328637 328035 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_15490 329394 328717 gene locus_tag LOCUS_15500 329394 328717 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_15500 330362 329394 gene locus_tag LOCUS_15510 330362 329394 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_15510 332045 330435 gene locus_tag LOCUS_15520 gene pdhC 332045 330435 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_15520 333047 332049 gene locus_tag LOCUS_15530 gene pdhA 333047 332049 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_15530 333659 333177 gene locus_tag LOCUS_15540 gene cdd 333659 333177 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_15540 334905 333727 gene locus_tag LOCUS_15550 gene porV 334905 333727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_15550 338714 334944 gene locus_tag LOCUS_15560 gene porU 338714 334944 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_15560 339016 340710 gene locus_tag LOCUS_15570 gene gldJ 339016 340710 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_15570 340856 342058 gene locus_tag LOCUS_15580 gene murF 340856 342058 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_15580 342173 342098 gene locus_tag LOCUS_t00270 342173 342098 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 343468 342254 gene locus_tag LOCUS_15590 gene folC 343468 342254 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_15590 344282 343479 gene locus_tag LOCUS_15600 344282 343479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 344717 344322 gene locus_tag LOCUS_15610 344717 344322 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_15610 345426 344719 gene locus_tag LOCUS_15620 345426 344719 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_15620 346834 345473 gene locus_tag LOCUS_15630 346834 345473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883648.1 protein_id gnl|my_center|LOCUS_15630 348106 346841 gene locus_tag LOCUS_15640 348106 346841 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_15640 349262 348192 gene locus_tag LOCUS_15650 349262 348192 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_15650 349355 350494 gene locus_tag LOCUS_15660 349355 350494 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_15660 350724 351107 gene locus_tag LOCUS_15670 350724 351107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 351191 351649 gene locus_tag LOCUS_15680 351191 351649 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418920.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence4 360 1868 gene locus_tag LOCUS_15690 360 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2090 1872 gene locus_tag LOCUS_15700 2090 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2226 2402 gene locus_tag LOCUS_15710 2226 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 2617 4602 gene locus_tag LOCUS_15720 gene hutU 2617 4602 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_15720 4656 5174 gene locus_tag LOCUS_15730 4656 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_15730 5231 6274 gene locus_tag LOCUS_15740 5231 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 6350 8107 gene locus_tag LOCUS_15750 gene phhA 6350 8107 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964058.1 protein_id gnl|my_center|LOCUS_15750 8168 8476 gene locus_tag LOCUS_15760 8168 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 9443 8499 gene locus_tag LOCUS_15770 9443 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_15770 12225 9562 gene locus_tag LOCUS_15780 gene alaS 12225 9562 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 protein_id gnl|my_center|LOCUS_15780 12410 13387 gene locus_tag LOCUS_15790 12410 13387 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_15790 13387 13716 gene locus_tag LOCUS_15800 13387 13716 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_15800 13729 14346 gene locus_tag LOCUS_15810 13729 14346 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964048.1 protein_id gnl|my_center|LOCUS_15810 14346 14783 gene locus_tag LOCUS_15820 14346 14783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_15820 14783 15619 gene locus_tag LOCUS_15830 14783 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 18474 15691 gene locus_tag LOCUS_15840 18474 15691 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_15840 19921 18611 gene locus_tag LOCUS_15850 gene der 19921 18611 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_15850 20071 20562 gene locus_tag LOCUS_15860 20071 20562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 21447 20563 gene locus_tag LOCUS_15870 gene era 21447 20563 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_15870 21563 21636 gene locus_tag LOCUS_t00280 21563 21636 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21671 21744 gene locus_tag LOCUS_t00290 21671 21744 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21888 22340 gene locus_tag LOCUS_15880 21888 22340 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 protein_id gnl|my_center|LOCUS_15880 22411 22893 gene locus_tag LOCUS_15890 22411 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 22970 24115 gene locus_tag LOCUS_15900 22970 24115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 protein_id gnl|my_center|LOCUS_15900 26125 24215 gene locus_tag LOCUS_15910 26125 24215 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_15910 26193 26585 gene locus_tag LOCUS_15920 26193 26585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_15920 27635 26580 gene locus_tag LOCUS_15930 gene fjo30 27635 26580 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_15930 28588 27701 gene locus_tag LOCUS_15940 gene gldN 28588 27701 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_15940 30112 28634 gene locus_tag LOCUS_15950 gene gldM 30112 28634 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_15950 30866 30231 gene locus_tag LOCUS_15960 gene gldL 30866 30231 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_15960 32309 30918 gene locus_tag LOCUS_15970 gene gldK 32309 30918 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_15970 33602 32454 gene locus_tag LOCUS_15980 gene fjo29 33602 32454 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_15980 36104 33606 gene locus_tag LOCUS_15990 gene topA 36104 33606 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_15990 36280 37728 gene locus_tag LOCUS_16000 gene miaB 36280 37728 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_16000 37731 38999 gene locus_tag LOCUS_16010 37731 38999 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_16010 39007 39504 gene locus_tag LOCUS_16020 39007 39504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_16020 39521 40294 gene locus_tag LOCUS_16030 39521 40294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_16030 40297 40653 gene locus_tag LOCUS_16040 40297 40653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 40787 41065 gene locus_tag LOCUS_16050 gene groS 40787 41065 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_16050 41092 42720 gene locus_tag LOCUS_16060 gene groL 41092 42720 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_16060 42791 45151 gene locus_tag LOCUS_16070 42791 45151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 46039 45206 gene locus_tag LOCUS_16080 46039 45206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 47650 46052 gene locus_tag LOCUS_16090 47650 46052 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122718.1 protein_id gnl|my_center|LOCUS_16090 49551 47683 gene locus_tag LOCUS_16100 49551 47683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 52051 49556 gene locus_tag LOCUS_16110 52051 49556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 52457 52137 gene locus_tag LOCUS_16120 52457 52137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 52980 52636 gene locus_tag LOCUS_16130 52980 52636 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964132.1 protein_id gnl|my_center|LOCUS_16130 55245 53002 gene locus_tag LOCUS_16140 55245 53002 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_16140 55707 55300 gene locus_tag LOCUS_16150 55707 55300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964134.1 protein_id gnl|my_center|LOCUS_16150 56179 55742 gene locus_tag LOCUS_16160 56179 55742 CDS product exosortase F system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964135.1 protein_id gnl|my_center|LOCUS_16160 56741 56172 gene locus_tag LOCUS_16170 56741 56172 CDS product exosortase family protein XrtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964136.1 protein_id gnl|my_center|LOCUS_16170 56796 57248 gene locus_tag LOCUS_16180 56796 57248 CDS product GAF domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_16180 57360 57629 gene locus_tag LOCUS_16190 gene rpsO 57360 57629 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H184 protein_id gnl|my_center|LOCUS_16190 57772 59925 gene locus_tag LOCUS_16200 gene pnp 57772 59925 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H185 protein_id gnl|my_center|LOCUS_16200 60006 62237 gene locus_tag LOCUS_16210 60006 62237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 62317 63180 gene locus_tag LOCUS_16220 gene rpoD 62317 63180 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_16220 63393 64055 gene locus_tag LOCUS_16230 gene rpe 63393 64055 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_16230 64509 64090 gene locus_tag LOCUS_16240 64509 64090 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939136.1 protein_id gnl|my_center|LOCUS_16240 65403 64603 gene locus_tag LOCUS_16250 65403 64603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964150.1 protein_id gnl|my_center|LOCUS_16250 65620 65546 gene locus_tag LOCUS_t00300 65620 65546 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 66159 65710 gene locus_tag LOCUS_16260 66159 65710 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_16260 68223 66268 gene locus_tag LOCUS_16270 gene ftsZ 68223 66268 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H191 protein_id gnl|my_center|LOCUS_16270 69605 68235 gene locus_tag LOCUS_16280 gene ftsA 69605 68235 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_16280 70263 69613 gene locus_tag LOCUS_16290 gene ftsQ 70263 69613 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964154.1 protein_id gnl|my_center|LOCUS_16290 71674 70325 gene locus_tag LOCUS_16300 gene murC 71674 70325 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_16300 72777 71677 gene locus_tag LOCUS_16310 gene murG 72777 71677 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_16310 74056 72770 gene locus_tag LOCUS_16320 gene ftsW 74056 72770 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_16320 75393 74059 gene locus_tag LOCUS_16330 gene murD 75393 74059 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_16330 76615 75395 gene locus_tag LOCUS_16340 gene mraY 76615 75395 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_16340 78082 76619 gene locus_tag LOCUS_16350 gene murE 78082 76619 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_16350 80007 78079 gene locus_tag LOCUS_16360 gene ftsI 80007 78079 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_16360 80411 80052 gene locus_tag LOCUS_16370 80411 80052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964162.1 protein_id gnl|my_center|LOCUS_16370 81313 80417 gene locus_tag LOCUS_16380 gene rsmH 81313 80417 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 protein_id gnl|my_center|LOCUS_16380 81770 81300 gene locus_tag LOCUS_16390 gene mraZ 81770 81300 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_16390 82119 82874 gene locus_tag LOCUS_16400 gene pcbD 82119 82874 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_16400 82909 83532 gene locus_tag LOCUS_16410 gene engB 82909 83532 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 protein_id gnl|my_center|LOCUS_16410 83905 83573 gene locus_tag LOCUS_16420 gene gldC 83905 83573 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_16420 84861 83905 gene locus_tag LOCUS_16430 gene gldB 84861 83905 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_16430 84965 85777 gene locus_tag LOCUS_16440 gene nadE 84965 85777 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 protein_id gnl|my_center|LOCUS_16440 85851 86480 gene locus_tag LOCUS_16450 85851 86480 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964170.1 protein_id gnl|my_center|LOCUS_16450 88453 86477 gene locus_tag LOCUS_16460 gene dnaG 88453 86477 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_16460 89591 88611 gene locus_tag LOCUS_16470 89591 88611 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_16470 90858 89818 gene locus_tag LOCUS_16480 gene rlmN 90858 89818 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_16480 91097 91738 gene locus_tag LOCUS_16490 91097 91738 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_16490 92169 91747 gene locus_tag LOCUS_16500 92169 91747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 92742 92170 gene locus_tag LOCUS_16510 92742 92170 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_16510 93091 92744 gene locus_tag LOCUS_16520 93091 92744 CDS product Sec-independent protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964182.1 protein_id gnl|my_center|LOCUS_16520 95491 93221 gene locus_tag LOCUS_16530 95491 93221 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_16530 96006 95503 gene locus_tag LOCUS_16540 96006 95503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964227.1 protein_id gnl|my_center|LOCUS_16540 96718 95996 gene locus_tag LOCUS_16550 96718 95996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964228.1 protein_id gnl|my_center|LOCUS_16550 96903 97610 gene locus_tag LOCUS_16560 gene pepE 96903 97610 CDS product dipeptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_16560 97714 97641 gene locus_tag LOCUS_t00310 97714 97641 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 97810 97737 gene locus_tag LOCUS_t00320 97810 97737 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 98105 99694 gene locus_tag LOCUS_16570 98105 99694 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964231.1 protein_id gnl|my_center|LOCUS_16570 100414 99683 gene locus_tag LOCUS_16580 100414 99683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964232.1 protein_id gnl|my_center|LOCUS_16580 100632 103019 gene locus_tag LOCUS_16590 100632 103019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 103093 104589 gene locus_tag LOCUS_16600 gene gpmI 103093 104589 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_16600 104591 105112 gene locus_tag LOCUS_16610 104591 105112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 105244 105915 gene locus_tag LOCUS_16620 105244 105915 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_16620 105912 107573 gene locus_tag LOCUS_16630 105912 107573 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_16630 107576 108928 gene locus_tag LOCUS_16640 107576 108928 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_16640 108912 110315 gene locus_tag LOCUS_16650 108912 110315 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_16650 110706 110365 gene locus_tag LOCUS_16660 gene rpbA 110706 110365 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962513.1 protein_id gnl|my_center|LOCUS_16660 110854 111672 gene locus_tag LOCUS_16670 gene map 110854 111672 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_16670 111705 112079 gene locus_tag LOCUS_16680 111705 112079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 112114 112902 gene locus_tag LOCUS_16690 112114 112902 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_16690 113901 112888 gene locus_tag LOCUS_16700 113901 112888 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_16700 114241 113879 gene locus_tag LOCUS_16710 114241 113879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 114970 114317 gene locus_tag LOCUS_16720 114970 114317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 116348 115035 gene locus_tag LOCUS_16730 gene nqrF 116348 115035 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_16730 117100 116351 gene locus_tag LOCUS_16740 gene nqrE 117100 116351 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR7 protein_id gnl|my_center|LOCUS_16740 117778 117104 gene locus_tag LOCUS_16750 gene nqrD 117778 117104 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_16750 118507 117782 gene locus_tag LOCUS_16760 gene nqrC 118507 117782 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_16760 119622 118510 gene locus_tag LOCUS_16770 gene nqrB 119622 118510 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K8 protein_id gnl|my_center|LOCUS_16770 121098 119752 gene locus_tag LOCUS_16780 gene nqrA 121098 119752 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_16780 121295 122542 gene locus_tag LOCUS_16790 121295 122542 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_16790 122545 123555 gene locus_tag LOCUS_16800 122545 123555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 123556 123942 gene locus_tag LOCUS_16810 gene apaG 123556 123942 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_16810 124044 125669 gene locus_tag LOCUS_16820 gene pruA 124044 125669 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_16820 126340 125711 gene locus_tag LOCUS_16830 gene rsmG 126340 125711 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_16830 126453 127550 gene locus_tag LOCUS_16840 126453 127550 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_16840 127575 128759 gene locus_tag LOCUS_16850 gene aspC1 127575 128759 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_16850 128813 129979 gene locus_tag LOCUS_16860 gene purT 128813 129979 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP9 protein_id gnl|my_center|LOCUS_16860 129992 130315 gene locus_tag LOCUS_16870 129992 130315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962578.1 protein_id gnl|my_center|LOCUS_16870 130322 130897 gene locus_tag LOCUS_16880 130322 130897 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 protein_id gnl|my_center|LOCUS_16880 130976 131692 gene locus_tag LOCUS_16890 130976 131692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766240.1 protein_id gnl|my_center|LOCUS_16890 132349 131696 gene locus_tag LOCUS_16900 132349 131696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 132442 132726 gene locus_tag LOCUS_16910 132442 132726 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405647.1 protein_id gnl|my_center|LOCUS_16910 132743 132970 gene locus_tag LOCUS_16920 132743 132970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107822.1 protein_id gnl|my_center|LOCUS_16920 132960 133499 gene locus_tag LOCUS_16930 132960 133499 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_16930 133489 134283 gene locus_tag LOCUS_16940 133489 134283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 134424 135299 gene locus_tag LOCUS_16950 gene fabD 134424 135299 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_16950 135366 136043 gene locus_tag LOCUS_16960 135366 136043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 137091 136078 gene locus_tag LOCUS_16970 gene galE 137091 136078 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_16970 138289 137162 gene locus_tag LOCUS_16980 gene porR 138289 137162 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_16980 138461 139639 gene locus_tag LOCUS_16990 gene kdtA 138461 139639 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_16990 139690 141834 gene locus_tag LOCUS_17000 gene dpp11 139690 141834 CDS product Asp/Glu-specific dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWM2 protein_id gnl|my_center|LOCUS_17000 141993 142190 gene locus_tag LOCUS_17010 141993 142190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 142600 142253 gene locus_tag LOCUS_17020 142600 142253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962555.1 protein_id gnl|my_center|LOCUS_17020 142791 142705 gene locus_tag LOCUS_t00330 142791 142705 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 142882 142809 gene locus_tag LOCUS_t00340 142882 142809 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 145657 143039 gene locus_tag LOCUS_17030 gene mutS 145657 143039 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWN3 protein_id gnl|my_center|LOCUS_17030 145804 146331 gene locus_tag LOCUS_17040 145804 146331 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_17040 146424 146615 gene locus_tag LOCUS_17050 146424 146615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 147742 146612 gene locus_tag LOCUS_17060 147742 146612 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962567.1 protein_id gnl|my_center|LOCUS_17060 147919 149631 gene locus_tag LOCUS_17070 gene sppA 147919 149631 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_17070 149711 150421 gene locus_tag LOCUS_17080 149711 150421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_17080 150526 153156 gene locus_tag LOCUS_17090 150526 153156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962569.1 protein_id gnl|my_center|LOCUS_17090 154022 153231 gene locus_tag LOCUS_17100 154022 153231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_17100 154117 155640 gene locus_tag LOCUS_17110 154117 155640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_17110 156011 157585 gene locus_tag LOCUS_17120 156011 157585 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_17120 157588 157722 gene locus_tag LOCUS_17130 157588 157722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 159007 157775 gene locus_tag LOCUS_17140 gene clpX 159007 157775 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_17140 159760 159086 gene locus_tag LOCUS_17150 gene clpP 159760 159086 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_17150 161174 159849 gene locus_tag LOCUS_17160 gene tig 161174 159849 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_17160 161619 161275 gene locus_tag LOCUS_17170 161619 161275 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964186.1 protein_id gnl|my_center|LOCUS_17170 163185 161689 gene locus_tag LOCUS_17180 163185 161689 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_17180 164439 163204 gene locus_tag LOCUS_17190 164439 163204 CDS product fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_17190 165323 164562 gene locus_tag LOCUS_17200 165323 164562 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_17200 166036 165323 gene locus_tag LOCUS_17210 gene pdxJ 166036 165323 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 protein_id gnl|my_center|LOCUS_17210 166128 166787 gene locus_tag LOCUS_17220 166128 166787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_17220 166794 167669 gene locus_tag LOCUS_17230 gene nadK 166794 167669 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_17230 167778 168461 gene locus_tag LOCUS_17240 167778 168461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_17240 168463 169206 gene locus_tag LOCUS_17250 gene uppS 168463 169206 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_17250 169211 171838 gene locus_tag LOCUS_17260 gene bamA 169211 171838 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 protein_id gnl|my_center|LOCUS_17260 171951 172943 gene locus_tag LOCUS_17270 gene skp 171951 172943 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964196.1 protein_id gnl|my_center|LOCUS_17270 172973 173476 gene locus_tag LOCUS_17280 172973 173476 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964197.1 protein_id gnl|my_center|LOCUS_17280 173551 174330 gene locus_tag LOCUS_17290 gene murI 173551 174330 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D7 protein_id gnl|my_center|LOCUS_17290 174850 174335 gene locus_tag LOCUS_17300 174850 174335 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_17300 175924 174926 gene locus_tag LOCUS_17310 175924 174926 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_17310 176129 177028 gene locus_tag LOCUS_17320 176129 177028 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 protein_id gnl|my_center|LOCUS_17320 179353 177095 gene locus_tag LOCUS_17330 179353 177095 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PX3 protein_id gnl|my_center|LOCUS_17330 181760 179538 gene locus_tag LOCUS_17340 181760 179538 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PX3 protein_id gnl|my_center|LOCUS_17340 183057 181852 gene locus_tag LOCUS_17350 183057 181852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 183394 184212 gene locus_tag LOCUS_17360 gene mscS3 183394 184212 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963360.1 protein_id gnl|my_center|LOCUS_17360 184872 184213 gene locus_tag LOCUS_17370 184872 184213 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_17370 186277 184976 gene locus_tag LOCUS_17380 186277 184976 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_17380 187603 186281 gene locus_tag LOCUS_17390 187603 186281 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_17390 187707 189098 gene locus_tag LOCUS_17400 187707 189098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964213.1 protein_id gnl|my_center|LOCUS_17400 189385 189110 gene locus_tag LOCUS_17410 189385 189110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964212.1 protein_id gnl|my_center|LOCUS_17410 189917 189375 gene locus_tag LOCUS_17420 gene yozB 189917 189375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_17420 190549 189920 gene locus_tag LOCUS_17430 gene ypmQ 190549 189920 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_17430 191259 190552 gene locus_tag LOCUS_17440 191259 190552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964209.1 protein_id gnl|my_center|LOCUS_17440 191682 191332 gene locus_tag LOCUS_17450 191682 191332 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_17450 192672 191701 gene locus_tag LOCUS_17460 192672 191701 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_17460 193304 192717 gene locus_tag LOCUS_17470 gene ctaE 193304 192717 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_17470 194196 193306 gene locus_tag LOCUS_17480 gene ctaB 194196 193306 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_17480 196522 194402 gene locus_tag LOCUS_17490 196522 194402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964216.1 protein_id gnl|my_center|LOCUS_17490 197348 196530 gene locus_tag LOCUS_17500 gene deoC 197348 196530 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F6 protein_id gnl|my_center|LOCUS_17500 198102 197350 gene locus_tag LOCUS_17510 198102 197350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 198928 198194 gene locus_tag LOCUS_17520 198928 198194 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A441 protein_id gnl|my_center|LOCUS_17520 199363 198974 gene locus_tag LOCUS_17530 199363 198974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 199712 199332 gene locus_tag LOCUS_17540 gene gcvH 199712 199332 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_17540 207005 199797 gene locus_tag LOCUS_17550 gene sprA 207005 199797 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_17550 207590 207009 gene locus_tag LOCUS_17560 gene ruvA 207590 207009 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_17560 209919 207628 gene locus_tag LOCUS_17570 gene maeB 209919 207628 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_17570 210907 209981 gene locus_tag LOCUS_17580 gene queG 210907 209981 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_17580 211930 210908 gene locus_tag LOCUS_17590 gene ruvB 211930 210908 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_17590 213775 212006 gene locus_tag LOCUS_17600 gene ctaD 213775 212006 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_17600 214955 213804 gene locus_tag LOCUS_17610 gene ctaC 214955 213804 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_17610 216252 214975 gene locus_tag LOCUS_17620 gene actF 216252 214975 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_17620 216873 216328 gene locus_tag LOCUS_17630 gene actE 216873 216328 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_17630 217407 216883 gene locus_tag LOCUS_17640 gene actD 217407 216883 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_17640 218818 217412 gene locus_tag LOCUS_17650 gene actC 218818 217412 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_17650 221882 218847 gene locus_tag LOCUS_17660 gene actB 221882 218847 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_17660 223148 221916 gene locus_tag LOCUS_17670 gene actA 223148 221916 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_17670 223446 223835 gene locus_tag LOCUS_17680 223446 223835 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962542.1 protein_id gnl|my_center|LOCUS_17680 223835 224329 gene locus_tag LOCUS_17690 223835 224329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 224388 226592 gene locus_tag LOCUS_17700 224388 226592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_17700 227035 226646 gene locus_tag LOCUS_17710 227035 226646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 229885 227117 gene locus_tag LOCUS_17720 gene infB 229885 227117 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 protein_id gnl|my_center|LOCUS_17720 231188 229950 gene locus_tag LOCUS_17730 gene nusA 231188 229950 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_17730 231669 231202 gene locus_tag LOCUS_17740 gene rimP 231669 231202 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV6 protein_id gnl|my_center|LOCUS_17740 231837 232661 gene locus_tag LOCUS_17750 gene uspA 231837 232661 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_17750 232783 232712 gene locus_tag LOCUS_t00350 232783 232712 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 232950 236156 gene locus_tag LOCUS_17760 232950 236156 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 protein_id gnl|my_center|LOCUS_17760 236225 236863 gene locus_tag LOCUS_17770 236225 236863 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_17770 237156 236860 gene locus_tag LOCUS_17780 237156 236860 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_17780 238426 237230 gene locus_tag LOCUS_17790 238426 237230 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_17790 238589 239059 gene locus_tag LOCUS_17800 238589 239059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 239061 241913 gene locus_tag LOCUS_17810 gene polA 239061 241913 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_17810 242017 242556 gene locus_tag LOCUS_17820 242017 242556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 243001 244308 gene locus_tag LOCUS_17830 243001 244308 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_17830 244430 244885 gene locus_tag LOCUS_17840 gene rplM 244430 244885 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 protein_id gnl|my_center|LOCUS_17840 244885 245271 gene locus_tag LOCUS_17850 gene rpsI 244885 245271 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU3 protein_id gnl|my_center|LOCUS_17850 245451 246218 gene locus_tag LOCUS_17860 gene rpsB 245451 246218 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_17860 246331 247152 gene locus_tag LOCUS_17870 gene tsf 246331 247152 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_17870 247241 247450 gene locus_tag LOCUS_17880 247241 247450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 247541 251260 gene locus_tag LOCUS_17890 247541 251260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 251263 251829 gene locus_tag LOCUS_17900 gene tag 251263 251829 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_17900 251831 252049 gene locus_tag LOCUS_17910 251831 252049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963989.1 protein_id gnl|my_center|LOCUS_17910 252252 252458 gene locus_tag LOCUS_17920 gene thiS 252252 252458 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962596.1 protein_id gnl|my_center|LOCUS_17920 252575 254398 gene locus_tag LOCUS_17930 gene thiC 252575 254398 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWR6 protein_id gnl|my_center|LOCUS_17930 254424 255035 gene locus_tag LOCUS_17940 gene thiE1 254424 255035 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962598.1 protein_id gnl|my_center|LOCUS_17940 255008 255763 gene locus_tag LOCUS_17950 gene thiD 255008 255763 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962599.1 protein_id gnl|my_center|LOCUS_17950 255756 256379 gene locus_tag LOCUS_17960 gene thiE 255756 256379 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWR9 protein_id gnl|my_center|LOCUS_17960 256366 257136 gene locus_tag LOCUS_17970 gene thiG 256366 257136 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS0 protein_id gnl|my_center|LOCUS_17970 257365 257742 gene locus_tag LOCUS_17980 257365 257742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_17980 257784 258905 gene locus_tag LOCUS_17990 gene thiH 257784 258905 CDS product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_17990 258969 259679 gene locus_tag LOCUS_18000 gene thiF 258969 259679 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962603.1 protein_id gnl|my_center|LOCUS_18000 260311 259676 gene locus_tag LOCUS_18010 gene aat 260311 259676 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H233 protein_id gnl|my_center|LOCUS_18010 260789 260415 gene locus_tag LOCUS_18020 260789 260415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_18020 261677 260802 gene locus_tag LOCUS_18030 261677 260802 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_18030 261899 262921 gene locus_tag LOCUS_18040 gene porY 261899 262921 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_18040 263523 263134 gene locus_tag LOCUS_18050 263523 263134 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_18050 264051 263578 gene locus_tag LOCUS_18060 gene greA 264051 263578 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_18060 264183 264608 gene locus_tag LOCUS_18070 264183 264608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964454.1 protein_id gnl|my_center|LOCUS_18070 266838 264664 gene locus_tag LOCUS_18080 266838 264664 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_18080 267448 267047 gene locus_tag LOCUS_18090 267448 267047 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_18090 268976 267441 gene locus_tag LOCUS_18100 268976 267441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 269560 268946 gene locus_tag LOCUS_18110 gene pnuC 269560 268946 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_18110 270273 269554 gene locus_tag LOCUS_18120 gene pcrB 270273 269554 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_18120 270904 270275 gene locus_tag LOCUS_18130 gene sfp 270904 270275 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_18130 271037 272353 gene locus_tag LOCUS_18140 gene ahcY 271037 272353 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_18140 272651 273022 gene locus_tag LOCUS_18150 272651 273022 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761500.1 protein_id gnl|my_center|LOCUS_18150 273019 274590 gene locus_tag LOCUS_18160 273019 274590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 274924 275904 gene locus_tag LOCUS_18170 274924 275904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_18170 276717 275995 gene locus_tag LOCUS_18180 276717 275995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962381.1 protein_id gnl|my_center|LOCUS_18180 277768 276824 gene locus_tag LOCUS_18190 277768 276824 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963731.1 protein_id gnl|my_center|LOCUS_18190 278256 277894 gene locus_tag LOCUS_18200 278256 277894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_18200 279063 278281 gene locus_tag LOCUS_18210 279063 278281 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_18210 280197 279154 gene locus_tag LOCUS_18220 280197 279154 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_18220 280857 280303 gene locus_tag LOCUS_18230 gene ruvC 280857 280303 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_18230 280943 281860 gene locus_tag LOCUS_18240 280943 281860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962386.1 protein_id gnl|my_center|LOCUS_18240 281857 282957 gene locus_tag LOCUS_18250 281857 282957 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_18250 283528 283049 gene locus_tag LOCUS_18260 283528 283049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962388.1 protein_id gnl|my_center|LOCUS_18260 283623 284084 gene locus_tag LOCUS_18270 283623 284084 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962389.1 protein_id gnl|my_center|LOCUS_18270 284085 285773 gene locus_tag LOCUS_18280 284085 285773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 285780 286430 gene locus_tag LOCUS_18290 285780 286430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 286523 289069 gene locus_tag LOCUS_18300 286523 289069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 290016 289507 gene locus_tag LOCUS_18310 290016 289507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 290577 290071 gene locus_tag LOCUS_18320 290577 290071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 291530 290859 gene locus_tag LOCUS_18330 291530 290859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence5 6709 1382 gene locus_tag LOCUS_18340 6709 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 12530 6942 gene locus_tag LOCUS_18350 12530 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 12764 14575 gene locus_tag LOCUS_18360 12764 14575 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962777.1 protein_id gnl|my_center|LOCUS_18360 14685 15530 gene locus_tag LOCUS_18370 gene acdS 14685 15530 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_18370 15520 16389 gene locus_tag LOCUS_18380 15520 16389 CDS product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 protein_id gnl|my_center|LOCUS_18380 16389 17678 gene locus_tag LOCUS_18390 gene hemL 16389 17678 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW4 protein_id gnl|my_center|LOCUS_18390 18038 17709 gene locus_tag LOCUS_18400 18038 17709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 18533 18111 gene locus_tag LOCUS_18410 18533 18111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 20363 18666 gene locus_tag LOCUS_18420 gene lysS 20363 18666 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 protein_id gnl|my_center|LOCUS_18420 20694 21398 gene locus_tag LOCUS_18430 20694 21398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 21398 22099 gene locus_tag LOCUS_18440 gene lipB 21398 22099 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_18440 22695 22096 gene locus_tag LOCUS_18450 gene rnhB 22695 22096 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW0 protein_id gnl|my_center|LOCUS_18450 22943 26005 gene locus_tag LOCUS_18460 22943 26005 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963331.1 protein_id gnl|my_center|LOCUS_18460 26018 27502 gene locus_tag LOCUS_18470 26018 27502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963330.1 protein_id gnl|my_center|LOCUS_18470 27521 28363 gene locus_tag LOCUS_18480 27521 28363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 28377 29378 gene locus_tag LOCUS_18490 28377 29378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 29469 31370 gene locus_tag LOCUS_18500 29469 31370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_18500 31555 32916 gene locus_tag LOCUS_18510 31555 32916 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_18510 33008 34273 gene locus_tag LOCUS_18520 33008 34273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_18520 34284 34502 gene locus_tag LOCUS_18530 34284 34502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_18530 34586 36406 gene locus_tag LOCUS_18540 gene snf 34586 36406 CDS product sodium:calcium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_18540 36438 36599 gene locus_tag LOCUS_18550 36438 36599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 36697 37494 gene locus_tag LOCUS_18560 36697 37494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963324.1 protein_id gnl|my_center|LOCUS_18560 37521 38687 gene locus_tag LOCUS_18570 37521 38687 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_18570 38952 39146 gene locus_tag LOCUS_18580 gene rpsU 38952 39146 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_18580 39216 40112 gene locus_tag LOCUS_18590 gene xerC 39216 40112 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_18590 40146 40448 gene locus_tag LOCUS_18600 40146 40448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_18600 40540 40614 gene locus_tag LOCUS_t00360 40540 40614 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 40650 40731 gene locus_tag LOCUS_t00370 40650 40731 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 40793 40865 gene locus_tag LOCUS_t00380 40793 40865 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 40930 42117 gene locus_tag LOCUS_18610 gene tuf 40930 42117 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU7 protein_id gnl|my_center|LOCUS_18610 42181 42252 gene locus_tag LOCUS_t00390 42181 42252 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 42267 42461 gene locus_tag LOCUS_18620 gene secE 42267 42461 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU6 protein_id gnl|my_center|LOCUS_18620 42469 43020 gene locus_tag LOCUS_18630 gene nusG 42469 43020 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU5 protein_id gnl|my_center|LOCUS_18630 43082 43525 gene locus_tag LOCUS_18640 gene rplK 43082 43525 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU4 protein_id gnl|my_center|LOCUS_18640 43537 44226 gene locus_tag LOCUS_18650 gene rplA 43537 44226 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU3 protein_id gnl|my_center|LOCUS_18650 44249 44746 gene locus_tag LOCUS_18660 gene rplJ 44249 44746 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU2 protein_id gnl|my_center|LOCUS_18660 44804 45175 gene locus_tag LOCUS_18670 gene rplL 44804 45175 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU1 protein_id gnl|my_center|LOCUS_18670 45300 49112 gene locus_tag LOCUS_18680 gene rpoB 45300 49112 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU0 protein_id gnl|my_center|LOCUS_18680 49210 53514 gene locus_tag LOCUS_18690 gene rpoC 49210 53514 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT9 protein_id gnl|my_center|LOCUS_18690 53675 53983 gene locus_tag LOCUS_18700 53675 53983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_18700 54108 54602 gene locus_tag LOCUS_18710 54108 54602 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_18710 55387 54599 gene locus_tag LOCUS_18720 55387 54599 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_18720 56319 55540 gene locus_tag LOCUS_18730 56319 55540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_18730 57415 56321 gene locus_tag LOCUS_18740 gene yqfO 57415 56321 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX9 protein_id gnl|my_center|LOCUS_18740 57482 58501 gene locus_tag LOCUS_18750 gene lpxK 57482 58501 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_18750 58473 59285 gene locus_tag LOCUS_18760 gene deoD 58473 59285 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM2 protein_id gnl|my_center|LOCUS_18760 61476 59269 gene locus_tag LOCUS_18770 61476 59269 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_18770 62523 61522 gene locus_tag LOCUS_18780 gene gapA1 62523 61522 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963588.1 protein_id gnl|my_center|LOCUS_18780 63394 62525 gene locus_tag LOCUS_18790 gene lipA 63394 62525 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_18790 64760 63516 gene locus_tag LOCUS_18800 gene yjhB 64760 63516 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_18800 65379 64810 gene locus_tag LOCUS_18810 65379 64810 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_18810 66479 65370 gene locus_tag LOCUS_18820 66479 65370 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_18820 66698 66495 gene locus_tag LOCUS_18830 66698 66495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 67767 66760 gene locus_tag LOCUS_18840 gene murB 67767 66760 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_18840 68890 67811 gene locus_tag LOCUS_18850 gene recF 68890 67811 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_18850 69015 69800 gene locus_tag LOCUS_18860 69015 69800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_18860 69802 70290 gene locus_tag LOCUS_18870 gene ribH 69802 70290 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_18870 70400 70699 gene locus_tag LOCUS_18880 70400 70699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 70700 72559 gene locus_tag LOCUS_18890 gene mutL 70700 72559 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_18890 72556 73308 gene locus_tag LOCUS_18900 72556 73308 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_18900 73364 74224 gene locus_tag LOCUS_18910 73364 74224 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963287.1 protein_id gnl|my_center|LOCUS_18910 74224 75267 gene locus_tag LOCUS_18920 74224 75267 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_18920 75875 75264 gene locus_tag LOCUS_18930 75875 75264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 protein_id gnl|my_center|LOCUS_18930 77517 75919 gene locus_tag LOCUS_18940 gene lepB 77517 75919 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP1 protein_id gnl|my_center|LOCUS_18940 78266 77571 gene locus_tag LOCUS_18950 gene dapB 78266 77571 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_18950 78865 78311 gene locus_tag LOCUS_18960 78865 78311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_18960 79764 78865 gene locus_tag LOCUS_18970 gene parB 79764 78865 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_18970 80534 79770 gene locus_tag LOCUS_18980 gene parA 80534 79770 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_18980 80688 81245 gene locus_tag LOCUS_18990 80688 81245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 82523 81438 gene locus_tag LOCUS_19000 82523 81438 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204968.1 protein_id gnl|my_center|LOCUS_19000 83002 82568 gene locus_tag LOCUS_19010 83002 82568 CDS product SOS-response transcriptional regulator UmuD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202621.1 protein_id gnl|my_center|LOCUS_19010 84261 82993 gene locus_tag LOCUS_19020 gene umuC 84261 82993 CDS product SOS mutagenesis and repair protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_19020 86519 84399 gene locus_tag LOCUS_19030 gene mutB 86519 84399 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 protein_id gnl|my_center|LOCUS_19030 87893 86523 gene locus_tag LOCUS_19040 gene mutA 87893 86523 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963259.1 protein_id gnl|my_center|LOCUS_19040 88160 87918 gene locus_tag LOCUS_19050 88160 87918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 88895 88257 gene locus_tag LOCUS_19060 gene udk 88895 88257 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 protein_id gnl|my_center|LOCUS_19060 88988 89063 gene locus_tag LOCUS_t00400 88988 89063 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 89118 89357 gene locus_tag LOCUS_19070 89118 89357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 89560 90507 gene locus_tag LOCUS_19080 gene trxB1 89560 90507 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_19080 91080 90553 gene locus_tag LOCUS_19090 91080 90553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 91916 91083 gene locus_tag LOCUS_19100 91916 91083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962838.1 protein_id gnl|my_center|LOCUS_19100 92971 92246 gene locus_tag LOCUS_19110 92971 92246 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962837.1 protein_id gnl|my_center|LOCUS_19110 94716 92983 gene locus_tag LOCUS_19120 94716 92983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_19120 95051 94722 gene locus_tag LOCUS_19130 95051 94722 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_19130 95576 95121 gene locus_tag LOCUS_19140 95576 95121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962834.1 protein_id gnl|my_center|LOCUS_19140 95731 96186 gene locus_tag LOCUS_19150 95731 96186 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_19150 96271 97179 gene locus_tag LOCUS_19160 96271 97179 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_19160 97857 97225 gene locus_tag LOCUS_19170 97857 97225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 98040 98579 gene locus_tag LOCUS_19180 gene grpE 98040 98579 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_19180 98615 99733 gene locus_tag LOCUS_19190 gene dnaJ 98615 99733 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_19190 99894 100814 gene locus_tag LOCUS_19200 gene natA 99894 100814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_19200 100839 102146 gene locus_tag LOCUS_19210 gene natB 100839 102146 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_19210 102150 102980 gene locus_tag LOCUS_19220 102150 102980 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_19220 103014 104177 gene locus_tag LOCUS_19230 103014 104177 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_19230 104179 104811 gene locus_tag LOCUS_19240 104179 104811 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962826.1 protein_id gnl|my_center|LOCUS_19240 104831 105049 gene locus_tag LOCUS_19250 104831 105049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962825.1 protein_id gnl|my_center|LOCUS_19250 105731 105087 gene locus_tag LOCUS_19260 105731 105087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 105910 107547 gene locus_tag LOCUS_19270 105910 107547 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962719.1 protein_id gnl|my_center|LOCUS_19270 107943 107776 gene locus_tag LOCUS_19280 107943 107776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 108212 108682 gene locus_tag LOCUS_19290 108212 108682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 109230 108781 gene locus_tag LOCUS_19300 109230 108781 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_19300 111555 109354 gene locus_tag LOCUS_19310 111555 109354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 112575 111598 gene locus_tag LOCUS_19320 112575 111598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962712.1 protein_id gnl|my_center|LOCUS_19320 113112 112579 gene locus_tag LOCUS_19330 113112 112579 CDS product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361994.1 protein_id gnl|my_center|LOCUS_19330 113835 113248 gene locus_tag LOCUS_19340 113835 113248 CDS product RNAse inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962725.1 protein_id gnl|my_center|LOCUS_19340 113911 114789 gene locus_tag LOCUS_19350 113911 114789 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962727.1 protein_id gnl|my_center|LOCUS_19350 114897 116273 gene locus_tag LOCUS_19360 gene norM 114897 116273 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_19360 116314 116544 gene locus_tag LOCUS_19370 116314 116544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_19370 116556 117290 gene locus_tag LOCUS_19380 116556 117290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 118379 117294 gene locus_tag LOCUS_19390 gene argK 118379 117294 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962733.1 protein_id gnl|my_center|LOCUS_19390 118481 119392 gene locus_tag LOCUS_19400 118481 119392 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932156.1 protein_id gnl|my_center|LOCUS_19400 119396 120805 gene locus_tag LOCUS_19410 gene glcD 119396 120805 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_19410 120856 121224 gene locus_tag LOCUS_19420 120856 121224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962738.1 protein_id gnl|my_center|LOCUS_19420 121318 123459 gene locus_tag LOCUS_19430 121318 123459 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_19430 123908 123510 gene locus_tag LOCUS_19440 123908 123510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962736.1 protein_id gnl|my_center|LOCUS_19440 124481 123909 gene locus_tag LOCUS_19450 124481 123909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 124897 124481 gene locus_tag LOCUS_19460 124897 124481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 128339 124980 gene locus_tag LOCUS_19470 gene secA 128339 124980 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_19470 128645 128424 gene locus_tag LOCUS_19480 128645 128424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_19480 129402 128833 gene locus_tag LOCUS_19490 129402 128833 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_19490 130370 129684 gene locus_tag LOCUS_19500 130370 129684 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_19500 131277 130456 gene locus_tag LOCUS_19510 131277 130456 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_19510 133200 131341 gene locus_tag LOCUS_19520 133200 131341 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_19520 133273 134430 gene locus_tag LOCUS_19530 133273 134430 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962750.1 protein_id gnl|my_center|LOCUS_19530 134520 135815 gene locus_tag LOCUS_19540 gene bfmBB 134520 135815 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_19540 135894 136835 gene locus_tag LOCUS_19550 135894 136835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 136835 137479 gene locus_tag LOCUS_19560 136835 137479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 137460 138230 gene locus_tag LOCUS_19570 137460 138230 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_19570 138249 138860 gene locus_tag LOCUS_19580 138249 138860 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_19580 138862 139212 gene locus_tag LOCUS_19590 138862 139212 CDS product phosphotransfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361989.1 protein_id gnl|my_center|LOCUS_19590 139218 140465 gene locus_tag LOCUS_19600 139218 140465 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 protein_id gnl|my_center|LOCUS_19600 140545 140781 gene locus_tag LOCUS_19610 gene rpmB 140545 140781 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_19610 140808 140990 gene locus_tag LOCUS_19620 gene rpmG 140808 140990 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_19620 140998 141150 gene locus_tag LOCUS_19630 140998 141150 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_19630 141235 142215 gene locus_tag LOCUS_19640 gene ftsY 141235 142215 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 protein_id gnl|my_center|LOCUS_19640 143452 142388 gene locus_tag LOCUS_19650 143452 142388 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_19650 143541 143963 gene locus_tag LOCUS_19660 143541 143963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 143965 144261 gene locus_tag LOCUS_19670 143965 144261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_19670 144729 144310 gene locus_tag LOCUS_19680 gene ndk 144729 144310 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_19680 145624 144794 gene locus_tag LOCUS_19690 145624 144794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_19690 147368 145773 gene locus_tag LOCUS_19700 gene bshC 147368 145773 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_19700 148338 147436 gene locus_tag LOCUS_19710 148338 147436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964188.1 protein_id gnl|my_center|LOCUS_19710 151676 148341 gene locus_tag LOCUS_19720 151676 148341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 151975 154053 gene locus_tag LOCUS_19730 151975 154053 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_19730 154137 156239 gene locus_tag LOCUS_19740 154137 156239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 156310 156795 gene locus_tag LOCUS_19750 156310 156795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 156797 158239 gene locus_tag LOCUS_19760 gene accC 156797 158239 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_19760 158286 159878 gene locus_tag LOCUS_19770 gene pccB 158286 159878 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_19770 160140 161225 gene locus_tag LOCUS_19780 160140 161225 CDS product peptidoglycan endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963350.1 protein_id gnl|my_center|LOCUS_19780 161797 161222 gene locus_tag LOCUS_19790 161797 161222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 162285 161809 gene locus_tag LOCUS_19800 162285 161809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 163276 162287 gene locus_tag LOCUS_19810 163276 162287 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_19810 163534 163295 gene locus_tag LOCUS_19820 163534 163295 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VD93 protein_id gnl|my_center|LOCUS_19820 164056 163541 gene locus_tag LOCUS_19830 164056 163541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019126.1 protein_id gnl|my_center|LOCUS_19830 165447 164134 gene locus_tag LOCUS_19840 gene rimO 165447 164134 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_19840 167113 165569 gene locus_tag LOCUS_19850 167113 165569 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_19850 167638 167850 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccaagaattccatccccatcccca 168275 169753 gene locus_tag LOCUS_19860 gene proS 168275 169753 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_19860 169834 169906 gene locus_tag LOCUS_t00410 169834 169906 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 169917 169989 gene locus_tag LOCUS_t00420 169917 169989 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 170142 170393 gene locus_tag LOCUS_19870 gene rpsT 170142 170393 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_19870 170528 172324 gene locus_tag LOCUS_19880 gene typA 170528 172324 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_19880 172404 172844 gene locus_tag LOCUS_19890 172404 172844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362012.1 protein_id gnl|my_center|LOCUS_19890 173977 172886 gene locus_tag LOCUS_19900 gene ppiA 173977 172886 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963995.1 protein_id gnl|my_center|LOCUS_19900 174438 173989 gene locus_tag LOCUS_19910 gene gldI 174438 173989 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T4 protein_id gnl|my_center|LOCUS_19910 175556 174540 gene locus_tag LOCUS_19920 gene fjo19 175556 174540 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_19920 175929 175558 gene locus_tag LOCUS_19930 gene crcB 175929 175558 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J1 protein_id gnl|my_center|LOCUS_19930 177964 175931 gene locus_tag LOCUS_19940 177964 175931 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963773.1 protein_id gnl|my_center|LOCUS_19940 178829 177981 gene locus_tag LOCUS_19950 178829 177981 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_19950 179739 178840 gene locus_tag LOCUS_19960 179739 178840 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_19960 180570 179806 gene locus_tag LOCUS_19970 180570 179806 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_19970 181237 180578 gene locus_tag LOCUS_19980 gene lolD 181237 180578 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_19980 181438 182070 gene locus_tag LOCUS_19990 gene mrsA 181438 182070 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB5 protein_id gnl|my_center|LOCUS_19990 182115 182408 gene locus_tag LOCUS_20000 182115 182408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962796.1 protein_id gnl|my_center|LOCUS_20000 182750 182427 gene locus_tag LOCUS_20010 182750 182427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 protein_id gnl|my_center|LOCUS_20010 183185 182754 gene locus_tag LOCUS_20020 183185 182754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962798.1 protein_id gnl|my_center|LOCUS_20020 183882 183265 gene locus_tag LOCUS_20030 183882 183265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962799.1 protein_id gnl|my_center|LOCUS_20030 184887 183931 gene locus_tag LOCUS_20040 gene serA 184887 183931 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_20040 186005 184935 gene locus_tag LOCUS_20050 gene serC 186005 184935 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 protein_id gnl|my_center|LOCUS_20050 187193 186132 gene locus_tag LOCUS_20060 187193 186132 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_20060 187333 187683 gene locus_tag LOCUS_20070 gene fdx1 187333 187683 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_20070 187763 188920 gene locus_tag LOCUS_20080 187763 188920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962804.1 protein_id gnl|my_center|LOCUS_20080 189057 190151 gene locus_tag LOCUS_20090 gene engD 189057 190151 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC6 protein_id gnl|my_center|LOCUS_20090 191216 190251 gene locus_tag LOCUS_20100 191216 190251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 191419 193275 gene locus_tag LOCUS_20110 gene parE 191419 193275 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_20110 193365 196067 gene locus_tag LOCUS_20120 gene parC 193365 196067 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_20120 196167 197456 gene locus_tag LOCUS_20130 196167 197456 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_20130 198266 197493 gene locus_tag LOCUS_20140 198266 197493 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 protein_id gnl|my_center|LOCUS_20140 198651 198319 gene locus_tag LOCUS_20150 198651 198319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962882.1 protein_id gnl|my_center|LOCUS_20150 199315 198740 gene locus_tag LOCUS_20160 199315 198740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_20160 199529 199302 gene locus_tag LOCUS_20170 199529 199302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 199993 199529 gene locus_tag LOCUS_20180 199993 199529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 200826 200014 gene locus_tag LOCUS_20190 gene murQ 200826 200014 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_20190 201702 200992 gene locus_tag LOCUS_20200 201702 200992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_20200 202445 201702 gene locus_tag LOCUS_20210 202445 201702 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_20210 202586 203752 gene locus_tag LOCUS_20220 202586 203752 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_20220 203758 203991 gene locus_tag LOCUS_20230 203758 203991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962889.1 protein_id gnl|my_center|LOCUS_20230 205309 204056 gene locus_tag LOCUS_20240 205309 204056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 205887 205504 gene locus_tag LOCUS_20250 205887 205504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 206541 205891 gene locus_tag LOCUS_20260 206541 205891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_20260 207085 206552 gene locus_tag LOCUS_20270 207085 206552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 protein_id gnl|my_center|LOCUS_20270 208571 207156 gene locus_tag LOCUS_20280 gene trmA 208571 207156 CDS product tRNA (uracil-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_20280 208595 209191 gene locus_tag LOCUS_20290 208595 209191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_20290 213622 209228 gene locus_tag LOCUS_20300 213622 209228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 213830 215074 gene locus_tag LOCUS_20310 gene rocD 213830 215074 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_20310 215078 215533 gene locus_tag LOCUS_20320 215078 215533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962899.1 protein_id gnl|my_center|LOCUS_20320 216345 215584 gene locus_tag LOCUS_20330 216345 215584 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962769.1 protein_id gnl|my_center|LOCUS_20330 216623 216342 gene locus_tag LOCUS_20340 216623 216342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 217276 216623 gene locus_tag LOCUS_20350 gene psd 217276 216623 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_20350 218072 217266 gene locus_tag LOCUS_20360 gene cdsA 218072 217266 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 protein_id gnl|my_center|LOCUS_20360 218682 218074 gene locus_tag LOCUS_20370 218682 218074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_20370 220714 218792 gene locus_tag LOCUS_20380 gene ftsH 220714 218792 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_20380 221091 220720 gene locus_tag LOCUS_20390 gene rsfS 221091 220720 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_20390 221186 221917 gene locus_tag LOCUS_20400 gene birA 221186 221917 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_20400 222016 225150 gene locus_tag LOCUS_20410 gene ccsBA 222016 225150 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_20410 225571 225161 gene locus_tag LOCUS_20420 225571 225161 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022200.1 protein_id gnl|my_center|LOCUS_20420 225682 226269 gene locus_tag LOCUS_20430 gene bsaA 225682 226269 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH0 protein_id gnl|my_center|LOCUS_20430 226767 226270 gene locus_tag LOCUS_20440 gene yncA 226767 226270 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963787.1 protein_id gnl|my_center|LOCUS_20440 226840 228492 gene locus_tag LOCUS_20450 gene menD 226840 228492 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_20450 228530 228922 gene locus_tag LOCUS_20460 228530 228922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963785.1 protein_id gnl|my_center|LOCUS_20460 229017 229874 gene locus_tag LOCUS_20470 gene nadC 229017 229874 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_20470 229878 230804 gene locus_tag LOCUS_20480 gene yfkH 229878 230804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_20480 230829 231395 gene locus_tag LOCUS_20490 230829 231395 CDS product chalcone isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_20490 231474 233924 gene locus_tag LOCUS_20500 gene priA 231474 233924 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 protein_id gnl|my_center|LOCUS_20500 234616 233921 gene locus_tag LOCUS_20510 234616 233921 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_20510 234717 235109 gene locus_tag LOCUS_20520 gene rpsF 234717 235109 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 protein_id gnl|my_center|LOCUS_20520 235113 235409 gene locus_tag LOCUS_20530 gene rpsR 235113 235409 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_20530 235477 235920 gene locus_tag LOCUS_20540 gene rplI 235477 235920 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P1 protein_id gnl|my_center|LOCUS_20540 236046 236519 gene locus_tag LOCUS_20550 236046 236519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 protein_id gnl|my_center|LOCUS_20550 236533 238533 gene locus_tag LOCUS_20560 gene ligA 236533 238533 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 protein_id gnl|my_center|LOCUS_20560 238526 239212 gene locus_tag LOCUS_20570 238526 239212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963951.1 protein_id gnl|my_center|LOCUS_20570 239218 239910 gene locus_tag LOCUS_20580 239218 239910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 240817 239903 gene locus_tag LOCUS_20590 240817 239903 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_20590 241612 240830 gene locus_tag LOCUS_20600 241612 240830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 protein_id gnl|my_center|LOCUS_20600 241662 242180 gene locus_tag LOCUS_20610 241662 242180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963940.1 protein_id gnl|my_center|LOCUS_20610 242182 243060 gene locus_tag LOCUS_20620 gene dapA 242182 243060 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_20620 243157 243951 gene locus_tag LOCUS_20630 gene bamD 243157 243951 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_20630 243962 244276 gene locus_tag LOCUS_20640 243962 244276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_20640 244287 245498 gene locus_tag LOCUS_20650 gene coaBC 244287 245498 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_20650 245488 246381 gene locus_tag LOCUS_20660 245488 246381 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_20660 246405 248057 gene locus_tag LOCUS_20670 gene recN 246405 248057 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_20670 248123 249313 gene locus_tag LOCUS_20680 gene fabV 248123 249313 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N4 protein_id gnl|my_center|LOCUS_20680 249477 252767 gene locus_tag LOCUS_20690 249477 252767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 252848 253852 gene locus_tag LOCUS_20700 252848 253852 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_20700 253849 254436 gene locus_tag LOCUS_20710 gene coaE 253849 254436 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_20710 254508 256091 gene locus_tag LOCUS_20720 gene rprX 254508 256091 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_20720 256104 256802 gene locus_tag LOCUS_20730 gene rprY 256104 256802 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_20730 257760 256837 gene locus_tag LOCUS_20740 gene miaA 257760 256837 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V8 protein_id gnl|my_center|LOCUS_20740 258604 257753 gene locus_tag LOCUS_20750 258604 257753 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_20750 259997 258636 gene locus_tag LOCUS_20760 259997 258636 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_20760 260813 260148 gene locus_tag LOCUS_20770 260813 260148 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_20770 261277 260813 gene locus_tag LOCUS_20780 261277 260813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 262578 261361 gene locus_tag LOCUS_20790 262578 261361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964016.1 protein_id gnl|my_center|LOCUS_20790 263543 262653 gene locus_tag LOCUS_20800 263543 262653 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_20800 263935 263540 gene locus_tag LOCUS_20810 263935 263540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 264904 263939 gene locus_tag LOCUS_20820 264904 263939 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_20820 265005 265646 gene locus_tag LOCUS_20830 gene pcm 265005 265646 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_20830 265658 269392 gene locus_tag LOCUS_20840 265658 269392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583095.1 protein_id gnl|my_center|LOCUS_20840 269793 269431 gene locus_tag LOCUS_20850 269793 269431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 270263 269811 gene locus_tag LOCUS_20860 gene smpB 270263 269811 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 protein_id gnl|my_center|LOCUS_20860 270357 271805 gene locus_tag LOCUS_20870 270357 271805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 271806 273113 gene locus_tag LOCUS_20880 271806 273113 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583646.1 protein_id gnl|my_center|LOCUS_20880 273208 273489 gene locus_tag LOCUS_20890 273208 273489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963991.1 protein_id gnl|my_center|LOCUS_20890 274366 273521 gene locus_tag LOCUS_20900 274366 273521 CDS product LACX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562113.1 protein_id gnl|my_center|LOCUS_20900 274923 274363 gene locus_tag LOCUS_20910 274923 274363 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963990.1 protein_id gnl|my_center|LOCUS_20910 275225 275761 gene locus_tag LOCUS_20920 275225 275761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 276331 275825 gene locus_tag LOCUS_20930 276331 275825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 279011 276423 gene locus_tag LOCUS_20940 gene clpB 279011 276423 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0F9 protein_id gnl|my_center|LOCUS_20940 279175 279564 gene locus_tag LOCUS_20950 gene ytxJ 279175 279564 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_20950 280776 279595 gene locus_tag LOCUS_20960 280776 279595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963930.1 protein_id gnl|my_center|LOCUS_20960 281335 280868 gene locus_tag LOCUS_20970 281335 280868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 282735 281452 gene locus_tag LOCUS_20980 gene fahA 282735 281452 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_20980 282848 284122 gene locus_tag LOCUS_20990 gene glyA 282848 284122 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_20990 285227 284202 gene locus_tag LOCUS_21000 285227 284202 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_21000 285452 285841 gene locus_tag LOCUS_21010 285452 285841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence6 1109 399 gene locus_tag LOCUS_21020 1109 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_21020 1203 2291 gene locus_tag LOCUS_21030 1203 2291 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_21030 2291 4183 gene locus_tag LOCUS_21040 2291 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 4180 4881 gene locus_tag LOCUS_21050 4180 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 5016 6317 gene locus_tag LOCUS_21060 5016 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 8433 6430 gene locus_tag LOCUS_21070 8433 6430 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962880.1 protein_id gnl|my_center|LOCUS_21070 8547 11426 gene locus_tag LOCUS_21080 8547 11426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962879.1 protein_id gnl|my_center|LOCUS_21080 11606 14011 gene locus_tag LOCUS_21090 11606 14011 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_21090 15249 14128 gene locus_tag LOCUS_21100 15249 14128 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_21100 17197 15365 gene locus_tag LOCUS_21110 17197 15365 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963720.1 protein_id gnl|my_center|LOCUS_21110 17262 17765 gene locus_tag LOCUS_21120 17262 17765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 18092 17817 gene locus_tag LOCUS_21130 18092 17817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21130 18376 18137 gene locus_tag LOCUS_21140 18376 18137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 18650 19327 gene locus_tag LOCUS_21150 18650 19327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963247.1 protein_id gnl|my_center|LOCUS_21150 20616 19405 gene locus_tag LOCUS_21160 20616 19405 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_21160 23157 20728 gene locus_tag LOCUS_21170 23157 20728 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_21170 23506 23243 gene locus_tag LOCUS_21180 23506 23243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963907.1 protein_id gnl|my_center|LOCUS_21180 23614 24582 gene locus_tag LOCUS_21190 23614 24582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963908.1 protein_id gnl|my_center|LOCUS_21190 24583 25701 gene locus_tag LOCUS_21200 gene yghO 24583 25701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_21200 27218 25962 gene locus_tag LOCUS_21210 27218 25962 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_21210 27548 28120 gene locus_tag LOCUS_21220 27548 28120 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_21220 28723 28121 gene locus_tag LOCUS_21230 28723 28121 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_21230 28892 30799 gene locus_tag LOCUS_21240 28892 30799 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_21240 30886 31659 gene locus_tag LOCUS_21250 30886 31659 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 protein_id gnl|my_center|LOCUS_21250 31682 32524 gene locus_tag LOCUS_21260 31682 32524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 32559 32984 gene locus_tag LOCUS_21270 32559 32984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 33673 33020 gene locus_tag LOCUS_21280 gene trmH 33673 33020 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_21280 35921 33702 gene locus_tag LOCUS_21290 35921 33702 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767848.1 protein_id gnl|my_center|LOCUS_21290 37227 35926 gene locus_tag LOCUS_21300 37227 35926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 37851 37303 gene locus_tag LOCUS_21310 37851 37303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 38522 37875 gene locus_tag LOCUS_21320 38522 37875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 38635 39165 gene locus_tag LOCUS_21330 38635 39165 CDS product RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_21330 39158 39940 gene locus_tag LOCUS_21340 39158 39940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 39998 40684 gene locus_tag LOCUS_21350 gene npdA 39998 40684 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 protein_id gnl|my_center|LOCUS_21350 40927 42273 gene locus_tag LOCUS_21360 gene purB 40927 42273 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_21360 42406 43053 gene locus_tag LOCUS_21370 42406 43053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 43098 43775 gene locus_tag LOCUS_21380 43098 43775 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998217.1 protein_id gnl|my_center|LOCUS_21380 43851 44357 gene locus_tag LOCUS_21390 43851 44357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 44456 46684 gene locus_tag LOCUS_21400 44456 46684 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786012.1 protein_id gnl|my_center|LOCUS_21400 46834 47271 gene locus_tag LOCUS_21410 46834 47271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 48832 47360 gene locus_tag LOCUS_21420 gene guaB 48832 47360 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_21420 51362 48921 gene locus_tag LOCUS_21430 gene fecA 51362 48921 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_21430 52716 51343 gene locus_tag LOCUS_21440 52716 51343 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_21440 53833 52718 gene locus_tag LOCUS_21450 gene irpA 53833 52718 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_21450 55108 53906 gene locus_tag LOCUS_21460 55108 53906 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_21460 55272 56015 gene locus_tag LOCUS_21470 55272 56015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 56893 56012 gene locus_tag LOCUS_21480 gene mvaB 56893 56012 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_21480 57912 56896 gene locus_tag LOCUS_21490 gene pyrD 57912 56896 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_21490 58038 59276 gene locus_tag LOCUS_21500 gene pepT 58038 59276 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W1 protein_id gnl|my_center|LOCUS_21500 60204 59332 gene locus_tag LOCUS_21510 gene rimK 60204 59332 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JS5 protein_id gnl|my_center|LOCUS_21510 60354 60929 gene locus_tag LOCUS_21520 60354 60929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989716.1 protein_id gnl|my_center|LOCUS_21520 61203 60931 gene locus_tag LOCUS_21530 gene yajC 61203 60931 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_21530 61695 61225 gene locus_tag LOCUS_21540 61695 61225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 62621 61713 gene locus_tag LOCUS_21550 gene nusB 62621 61713 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_21550 63839 62733 gene locus_tag LOCUS_21560 gene vdh 63839 62733 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_21560 64035 65798 gene locus_tag LOCUS_21570 64035 65798 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_21570 65864 66238 gene locus_tag LOCUS_21580 65864 66238 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_21580 66633 66292 gene locus_tag LOCUS_21590 gene csaA 66633 66292 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_21590 66894 67448 gene locus_tag LOCUS_21600 66894 67448 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_21600 67525 67905 gene locus_tag LOCUS_21610 67525 67905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 68380 67877 gene locus_tag LOCUS_21620 68380 67877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 68882 68370 gene locus_tag LOCUS_21630 68882 68370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 69204 68893 gene locus_tag LOCUS_21640 69204 68893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 70139 69288 gene locus_tag LOCUS_21650 70139 69288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 70608 70213 gene locus_tag LOCUS_21660 70608 70213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 71812 70880 gene locus_tag LOCUS_21670 gene ppiC 71812 70880 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_21670 72029 72826 gene locus_tag LOCUS_21680 72029 72826 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_21680 72829 73278 gene locus_tag LOCUS_21690 72829 73278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 73337 74011 gene locus_tag LOCUS_21700 gene trmD 73337 74011 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_21700 74196 74552 gene locus_tag LOCUS_21710 gene rplS 74196 74552 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_21710 74764 76986 gene locus_tag LOCUS_21720 74764 76986 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104510.1 protein_id gnl|my_center|LOCUS_21720 77685 77044 gene locus_tag LOCUS_21730 77685 77044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 77869 80247 gene locus_tag LOCUS_21740 77869 80247 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_21740 80252 81091 gene locus_tag LOCUS_21750 80252 81091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_21750 81126 81788 gene locus_tag LOCUS_21760 81126 81788 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963877.1 protein_id gnl|my_center|LOCUS_21760 82970 81792 gene locus_tag LOCUS_21770 82970 81792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 83123 85111 gene locus_tag LOCUS_21780 gene uvrB 83123 85111 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY25 protein_id gnl|my_center|LOCUS_21780 85210 85668 gene locus_tag LOCUS_21790 85210 85668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 85672 86130 gene locus_tag LOCUS_21800 85672 86130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 86807 86172 gene locus_tag LOCUS_21810 86807 86172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 87258 86857 gene locus_tag LOCUS_21820 87258 86857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963055.1 protein_id gnl|my_center|LOCUS_21820 87335 87778 gene locus_tag LOCUS_21830 87335 87778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963057.1 protein_id gnl|my_center|LOCUS_21830 87974 89857 gene locus_tag LOCUS_21840 87974 89857 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_21840 89854 91113 gene locus_tag LOCUS_21850 gene pyrC2 89854 91113 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_21850 91251 91574 gene locus_tag LOCUS_21860 91251 91574 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963234.1 protein_id gnl|my_center|LOCUS_21860 91614 92258 gene locus_tag LOCUS_21870 91614 92258 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_21870 92880 92311 gene locus_tag LOCUS_21880 92880 92311 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528503.1 protein_id gnl|my_center|LOCUS_21880 93023 93520 gene locus_tag LOCUS_21890 gene tpx 93023 93520 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZY8 protein_id gnl|my_center|LOCUS_21890 93524 93898 gene locus_tag LOCUS_21900 gene dgkA 93524 93898 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963705.1 protein_id gnl|my_center|LOCUS_21900 93937 96405 gene locus_tag LOCUS_21910 gene ftsK 93937 96405 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_21910 96411 97055 gene locus_tag LOCUS_21920 gene lolA 96411 97055 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_21920 97059 98501 gene locus_tag LOCUS_21930 97059 98501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963702.1 protein_id gnl|my_center|LOCUS_21930 98501 99634 gene locus_tag LOCUS_21940 gene ribBA 98501 99634 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_21940 100392 99640 gene locus_tag LOCUS_21950 100392 99640 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_21950 100598 100683 gene locus_tag LOCUS_t00430 100598 100683 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 100946 102187 gene locus_tag LOCUS_21960 100946 102187 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_21960 102282 102557 gene locus_tag LOCUS_21970 102282 102557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 102718 106971 gene locus_tag LOCUS_21980 102718 106971 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_21980 107058 108251 gene locus_tag LOCUS_21990 107058 108251 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_21990 108568 109035 gene locus_tag LOCUS_22000 108568 109035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 109287 109679 gene locus_tag LOCUS_22010 109287 109679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 109750 110637 gene locus_tag LOCUS_22020 gene yneE 109750 110637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001376869.1 protein_id gnl|my_center|LOCUS_22020 110643 112679 gene locus_tag LOCUS_22030 110643 112679 CDS product cadmium/zinc/cobalt-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_22030 112752 113108 gene locus_tag LOCUS_22040 112752 113108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 113296 113637 gene locus_tag LOCUS_22050 113296 113637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 113825 117589 gene locus_tag LOCUS_22060 113825 117589 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_22060 117582 118802 gene locus_tag LOCUS_22070 117582 118802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 118805 120583 gene locus_tag LOCUS_22080 118805 120583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 120594 120854 gene locus_tag LOCUS_22090 120594 120854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 120883 121422 gene locus_tag LOCUS_22100 120883 121422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 121599 124121 gene locus_tag LOCUS_22110 121599 124121 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946759.1 protein_id gnl|my_center|LOCUS_22110 124223 125068 gene locus_tag LOCUS_22120 124223 125068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964382.1 protein_id gnl|my_center|LOCUS_22120 125366 125653 gene locus_tag LOCUS_22130 125366 125653 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 protein_id gnl|my_center|LOCUS_22130 125761 126594 gene locus_tag LOCUS_22140 125761 126594 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963651.1 protein_id gnl|my_center|LOCUS_22140 126712 127338 gene locus_tag LOCUS_22150 126712 127338 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963650.1 protein_id gnl|my_center|LOCUS_22150 127478 128008 gene locus_tag LOCUS_22160 127478 128008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 128001 128690 gene locus_tag LOCUS_22170 128001 128690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036264.1 protein_id gnl|my_center|LOCUS_22170 129478 128825 gene locus_tag LOCUS_22180 129478 128825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 130463 129456 gene locus_tag LOCUS_22190 130463 129456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 131011 130466 gene locus_tag LOCUS_22200 131011 130466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 131088 131771 gene locus_tag LOCUS_22210 131088 131771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 131761 132099 gene locus_tag LOCUS_22220 131761 132099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 132107 132874 gene locus_tag LOCUS_22230 132107 132874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 133167 133430 gene locus_tag LOCUS_22240 133167 133430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 134477 134893 gene locus_tag LOCUS_22250 134477 134893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964407.1 protein_id gnl|my_center|LOCUS_22250 134911 135090 gene locus_tag LOCUS_22260 134911 135090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963664.1 protein_id gnl|my_center|LOCUS_22260 135335 135165 gene locus_tag LOCUS_22270 135335 135165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 135543 135328 gene locus_tag LOCUS_22280 135543 135328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964410.1 protein_id gnl|my_center|LOCUS_22280 135948 135553 gene locus_tag LOCUS_22290 135948 135553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963661.1 protein_id gnl|my_center|LOCUS_22290 136758 136000 gene locus_tag LOCUS_22300 136758 136000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963660.1 protein_id gnl|my_center|LOCUS_22300 137025 137228 gene locus_tag LOCUS_22310 137025 137228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964413.1 protein_id gnl|my_center|LOCUS_22310 137657 138481 gene locus_tag LOCUS_22320 137657 138481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 139405 138587 gene locus_tag LOCUS_22330 139405 138587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 139912 139511 gene locus_tag LOCUS_22340 139912 139511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 140336 139917 gene locus_tag LOCUS_22350 gene rnk-1 140336 139917 CDS product RNA polymerase-binding protein Rnk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941393.1 protein_id gnl|my_center|LOCUS_22350 141655 140351 gene locus_tag LOCUS_22360 141655 140351 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEM0 protein_id gnl|my_center|LOCUS_22360 142113 141811 gene locus_tag LOCUS_22370 142113 141811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 143491 142163 gene locus_tag LOCUS_22380 143491 142163 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545725.1 protein_id gnl|my_center|LOCUS_22380 144591 143500 gene locus_tag LOCUS_22390 144591 143500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22390 144733 144906 gene locus_tag LOCUS_22400 144733 144906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 145724 147091 gene locus_tag LOCUS_22410 gene eptA 145724 147091 CDS product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O24867 protein_id gnl|my_center|LOCUS_22410 148549 147254 gene locus_tag LOCUS_22420 148549 147254 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_22420 150215 148551 gene locus_tag LOCUS_22430 150215 148551 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964344.1 protein_id gnl|my_center|LOCUS_22430 151737 150208 gene locus_tag LOCUS_22440 151737 150208 CDS product all-trans-retinol 13,14-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_22440 155327 151734 gene locus_tag LOCUS_22450 155327 151734 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964346.1 protein_id gnl|my_center|LOCUS_22450 156604 155426 gene locus_tag LOCUS_22460 156604 155426 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964347.1 protein_id gnl|my_center|LOCUS_22460 157066 156614 gene locus_tag LOCUS_22470 157066 156614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964348.1 protein_id gnl|my_center|LOCUS_22470 157472 157101 gene locus_tag LOCUS_22480 157472 157101 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964349.1 protein_id gnl|my_center|LOCUS_22480 158049 157477 gene locus_tag LOCUS_22490 158049 157477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964350.1 protein_id gnl|my_center|LOCUS_22490 158683 158054 gene locus_tag LOCUS_22500 158683 158054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964351.1 protein_id gnl|my_center|LOCUS_22500 159200 158649 gene locus_tag LOCUS_22510 159200 158649 CDS product cell envelope biogenesis protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964352.1 protein_id gnl|my_center|LOCUS_22510 160035 159253 gene locus_tag LOCUS_22520 160035 159253 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964353.1 protein_id gnl|my_center|LOCUS_22520 161090 160029 gene locus_tag LOCUS_22530 161090 160029 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_22530 162286 161090 gene locus_tag LOCUS_22540 162286 161090 CDS product beta-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964355.1 protein_id gnl|my_center|LOCUS_22540 162547 162290 gene locus_tag LOCUS_22550 162547 162290 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_22550 163163 162549 gene locus_tag LOCUS_22560 163163 162549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964358.1 protein_id gnl|my_center|LOCUS_22560 164301 163165 gene locus_tag LOCUS_22570 164301 163165 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964359.1 protein_id gnl|my_center|LOCUS_22570 164754 164305 gene locus_tag LOCUS_22580 164754 164305 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964360.1 protein_id gnl|my_center|LOCUS_22580 166009 164729 gene locus_tag LOCUS_22590 166009 164729 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964361.1 protein_id gnl|my_center|LOCUS_22590 166754 165999 gene locus_tag LOCUS_22600 166754 165999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964362.1 protein_id gnl|my_center|LOCUS_22600 167753 166758 gene locus_tag LOCUS_22610 167753 166758 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 protein_id gnl|my_center|LOCUS_22610 168157 167753 gene locus_tag LOCUS_22620 168157 167753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964366.1 protein_id gnl|my_center|LOCUS_22620 168618 168157 gene locus_tag LOCUS_22630 gene darC2 168618 168157 CDS product flexirubin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964367.1 protein_id gnl|my_center|LOCUS_22630 169058 168621 gene locus_tag LOCUS_22640 gene darC1 169058 168621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964368.1 protein_id gnl|my_center|LOCUS_22640 170193 169060 gene locus_tag LOCUS_22650 gene darB 170193 169060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 protein_id gnl|my_center|LOCUS_22650 171113 170211 gene locus_tag LOCUS_22660 gene darA 171113 170211 CDS product dialkylrecorsinol condensing protein DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964370.1 protein_id gnl|my_center|LOCUS_22660 172783 171137 gene locus_tag LOCUS_22670 172783 171137 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_22670 173730 172849 gene locus_tag LOCUS_22680 173730 172849 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_22680 173986 173735 gene locus_tag LOCUS_22690 gene acpP 173986 173735 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1W5 protein_id gnl|my_center|LOCUS_22690 175215 173989 gene locus_tag LOCUS_22700 gene fabB 175215 173989 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_22700 175958 175227 gene locus_tag LOCUS_22710 175958 175227 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_22710 177073 175964 gene locus_tag LOCUS_22720 177073 175964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964376.1 protein_id gnl|my_center|LOCUS_22720 178613 177096 gene locus_tag LOCUS_22730 gene hutH2 178613 177096 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964377.1 protein_id gnl|my_center|LOCUS_22730 178728 179975 gene locus_tag LOCUS_22740 178728 179975 CDS product dehydrogenase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964378.1 protein_id gnl|my_center|LOCUS_22740 180694 180098 gene locus_tag LOCUS_22750 180694 180098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964330.1 protein_id gnl|my_center|LOCUS_22750 180994 180779 gene locus_tag LOCUS_22760 180994 180779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 181400 181011 gene locus_tag LOCUS_22770 181400 181011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 181547 182911 gene locus_tag LOCUS_22780 gene hemN 181547 182911 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_22780 183018 184373 gene locus_tag LOCUS_22790 gene rhlE 183018 184373 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_22790 184455 185027 gene locus_tag LOCUS_22800 184455 185027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_22800 185190 185753 gene locus_tag LOCUS_22810 185190 185753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 185906 186319 gene locus_tag LOCUS_22820 185906 186319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 186367 188211 gene locus_tag LOCUS_22830 186367 188211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 188400 188873 gene locus_tag LOCUS_22840 188400 188873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 188941 189477 gene locus_tag LOCUS_22850 188941 189477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 189481 189687 gene locus_tag LOCUS_22860 189481 189687 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816366.1 protein_id gnl|my_center|LOCUS_22860 189863 190363 gene locus_tag LOCUS_22870 189863 190363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 190415 190792 gene locus_tag LOCUS_22880 190415 190792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 190853 191512 gene locus_tag LOCUS_22890 190853 191512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764517.1 protein_id gnl|my_center|LOCUS_22890 191609 191923 gene locus_tag LOCUS_22900 191609 191923 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985299.1 protein_id gnl|my_center|LOCUS_22900 192062 192568 gene locus_tag LOCUS_22910 192062 192568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 195292 192662 gene locus_tag LOCUS_22920 gene valS 195292 192662 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H092 protein_id gnl|my_center|LOCUS_22920 195461 195892 gene locus_tag LOCUS_22930 195461 195892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963807.1 protein_id gnl|my_center|LOCUS_22930 197250 195928 gene locus_tag LOCUS_22940 197250 195928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 197373 198572 gene locus_tag LOCUS_22950 gene aspC2 197373 198572 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_22950 >Feature sequence7 2247 1831 gene locus_tag LOCUS_22960 2247 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962757.1 protein_id gnl|my_center|LOCUS_22960 2402 3073 gene locus_tag LOCUS_22970 gene folE2 2402 3073 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_22970 3253 4746 gene locus_tag LOCUS_22980 gene cysS 3253 4746 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_22980 4840 5067 gene locus_tag LOCUS_22990 4840 5067 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX81 protein_id gnl|my_center|LOCUS_22990 5253 6206 gene locus_tag LOCUS_23000 gene lgt 5253 6206 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX82 protein_id gnl|my_center|LOCUS_23000 6719 6261 gene locus_tag LOCUS_23010 6719 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 9760 6830 gene locus_tag LOCUS_23020 gene secDF 9760 6830 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 protein_id gnl|my_center|LOCUS_23020 10882 9950 gene locus_tag LOCUS_23030 gene mdh 10882 9950 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX11 protein_id gnl|my_center|LOCUS_23030 11915 10908 gene locus_tag LOCUS_23040 11915 10908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 13851 11908 gene locus_tag LOCUS_23050 gene gyrB 13851 11908 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX10 protein_id gnl|my_center|LOCUS_23050 15812 14148 gene locus_tag LOCUS_23060 gene asnB 15812 14148 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_23060 16419 16042 gene locus_tag LOCUS_23070 16419 16042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_23070 18347 16593 gene locus_tag LOCUS_23080 18347 16593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_23080 21420 18406 gene locus_tag LOCUS_23090 21420 18406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_23090 21607 22290 gene locus_tag LOCUS_23100 gene ftsE 21607 22290 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_23100 22290 23183 gene locus_tag LOCUS_23110 22290 23183 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_23110 23200 23940 gene locus_tag LOCUS_23120 23200 23940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 23943 24866 gene locus_tag LOCUS_23130 23943 24866 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_23130 25261 24863 gene locus_tag LOCUS_23140 25261 24863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963968.1 protein_id gnl|my_center|LOCUS_23140 26063 25239 gene locus_tag LOCUS_23150 26063 25239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 26113 27255 gene locus_tag LOCUS_23160 gene wbsE 26113 27255 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 protein_id gnl|my_center|LOCUS_23160 28552 27218 gene locus_tag LOCUS_23170 28552 27218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 29826 28552 gene locus_tag LOCUS_23180 gene wzxE 29826 28552 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963976.1 protein_id gnl|my_center|LOCUS_23180 31000 29828 gene locus_tag LOCUS_23190 31000 29828 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963975.1 protein_id gnl|my_center|LOCUS_23190 31980 30997 gene locus_tag LOCUS_23200 31980 30997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_23200 32088 33878 gene locus_tag LOCUS_23210 32088 33878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 33879 34847 gene locus_tag LOCUS_23220 33879 34847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089839.1 protein_id gnl|my_center|LOCUS_23220 34926 37922 gene locus_tag LOCUS_23230 34926 37922 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_23230 37957 39243 gene locus_tag LOCUS_23240 37957 39243 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 protein_id gnl|my_center|LOCUS_23240 39330 40121 gene locus_tag LOCUS_23250 39330 40121 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_23250 40272 42491 gene locus_tag LOCUS_23260 gene relA 40272 42491 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_23260 42597 43037 gene locus_tag LOCUS_23270 gene fur 42597 43037 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_23270 43068 44339 gene locus_tag LOCUS_23280 gene purA 43068 44339 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_23280 44426 46114 gene locus_tag LOCUS_23290 44426 46114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_23290 46151 47329 gene locus_tag LOCUS_23300 gene argD 46151 47329 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_23300 47429 48883 gene locus_tag LOCUS_23310 47429 48883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_23310 48888 49523 gene locus_tag LOCUS_23320 gene dedA 48888 49523 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364322.1 protein_id gnl|my_center|LOCUS_23320 49523 50287 gene locus_tag LOCUS_23330 gene aroE 49523 50287 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_23330 50293 50772 gene locus_tag LOCUS_23340 50293 50772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 50931 52826 gene locus_tag LOCUS_23350 50931 52826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963876.1 protein_id gnl|my_center|LOCUS_23350 52945 53373 gene locus_tag LOCUS_23360 52945 53373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 53373 53864 gene locus_tag LOCUS_23370 53373 53864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 53960 54583 gene locus_tag LOCUS_23380 53960 54583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 55015 54728 gene locus_tag LOCUS_23390 gene yqjZ 55015 54728 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157881.1 protein_id gnl|my_center|LOCUS_23390 55804 55082 gene locus_tag LOCUS_23400 55804 55082 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_23400 56052 58127 gene locus_tag LOCUS_23410 56052 58127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 58614 58186 gene locus_tag LOCUS_23420 58614 58186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 59288 58701 gene locus_tag LOCUS_23430 gene def 59288 58701 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_23430 59783 59367 gene locus_tag LOCUS_23440 59783 59367 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_23440 59927 60742 gene locus_tag LOCUS_23450 gene dapD 59927 60742 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_23450 60989 60828 gene locus_tag LOCUS_23460 60989 60828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 61045 62634 gene locus_tag LOCUS_23470 61045 62634 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107506.1 protein_id gnl|my_center|LOCUS_23470 63381 62620 gene locus_tag LOCUS_23480 63381 62620 CDS product beta 1,4 glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016465.1 protein_id gnl|my_center|LOCUS_23480 63472 64542 gene locus_tag LOCUS_23490 63472 64542 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016813.1 protein_id gnl|my_center|LOCUS_23490 65354 64539 gene locus_tag LOCUS_23500 65354 64539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 66144 65377 gene locus_tag LOCUS_23510 66144 65377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963748.1 protein_id gnl|my_center|LOCUS_23510 66834 66145 gene locus_tag LOCUS_23520 66834 66145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 67106 68023 gene locus_tag LOCUS_23530 67106 68023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 68026 68598 gene locus_tag LOCUS_23540 68026 68598 CDS product translation factor Sua5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_23540 68679 70097 gene locus_tag LOCUS_23550 gene cca 68679 70097 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_23550 70123 71148 gene locus_tag LOCUS_23560 70123 71148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 71884 71129 gene locus_tag LOCUS_23570 71884 71129 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_23570 72311 71943 gene locus_tag LOCUS_23580 72311 71943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963760.1 protein_id gnl|my_center|LOCUS_23580 72628 72314 gene locus_tag LOCUS_23590 72628 72314 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963761.1 protein_id gnl|my_center|LOCUS_23590 73974 72619 gene locus_tag LOCUS_23600 73974 72619 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_23600 74601 73981 gene locus_tag LOCUS_23610 74601 73981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963764.1 protein_id gnl|my_center|LOCUS_23610 76973 74823 gene locus_tag LOCUS_23620 76973 74823 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_23620 77145 77663 gene locus_tag LOCUS_23630 77145 77663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_23630 77710 78069 gene locus_tag LOCUS_23640 77710 78069 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963769.1 protein_id gnl|my_center|LOCUS_23640 78105 79163 gene locus_tag LOCUS_23650 78105 79163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_23650 79280 79471 gene locus_tag LOCUS_23660 79280 79471 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_23660 80836 79607 gene locus_tag LOCUS_23670 gene sucC 80836 79607 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_23670 81036 82265 gene locus_tag LOCUS_23680 81036 82265 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_23680 82783 82298 gene locus_tag LOCUS_23690 82783 82298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 84437 82827 gene locus_tag LOCUS_23700 gene pafA 84437 82827 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_23700 84962 84510 gene locus_tag LOCUS_23710 84962 84510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 85913 84969 gene locus_tag LOCUS_23720 85913 84969 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_23720 87531 85915 gene locus_tag LOCUS_23730 87531 85915 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_23730 88517 87582 gene locus_tag LOCUS_23740 88517 87582 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081007.1 protein_id gnl|my_center|LOCUS_23740 89714 88527 gene locus_tag LOCUS_23750 gene mnmA 89714 88527 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_23750 90470 89730 gene locus_tag LOCUS_23760 90470 89730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964005.1 protein_id gnl|my_center|LOCUS_23760 91303 90503 gene locus_tag LOCUS_23770 gene proC 91303 90503 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTZ3 protein_id gnl|my_center|LOCUS_23770 93257 91356 gene locus_tag LOCUS_23780 gene yidC 93257 91356 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U2 protein_id gnl|my_center|LOCUS_23780 94936 93329 gene locus_tag LOCUS_23790 gene pyrG 94936 93329 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_23790 95261 95034 gene locus_tag LOCUS_23800 95261 95034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 protein_id gnl|my_center|LOCUS_23800 95666 95262 gene locus_tag LOCUS_23810 gene osmC 95666 95262 CDS product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_23810 97561 95666 gene locus_tag LOCUS_23820 97561 95666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 protein_id gnl|my_center|LOCUS_23820 99199 97667 gene locus_tag LOCUS_23830 gene guaA 99199 97667 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_23830 100496 99318 gene locus_tag LOCUS_23840 gene purM 100496 99318 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_23840 101011 100571 gene locus_tag LOCUS_23850 101011 100571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 101831 101022 gene locus_tag LOCUS_23860 101831 101022 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962709.1 protein_id gnl|my_center|LOCUS_23860 103444 101957 gene locus_tag LOCUS_23870 103444 101957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 104890 103448 gene locus_tag LOCUS_23880 104890 103448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 105322 104894 gene locus_tag LOCUS_23890 105322 104894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 106016 105336 gene locus_tag LOCUS_23900 106016 105336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 106548 106069 gene locus_tag LOCUS_23910 106548 106069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 107409 106624 gene locus_tag LOCUS_23920 107409 106624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 109892 107703 gene locus_tag LOCUS_23930 gene glnA 109892 107703 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_23930 110553 110071 gene locus_tag LOCUS_23940 110553 110071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 110731 110874 gene locus_tag LOCUS_23950 110731 110874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963202.1 protein_id gnl|my_center|LOCUS_23950 111451 110879 gene locus_tag LOCUS_23960 gene rpoE2 111451 110879 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261608.1 protein_id gnl|my_center|LOCUS_23960 115179 111754 gene locus_tag LOCUS_23970 gene icmF 115179 111754 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_23970 115311 116021 gene locus_tag LOCUS_23980 115311 116021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_23980 116980 116177 gene locus_tag LOCUS_23990 116980 116177 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_23990 117491 116991 gene locus_tag LOCUS_24000 117491 116991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 118311 117493 gene locus_tag LOCUS_24010 gene pyrF 118311 117493 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_24010 119471 118398 gene locus_tag LOCUS_24020 gene prfA 119471 118398 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_24020 119637 120176 gene locus_tag LOCUS_24030 119637 120176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964027.1 protein_id gnl|my_center|LOCUS_24030 120379 121032 gene locus_tag LOCUS_24040 120379 121032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 121192 121809 gene locus_tag LOCUS_24050 121192 121809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 122058 122876 gene locus_tag LOCUS_24060 122058 122876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 123163 123621 gene locus_tag LOCUS_24070 123163 123621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 125137 123671 gene locus_tag LOCUS_24080 gene pepD 125137 123671 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964033.1 protein_id gnl|my_center|LOCUS_24080 125548 126300 gene locus_tag LOCUS_24090 125548 126300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 127277 126312 gene locus_tag LOCUS_24100 127277 126312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 128584 127280 gene locus_tag LOCUS_24110 gene ndh 128584 127280 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_24110 128817 129311 gene locus_tag LOCUS_24120 128817 129311 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_24120 129311 129958 gene locus_tag LOCUS_24130 129311 129958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964037.1 protein_id gnl|my_center|LOCUS_24130 130796 129993 gene locus_tag LOCUS_24140 130796 129993 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_24140 131540 130896 gene locus_tag LOCUS_24150 131540 130896 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_24150 131610 132053 gene locus_tag LOCUS_24160 131610 132053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_24160 132133 132600 gene locus_tag LOCUS_24170 gene mrsB1 132133 132600 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963828.1 protein_id gnl|my_center|LOCUS_24170 132800 132513 gene locus_tag LOCUS_24180 132800 132513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 132721 132987 gene locus_tag LOCUS_24190 132721 132987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 132992 133480 gene locus_tag LOCUS_24200 132992 133480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962860.1 protein_id gnl|my_center|LOCUS_24200 133468 134142 gene locus_tag LOCUS_24210 133468 134142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_24210 134139 135182 gene locus_tag LOCUS_24220 134139 135182 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_24220 135503 136006 gene locus_tag LOCUS_24230 135503 136006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 136255 136152 gene locus_tag LOCUS_r00010 136255 136152 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8