>Feature sequence01 3283 2813 gene locus_tag LOCUS_00010 3283 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3691 5004 gene locus_tag LOCUS_00020 3691 5004 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_00020 6048 5023 gene locus_tag LOCUS_00030 6048 5023 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_00030 6255 6710 gene locus_tag LOCUS_00040 gene rplM 6255 6710 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 protein_id gnl|my_center|LOCUS_00040 6710 7096 gene locus_tag LOCUS_00050 gene rpsI 6710 7096 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU3 protein_id gnl|my_center|LOCUS_00050 7339 8103 gene locus_tag LOCUS_00060 gene rpsB 7339 8103 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_00060 8244 9068 gene locus_tag LOCUS_00070 gene tsf 8244 9068 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_00070 9230 12835 gene locus_tag LOCUS_00080 9230 12835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12835 13389 gene locus_tag LOCUS_00090 gene tag 12835 13389 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_00090 13431 13646 gene locus_tag LOCUS_00100 13431 13646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963989.1 protein_id gnl|my_center|LOCUS_00100 13747 15750 gene locus_tag LOCUS_00110 13747 15750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 16065 16244 gene locus_tag LOCUS_00120 16065 16244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16338 16853 gene locus_tag LOCUS_00130 16338 16853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 17091 17297 gene locus_tag LOCUS_00140 17091 17297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17339 19162 gene locus_tag LOCUS_00150 gene thiC 17339 19162 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWR6 protein_id gnl|my_center|LOCUS_00150 19245 19838 gene locus_tag LOCUS_00160 gene thiE1 19245 19838 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962598.1 protein_id gnl|my_center|LOCUS_00160 19805 20560 gene locus_tag LOCUS_00170 gene thiD 19805 20560 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962599.1 protein_id gnl|my_center|LOCUS_00170 20553 21176 gene locus_tag LOCUS_00180 gene thiE 20553 21176 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWR9 protein_id gnl|my_center|LOCUS_00180 21163 21933 gene locus_tag LOCUS_00190 gene thiG 21163 21933 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS0 protein_id gnl|my_center|LOCUS_00190 21973 23088 gene locus_tag LOCUS_00200 gene thiH 21973 23088 CDS product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_00200 23094 23804 gene locus_tag LOCUS_00210 gene thiF 23094 23804 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962603.1 protein_id gnl|my_center|LOCUS_00210 24512 23793 gene locus_tag LOCUS_00220 gene aat 24512 23793 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H233 protein_id gnl|my_center|LOCUS_00220 24908 24531 gene locus_tag LOCUS_00230 24908 24531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_00230 25795 24920 gene locus_tag LOCUS_00240 25795 24920 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_00240 26108 27133 gene locus_tag LOCUS_00250 gene porY 26108 27133 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_00250 27554 27165 gene locus_tag LOCUS_00260 27554 27165 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_00260 28091 27558 gene locus_tag LOCUS_00270 gene greA 28091 27558 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_00270 28190 28621 gene locus_tag LOCUS_00280 28190 28621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964454.1 protein_id gnl|my_center|LOCUS_00280 30955 28850 gene locus_tag LOCUS_00290 30955 28850 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_00290 32320 31052 gene locus_tag LOCUS_00300 32320 31052 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_00300 33127 32564 gene locus_tag LOCUS_00310 33127 32564 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 protein_id gnl|my_center|LOCUS_00310 34496 33129 gene locus_tag LOCUS_00320 34496 33129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 35725 34520 gene locus_tag LOCUS_00330 35725 34520 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_00330 36500 35763 gene locus_tag LOCUS_00340 gene coaX 36500 35763 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B4 protein_id gnl|my_center|LOCUS_00340 36604 36677 gene locus_tag LOCUS_t00010 36604 36677 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 37763 36723 gene locus_tag LOCUS_00350 gene guaC 37763 36723 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFP5 protein_id gnl|my_center|LOCUS_00350 38629 38240 gene locus_tag LOCUS_00360 38629 38240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 39562 38645 gene locus_tag LOCUS_00370 39562 38645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_00370 41021 39705 gene locus_tag LOCUS_00380 gene mvaA 41021 39705 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_00380 47024 41052 gene locus_tag LOCUS_00390 47024 41052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 47158 49329 gene locus_tag LOCUS_00400 gene pepX1 47158 49329 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_00400 49372 50940 gene locus_tag LOCUS_00410 49372 50940 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957619.1 protein_id gnl|my_center|LOCUS_00410 50978 53191 gene locus_tag LOCUS_00420 50978 53191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 53243 53707 gene locus_tag LOCUS_00430 53243 53707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 55523 53715 gene locus_tag LOCUS_00440 55523 53715 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_00440 56353 55742 gene locus_tag LOCUS_00450 56353 55742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 57498 56383 gene locus_tag LOCUS_00460 gene lpxB 57498 56383 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_00460 58044 57520 gene locus_tag LOCUS_00470 58044 57520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 58400 58125 gene locus_tag LOCUS_00480 58400 58125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964420.1 protein_id gnl|my_center|LOCUS_00480 59146 58397 gene locus_tag LOCUS_00490 gene surE 59146 58397 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_00490 59315 61486 gene locus_tag LOCUS_00500 59315 61486 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_00500 61570 62565 gene locus_tag LOCUS_00510 61570 62565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089839.1 protein_id gnl|my_center|LOCUS_00510 62774 62595 gene locus_tag LOCUS_00520 62774 62595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 62969 62793 gene locus_tag LOCUS_00530 62969 62793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 63121 62969 gene locus_tag LOCUS_00540 63121 62969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 64203 64466 gene locus_tag LOCUS_00550 64203 64466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 64656 64895 gene locus_tag LOCUS_00560 64656 64895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 66568 64913 gene locus_tag LOCUS_00570 66568 64913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 67120 66944 gene locus_tag LOCUS_00580 67120 66944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 67484 68662 gene locus_tag LOCUS_00590 gene gcdH 67484 68662 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_00590 68784 69566 gene locus_tag LOCUS_00600 68784 69566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_00600 69793 70698 gene locus_tag LOCUS_00610 69793 70698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 70801 72513 gene locus_tag LOCUS_00620 70801 72513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 72506 73156 gene locus_tag LOCUS_00630 72506 73156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 73250 74605 gene locus_tag LOCUS_00640 73250 74605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 74628 76148 gene locus_tag LOCUS_00650 gene lnt 74628 76148 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_00650 76145 77641 gene locus_tag LOCUS_00660 76145 77641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 78484 77870 gene locus_tag LOCUS_00670 78484 77870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963611.1 protein_id gnl|my_center|LOCUS_00670 80557 78509 gene locus_tag LOCUS_00680 80557 78509 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963613.1 protein_id gnl|my_center|LOCUS_00680 80692 81582 gene locus_tag LOCUS_00690 80692 81582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963614.1 protein_id gnl|my_center|LOCUS_00690 81588 81938 gene locus_tag LOCUS_00700 81588 81938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963615.1 protein_id gnl|my_center|LOCUS_00700 82316 81987 gene locus_tag LOCUS_00710 82316 81987 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_00710 83374 82316 gene locus_tag LOCUS_00720 83374 82316 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_00720 83693 83454 gene locus_tag LOCUS_00730 83693 83454 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_00730 84837 83695 gene locus_tag LOCUS_00740 gene mrp 84837 83695 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 protein_id gnl|my_center|LOCUS_00740 86280 84994 gene locus_tag LOCUS_00750 86280 84994 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786410.1 protein_id gnl|my_center|LOCUS_00750 88699 86273 gene locus_tag LOCUS_00760 88699 86273 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_00760 89550 88753 gene locus_tag LOCUS_00770 89550 88753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 90262 89561 gene locus_tag LOCUS_00780 90262 89561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768705.1 protein_id gnl|my_center|LOCUS_00780 91444 90299 gene locus_tag LOCUS_00790 91444 90299 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_00790 91681 93030 gene locus_tag LOCUS_00800 91681 93030 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202491.1 protein_id gnl|my_center|LOCUS_00800 93032 94363 gene locus_tag LOCUS_00810 93032 94363 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107493.1 protein_id gnl|my_center|LOCUS_00810 95827 94370 gene locus_tag LOCUS_00820 gene speE1 95827 94370 CDS product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 protein_id gnl|my_center|LOCUS_00820 95944 96501 gene locus_tag LOCUS_00830 95944 96501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 96491 97639 gene locus_tag LOCUS_00840 96491 97639 CDS product glutathionylspermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858689.1 protein_id gnl|my_center|LOCUS_00840 97656 98243 gene locus_tag LOCUS_00850 97656 98243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 98254 98604 gene locus_tag LOCUS_00860 gene speH 98254 98604 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66615 protein_id gnl|my_center|LOCUS_00860 99000 98653 gene locus_tag LOCUS_00870 gene ogt2 99000 98653 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_00870 99629 99003 gene locus_tag LOCUS_00880 99629 99003 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962540.1 protein_id gnl|my_center|LOCUS_00880 100307 99633 gene locus_tag LOCUS_00890 gene trmB 100307 99633 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_00890 100441 101262 gene locus_tag LOCUS_00900 100441 101262 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_00900 101268 102317 gene locus_tag LOCUS_00910 101268 102317 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_00910 103340 102300 gene locus_tag LOCUS_00920 gene phoR 103340 102300 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_00920 104023 103340 gene locus_tag LOCUS_00930 gene phoP 104023 103340 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_00930 104200 106968 gene locus_tag LOCUS_00940 104200 106968 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962528.1 protein_id gnl|my_center|LOCUS_00940 107202 108365 gene locus_tag LOCUS_00950 107202 108365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962527.1 protein_id gnl|my_center|LOCUS_00950 108542 108847 gene locus_tag LOCUS_00960 108542 108847 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962299.1 protein_id gnl|my_center|LOCUS_00960 108952 110595 gene locus_tag LOCUS_00970 108952 110595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 110871 111881 gene locus_tag LOCUS_00980 110871 111881 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_00980 113190 111883 gene locus_tag LOCUS_00990 gene tyrS 113190 111883 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 protein_id gnl|my_center|LOCUS_00990 113290 114282 gene locus_tag LOCUS_01000 113290 114282 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_01000 114670 114233 gene locus_tag LOCUS_01010 114670 114233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 116016 114673 gene locus_tag LOCUS_01020 gene pyrC1 116016 114673 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_01020 116741 116016 gene locus_tag LOCUS_01030 116741 116016 CDS product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962342.1 protein_id gnl|my_center|LOCUS_01030 117525 118283 gene locus_tag LOCUS_01040 117525 118283 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_01040 119980 118355 gene locus_tag LOCUS_01050 gene pckA 119980 118355 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H256 protein_id gnl|my_center|LOCUS_01050 120437 120054 gene locus_tag LOCUS_01060 120437 120054 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_01060 120561 121931 gene locus_tag LOCUS_01070 120561 121931 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_01070 122022 122492 gene locus_tag LOCUS_01080 122022 122492 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_01080 123289 122594 gene locus_tag LOCUS_01090 123289 122594 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_01090 123565 123380 gene locus_tag LOCUS_01100 123565 123380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 124242 123643 gene locus_tag LOCUS_01110 124242 123643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 127395 124486 gene locus_tag LOCUS_01120 gene leuS 127395 124486 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H244 protein_id gnl|my_center|LOCUS_01120 127793 128668 gene locus_tag LOCUS_01130 gene ftsX 127793 128668 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_01130 128698 128946 gene locus_tag LOCUS_01140 gene fjo13 128698 128946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_01140 130068 129451 gene locus_tag LOCUS_01150 130068 129451 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168573.1 protein_id gnl|my_center|LOCUS_01150 131938 130070 gene locus_tag LOCUS_01160 131938 130070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 132034 132819 gene locus_tag LOCUS_01170 gene uppP 132034 132819 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H239 protein_id gnl|my_center|LOCUS_01170 132820 133518 gene locus_tag LOCUS_01180 gene truB 132820 133518 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_01180 133508 134077 gene locus_tag LOCUS_01190 133508 134077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 134209 136044 gene locus_tag LOCUS_01200 134209 136044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 136055 137653 gene locus_tag LOCUS_01210 136055 137653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 138283 137645 gene locus_tag LOCUS_01220 138283 137645 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_01220 138331 139128 gene locus_tag LOCUS_01230 138331 139128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 139196 139903 gene locus_tag LOCUS_01240 gene pyrH 139196 139903 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_01240 139981 140544 gene locus_tag LOCUS_01250 gene frr 139981 140544 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_01250 140693 143179 gene locus_tag LOCUS_01260 140693 143179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962609.1 protein_id gnl|my_center|LOCUS_01260 143359 145668 gene locus_tag LOCUS_01270 143359 145668 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_01270 145700 147145 gene locus_tag LOCUS_01280 gene asnS 145700 147145 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_01280 147223 148689 gene locus_tag LOCUS_01290 gene rpoN 147223 148689 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_01290 148833 149321 gene locus_tag LOCUS_01300 148833 149321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962552.1 protein_id gnl|my_center|LOCUS_01300 150002 149316 gene locus_tag LOCUS_01310 150002 149316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_01310 150562 150089 gene locus_tag LOCUS_01320 150562 150089 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_01320 151194 150586 gene locus_tag LOCUS_01330 151194 150586 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_01330 151619 151197 gene locus_tag LOCUS_01340 151619 151197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 152471 151641 gene locus_tag LOCUS_01350 152471 151641 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_01350 152639 152551 gene locus_tag LOCUS_t00020 152639 152551 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 153742 152717 gene locus_tag LOCUS_01360 gene ansA 153742 152717 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_01360 154868 153732 gene locus_tag LOCUS_01370 154868 153732 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_01370 155717 154929 gene locus_tag LOCUS_01380 155717 154929 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_01380 156538 155810 gene locus_tag LOCUS_01390 156538 155810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 157124 156540 gene locus_tag LOCUS_01400 157124 156540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 157313 158338 gene locus_tag LOCUS_01410 157313 158338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 158416 160425 gene locus_tag LOCUS_01420 158416 160425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 160406 163003 gene locus_tag LOCUS_01430 160406 163003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 162948 163385 gene locus_tag LOCUS_01440 162948 163385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 164689 163481 gene locus_tag LOCUS_01450 gene sucB 164689 163481 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_01450 167532 164761 gene locus_tag LOCUS_01460 gene sucA 167532 164761 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_01460 167647 168192 gene locus_tag LOCUS_01470 167647 168192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964495.1 protein_id gnl|my_center|LOCUS_01470 168700 169338 gene locus_tag LOCUS_01480 168700 169338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 169338 170042 gene locus_tag LOCUS_01490 169338 170042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 170054 172693 gene locus_tag LOCUS_01500 170054 172693 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_01500 173027 172677 gene locus_tag LOCUS_01510 173027 172677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964494.1 protein_id gnl|my_center|LOCUS_01510 174092 173118 gene locus_tag LOCUS_01520 174092 173118 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_01520 174290 174889 gene locus_tag LOCUS_01530 174290 174889 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_01530 174893 176233 gene locus_tag LOCUS_01540 174893 176233 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_01540 176246 177409 gene locus_tag LOCUS_01550 176246 177409 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_01550 177417 180914 gene locus_tag LOCUS_01560 177417 180914 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_01560 182051 180996 gene locus_tag LOCUS_01570 gene paaE 182051 180996 CDS product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_01570 182168 182503 gene locus_tag LOCUS_01580 gene ywzG 182168 182503 CDS product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 protein_id gnl|my_center|LOCUS_01580 182505 183140 gene locus_tag LOCUS_01590 182505 183140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 183127 183756 gene locus_tag LOCUS_01600 183127 183756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 183761 184429 gene locus_tag LOCUS_01610 183761 184429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 184504 185205 gene locus_tag LOCUS_01620 184504 185205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 185343 186725 gene locus_tag LOCUS_01630 185343 186725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 186768 187463 gene locus_tag LOCUS_01640 186768 187463 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_01640 188204 187695 gene locus_tag LOCUS_01650 188204 187695 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_01650 189203 188274 gene locus_tag LOCUS_01660 189203 188274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 protein_id gnl|my_center|LOCUS_01660 189965 189282 gene locus_tag LOCUS_01670 189965 189282 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_01670 191226 189958 gene locus_tag LOCUS_01680 191226 189958 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963526.1 protein_id gnl|my_center|LOCUS_01680 191368 191841 gene locus_tag LOCUS_01690 191368 191841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 191917 192387 gene locus_tag LOCUS_01700 gene ogt1 191917 192387 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN0 protein_id gnl|my_center|LOCUS_01700 192447 193604 gene locus_tag LOCUS_01710 192447 193604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 193626 193910 gene locus_tag LOCUS_01720 193626 193910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 193936 194649 gene locus_tag LOCUS_01730 193936 194649 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_01730 197651 194706 gene locus_tag LOCUS_01740 197651 194706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 197851 199290 gene locus_tag LOCUS_01750 197851 199290 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962212.1 protein_id gnl|my_center|LOCUS_01750 199295 200416 gene locus_tag LOCUS_01760 199295 200416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 200500 202101 gene locus_tag LOCUS_01770 gene fumB 200500 202101 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EG8 protein_id gnl|my_center|LOCUS_01770 205086 202198 gene locus_tag LOCUS_01780 205086 202198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 206393 205227 gene locus_tag LOCUS_01790 206393 205227 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_01790 207127 206468 gene locus_tag LOCUS_01800 gene atoA 207127 206468 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_01800 207830 207132 gene locus_tag LOCUS_01810 gene atoD 207830 207132 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_01810 210133 207848 gene locus_tag LOCUS_01820 gene mrcA 210133 207848 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_01820 210583 210137 gene locus_tag LOCUS_01830 gene gldH 210583 210137 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_01830 211781 210609 gene locus_tag LOCUS_01840 gene fjo17 211781 210609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_01840 213330 211975 gene locus_tag LOCUS_01850 gene yceA 213330 211975 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL9 protein_id gnl|my_center|LOCUS_01850 213606 214610 gene locus_tag LOCUS_01860 gene recA 213606 214610 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_01860 214747 215151 gene locus_tag LOCUS_01870 214747 215151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 215169 215711 gene locus_tag LOCUS_01880 215169 215711 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_01880 215708 217495 gene locus_tag LOCUS_01890 215708 217495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 217956 217612 gene locus_tag LOCUS_01900 217956 217612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962526.1 protein_id gnl|my_center|LOCUS_01900 219125 218121 gene locus_tag LOCUS_01910 219125 218121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962448.1 protein_id gnl|my_center|LOCUS_01910 219220 220965 gene locus_tag LOCUS_01920 gene aspS 219220 220965 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_01920 221011 221244 gene locus_tag LOCUS_01930 221011 221244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 221320 221520 gene locus_tag LOCUS_01940 221320 221520 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_01940 222064 221582 gene locus_tag LOCUS_01950 222064 221582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 223220 222069 gene locus_tag LOCUS_01960 223220 222069 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964416.1 protein_id gnl|my_center|LOCUS_01960 224621 223350 gene locus_tag LOCUS_01970 gene bioA 224621 223350 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_01970 225347 224712 gene locus_tag LOCUS_01980 gene bioD 225347 224712 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_01980 225768 225349 gene locus_tag LOCUS_01990 225768 225349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 226968 225826 gene locus_tag LOCUS_02000 gene bioF 226968 225826 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_02000 229734 227242 gene locus_tag LOCUS_02010 229734 227242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 234778 229976 gene locus_tag LOCUS_02020 234778 229976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 235158 234877 gene locus_tag LOCUS_02030 235158 234877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 236749 235238 gene locus_tag LOCUS_02040 gene atpD 236749 235238 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_02040 238749 236902 gene locus_tag LOCUS_02050 gene glmS 238749 236902 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_02050 240401 238758 gene locus_tag LOCUS_02060 240401 238758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962289.1 protein_id gnl|my_center|LOCUS_02060 241226 240420 gene locus_tag LOCUS_02070 241226 240420 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_02070 241334 242182 gene locus_tag LOCUS_02080 gene panC 241334 242182 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 protein_id gnl|my_center|LOCUS_02080 242248 242598 gene locus_tag LOCUS_02090 gene panD 242248 242598 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 protein_id gnl|my_center|LOCUS_02090 242601 243560 gene locus_tag LOCUS_02100 242601 243560 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_02100 243654 244868 gene locus_tag LOCUS_02110 243654 244868 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962284.1 protein_id gnl|my_center|LOCUS_02110 244874 246235 gene locus_tag LOCUS_02120 gene radA 244874 246235 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_02120 247085 246237 gene locus_tag LOCUS_02130 247085 246237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 248105 247242 gene locus_tag LOCUS_02140 248105 247242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 248591 248280 gene locus_tag LOCUS_02150 248591 248280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02150 249407 248640 gene locus_tag LOCUS_02160 249407 248640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 250325 249459 gene locus_tag LOCUS_02170 250325 249459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 251458 250520 gene locus_tag LOCUS_02180 251458 250520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02180 252056 251505 gene locus_tag LOCUS_02190 252056 251505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 252592 252074 gene locus_tag LOCUS_02200 252592 252074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 253126 252605 gene locus_tag LOCUS_02210 253126 252605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 260202 253120 gene locus_tag LOCUS_02220 260202 253120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022037.1 protein_id gnl|my_center|LOCUS_02220 260613 260212 gene locus_tag LOCUS_02230 260613 260212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 261943 261194 gene locus_tag LOCUS_02240 261943 261194 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_02240 263724 261940 gene locus_tag LOCUS_02250 263724 261940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 263958 264482 gene locus_tag LOCUS_02260 263958 264482 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687996.1 protein_id gnl|my_center|LOCUS_02260 264513 265832 gene locus_tag LOCUS_02270 264513 265832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 265850 267025 gene locus_tag LOCUS_02280 265850 267025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 267095 268711 gene locus_tag LOCUS_02290 267095 268711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 268821 269348 gene locus_tag LOCUS_02300 268821 269348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02300 269332 270255 gene locus_tag LOCUS_02310 269332 270255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02310 273593 270321 gene locus_tag LOCUS_02320 273593 270321 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_02320 274923 273883 gene locus_tag LOCUS_02330 gene tas 274923 273883 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962241.1 protein_id gnl|my_center|LOCUS_02330 276036 275071 gene locus_tag LOCUS_02340 276036 275071 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_02340 276961 276200 gene locus_tag LOCUS_02350 gene xth 276961 276200 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_02350 277141 278946 gene locus_tag LOCUS_02360 277141 278946 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_02360 279298 278981 gene locus_tag LOCUS_02370 279298 278981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056973.1 protein_id gnl|my_center|LOCUS_02370 280678 279323 gene locus_tag LOCUS_02380 280678 279323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 282150 280798 gene locus_tag LOCUS_02390 gene mgtE 282150 280798 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_02390 282916 282140 gene locus_tag LOCUS_02400 gene rsmA 282916 282140 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_02400 283234 282974 gene locus_tag LOCUS_02410 283234 282974 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090833.1 protein_id gnl|my_center|LOCUS_02410 283645 283319 gene locus_tag LOCUS_02420 283645 283319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_02420 285454 283676 gene locus_tag LOCUS_02430 285454 283676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_02430 286805 285534 gene locus_tag LOCUS_02440 gene serS 286805 285534 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_02440 286964 287152 gene locus_tag LOCUS_02450 286964 287152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 287721 287242 gene locus_tag LOCUS_02460 gene rnhA 287721 287242 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_02460 288306 287740 gene locus_tag LOCUS_02470 gene purN 288306 287740 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 protein_id gnl|my_center|LOCUS_02470 288481 288717 gene locus_tag LOCUS_02480 gene acpP 288481 288717 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_02480 288993 290246 gene locus_tag LOCUS_02490 gene fabF 288993 290246 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_02490 290256 290999 gene locus_tag LOCUS_02500 gene rnc 290256 290999 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 protein_id gnl|my_center|LOCUS_02500 291114 291590 gene locus_tag LOCUS_02510 291114 291590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962379.1 protein_id gnl|my_center|LOCUS_02510 291596 293026 gene locus_tag LOCUS_02520 gene pykA 291596 293026 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_02520 293634 293311 gene locus_tag LOCUS_02530 293634 293311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 294228 293782 gene locus_tag LOCUS_02540 294228 293782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 295903 294257 gene locus_tag LOCUS_02550 295903 294257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 297223 296111 gene locus_tag LOCUS_02560 gene dinB2 297223 296111 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_02560 297380 297847 gene locus_tag LOCUS_02570 297380 297847 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962372.1 protein_id gnl|my_center|LOCUS_02570 298437 297856 gene locus_tag LOCUS_02580 gene yvaF 298437 297856 CDS product putative HTH-type transcriptional regulator YvaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32228 protein_id gnl|my_center|LOCUS_02580 299877 298483 gene locus_tag LOCUS_02590 299877 298483 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108068.1 protein_id gnl|my_center|LOCUS_02590 303034 299888 gene locus_tag LOCUS_02600 303034 299888 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_02600 304159 303053 gene locus_tag LOCUS_02610 304159 303053 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783796.1 protein_id gnl|my_center|LOCUS_02610 304661 304173 gene locus_tag LOCUS_02620 304661 304173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 305264 304770 gene locus_tag LOCUS_02630 305264 304770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962371.1 protein_id gnl|my_center|LOCUS_02630 305721 305296 gene locus_tag LOCUS_02640 305721 305296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_02640 309147 305815 gene locus_tag LOCUS_02650 309147 305815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404656.1 protein_id gnl|my_center|LOCUS_02650 311429 309792 gene locus_tag LOCUS_02660 gene pgi 311429 309792 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ0 protein_id gnl|my_center|LOCUS_02660 312667 311429 gene locus_tag LOCUS_02670 312667 311429 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_02670 313619 312687 gene locus_tag LOCUS_02680 313619 312687 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_02680 314392 313619 gene locus_tag LOCUS_02690 314392 313619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_02690 315842 314679 gene locus_tag LOCUS_02700 gene hppD 315842 314679 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_02700 316305 315847 gene locus_tag LOCUS_02710 316305 315847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 317470 316307 gene locus_tag LOCUS_02720 gene hmgA 317470 316307 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_02720 319889 317712 gene locus_tag LOCUS_02730 319889 317712 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_02730 321726 319930 gene locus_tag LOCUS_02740 gene uvrC 321726 319930 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_02740 321900 322868 gene locus_tag LOCUS_02750 321900 322868 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_02750 322861 323418 gene locus_tag LOCUS_02760 gene ygfA 322861 323418 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_02760 323547 326621 gene locus_tag LOCUS_02770 323547 326621 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792393.1 protein_id gnl|my_center|LOCUS_02770 326634 328199 gene locus_tag LOCUS_02780 326634 328199 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291422.1 protein_id gnl|my_center|LOCUS_02780 328327 330243 gene locus_tag LOCUS_02790 328327 330243 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_02790 330319 331914 gene locus_tag LOCUS_02800 330319 331914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 331989 332063 gene locus_tag LOCUS_t00030 331989 332063 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 333017 332490 gene locus_tag LOCUS_02810 333017 332490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 334495 333221 gene locus_tag LOCUS_02820 334495 333221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 338085 334501 gene locus_tag LOCUS_02830 338085 334501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 339613 338108 gene locus_tag LOCUS_02840 339613 338108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 340173 339616 gene locus_tag LOCUS_02850 340173 339616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 343196 340194 gene locus_tag LOCUS_02860 343196 340194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 346234 343208 gene locus_tag LOCUS_02870 346234 343208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 349423 346241 gene locus_tag LOCUS_02880 349423 346241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 349859 349440 gene locus_tag LOCUS_02890 349859 349440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141413.1 protein_id gnl|my_center|LOCUS_02890 350162 349872 gene locus_tag LOCUS_02900 350162 349872 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_02900 351846 350164 gene locus_tag LOCUS_02910 351846 350164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 352623 351850 gene locus_tag LOCUS_02920 352623 351850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 352796 352620 gene locus_tag LOCUS_02930 352796 352620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 353262 352804 gene locus_tag LOCUS_02940 353262 352804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 353708 353268 gene locus_tag LOCUS_02950 353708 353268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 355656 353740 gene locus_tag LOCUS_02960 355656 353740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 356349 355687 gene locus_tag LOCUS_02970 356349 355687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 356604 357821 gene locus_tag LOCUS_02980 356604 357821 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YH8 protein_id gnl|my_center|LOCUS_02980 357824 360145 gene locus_tag LOCUS_02990 357824 360145 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109412.1 protein_id gnl|my_center|LOCUS_02990 360148 361068 gene locus_tag LOCUS_03000 360148 361068 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816114.1 protein_id gnl|my_center|LOCUS_03000 361555 361208 gene locus_tag LOCUS_03010 361555 361208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 362173 363354 gene locus_tag LOCUS_03020 362173 363354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 363580 364035 gene locus_tag LOCUS_03030 363580 364035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_03030 365492 364119 gene locus_tag LOCUS_03040 365492 364119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 366572 365622 gene locus_tag LOCUS_03050 gene ltd 366572 365622 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_03050 366768 367352 gene locus_tag LOCUS_03060 366768 367352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 367380 370736 gene locus_tag LOCUS_03070 gene mfd 367380 370736 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_03070 371305 370742 gene locus_tag LOCUS_03080 371305 370742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 371408 372187 gene locus_tag LOCUS_03090 371408 372187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 374736 372652 gene locus_tag LOCUS_03100 374736 372652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 376461 375235 gene locus_tag LOCUS_03110 376461 375235 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_03110 377277 376513 gene locus_tag LOCUS_03120 377277 376513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 protein_id gnl|my_center|LOCUS_03120 378590 377277 gene locus_tag LOCUS_03130 378590 377277 CDS product cytochrome c biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964529.1 protein_id gnl|my_center|LOCUS_03130 379631 378639 gene locus_tag LOCUS_03140 379631 378639 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_03140 380168 379734 gene locus_tag LOCUS_03150 gene dut 380168 379734 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_03150 381634 380165 gene locus_tag LOCUS_03160 381634 380165 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_03160 382185 381679 gene locus_tag LOCUS_03170 382185 381679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 382417 383094 gene locus_tag LOCUS_03180 382417 383094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 385432 383165 gene locus_tag LOCUS_03190 385432 383165 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404072.1 protein_id gnl|my_center|LOCUS_03190 385657 387702 gene locus_tag LOCUS_03200 385657 387702 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_03200 388824 387751 gene locus_tag LOCUS_03210 388824 387751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963799.1 protein_id gnl|my_center|LOCUS_03210 390307 388901 gene locus_tag LOCUS_03220 390307 388901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 391048 390317 gene locus_tag LOCUS_03230 391048 390317 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122357.1 protein_id gnl|my_center|LOCUS_03230 391885 391055 gene locus_tag LOCUS_03240 391885 391055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 392661 391891 gene locus_tag LOCUS_03250 392661 391891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 394528 392714 gene locus_tag LOCUS_03260 394528 392714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 395678 394557 gene locus_tag LOCUS_03270 395678 394557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 396370 395684 gene locus_tag LOCUS_03280 396370 395684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 397309 396527 gene locus_tag LOCUS_03290 gene atpG 397309 396527 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_03290 399033 397459 gene locus_tag LOCUS_03300 gene atpA 399033 397459 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_03300 399611 399078 gene locus_tag LOCUS_03310 gene atpH 399611 399078 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_03310 400105 399614 gene locus_tag LOCUS_03320 gene atpF 400105 399614 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_03320 400385 400182 gene locus_tag LOCUS_03330 400385 400182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 401631 400426 gene locus_tag LOCUS_03340 gene atpB 401631 400426 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_03340 402025 401633 gene locus_tag LOCUS_03350 402025 401633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 402236 402015 gene locus_tag LOCUS_03360 402236 402015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 405156 402304 gene locus_tag LOCUS_03370 405156 402304 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962323.1 protein_id gnl|my_center|LOCUS_03370 405866 405471 gene locus_tag LOCUS_03380 405866 405471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_03380 408352 405899 gene locus_tag LOCUS_03390 gene sprE 408352 405899 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_03390 409263 408598 gene locus_tag LOCUS_03400 409263 408598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 409676 409317 gene locus_tag LOCUS_03410 409676 409317 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_03410 410671 409709 gene locus_tag LOCUS_03420 410671 409709 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_03420 410794 412857 gene locus_tag LOCUS_03430 gene metG 410794 412857 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_03430 413225 413073 gene locus_tag LOCUS_03440 413225 413073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 413449 413297 gene locus_tag LOCUS_03450 413449 413297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 >Feature sequence02 574 158 gene locus_tag LOCUS_03460 574 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 1148 756 gene locus_tag LOCUS_03470 1148 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 2098 1301 gene locus_tag LOCUS_03480 2098 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 2509 2162 gene locus_tag LOCUS_03490 gene mmcA 2509 2162 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921253.1 protein_id gnl|my_center|LOCUS_03490 4908 2623 gene locus_tag LOCUS_03500 4908 2623 CDS product sugar hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_03500 7192 4910 gene locus_tag LOCUS_03510 7192 4910 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109052.1 protein_id gnl|my_center|LOCUS_03510 7516 7310 gene locus_tag LOCUS_03520 7516 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 7945 7547 gene locus_tag LOCUS_03530 7945 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 8254 8179 gene locus_tag LOCUS_t00040 8254 8179 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8724 8338 gene locus_tag LOCUS_03540 8724 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963214.1 protein_id gnl|my_center|LOCUS_03540 10039 8843 gene locus_tag LOCUS_03550 gene ald 10039 8843 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_03550 10618 10205 gene locus_tag LOCUS_03560 10618 10205 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_03560 12293 10740 gene locus_tag LOCUS_03570 gene porX 12293 10740 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_03570 13095 12382 gene locus_tag LOCUS_03580 13095 12382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 13252 14487 gene locus_tag LOCUS_03590 13252 14487 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_03590 14592 15608 gene locus_tag LOCUS_03600 gene lpxD 14592 15608 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_03600 15620 17008 gene locus_tag LOCUS_03610 gene fabZ 15620 17008 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_03610 17013 17801 gene locus_tag LOCUS_03620 gene lpxA 17013 17801 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_03620 17833 18393 gene locus_tag LOCUS_03630 gene efp 17833 18393 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_03630 18469 19410 gene locus_tag LOCUS_03640 18469 19410 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_03640 19400 19762 gene locus_tag LOCUS_03650 19400 19762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963120.1 protein_id gnl|my_center|LOCUS_03650 19855 20727 gene locus_tag LOCUS_03660 gene sucD 19855 20727 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_03660 21980 20799 gene locus_tag LOCUS_03670 gene mauG 21980 20799 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_03670 24247 22136 gene locus_tag LOCUS_03680 24247 22136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 24474 25220 gene locus_tag LOCUS_03690 24474 25220 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_03690 25295 27322 gene locus_tag LOCUS_03700 25295 27322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_03700 27832 27317 gene locus_tag LOCUS_03710 27832 27317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03710 28276 28710 gene locus_tag LOCUS_03720 28276 28710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 28791 29687 gene locus_tag LOCUS_03730 28791 29687 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3N5W7 protein_id gnl|my_center|LOCUS_03730 29689 29898 gene locus_tag LOCUS_03740 29689 29898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 29951 31234 gene locus_tag LOCUS_03750 29951 31234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 31245 31907 gene locus_tag LOCUS_03760 31245 31907 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_03760 31900 33300 gene locus_tag LOCUS_03770 31900 33300 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_03770 33339 33746 gene locus_tag LOCUS_03780 33339 33746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963035.1 protein_id gnl|my_center|LOCUS_03780 33843 38180 gene locus_tag LOCUS_03790 33843 38180 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_03790 38180 39295 gene locus_tag LOCUS_03800 38180 39295 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_03800 39306 39785 gene locus_tag LOCUS_03810 39306 39785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963109.1 protein_id gnl|my_center|LOCUS_03810 39797 40504 gene locus_tag LOCUS_03820 39797 40504 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_03820 40773 41630 gene locus_tag LOCUS_03830 gene hisG 40773 41630 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY81 protein_id gnl|my_center|LOCUS_03830 41666 42955 gene locus_tag LOCUS_03840 gene hisD 41666 42955 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY80 protein_id gnl|my_center|LOCUS_03840 42979 44043 gene locus_tag LOCUS_03850 gene hisC 42979 44043 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY79 protein_id gnl|my_center|LOCUS_03850 44036 45172 gene locus_tag LOCUS_03860 gene hisB 44036 45172 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 protein_id gnl|my_center|LOCUS_03860 45268 45861 gene locus_tag LOCUS_03870 gene hisH 45268 45861 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY77 protein_id gnl|my_center|LOCUS_03870 45869 46591 gene locus_tag LOCUS_03880 gene hisA 45869 46591 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_03880 46682 47437 gene locus_tag LOCUS_03890 gene hisF 46682 47437 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_03890 47501 48100 gene locus_tag LOCUS_03900 gene hisIE 47501 48100 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 protein_id gnl|my_center|LOCUS_03900 49148 48156 gene locus_tag LOCUS_03910 49148 48156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 49470 50135 gene locus_tag LOCUS_03920 49470 50135 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_03920 50622 50128 gene locus_tag LOCUS_03930 50622 50128 CDS product mep operon protein MepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181698.1 protein_id gnl|my_center|LOCUS_03930 51025 50633 gene locus_tag LOCUS_03940 51025 50633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_03940 52335 51115 gene locus_tag LOCUS_03950 52335 51115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 52462 52908 gene locus_tag LOCUS_03960 52462 52908 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963098.1 protein_id gnl|my_center|LOCUS_03960 54143 52905 gene locus_tag LOCUS_03970 gene mscS2 54143 52905 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_03970 54427 54158 gene locus_tag LOCUS_03980 gene ydzA 54427 54158 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_03980 54924 54424 gene locus_tag LOCUS_03990 54924 54424 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200970.1 protein_id gnl|my_center|LOCUS_03990 55505 55140 gene locus_tag LOCUS_04000 55505 55140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 55694 56641 gene locus_tag LOCUS_04010 55694 56641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 57287 56778 gene locus_tag LOCUS_04020 57287 56778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 57979 57293 gene locus_tag LOCUS_04030 57979 57293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 60631 58481 gene locus_tag LOCUS_04040 60631 58481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 61868 60939 gene locus_tag LOCUS_04050 61868 60939 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_04050 62636 61872 gene locus_tag LOCUS_04060 62636 61872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 64617 62623 gene locus_tag LOCUS_04070 64617 62623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 65676 64627 gene locus_tag LOCUS_04080 65676 64627 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_04080 66815 65679 gene locus_tag LOCUS_04090 66815 65679 CDS product family 88 glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107571.1 protein_id gnl|my_center|LOCUS_04090 67909 66908 gene locus_tag LOCUS_04100 67909 66908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 68836 67916 gene locus_tag LOCUS_04110 68836 67916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 69242 71728 gene locus_tag LOCUS_04120 69242 71728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 72803 72069 gene locus_tag LOCUS_04130 72803 72069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 74322 72982 gene locus_tag LOCUS_04140 74322 72982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 77534 74355 gene locus_tag LOCUS_04150 77534 74355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 79529 77745 gene locus_tag LOCUS_04160 79529 77745 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_04160 82763 79545 gene locus_tag LOCUS_04170 82763 79545 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_04170 84311 82779 gene locus_tag LOCUS_04180 84311 82779 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_04180 84503 85516 gene locus_tag LOCUS_04190 84503 85516 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_04190 87176 85569 gene locus_tag LOCUS_04200 gene uxaA 87176 85569 CDS product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34673 protein_id gnl|my_center|LOCUS_04200 88651 87188 gene locus_tag LOCUS_04210 gene uxaB 88651 87188 CDS product altronate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97L67 protein_id gnl|my_center|LOCUS_04210 90144 88696 gene locus_tag LOCUS_04220 90144 88696 CDS product hexuronate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202180.1 protein_id gnl|my_center|LOCUS_04220 90856 90188 gene locus_tag LOCUS_04230 90856 90188 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_04230 91374 90859 gene locus_tag LOCUS_04240 91374 90859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 92419 91397 gene locus_tag LOCUS_04250 92419 91397 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_04250 92755 92432 gene locus_tag LOCUS_04260 gene kdgF 92755 92432 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311855.1 protein_id gnl|my_center|LOCUS_04260 94166 92766 gene locus_tag LOCUS_04270 gene uxaC 94166 92766 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TY9 protein_id gnl|my_center|LOCUS_04270 95030 94245 gene locus_tag LOCUS_04280 gene idnO 95030 94245 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288236.1 protein_id gnl|my_center|LOCUS_04280 95869 95033 gene locus_tag LOCUS_04290 gene kduI 95869 95033 CDS product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K4 protein_id gnl|my_center|LOCUS_04290 96236 98155 gene locus_tag LOCUS_04300 96236 98155 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963092.1 protein_id gnl|my_center|LOCUS_04300 98156 98761 gene locus_tag LOCUS_04310 gene dnaQ 98156 98761 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932717.1 protein_id gnl|my_center|LOCUS_04310 100494 98764 gene locus_tag LOCUS_04320 100494 98764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 100999 100508 gene locus_tag LOCUS_04330 100999 100508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 101307 100996 gene locus_tag LOCUS_04340 gene acp 101307 100996 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CJZ0 protein_id gnl|my_center|LOCUS_04340 102547 101279 gene locus_tag LOCUS_04350 102547 101279 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_04350 103058 102636 gene locus_tag LOCUS_04360 103058 102636 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 protein_id gnl|my_center|LOCUS_04360 104112 103060 gene locus_tag LOCUS_04370 104112 103060 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_04370 104927 104220 gene locus_tag LOCUS_04380 104927 104220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 106092 104971 gene locus_tag LOCUS_04390 106092 104971 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_04390 106579 106148 gene locus_tag LOCUS_04400 106579 106148 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021908.1 protein_id gnl|my_center|LOCUS_04400 108611 106704 gene locus_tag LOCUS_04410 gene acsA 108611 106704 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_04410 109078 108716 gene locus_tag LOCUS_04420 109078 108716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 111786 109105 gene locus_tag LOCUS_04430 111786 109105 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 protein_id gnl|my_center|LOCUS_04430 113815 112058 gene locus_tag LOCUS_04440 113815 112058 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_04440 114102 113842 gene locus_tag LOCUS_04450 114102 113842 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_04450 115356 114121 gene locus_tag LOCUS_04460 115356 114121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 115873 115454 gene locus_tag LOCUS_04470 115873 115454 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362005.1 protein_id gnl|my_center|LOCUS_04470 116114 117244 gene locus_tag LOCUS_04480 116114 117244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 117249 117911 gene locus_tag LOCUS_04490 117249 117911 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_04490 117920 118633 gene locus_tag LOCUS_04500 117920 118633 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_04500 118637 119323 gene locus_tag LOCUS_04510 118637 119323 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_04510 120370 119399 gene locus_tag LOCUS_04520 120370 119399 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963375.1 protein_id gnl|my_center|LOCUS_04520 120638 122218 gene locus_tag LOCUS_04530 120638 122218 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_04530 122402 123298 gene locus_tag LOCUS_04540 122402 123298 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_04540 123303 123593 gene locus_tag LOCUS_04550 123303 123593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 123586 124092 gene locus_tag LOCUS_04560 123586 124092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 124363 124803 gene locus_tag LOCUS_04570 124363 124803 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_04570 124864 125538 gene locus_tag LOCUS_04580 124864 125538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 126191 125772 gene locus_tag LOCUS_04590 126191 125772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 126924 126304 gene locus_tag LOCUS_04600 126924 126304 CDS product peptidase M54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903951.1 protein_id gnl|my_center|LOCUS_04600 127216 128745 gene locus_tag LOCUS_04610 127216 128745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 128953 129750 gene locus_tag LOCUS_04620 128953 129750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 130398 129895 gene locus_tag LOCUS_04630 130398 129895 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888793.1 protein_id gnl|my_center|LOCUS_04630 131601 130624 gene locus_tag LOCUS_04640 131601 130624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 132437 131883 gene locus_tag LOCUS_04650 132437 131883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 132842 136588 gene locus_tag LOCUS_04660 132842 136588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 136717 138594 gene locus_tag LOCUS_04670 136717 138594 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963172.1 protein_id gnl|my_center|LOCUS_04670 139645 138653 gene locus_tag LOCUS_04680 139645 138653 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 protein_id gnl|my_center|LOCUS_04680 140963 139815 gene locus_tag LOCUS_04690 140963 139815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 141901 141491 gene locus_tag LOCUS_04700 141901 141491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 142062 141901 gene locus_tag LOCUS_04710 142062 141901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 144548 142227 gene locus_tag LOCUS_04720 144548 142227 CDS product double-stranded DNA repair protein Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870839.1 protein_id gnl|my_center|LOCUS_04720 145245 144532 gene locus_tag LOCUS_04730 145245 144532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 146530 145238 gene locus_tag LOCUS_04740 146530 145238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 147702 146989 gene locus_tag LOCUS_04750 147702 146989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 148292 147957 gene locus_tag LOCUS_04760 148292 147957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722968.1 protein_id gnl|my_center|LOCUS_04760 149701 148403 gene locus_tag LOCUS_04770 149701 148403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 150967 149705 gene locus_tag LOCUS_04780 150967 149705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 151191 151820 gene locus_tag LOCUS_04790 151191 151820 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226658.1 protein_id gnl|my_center|LOCUS_04790 151826 152620 gene locus_tag LOCUS_04800 151826 152620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 152695 153204 gene locus_tag LOCUS_04810 152695 153204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 153201 153995 gene locus_tag LOCUS_04820 153201 153995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 154950 154150 gene locus_tag LOCUS_04830 gene mttC 154950 154150 CDS product preprotein translocase subunit TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_04830 155735 155052 gene locus_tag LOCUS_04840 155735 155052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 156021 156599 gene locus_tag LOCUS_04850 156021 156599 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_04850 156730 157398 gene locus_tag LOCUS_04860 156730 157398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102692.1 protein_id gnl|my_center|LOCUS_04860 158030 157440 gene locus_tag LOCUS_04870 158030 157440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 158384 159400 gene locus_tag LOCUS_04880 158384 159400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 159624 160334 gene locus_tag LOCUS_04890 159624 160334 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660650.1 protein_id gnl|my_center|LOCUS_04890 160315 161421 gene locus_tag LOCUS_04900 160315 161421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202982.1 protein_id gnl|my_center|LOCUS_04900 162759 162526 gene locus_tag LOCUS_04910 162759 162526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 163476 162979 gene locus_tag LOCUS_04920 163476 162979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 165656 164139 gene locus_tag LOCUS_04930 165656 164139 CDS product ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107966.1 protein_id gnl|my_center|LOCUS_04930 165769 166380 gene locus_tag LOCUS_04940 165769 166380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 166413 167435 gene locus_tag LOCUS_04950 166413 167435 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_04950 168377 167496 gene locus_tag LOCUS_04960 168377 167496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963809.1 protein_id gnl|my_center|LOCUS_04960 168492 169523 gene locus_tag LOCUS_04970 168492 169523 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963810.1 protein_id gnl|my_center|LOCUS_04970 169628 170884 gene locus_tag LOCUS_04980 169628 170884 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963811.1 protein_id gnl|my_center|LOCUS_04980 173101 170894 gene locus_tag LOCUS_04990 173101 170894 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_04990 175420 173210 gene locus_tag LOCUS_05000 175420 173210 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_05000 177129 175435 gene locus_tag LOCUS_05010 177129 175435 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 protein_id gnl|my_center|LOCUS_05010 177343 177161 gene locus_tag LOCUS_05020 177343 177161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963197.1 protein_id gnl|my_center|LOCUS_05020 177960 178625 gene locus_tag LOCUS_05030 177960 178625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 179630 178626 gene locus_tag LOCUS_05040 gene holA 179630 178626 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_05040 179692 180138 gene locus_tag LOCUS_05050 179692 180138 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_05050 180142 180558 gene locus_tag LOCUS_05060 180142 180558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 180558 181550 gene locus_tag LOCUS_05070 180558 181550 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_05070 181622 182461 gene locus_tag LOCUS_05080 181622 182461 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_05080 182633 183208 gene locus_tag LOCUS_05090 182633 183208 CDS product chalcone isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964030.1 protein_id gnl|my_center|LOCUS_05090 184282 183260 gene locus_tag LOCUS_05100 184282 183260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 184906 184286 gene locus_tag LOCUS_05110 184906 184286 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_05110 185611 184973 gene locus_tag LOCUS_05120 185611 184973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 187953 185617 gene locus_tag LOCUS_05130 gene uvrD 187953 185617 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_05130 188136 188657 gene locus_tag LOCUS_05140 188136 188657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_05140 190462 188714 gene locus_tag LOCUS_05150 190462 188714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 191456 190548 gene locus_tag LOCUS_05160 191456 190548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 193526 191457 gene locus_tag LOCUS_05170 193526 191457 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963153.1 protein_id gnl|my_center|LOCUS_05170 193603 194334 gene locus_tag LOCUS_05180 193603 194334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_05180 194341 194835 gene locus_tag LOCUS_05190 194341 194835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 194837 195538 gene locus_tag LOCUS_05200 194837 195538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 195607 196239 gene locus_tag LOCUS_05210 195607 196239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 196774 196316 gene locus_tag LOCUS_05220 196774 196316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 197007 199112 gene locus_tag LOCUS_05230 gene recG 197007 199112 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_05230 199114 199551 gene locus_tag LOCUS_05240 199114 199551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 199979 200662 gene locus_tag LOCUS_05250 199979 200662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 200964 201848 gene locus_tag LOCUS_05260 200964 201848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 201868 202632 gene locus_tag LOCUS_05270 201868 202632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 202685 204010 gene locus_tag LOCUS_05280 202685 204010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 209744 204111 gene locus_tag LOCUS_05290 209744 204111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 209931 210392 gene locus_tag LOCUS_05300 209931 210392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 210897 211730 gene locus_tag LOCUS_05310 210897 211730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 212019 212591 gene locus_tag LOCUS_05320 212019 212591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 212809 213876 gene locus_tag LOCUS_05330 212809 213876 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_05330 213879 216968 gene locus_tag LOCUS_05340 213879 216968 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764017.1 protein_id gnl|my_center|LOCUS_05340 217019 218275 gene locus_tag LOCUS_05350 217019 218275 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403495.1 protein_id gnl|my_center|LOCUS_05350 218428 218994 gene locus_tag LOCUS_05360 218428 218994 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975272.1 protein_id gnl|my_center|LOCUS_05360 219293 220156 gene locus_tag LOCUS_05370 219293 220156 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_05370 220168 221265 gene locus_tag LOCUS_05380 220168 221265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 221288 222310 gene locus_tag LOCUS_05390 gene pepL 221288 222310 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FHS3 protein_id gnl|my_center|LOCUS_05390 222387 224816 gene locus_tag LOCUS_05400 gene pheT 222387 224816 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_05400 227661 224947 gene locus_tag LOCUS_05410 227661 224947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 227791 228540 gene locus_tag LOCUS_05420 227791 228540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_05420 228533 229060 gene locus_tag LOCUS_05430 gene kdsC 228533 229060 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_05430 229148 230095 gene locus_tag LOCUS_05440 229148 230095 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_05440 230082 230672 gene locus_tag LOCUS_05450 230082 230672 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_05450 230656 231192 gene locus_tag LOCUS_05460 230656 231192 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071240.1 protein_id gnl|my_center|LOCUS_05460 231287 233731 gene locus_tag LOCUS_05470 231287 233731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 233843 235585 gene locus_tag LOCUS_05480 233843 235585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 236483 235611 gene locus_tag LOCUS_05490 236483 235611 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_05490 236934 237293 gene locus_tag LOCUS_05500 236934 237293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 238295 237444 gene locus_tag LOCUS_05510 238295 237444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_05510 238435 238911 gene locus_tag LOCUS_05520 238435 238911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_05520 238942 239640 gene locus_tag LOCUS_05530 238942 239640 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_05530 239752 241041 gene locus_tag LOCUS_05540 gene phrB1 239752 241041 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_05540 241034 242515 gene locus_tag LOCUS_05550 gene phrB2 241034 242515 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964141.1 protein_id gnl|my_center|LOCUS_05550 243011 242580 gene locus_tag LOCUS_05560 243011 242580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029036.1 protein_id gnl|my_center|LOCUS_05560 243759 243103 gene locus_tag LOCUS_05570 243759 243103 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962785.1 protein_id gnl|my_center|LOCUS_05570 243858 244400 gene locus_tag LOCUS_05580 243858 244400 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_05580 244431 244835 gene locus_tag LOCUS_05590 244431 244835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962783.1 protein_id gnl|my_center|LOCUS_05590 244838 245281 gene locus_tag LOCUS_05600 244838 245281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_05600 245338 245754 gene locus_tag LOCUS_05610 245338 245754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 245855 246370 gene locus_tag LOCUS_05620 245855 246370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 246386 246577 gene locus_tag LOCUS_05630 246386 246577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 247598 246588 gene locus_tag LOCUS_05640 247598 246588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_05640 248008 249366 gene locus_tag LOCUS_05650 gene hemN 248008 249366 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_05650 251075 250428 gene locus_tag LOCUS_05660 251075 250428 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_05660 251804 251358 gene locus_tag LOCUS_05670 gene ccoH 251804 251358 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_05670 253310 251892 gene locus_tag LOCUS_05680 gene ccoG 253310 251892 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_05680 254405 253449 gene locus_tag LOCUS_05690 gene ccoP 254405 253449 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_05690 254590 254417 gene locus_tag LOCUS_05700 gene ccoQ 254590 254417 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963295.1 protein_id gnl|my_center|LOCUS_05700 256794 254596 gene locus_tag LOCUS_05710 gene ccoN/ccoO 256794 254596 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_05710 256988 256797 gene locus_tag LOCUS_05720 256988 256797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 259499 257109 gene locus_tag LOCUS_05730 gene ccoI 259499 257109 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_05730 259603 260280 gene locus_tag LOCUS_05740 259603 260280 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_05740 260338 261597 gene locus_tag LOCUS_05750 260338 261597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 261687 262901 gene locus_tag LOCUS_05760 gene rsmB 261687 262901 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_05760 262906 264024 gene locus_tag LOCUS_05770 262906 264024 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962855.1 protein_id gnl|my_center|LOCUS_05770 264390 264097 gene locus_tag LOCUS_05780 264390 264097 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707594.1 protein_id gnl|my_center|LOCUS_05780 265301 264522 gene locus_tag LOCUS_05790 265301 264522 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_05790 265487 266023 gene locus_tag LOCUS_05800 265487 266023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 266026 266229 gene locus_tag LOCUS_05810 266026 266229 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108348.1 protein_id gnl|my_center|LOCUS_05810 266279 266644 gene locus_tag LOCUS_05820 266279 266644 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035971.1 protein_id gnl|my_center|LOCUS_05820 266654 267817 gene locus_tag LOCUS_05830 266654 267817 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 protein_id gnl|my_center|LOCUS_05830 268314 267877 gene locus_tag LOCUS_05840 268314 267877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_05840 269002 268415 gene locus_tag LOCUS_05850 gene def 269002 268415 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_05850 269215 269889 gene locus_tag LOCUS_05860 269215 269889 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_05860 269898 271115 gene locus_tag LOCUS_05870 269898 271115 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_05870 271105 272079 gene locus_tag LOCUS_05880 gene argC 271105 272079 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A7 protein_id gnl|my_center|LOCUS_05880 272188 273366 gene locus_tag LOCUS_05890 272188 273366 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_05890 273448 274401 gene locus_tag LOCUS_05900 273448 274401 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_05900 274394 275194 gene locus_tag LOCUS_05910 gene argB 274394 275194 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B0 protein_id gnl|my_center|LOCUS_05910 275169 276254 gene locus_tag LOCUS_05920 275169 276254 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_05920 276256 277566 gene locus_tag LOCUS_05930 gene argH 276256 277566 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D3 protein_id gnl|my_center|LOCUS_05930 277973 277581 gene locus_tag LOCUS_05940 277973 277581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 278463 277990 gene locus_tag LOCUS_05950 278463 277990 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_05950 278885 278472 gene locus_tag LOCUS_05960 278885 278472 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_05960 280488 279010 gene locus_tag LOCUS_05970 gene mqo 280488 279010 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E6 protein_id gnl|my_center|LOCUS_05970 281217 280615 gene locus_tag LOCUS_05980 281217 280615 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963244.1 protein_id gnl|my_center|LOCUS_05980 281472 282287 gene locus_tag LOCUS_05990 gene dapD 281472 282287 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_05990 282293 283327 gene locus_tag LOCUS_06000 282293 283327 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707880.1 protein_id gnl|my_center|LOCUS_06000 283333 284439 gene locus_tag LOCUS_06010 283333 284439 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_06010 285271 284453 gene locus_tag LOCUS_06020 285271 284453 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122210.1 protein_id gnl|my_center|LOCUS_06020 286068 285295 gene locus_tag LOCUS_06030 286068 285295 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963745.1 protein_id gnl|my_center|LOCUS_06030 287003 286068 gene locus_tag LOCUS_06040 287003 286068 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963746.1 protein_id gnl|my_center|LOCUS_06040 288201 287005 gene locus_tag LOCUS_06050 288201 287005 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963747.1 protein_id gnl|my_center|LOCUS_06050 288957 288202 gene locus_tag LOCUS_06060 288957 288202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963748.1 protein_id gnl|my_center|LOCUS_06060 289031 290089 gene locus_tag LOCUS_06070 289031 290089 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355946.1 protein_id gnl|my_center|LOCUS_06070 290963 290103 gene locus_tag LOCUS_06080 290963 290103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 291117 292091 gene locus_tag LOCUS_06090 291117 292091 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963396.1 protein_id gnl|my_center|LOCUS_06090 293099 292092 gene locus_tag LOCUS_06100 293099 292092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 293131 294210 gene locus_tag LOCUS_06110 293131 294210 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965647.1 protein_id gnl|my_center|LOCUS_06110 294247 294903 gene locus_tag LOCUS_06120 294247 294903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 294893 295459 gene locus_tag LOCUS_06130 294893 295459 CDS product translation factor Sua5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_06130 295587 297002 gene locus_tag LOCUS_06140 gene cca 295587 297002 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_06140 297056 298081 gene locus_tag LOCUS_06150 gene ctaA 297056 298081 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 protein_id gnl|my_center|LOCUS_06150 298140 298910 gene locus_tag LOCUS_06160 298140 298910 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963758.1 protein_id gnl|my_center|LOCUS_06160 299695 298907 gene locus_tag LOCUS_06170 299695 298907 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_06170 300114 299746 gene locus_tag LOCUS_06180 300114 299746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963760.1 protein_id gnl|my_center|LOCUS_06180 300419 300111 gene locus_tag LOCUS_06190 300419 300111 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963761.1 protein_id gnl|my_center|LOCUS_06190 300739 300428 gene locus_tag LOCUS_06200 300739 300428 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963761.1 protein_id gnl|my_center|LOCUS_06200 302064 300730 gene locus_tag LOCUS_06210 302064 300730 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_06210 302700 302074 gene locus_tag LOCUS_06220 302700 302074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963764.1 protein_id gnl|my_center|LOCUS_06220 303535 303122 gene locus_tag LOCUS_06230 303535 303122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_06230 305770 303617 gene locus_tag LOCUS_06240 305770 303617 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_06240 306009 306539 gene locus_tag LOCUS_06250 306009 306539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_06250 306640 307698 gene locus_tag LOCUS_06260 306640 307698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_06260 307809 308201 gene locus_tag LOCUS_06270 307809 308201 CDS product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258306.1 protein_id gnl|my_center|LOCUS_06270 309575 308301 gene locus_tag LOCUS_06280 gene glyA 309575 308301 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_06280 309686 310969 gene locus_tag LOCUS_06290 gene fahA 309686 310969 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_06290 311136 312320 gene locus_tag LOCUS_06300 311136 312320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963930.1 protein_id gnl|my_center|LOCUS_06300 313519 312395 gene locus_tag LOCUS_06310 313519 312395 CDS product 3-carboxymuconate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_06310 313971 313552 gene locus_tag LOCUS_06320 gene ytxJ 313971 313552 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_06320 314533 314045 gene locus_tag LOCUS_06330 314533 314045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 315036 314515 gene locus_tag LOCUS_06340 315036 314515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 315143 317746 gene locus_tag LOCUS_06350 gene clpB 315143 317746 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0F9 protein_id gnl|my_center|LOCUS_06350 318228 317914 gene locus_tag LOCUS_06360 318228 317914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223286.1 protein_id gnl|my_center|LOCUS_06360 318359 318958 gene locus_tag LOCUS_06370 318359 318958 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195466.1 protein_id gnl|my_center|LOCUS_06370 319630 319040 gene locus_tag LOCUS_06380 319630 319040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918302.1 protein_id gnl|my_center|LOCUS_06380 319813 321222 gene locus_tag LOCUS_06390 319813 321222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 321509 321997 gene locus_tag LOCUS_06400 321509 321997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 322003 323373 gene locus_tag LOCUS_06410 322003 323373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 325292 323550 gene locus_tag LOCUS_06420 gene rho 325292 323550 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_06420 325478 325891 gene locus_tag LOCUS_06430 325478 325891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_06430 326676 326182 gene locus_tag LOCUS_06440 326676 326182 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_06440 326784 327563 gene locus_tag LOCUS_06450 gene truA 326784 327563 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_06450 327577 329325 gene locus_tag LOCUS_06460 327577 329325 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_06460 329489 330877 gene locus_tag LOCUS_06470 gene lpdA2 329489 330877 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_06470 332616 331177 gene locus_tag LOCUS_06480 332616 331177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 332985 333497 gene locus_tag LOCUS_06490 332985 333497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 334048 333494 gene locus_tag LOCUS_06500 334048 333494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 protein_id gnl|my_center|LOCUS_06500 334226 334041 gene locus_tag LOCUS_06510 334226 334041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 334611 334937 gene locus_tag LOCUS_06520 334611 334937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 335140 335832 gene locus_tag LOCUS_06530 335140 335832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963247.1 protein_id gnl|my_center|LOCUS_06530 337379 335919 gene locus_tag LOCUS_06540 gene cpsL 337379 335919 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292875.1 protein_id gnl|my_center|LOCUS_06540 338716 337403 gene locus_tag LOCUS_06550 338716 337403 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_06550 341114 338691 gene locus_tag LOCUS_06560 341114 338691 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_06560 341484 341206 gene locus_tag LOCUS_06570 341484 341206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 341592 342560 gene locus_tag LOCUS_06580 341592 342560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963908.1 protein_id gnl|my_center|LOCUS_06580 342563 343681 gene locus_tag LOCUS_06590 gene yghO 342563 343681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_06590 344039 343728 gene locus_tag LOCUS_06600 344039 343728 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_06600 344672 344058 gene locus_tag LOCUS_06610 344672 344058 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_06610 345198 344680 gene locus_tag LOCUS_06620 345198 344680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 345321 345776 gene locus_tag LOCUS_06630 345321 345776 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_06630 345778 346410 gene locus_tag LOCUS_06640 345778 346410 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_06640 346433 346999 gene locus_tag LOCUS_06650 gene yceI 346433 346999 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence03 1435 173 gene locus_tag LOCUS_06660 1435 173 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_06660 1512 2660 gene locus_tag LOCUS_06670 1512 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_06670 2707 3663 gene locus_tag LOCUS_06680 2707 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4210 3713 gene locus_tag LOCUS_06690 4210 3713 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_06690 4281 5021 gene locus_tag LOCUS_06700 4281 5021 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_06700 5494 5093 gene locus_tag LOCUS_06710 5494 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783513.1 protein_id gnl|my_center|LOCUS_06710 6145 5513 gene locus_tag LOCUS_06720 gene queE 6145 5513 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_06720 6314 7855 gene locus_tag LOCUS_06730 6314 7855 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_06730 7914 8279 gene locus_tag LOCUS_06740 7914 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 9572 8361 gene locus_tag LOCUS_06750 9572 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963254.1 protein_id gnl|my_center|LOCUS_06750 12087 9559 gene locus_tag LOCUS_06760 12087 9559 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963253.1 protein_id gnl|my_center|LOCUS_06760 16369 12137 gene locus_tag LOCUS_06770 16369 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 17978 16632 gene locus_tag LOCUS_06780 gene kmo 17978 16632 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_06780 18106 18753 gene locus_tag LOCUS_06790 18106 18753 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_06790 18985 20280 gene locus_tag LOCUS_06800 gene phrB3 18985 20280 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964143.1 protein_id gnl|my_center|LOCUS_06800 20352 21884 gene locus_tag LOCUS_06810 20352 21884 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964142.1 protein_id gnl|my_center|LOCUS_06810 23594 21888 gene locus_tag LOCUS_06820 23594 21888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 24685 23603 gene locus_tag LOCUS_06830 gene speB 24685 23603 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_06830 26047 24758 gene locus_tag LOCUS_06840 gene kynU 26047 24758 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_06840 26368 26111 gene locus_tag LOCUS_06850 26368 26111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 27719 26670 gene locus_tag LOCUS_06860 gene queA 27719 26670 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_06860 28089 28163 gene locus_tag LOCUS_t00050 28089 28163 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 29418 28171 gene locus_tag LOCUS_06870 gene aroA 29418 28171 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW83 protein_id gnl|my_center|LOCUS_06870 29799 29473 gene locus_tag LOCUS_06880 29799 29473 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_06880 31813 29801 gene locus_tag LOCUS_06890 31813 29801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 33732 31828 gene locus_tag LOCUS_06900 33732 31828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 34191 33739 gene locus_tag LOCUS_06910 gene dtd 34191 33739 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 protein_id gnl|my_center|LOCUS_06910 35175 34195 gene locus_tag LOCUS_06920 gene rsgA 35175 34195 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 protein_id gnl|my_center|LOCUS_06920 35807 35328 gene locus_tag LOCUS_06930 35807 35328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 37002 35920 gene locus_tag LOCUS_06940 37002 35920 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_06940 37882 37022 gene locus_tag LOCUS_06950 gene tyrA 37882 37022 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_06950 39024 37882 gene locus_tag LOCUS_06960 gene aspC3 39024 37882 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 protein_id gnl|my_center|LOCUS_06960 39848 39021 gene locus_tag LOCUS_06970 gene pheA 39848 39021 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_06970 40118 41020 gene locus_tag LOCUS_06980 gene gldA 40118 41020 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_06980 41540 41031 gene locus_tag LOCUS_06990 41540 41031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 42069 41680 gene locus_tag LOCUS_07000 42069 41680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 43312 42356 gene locus_tag LOCUS_07010 43312 42356 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU8 protein_id gnl|my_center|LOCUS_07010 46064 43392 gene locus_tag LOCUS_07020 46064 43392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07020 47051 46065 gene locus_tag LOCUS_07030 47051 46065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07030 48494 47397 gene locus_tag LOCUS_07040 48494 47397 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962430.1 protein_id gnl|my_center|LOCUS_07040 49452 48505 gene locus_tag LOCUS_07050 gene metX 49452 48505 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW98 protein_id gnl|my_center|LOCUS_07050 50012 49554 gene locus_tag LOCUS_07060 50012 49554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546638.1 protein_id gnl|my_center|LOCUS_07060 51310 50015 gene locus_tag LOCUS_07070 gene metY 51310 50015 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962432.1 protein_id gnl|my_center|LOCUS_07070 52415 51798 gene locus_tag LOCUS_07080 52415 51798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 54065 52422 gene locus_tag LOCUS_07090 gene cysI 54065 52422 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CMX5 protein_id gnl|my_center|LOCUS_07090 55867 54167 gene locus_tag LOCUS_07100 gene cysJ 55867 54167 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32214 protein_id gnl|my_center|LOCUS_07100 56675 55857 gene locus_tag LOCUS_07110 56675 55857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 57712 56801 gene locus_tag LOCUS_07120 gene cysK 57712 56801 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5G2 protein_id gnl|my_center|LOCUS_07120 58561 57734 gene locus_tag LOCUS_07130 58561 57734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 59166 60416 gene locus_tag LOCUS_07140 gene metK 59166 60416 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_07140 63514 60779 gene locus_tag LOCUS_07150 63514 60779 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_07150 64425 63595 gene locus_tag LOCUS_07160 64425 63595 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_07160 64544 66037 gene locus_tag LOCUS_07170 64544 66037 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202777.1 protein_id gnl|my_center|LOCUS_07170 66030 66710 gene locus_tag LOCUS_07180 gene rprY 66030 66710 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_07180 67620 66715 gene locus_tag LOCUS_07190 67620 66715 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_07190 67745 68530 gene locus_tag LOCUS_07200 67745 68530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962437.1 protein_id gnl|my_center|LOCUS_07200 68530 69144 gene locus_tag LOCUS_07210 68530 69144 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_07210 69223 69813 gene locus_tag LOCUS_07220 69223 69813 CDS product fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121856.1 protein_id gnl|my_center|LOCUS_07220 72209 69810 gene locus_tag LOCUS_07230 72209 69810 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_07230 72939 72268 gene locus_tag LOCUS_07240 72939 72268 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016415.1 protein_id gnl|my_center|LOCUS_07240 73934 72939 gene locus_tag LOCUS_07250 gene aspG 73934 72939 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_07250 76556 74055 gene locus_tag LOCUS_07260 76556 74055 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_07260 77210 76680 gene locus_tag LOCUS_07270 gene ppa 77210 76680 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH9 protein_id gnl|my_center|LOCUS_07270 77960 77322 gene locus_tag LOCUS_07280 gene alkA 77960 77322 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653302.1 protein_id gnl|my_center|LOCUS_07280 80575 78035 gene locus_tag LOCUS_07290 80575 78035 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_07290 81570 80593 gene locus_tag LOCUS_07300 gene pdhB 81570 80593 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_07300 81974 82720 gene locus_tag LOCUS_07310 gene etfB 81974 82720 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_07310 82754 83722 gene locus_tag LOCUS_07320 gene etfA 82754 83722 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_07320 83978 84607 gene locus_tag LOCUS_07330 83978 84607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_07330 84621 86282 gene locus_tag LOCUS_07340 gene yeiM 84621 86282 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_07340 86275 86640 gene locus_tag LOCUS_07350 86275 86640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 86685 87509 gene locus_tag LOCUS_07360 gene thyA 86685 87509 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 protein_id gnl|my_center|LOCUS_07360 87518 88285 gene locus_tag LOCUS_07370 87518 88285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 88381 90828 gene locus_tag LOCUS_07380 88381 90828 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_07380 91074 91769 gene locus_tag LOCUS_07390 91074 91769 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480502.1 protein_id gnl|my_center|LOCUS_07390 91851 93212 gene locus_tag LOCUS_07400 gene aldH 91851 93212 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185Z3 protein_id gnl|my_center|LOCUS_07400 93233 93718 gene locus_tag LOCUS_07410 gene dfrA 93233 93718 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_07410 93750 94493 gene locus_tag LOCUS_07420 gene menG 93750 94493 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_07420 94582 95277 gene locus_tag LOCUS_07430 gene porT 94582 95277 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_07430 96007 95285 gene locus_tag LOCUS_07440 96007 95285 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_07440 96043 98598 gene locus_tag LOCUS_07450 96043 98598 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_07450 98644 99711 gene locus_tag LOCUS_07460 gene fbaA 98644 99711 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_07460 99790 100644 gene locus_tag LOCUS_07470 gene accD 99790 100644 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_07470 100775 100857 gene locus_tag LOCUS_t00060 100775 100857 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 101451 101029 gene locus_tag LOCUS_07480 101451 101029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 102660 102205 gene locus_tag LOCUS_07490 102660 102205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 105696 102829 gene locus_tag LOCUS_07500 105696 102829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 106845 105745 gene locus_tag LOCUS_07510 106845 105745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 108404 106863 gene locus_tag LOCUS_07520 108404 106863 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_07520 111429 108415 gene locus_tag LOCUS_07530 111429 108415 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_07530 111711 112733 gene locus_tag LOCUS_07540 111711 112733 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_07540 112936 114342 gene locus_tag LOCUS_07550 112936 114342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 114326 115009 gene locus_tag LOCUS_07560 gene pgmB2 114326 115009 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_07560 115013 117310 gene locus_tag LOCUS_07570 115013 117310 CDS product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_07570 117312 119426 gene locus_tag LOCUS_07580 117312 119426 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_07580 119481 121322 gene locus_tag LOCUS_07590 gene susA 119481 121322 CDS product neopullulanase SusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G0 protein_id gnl|my_center|LOCUS_07590 121342 122280 gene locus_tag LOCUS_07600 121342 122280 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074155.1 protein_id gnl|my_center|LOCUS_07600 122286 123728 gene locus_tag LOCUS_07610 122286 123728 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 protein_id gnl|my_center|LOCUS_07610 123811 124491 gene locus_tag LOCUS_07620 gene glpQ 123811 124491 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_07620 124488 125699 gene locus_tag LOCUS_07630 124488 125699 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_07630 126298 125741 gene locus_tag LOCUS_07640 126298 125741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 127248 126322 gene locus_tag LOCUS_07650 127248 126322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 127820 127344 gene locus_tag LOCUS_07660 127820 127344 CDS product sensory protein TspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962480.1 protein_id gnl|my_center|LOCUS_07660 127904 128980 gene locus_tag LOCUS_07670 gene mvaD 127904 128980 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_07670 129016 129954 gene locus_tag LOCUS_07680 gene mvaK 129016 129954 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_07680 130007 130954 gene locus_tag LOCUS_07690 130007 130954 CDS product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_07690 131042 131935 gene locus_tag LOCUS_07700 131042 131935 CDS product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962486.1 protein_id gnl|my_center|LOCUS_07700 131995 132354 gene locus_tag LOCUS_07710 131995 132354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962487.1 protein_id gnl|my_center|LOCUS_07710 132810 132436 gene locus_tag LOCUS_07720 132810 132436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962748.1 protein_id gnl|my_center|LOCUS_07720 133192 132854 gene locus_tag LOCUS_07730 133192 132854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 134714 133719 gene locus_tag LOCUS_07740 134714 133719 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_07740 134863 136659 gene locus_tag LOCUS_07750 gene lepA 134863 136659 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_07750 136783 140952 gene locus_tag LOCUS_07760 136783 140952 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963617.1 protein_id gnl|my_center|LOCUS_07760 142260 141010 gene locus_tag LOCUS_07770 142260 141010 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_07770 142566 143585 gene locus_tag LOCUS_07780 142566 143585 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090081.1 protein_id gnl|my_center|LOCUS_07780 144269 143661 gene locus_tag LOCUS_07790 144269 143661 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_07790 146085 144262 gene locus_tag LOCUS_07800 146085 144262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 146284 146871 gene locus_tag LOCUS_07810 146284 146871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 146953 149139 gene locus_tag LOCUS_07820 146953 149139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 149136 150170 gene locus_tag LOCUS_07830 149136 150170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 150336 151862 gene locus_tag LOCUS_07840 gene purH 150336 151862 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_07840 151921 152949 gene locus_tag LOCUS_07850 gene mreB 151921 152949 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_07850 153018 153788 gene locus_tag LOCUS_07860 gene mreC 153018 153788 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 protein_id gnl|my_center|LOCUS_07860 154285 156198 gene locus_tag LOCUS_07870 gene pbpA 154285 156198 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_07870 156454 157452 gene locus_tag LOCUS_07880 gene rodA 156454 157452 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_07880 158795 157455 gene locus_tag LOCUS_07890 158795 157455 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_07890 159147 158785 gene locus_tag LOCUS_07900 159147 158785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 161517 159319 gene locus_tag LOCUS_07910 161517 159319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_07910 163086 161554 gene locus_tag LOCUS_07920 163086 161554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 164349 163102 gene locus_tag LOCUS_07930 164349 163102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 164633 164454 gene locus_tag LOCUS_07940 164633 164454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 165601 164723 gene locus_tag LOCUS_07950 165601 164723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 167705 165585 gene locus_tag LOCUS_07960 167705 165585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 170160 167779 gene locus_tag LOCUS_07970 170160 167779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963442.1 protein_id gnl|my_center|LOCUS_07970 171812 170298 gene locus_tag LOCUS_07980 171812 170298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 172759 171968 gene locus_tag LOCUS_07990 gene nucA 172759 171968 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_07990 172809 173366 gene locus_tag LOCUS_08000 172809 173366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 173713 173453 gene locus_tag LOCUS_08010 gene rpmA 173713 173453 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P8 protein_id gnl|my_center|LOCUS_08010 174427 173747 gene locus_tag LOCUS_08020 gene rplU 174427 173747 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P9 protein_id gnl|my_center|LOCUS_08020 174615 175940 gene locus_tag LOCUS_08030 174615 175940 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_08030 175949 178000 gene locus_tag LOCUS_08040 175949 178000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 178919 178050 gene locus_tag LOCUS_08050 gene fjo11 178919 178050 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_08050 179028 179537 gene locus_tag LOCUS_08060 179028 179537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 180102 179587 gene locus_tag LOCUS_08070 gene gldD 180102 179587 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_08070 181434 180142 gene locus_tag LOCUS_08080 181434 180142 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_08080 181907 181458 gene locus_tag LOCUS_08090 gene ssb 181907 181458 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H058 protein_id gnl|my_center|LOCUS_08090 182986 181958 gene locus_tag LOCUS_08100 gene mutY 182986 181958 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_08100 183042 183413 gene locus_tag LOCUS_08110 gene hupA 183042 183413 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_08110 183735 185285 gene locus_tag LOCUS_08120 gene cafA 183735 185285 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_08120 188315 185508 gene locus_tag LOCUS_08130 188315 185508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 189164 188412 gene locus_tag LOCUS_08140 189164 188412 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_08140 192183 189310 gene locus_tag LOCUS_08150 192183 189310 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963634.1 protein_id gnl|my_center|LOCUS_08150 194585 192294 gene locus_tag LOCUS_08160 gene pbpC 194585 192294 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_08160 200137 194636 gene locus_tag LOCUS_08170 200137 194636 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964323.1 protein_id gnl|my_center|LOCUS_08170 200657 200217 gene locus_tag LOCUS_08180 gene tadA 200657 200217 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_08180 200696 202468 gene locus_tag LOCUS_08190 gene dxs 200696 202468 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWC0 protein_id gnl|my_center|LOCUS_08190 202471 203415 gene locus_tag LOCUS_08200 202471 203415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_08200 203484 204746 gene locus_tag LOCUS_08210 gene umuC 203484 204746 CDS product SOS mutagenesis and repair protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_08210 204740 205183 gene locus_tag LOCUS_08220 204740 205183 CDS product SOS-response transcriptional regulator UmuD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202621.1 protein_id gnl|my_center|LOCUS_08220 205301 207373 gene locus_tag LOCUS_08230 205301 207373 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 protein_id gnl|my_center|LOCUS_08230 207380 208015 gene locus_tag LOCUS_08240 207380 208015 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_08240 208124 208339 gene locus_tag LOCUS_08250 208124 208339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 209072 210052 gene locus_tag LOCUS_08260 209072 210052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 210155 210784 gene locus_tag LOCUS_08270 210155 210784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 211193 211444 gene locus_tag LOCUS_08280 211193 211444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 211441 212280 gene locus_tag LOCUS_08290 211441 212280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 212391 212858 gene locus_tag LOCUS_08300 212391 212858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 213136 215940 gene locus_tag LOCUS_08310 213136 215940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 216062 217843 gene locus_tag LOCUS_08320 216062 217843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 218010 220835 gene locus_tag LOCUS_08330 218010 220835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 220863 222098 gene locus_tag LOCUS_08340 220863 222098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 222129 222683 gene locus_tag LOCUS_08350 222129 222683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 222747 224399 gene locus_tag LOCUS_08360 222747 224399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 224383 226590 gene locus_tag LOCUS_08370 224383 226590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 226590 227534 gene locus_tag LOCUS_08380 226590 227534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 228913 227813 gene locus_tag LOCUS_08390 228913 227813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 229744 229067 gene locus_tag LOCUS_08400 229744 229067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 230139 229744 gene locus_tag LOCUS_08410 230139 229744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 230078 230230 gene locus_tag LOCUS_08420 230078 230230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 232574 230286 gene locus_tag LOCUS_08430 232574 230286 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_08430 233273 232872 gene locus_tag LOCUS_08440 233273 232872 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_08440 234801 233266 gene locus_tag LOCUS_08450 234801 233266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 235385 234771 gene locus_tag LOCUS_08460 gene pnuC 235385 234771 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_08460 236098 235382 gene locus_tag LOCUS_08470 gene pcrB 236098 235382 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_08470 236727 236098 gene locus_tag LOCUS_08480 gene sfp 236727 236098 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_08480 236915 238231 gene locus_tag LOCUS_08490 gene ahcY 236915 238231 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_08490 238532 239632 gene locus_tag LOCUS_08500 238532 239632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_08500 242088 239764 gene locus_tag LOCUS_08510 242088 239764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 243831 242200 gene locus_tag LOCUS_08520 243831 242200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 244483 244280 gene locus_tag LOCUS_08530 244483 244280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 249026 244491 gene locus_tag LOCUS_08540 249026 244491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 249361 249137 gene locus_tag LOCUS_08550 249361 249137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 250929 249754 gene locus_tag LOCUS_08560 250929 249754 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963083.1 protein_id gnl|my_center|LOCUS_08560 251120 254209 gene locus_tag LOCUS_08570 251120 254209 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963084.1 protein_id gnl|my_center|LOCUS_08570 254206 255444 gene locus_tag LOCUS_08580 254206 255444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963085.1 protein_id gnl|my_center|LOCUS_08580 255512 256981 gene locus_tag LOCUS_08590 255512 256981 CDS product glycosyl hydrolase family 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963086.1 protein_id gnl|my_center|LOCUS_08590 258186 256978 gene locus_tag LOCUS_08600 258186 256978 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963087.1 protein_id gnl|my_center|LOCUS_08600 259526 258270 gene locus_tag LOCUS_08610 259526 258270 CDS product sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963088.1 protein_id gnl|my_center|LOCUS_08610 259887 259585 gene locus_tag LOCUS_08620 259887 259585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 260238 259936 gene locus_tag LOCUS_08630 260238 259936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 260388 262460 gene locus_tag LOCUS_08640 260388 262460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963167.1 protein_id gnl|my_center|LOCUS_08640 263500 262790 gene locus_tag LOCUS_08650 263500 262790 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_08650 263830 263513 gene locus_tag LOCUS_08660 263830 263513 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963165.1 protein_id gnl|my_center|LOCUS_08660 265115 263817 gene locus_tag LOCUS_08670 265115 263817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 266401 265133 gene locus_tag LOCUS_08680 266401 265133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 267432 266404 gene locus_tag LOCUS_08690 267432 266404 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963164.1 protein_id gnl|my_center|LOCUS_08690 268565 267432 gene locus_tag LOCUS_08700 268565 267432 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963163.1 protein_id gnl|my_center|LOCUS_08700 271261 268562 gene locus_tag LOCUS_08710 271261 268562 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963162.1 protein_id gnl|my_center|LOCUS_08710 271807 271265 gene locus_tag LOCUS_08720 271807 271265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963161.1 protein_id gnl|my_center|LOCUS_08720 272222 271809 gene locus_tag LOCUS_08730 272222 271809 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_08730 272918 272547 gene locus_tag LOCUS_08740 272918 272547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_08740 274430 272964 gene locus_tag LOCUS_08750 gene gltD 274430 272964 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262575.1 protein_id gnl|my_center|LOCUS_08750 278949 274435 gene locus_tag LOCUS_08760 gene gltA 278949 274435 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_08760 279378 280427 gene locus_tag LOCUS_08770 279378 280427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 280446 280784 gene locus_tag LOCUS_08780 280446 280784 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_08780 280809 282050 gene locus_tag LOCUS_08790 280809 282050 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAC1 protein_id gnl|my_center|LOCUS_08790 282884 282105 gene locus_tag LOCUS_08800 282884 282105 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_08800 283954 282899 gene locus_tag LOCUS_08810 283954 282899 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_08810 284135 284674 gene locus_tag LOCUS_08820 284135 284674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 285070 284792 gene locus_tag LOCUS_08830 285070 284792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 285633 285076 gene locus_tag LOCUS_08840 gene ruvC 285633 285076 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_08840 285688 286635 gene locus_tag LOCUS_08850 285688 286635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962386.1 protein_id gnl|my_center|LOCUS_08850 286707 287732 gene locus_tag LOCUS_08860 286707 287732 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_08860 288220 287735 gene locus_tag LOCUS_08870 288220 287735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962388.1 protein_id gnl|my_center|LOCUS_08870 288797 288303 gene locus_tag LOCUS_08880 288797 288303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 290093 288984 gene locus_tag LOCUS_08890 290093 288984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 291398 290100 gene locus_tag LOCUS_08900 291398 290100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 291759 291391 gene locus_tag LOCUS_08910 291759 291391 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_08910 291874 292374 gene locus_tag LOCUS_08920 291874 292374 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962389.1 protein_id gnl|my_center|LOCUS_08920 292756 292376 gene locus_tag LOCUS_08930 292756 292376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 293117 293041 gene locus_tag LOCUS_t00070 293117 293041 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 293418 293344 gene locus_tag LOCUS_t00080 293418 293344 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 294436 293516 gene locus_tag LOCUS_08940 294436 293516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_08940 294844 294527 gene locus_tag LOCUS_08950 294844 294527 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_08950 295564 294980 gene locus_tag LOCUS_08960 295564 294980 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962861.1 protein_id gnl|my_center|LOCUS_08960 300148 295628 gene locus_tag LOCUS_08970 gene dnaE 300148 295628 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_08970 300991 300305 gene locus_tag LOCUS_08980 300991 300305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962514.1 protein_id gnl|my_center|LOCUS_08980 301162 301707 gene locus_tag LOCUS_08990 gene rpsP 301162 301707 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI4 protein_id gnl|my_center|LOCUS_08990 301724 302251 gene locus_tag LOCUS_09000 gene rimM 301724 302251 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_09000 302316 302975 gene locus_tag LOCUS_09010 302316 302975 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI6 protein_id gnl|my_center|LOCUS_09010 304324 302978 gene locus_tag LOCUS_09020 gene dgt 304324 302978 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_09020 304903 304373 gene locus_tag LOCUS_09030 304903 304373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 305138 304914 gene locus_tag LOCUS_09040 305138 304914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963201.1 protein_id gnl|my_center|LOCUS_09040 306112 305231 gene locus_tag LOCUS_09050 306112 305231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 308857 306464 gene locus_tag LOCUS_09060 gene nrdA 308857 306464 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_09060 310093 309110 gene locus_tag LOCUS_09070 gene nrdB 310093 309110 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_09070 310921 310355 gene locus_tag LOCUS_09080 310921 310355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_09080 311028 311615 gene locus_tag LOCUS_09090 311028 311615 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_09090 311628 311822 gene locus_tag LOCUS_09100 311628 311822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 311853 312461 gene locus_tag LOCUS_09110 311853 312461 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962631.1 protein_id gnl|my_center|LOCUS_09110 313094 312588 gene locus_tag LOCUS_09120 313094 312588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 313733 313110 gene locus_tag LOCUS_09130 313733 313110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 313815 314366 gene locus_tag LOCUS_09140 313815 314366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 314363 315094 gene locus_tag LOCUS_09150 314363 315094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 318207 315091 gene locus_tag LOCUS_09160 318207 315091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 319818 318247 gene locus_tag LOCUS_09170 319818 318247 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_09170 320248 319823 gene locus_tag LOCUS_09180 320248 319823 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_09180 320844 320257 gene locus_tag LOCUS_09190 320844 320257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_09190 321022 321453 gene locus_tag LOCUS_09200 321022 321453 CDS product fructose 1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962635.1 protein_id gnl|my_center|LOCUS_09200 321777 322331 gene locus_tag LOCUS_09210 321777 322331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 324545 322923 gene locus_tag LOCUS_09220 gene ade 324545 322923 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI0 protein_id gnl|my_center|LOCUS_09220 324700 326400 gene locus_tag LOCUS_09230 gene recJ 324700 326400 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_09230 326393 327661 gene locus_tag LOCUS_09240 326393 327661 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195122.1 protein_id gnl|my_center|LOCUS_09240 328410 327658 gene locus_tag LOCUS_09250 gene lpxH 328410 327658 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_09250 328584 334694 gene locus_tag LOCUS_09260 328584 334694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence04 944 471 gene locus_tag LOCUS_09270 944 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1153 959 gene locus_tag LOCUS_09280 1153 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1350 2285 gene locus_tag LOCUS_09290 gene cas1 1350 2285 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_09290 2300 2605 gene locus_tag LOCUS_09300 gene cas2 2300 2605 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 protein_id gnl|my_center|LOCUS_09300 2718 5446 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatatcgtgttttccaaactttaatcaaaccacaac 10201 5579 gene locus_tag LOCUS_09310 10201 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 11821 10394 gene locus_tag LOCUS_09320 11821 10394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 11948 11874 gene locus_tag LOCUS_t00090 11948 11874 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12114 12506 gene locus_tag LOCUS_09330 12114 12506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_09330 12564 13406 gene locus_tag LOCUS_09340 12564 13406 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_09340 13959 13399 gene locus_tag LOCUS_09350 13959 13399 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_09350 14352 14080 gene locus_tag LOCUS_09360 gene hupB 14352 14080 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_09360 15478 14531 gene locus_tag LOCUS_09370 gene fmt 15478 14531 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H148 protein_id gnl|my_center|LOCUS_09370 17361 15478 gene locus_tag LOCUS_09380 gene recQ2 17361 15478 CDS product ATP-dependent DNA helicase RecQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 protein_id gnl|my_center|LOCUS_09380 17989 17399 gene locus_tag LOCUS_09390 17989 17399 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_09390 18062 18349 gene locus_tag LOCUS_09400 18062 18349 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_09400 18352 19050 gene locus_tag LOCUS_09410 18352 19050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_09410 19056 20366 gene locus_tag LOCUS_09420 gene murA 19056 20366 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 protein_id gnl|my_center|LOCUS_09420 22920 20458 gene locus_tag LOCUS_09430 22920 20458 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_09430 23387 22977 gene locus_tag LOCUS_09440 gene aroQ 23387 22977 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_09440 23823 24332 gene locus_tag LOCUS_09450 23823 24332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 24493 25209 gene locus_tag LOCUS_09460 24493 25209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_09460 25324 25908 gene locus_tag LOCUS_09470 25324 25908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 25979 26878 gene locus_tag LOCUS_09480 gene xerD 25979 26878 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_09480 27508 26924 gene locus_tag LOCUS_09490 27508 26924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964350.1 protein_id gnl|my_center|LOCUS_09490 29205 27643 gene locus_tag LOCUS_09500 gene rny 29205 27643 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 protein_id gnl|my_center|LOCUS_09500 29709 29416 gene locus_tag LOCUS_09510 29709 29416 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 protein_id gnl|my_center|LOCUS_09510 30005 29715 gene locus_tag LOCUS_09520 30005 29715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963282.1 protein_id gnl|my_center|LOCUS_09520 30199 31884 gene locus_tag LOCUS_09530 30199 31884 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_09530 31896 34358 gene locus_tag LOCUS_09540 31896 34358 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_09540 34407 35126 gene locus_tag LOCUS_09550 34407 35126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963279.1 protein_id gnl|my_center|LOCUS_09550 35344 36582 gene locus_tag LOCUS_09560 35344 36582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 37289 36588 gene locus_tag LOCUS_09570 37289 36588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963278.1 protein_id gnl|my_center|LOCUS_09570 37800 37345 gene locus_tag LOCUS_09580 37800 37345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_09580 39656 37809 gene locus_tag LOCUS_09590 gene msbA 39656 37809 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_09590 41383 39656 gene locus_tag LOCUS_09600 41383 39656 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 protein_id gnl|my_center|LOCUS_09600 42432 41476 gene locus_tag LOCUS_09610 42432 41476 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_09610 42963 42433 gene locus_tag LOCUS_09620 42963 42433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963274.1 protein_id gnl|my_center|LOCUS_09620 43197 43451 gene locus_tag LOCUS_09630 gene rpmE 43197 43451 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_09630 43567 44742 gene locus_tag LOCUS_09640 43567 44742 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_09640 44745 45083 gene locus_tag LOCUS_09650 44745 45083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 45395 45102 gene locus_tag LOCUS_09660 45395 45102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 45687 45415 gene locus_tag LOCUS_09670 45687 45415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 46364 45855 gene locus_tag LOCUS_09680 46364 45855 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119906.1 protein_id gnl|my_center|LOCUS_09680 46518 47846 gene locus_tag LOCUS_09690 46518 47846 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_09690 48386 47895 gene locus_tag LOCUS_09700 48386 47895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 48619 48951 gene locus_tag LOCUS_09710 48619 48951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 49660 48986 gene locus_tag LOCUS_09720 49660 48986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 49951 51372 gene locus_tag LOCUS_09730 gene rtcB 49951 51372 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SR8 protein_id gnl|my_center|LOCUS_09730 51402 52154 gene locus_tag LOCUS_09740 51402 52154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208285.1 protein_id gnl|my_center|LOCUS_09740 52156 53214 gene locus_tag LOCUS_09750 52156 53214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 54195 54428 gene locus_tag LOCUS_09760 54195 54428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 55193 55280 gene locus_tag LOCUS_t00100 55193 55280 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 55283 55357 gene locus_tag LOCUS_t00110 55283 55357 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 55599 55673 gene locus_tag LOCUS_t00120 55599 55673 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 55678 55752 gene locus_tag LOCUS_t00130 55678 55752 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 55785 56102 gene locus_tag LOCUS_09770 55785 56102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 56173 56577 gene locus_tag LOCUS_09780 56173 56577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 56747 56839 gene locus_tag LOCUS_t00140 56747 56839 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 57189 58286 gene locus_tag LOCUS_09790 57189 58286 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966652.1 protein_id gnl|my_center|LOCUS_09790 58819 58322 gene locus_tag LOCUS_09800 58819 58322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 59498 59052 gene locus_tag LOCUS_09810 59498 59052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 59958 59884 gene locus_tag LOCUS_t00150 59958 59884 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 62521 60266 gene locus_tag LOCUS_09820 62521 60266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 62882 62523 gene locus_tag LOCUS_09830 62882 62523 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_09830 64187 62952 gene locus_tag LOCUS_09840 64187 62952 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_09840 64271 64864 gene locus_tag LOCUS_09850 64271 64864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_09850 64864 65517 gene locus_tag LOCUS_09860 64864 65517 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_09860 65552 66268 gene locus_tag LOCUS_09870 65552 66268 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963855.1 protein_id gnl|my_center|LOCUS_09870 66658 66335 gene locus_tag LOCUS_09880 66658 66335 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY02 protein_id gnl|my_center|LOCUS_09880 66796 68856 gene locus_tag LOCUS_09890 gene ptrB 66796 68856 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_09890 68935 69975 gene locus_tag LOCUS_09900 68935 69975 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963027.1 protein_id gnl|my_center|LOCUS_09900 73226 70047 gene locus_tag LOCUS_09910 gene ccsBA 73226 70047 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_09910 74091 73363 gene locus_tag LOCUS_09920 gene birA 74091 73363 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_09920 74186 74554 gene locus_tag LOCUS_09930 gene rsfS 74186 74554 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_09930 74561 76474 gene locus_tag LOCUS_09940 gene ftsH 74561 76474 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_09940 76590 77195 gene locus_tag LOCUS_09950 76590 77195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_09950 77197 78009 gene locus_tag LOCUS_09960 gene cdsA 77197 78009 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 protein_id gnl|my_center|LOCUS_09960 77999 78646 gene locus_tag LOCUS_09970 gene psd 77999 78646 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_09970 78647 78925 gene locus_tag LOCUS_09980 78647 78925 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962768.1 protein_id gnl|my_center|LOCUS_09980 78922 79794 gene locus_tag LOCUS_09990 78922 79794 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962769.1 protein_id gnl|my_center|LOCUS_09990 81132 79852 gene locus_tag LOCUS_10000 gene rocD 81132 79852 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_10000 81725 81315 gene locus_tag LOCUS_10010 gene osmC 81725 81315 CDS product osmotically inducible protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338337.1 protein_id gnl|my_center|LOCUS_10010 82325 81834 gene locus_tag LOCUS_10020 82325 81834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_10020 83080 82619 gene locus_tag LOCUS_10030 83080 82619 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_10030 84675 83782 gene locus_tag LOCUS_10040 84675 83782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963669.1 protein_id gnl|my_center|LOCUS_10040 86915 84678 gene locus_tag LOCUS_10050 86915 84678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963644.1 protein_id gnl|my_center|LOCUS_10050 87398 86988 gene locus_tag LOCUS_10060 87398 86988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 87591 89003 gene locus_tag LOCUS_10070 gene trmA 87591 89003 CDS product tRNA (uracil-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_10070 89041 89556 gene locus_tag LOCUS_10080 89041 89556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 protein_id gnl|my_center|LOCUS_10080 89537 90253 gene locus_tag LOCUS_10090 89537 90253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_10090 90246 90758 gene locus_tag LOCUS_10100 90246 90758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 91499 90918 gene locus_tag LOCUS_10110 91499 90918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 91834 91472 gene locus_tag LOCUS_10120 91834 91472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 91924 92316 gene locus_tag LOCUS_10130 91924 92316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 92334 93176 gene locus_tag LOCUS_10140 92334 93176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_10140 93624 93226 gene locus_tag LOCUS_10150 93624 93226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962736.1 protein_id gnl|my_center|LOCUS_10150 94132 93626 gene locus_tag LOCUS_10160 94132 93626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 97633 94277 gene locus_tag LOCUS_10170 gene secA 97633 94277 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_10170 97948 97727 gene locus_tag LOCUS_10180 97948 97727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_10180 98718 98149 gene locus_tag LOCUS_10190 98718 98149 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_10190 99772 98912 gene locus_tag LOCUS_10200 99772 98912 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_10200 100117 99947 gene locus_tag LOCUS_10210 100117 99947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 100817 100104 gene locus_tag LOCUS_10220 100817 100104 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_10220 101661 100903 gene locus_tag LOCUS_10230 101661 100903 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_10230 102177 101836 gene locus_tag LOCUS_10240 102177 101836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962747.1 protein_id gnl|my_center|LOCUS_10240 102310 102684 gene locus_tag LOCUS_10250 102310 102684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962748.1 protein_id gnl|my_center|LOCUS_10250 104625 102760 gene locus_tag LOCUS_10260 104625 102760 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_10260 104761 105330 gene locus_tag LOCUS_10270 104761 105330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 107229 105379 gene locus_tag LOCUS_10280 gene gaa 107229 105379 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_10280 107342 108469 gene locus_tag LOCUS_10290 107342 108469 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962750.1 protein_id gnl|my_center|LOCUS_10290 108554 109876 gene locus_tag LOCUS_10300 gene bfmBB 108554 109876 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_10300 109977 110747 gene locus_tag LOCUS_10310 109977 110747 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_10310 110824 111435 gene locus_tag LOCUS_10320 110824 111435 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_10320 111442 111786 gene locus_tag LOCUS_10330 111442 111786 CDS product phosphotransfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361989.1 protein_id gnl|my_center|LOCUS_10330 111799 113046 gene locus_tag LOCUS_10340 111799 113046 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 protein_id gnl|my_center|LOCUS_10340 113126 113362 gene locus_tag LOCUS_10350 gene rpmB 113126 113362 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_10350 113395 113577 gene locus_tag LOCUS_10360 gene rpmG 113395 113577 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_10360 113586 113738 gene locus_tag LOCUS_10370 113586 113738 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_10370 113828 114781 gene locus_tag LOCUS_10380 gene ftsY 113828 114781 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 protein_id gnl|my_center|LOCUS_10380 114976 115701 gene locus_tag LOCUS_10390 114976 115701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 117064 115703 gene locus_tag LOCUS_10400 117064 115703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 117155 117589 gene locus_tag LOCUS_10410 117155 117589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 117573 117869 gene locus_tag LOCUS_10420 117573 117869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_10420 119393 117945 gene locus_tag LOCUS_10430 gene gapA2 119393 117945 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX7 protein_id gnl|my_center|LOCUS_10430 119554 120189 gene locus_tag LOCUS_10440 119554 120189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 121627 120245 gene locus_tag LOCUS_10450 gene degP/Q 121627 120245 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_10450 121828 122610 gene locus_tag LOCUS_10460 gene dapF 121828 122610 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_10460 122702 123235 gene locus_tag LOCUS_10470 122702 123235 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_10470 123300 124280 gene locus_tag LOCUS_10480 gene pabC 123300 124280 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_10480 124452 125336 gene locus_tag LOCUS_10490 124452 125336 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_10490 125407 126087 gene locus_tag LOCUS_10500 125407 126087 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963343.1 protein_id gnl|my_center|LOCUS_10500 126819 126088 gene locus_tag LOCUS_10510 126819 126088 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_10510 127277 126819 gene locus_tag LOCUS_10520 127277 126819 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 protein_id gnl|my_center|LOCUS_10520 128708 127281 gene locus_tag LOCUS_10530 gene dnaA 128708 127281 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_10530 128879 129310 gene locus_tag LOCUS_10540 128879 129310 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_10540 129945 129325 gene locus_tag LOCUS_10550 129945 129325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_10550 130804 129947 gene locus_tag LOCUS_10560 130804 129947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44170 protein_id gnl|my_center|LOCUS_10560 131409 130804 gene locus_tag LOCUS_10570 131409 130804 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_10570 132463 131402 gene locus_tag LOCUS_10580 gene ribD 132463 131402 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_10580 132546 133022 gene locus_tag LOCUS_10590 gene yjgM 132546 133022 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_10590 133046 133906 gene locus_tag LOCUS_10600 gene prmC 133046 133906 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_10600 135163 133922 gene locus_tag LOCUS_10610 135163 133922 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_10610 135371 136807 gene locus_tag LOCUS_10620 gene hisS 135371 136807 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H160 protein_id gnl|my_center|LOCUS_10620 136897 137844 gene locus_tag LOCUS_10630 gene trxB1 136897 137844 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_10630 138747 137914 gene locus_tag LOCUS_10640 138747 137914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962838.1 protein_id gnl|my_center|LOCUS_10640 139620 138880 gene locus_tag LOCUS_10650 139620 138880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 141349 139652 gene locus_tag LOCUS_10660 141349 139652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_10660 141690 141355 gene locus_tag LOCUS_10670 141690 141355 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_10670 142240 141785 gene locus_tag LOCUS_10680 142240 141785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962834.1 protein_id gnl|my_center|LOCUS_10680 142427 142882 gene locus_tag LOCUS_10690 142427 142882 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_10690 142964 143869 gene locus_tag LOCUS_10700 142964 143869 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_10700 144590 143919 gene locus_tag LOCUS_10710 144590 143919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 144772 145311 gene locus_tag LOCUS_10720 gene grpE 144772 145311 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_10720 145358 146473 gene locus_tag LOCUS_10730 gene dnaJ 145358 146473 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_10730 146991 147911 gene locus_tag LOCUS_10740 gene natA 146991 147911 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_10740 147946 149259 gene locus_tag LOCUS_10750 gene natB 147946 149259 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_10750 149262 150089 gene locus_tag LOCUS_10760 149262 150089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 150308 151471 gene locus_tag LOCUS_10770 150308 151471 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_10770 151549 152163 gene locus_tag LOCUS_10780 151549 152163 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962826.1 protein_id gnl|my_center|LOCUS_10780 152193 152411 gene locus_tag LOCUS_10790 152193 152411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962825.1 protein_id gnl|my_center|LOCUS_10790 153129 152464 gene locus_tag LOCUS_10800 153129 152464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 153515 155149 gene locus_tag LOCUS_10810 153515 155149 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962719.1 protein_id gnl|my_center|LOCUS_10810 155182 155460 gene locus_tag LOCUS_10820 155182 155460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 155545 157191 gene locus_tag LOCUS_10830 gene gatA 155545 157191 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759455.1 protein_id gnl|my_center|LOCUS_10830 157905 157246 gene locus_tag LOCUS_10840 157905 157246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 158342 157995 gene locus_tag LOCUS_10850 158342 157995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 158713 158408 gene locus_tag LOCUS_10860 158713 158408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 161398 158735 gene locus_tag LOCUS_10870 161398 158735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 161934 161401 gene locus_tag LOCUS_10880 161934 161401 CDS product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361994.1 protein_id gnl|my_center|LOCUS_10880 162140 163021 gene locus_tag LOCUS_10890 162140 163021 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962727.1 protein_id gnl|my_center|LOCUS_10890 163310 164683 gene locus_tag LOCUS_10900 gene norM 163310 164683 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_10900 164680 165588 gene locus_tag LOCUS_10910 164680 165588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_10910 165597 165824 gene locus_tag LOCUS_10920 165597 165824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_10920 167226 166048 gene locus_tag LOCUS_10930 gene argK 167226 166048 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962733.1 protein_id gnl|my_center|LOCUS_10930 167235 168146 gene locus_tag LOCUS_10940 167235 168146 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932156.1 protein_id gnl|my_center|LOCUS_10940 168170 169573 gene locus_tag LOCUS_10950 gene glcD 168170 169573 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 protein_id gnl|my_center|LOCUS_10950 170071 169652 gene locus_tag LOCUS_10960 gene ndk 170071 169652 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_10960 170284 170835 gene locus_tag LOCUS_10970 170284 170835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964064.1 protein_id gnl|my_center|LOCUS_10970 171891 170896 gene locus_tag LOCUS_10980 171891 170896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964316.1 protein_id gnl|my_center|LOCUS_10980 172842 172177 gene locus_tag LOCUS_10990 172842 172177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10990 174233 172878 gene locus_tag LOCUS_11000 174233 172878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 175909 174374 gene locus_tag LOCUS_11010 gene bshC 175909 174374 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_11010 176391 177143 gene locus_tag LOCUS_11020 176391 177143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 177147 178538 gene locus_tag LOCUS_11030 gene rtcB 177147 178538 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7R9 protein_id gnl|my_center|LOCUS_11030 178764 179450 gene locus_tag LOCUS_11040 178764 179450 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788396.1 protein_id gnl|my_center|LOCUS_11040 179483 180022 gene locus_tag LOCUS_11050 179483 180022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 180285 180680 gene locus_tag LOCUS_11060 180285 180680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 184776 180730 gene locus_tag LOCUS_11070 184776 180730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 185175 185519 gene locus_tag LOCUS_11080 185175 185519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 185543 187738 gene locus_tag LOCUS_11090 185543 187738 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_11090 187824 189932 gene locus_tag LOCUS_11100 187824 189932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 190065 191021 gene locus_tag LOCUS_11110 190065 191021 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_11110 191109 192209 gene locus_tag LOCUS_11120 191109 192209 CDS product peptidoglycan endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963350.1 protein_id gnl|my_center|LOCUS_11120 192467 193579 gene locus_tag LOCUS_11130 192467 193579 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_11130 193743 194123 gene locus_tag LOCUS_11140 193743 194123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_11140 194151 194357 gene locus_tag LOCUS_11150 194151 194357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 194364 194945 gene locus_tag LOCUS_11160 194364 194945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 195205 195843 gene locus_tag LOCUS_11170 195205 195843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 195970 196443 gene locus_tag LOCUS_11180 195970 196443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 197223 196993 gene locus_tag LOCUS_11190 197223 196993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 197330 197611 gene locus_tag LOCUS_11200 197330 197611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 197716 199026 gene locus_tag LOCUS_11210 197716 199026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_11210 199051 199443 gene locus_tag LOCUS_11220 199051 199443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 200475 199444 gene locus_tag LOCUS_11230 200475 199444 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_11230 200973 200737 gene locus_tag LOCUS_11240 200973 200737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 202077 201088 gene locus_tag LOCUS_11250 202077 201088 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_11250 203151 202192 gene locus_tag LOCUS_11260 203151 202192 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E005 protein_id gnl|my_center|LOCUS_11260 203992 203156 gene locus_tag LOCUS_11270 203992 203156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057947.1 protein_id gnl|my_center|LOCUS_11270 204381 205307 gene locus_tag LOCUS_11280 204381 205307 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_11280 205835 205308 gene locus_tag LOCUS_11290 205835 205308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 207183 205867 gene locus_tag LOCUS_11300 gene rimO 207183 205867 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_11300 208912 207428 gene locus_tag LOCUS_11310 208912 207428 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_11310 209934 208969 gene locus_tag LOCUS_11320 209934 208969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 210033 211511 gene locus_tag LOCUS_11330 gene proS 210033 211511 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_11330 211593 211665 gene locus_tag LOCUS_t00160 211593 211665 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 211677 211749 gene locus_tag LOCUS_t00170 211677 211749 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 211907 212158 gene locus_tag LOCUS_11340 gene rpsT 211907 212158 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_11340 212308 214104 gene locus_tag LOCUS_11350 gene typA 212308 214104 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_11350 214164 214595 gene locus_tag LOCUS_11360 214164 214595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362012.1 protein_id gnl|my_center|LOCUS_11360 215635 214649 gene locus_tag LOCUS_11370 215635 214649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 217510 215687 gene locus_tag LOCUS_11380 217510 215687 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963883.1 protein_id gnl|my_center|LOCUS_11380 218143 217559 gene locus_tag LOCUS_11390 218143 217559 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_11390 218267 219655 gene locus_tag LOCUS_11400 218267 219655 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_11400 219940 220938 gene locus_tag LOCUS_11410 219940 220938 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_11410 220940 221527 gene locus_tag LOCUS_11420 gene coaE 220940 221527 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_11420 221635 223182 gene locus_tag LOCUS_11430 gene rprX 221635 223182 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_11430 223189 223887 gene locus_tag LOCUS_11440 gene rprY 223189 223887 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_11440 224328 223948 gene locus_tag LOCUS_11450 224328 223948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 224549 224325 gene locus_tag LOCUS_11460 224549 224325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 225516 224779 gene locus_tag LOCUS_11470 225516 224779 CDS product acyl-ACP thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_11470 226436 225516 gene locus_tag LOCUS_11480 gene miaA 226436 225516 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V8 protein_id gnl|my_center|LOCUS_11480 227430 226588 gene locus_tag LOCUS_11490 227430 226588 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_11490 228808 227447 gene locus_tag LOCUS_11500 228808 227447 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_11500 229564 228890 gene locus_tag LOCUS_11510 229564 228890 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_11510 230624 229566 gene locus_tag LOCUS_11520 230624 229566 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085147.1 protein_id gnl|my_center|LOCUS_11520 231853 230624 gene locus_tag LOCUS_11530 231853 230624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964016.1 protein_id gnl|my_center|LOCUS_11530 232808 231918 gene locus_tag LOCUS_11540 232808 231918 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_11540 233203 232805 gene locus_tag LOCUS_11550 233203 232805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 234201 233200 gene locus_tag LOCUS_11560 234201 233200 CDS product DUF1016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_11560 235170 234202 gene locus_tag LOCUS_11570 235170 234202 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_11570 235254 235955 gene locus_tag LOCUS_11580 gene pcm 235254 235955 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_11580 236404 235952 gene locus_tag LOCUS_11590 gene smpB 236404 235952 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 protein_id gnl|my_center|LOCUS_11590 236619 238094 gene locus_tag LOCUS_11600 236619 238094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 238274 239692 gene locus_tag LOCUS_11610 238274 239692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 239692 241008 gene locus_tag LOCUS_11620 239692 241008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 241137 241418 gene locus_tag LOCUS_11630 241137 241418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963991.1 protein_id gnl|my_center|LOCUS_11630 242298 241453 gene locus_tag LOCUS_11640 242298 241453 CDS product LACX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562113.1 protein_id gnl|my_center|LOCUS_11640 243829 242300 gene locus_tag LOCUS_11650 243829 242300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 244985 243843 gene locus_tag LOCUS_11660 244985 243843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 245549 244989 gene locus_tag LOCUS_11670 245549 244989 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963990.1 protein_id gnl|my_center|LOCUS_11670 246024 245551 gene locus_tag LOCUS_11680 gene yjdF 246024 245551 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_11680 246656 246276 gene locus_tag LOCUS_11690 246656 246276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 248801 246912 gene locus_tag LOCUS_11700 248801 246912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963876.1 protein_id gnl|my_center|LOCUS_11700 249569 249015 gene locus_tag LOCUS_11710 249569 249015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 250397 249636 gene locus_tag LOCUS_11720 gene aroE 250397 249636 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_11720 251372 250404 gene locus_tag LOCUS_11730 251372 250404 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 protein_id gnl|my_center|LOCUS_11730 252838 251444 gene locus_tag LOCUS_11740 252838 251444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_11740 254205 253006 gene locus_tag LOCUS_11750 gene argD 254205 253006 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_11750 255193 254195 gene locus_tag LOCUS_11760 255193 254195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963136.1 protein_id gnl|my_center|LOCUS_11760 256937 255231 gene locus_tag LOCUS_11770 256937 255231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_11770 257541 257011 gene locus_tag LOCUS_11780 257541 257011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 258943 257672 gene locus_tag LOCUS_11790 gene purA 258943 257672 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_11790 259435 258983 gene locus_tag LOCUS_11800 gene fur 259435 258983 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_11800 261763 259544 gene locus_tag LOCUS_11810 gene relA 261763 259544 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_11810 262740 261949 gene locus_tag LOCUS_11820 262740 261949 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_11820 264163 262868 gene locus_tag LOCUS_11830 264163 262868 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 protein_id gnl|my_center|LOCUS_11830 267214 264182 gene locus_tag LOCUS_11840 267214 264182 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_11840 268608 267523 gene locus_tag LOCUS_11850 268608 267523 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_11850 269784 268699 gene locus_tag LOCUS_11860 gene gfo 269784 268699 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036051.1 protein_id gnl|my_center|LOCUS_11860 270909 270172 gene locus_tag LOCUS_11870 270909 270172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963980.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence05 1639 761 gene locus_tag LOCUS_11880 1639 761 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_11880 2272 1655 gene locus_tag LOCUS_11890 2272 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964037.1 protein_id gnl|my_center|LOCUS_11890 2770 2276 gene locus_tag LOCUS_11900 2770 2276 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_11900 3067 4371 gene locus_tag LOCUS_11910 gene ndh 3067 4371 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_11910 4375 5484 gene locus_tag LOCUS_11920 4375 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 5530 6495 gene locus_tag LOCUS_11930 5530 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 7503 6505 gene locus_tag LOCUS_11940 7503 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_11940 7641 7853 gene locus_tag LOCUS_11950 7641 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 7850 8143 gene locus_tag LOCUS_11960 7850 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 8188 9654 gene locus_tag LOCUS_11970 gene pepD 8188 9654 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964033.1 protein_id gnl|my_center|LOCUS_11970 9880 10152 gene locus_tag LOCUS_11980 9880 10152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 11051 10281 gene locus_tag LOCUS_11990 11051 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 11180 12211 gene locus_tag LOCUS_12000 11180 12211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_12000 12171 14450 gene locus_tag LOCUS_12010 12171 14450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 14985 14527 gene locus_tag LOCUS_12020 14985 14527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 16215 15307 gene locus_tag LOCUS_12030 16215 15307 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108261.1 protein_id gnl|my_center|LOCUS_12030 17009 16212 gene locus_tag LOCUS_12040 17009 16212 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_12040 17620 17087 gene locus_tag LOCUS_12050 17620 17087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964027.1 protein_id gnl|my_center|LOCUS_12050 18740 17628 gene locus_tag LOCUS_12060 18740 17628 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_12060 20963 18807 gene locus_tag LOCUS_12070 20963 18807 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_12070 21711 21163 gene locus_tag LOCUS_12080 21711 21163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964027.1 protein_id gnl|my_center|LOCUS_12080 21901 22974 gene locus_tag LOCUS_12090 gene prfA 21901 22974 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_12090 23048 24367 gene locus_tag LOCUS_12100 23048 24367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 25155 24490 gene locus_tag LOCUS_12110 25155 24490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 25631 25266 gene locus_tag LOCUS_12120 25631 25266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 25986 25633 gene locus_tag LOCUS_12130 25986 25633 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964582.1 protein_id gnl|my_center|LOCUS_12130 26276 25992 gene locus_tag LOCUS_12140 26276 25992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 26461 26309 gene locus_tag LOCUS_12150 26461 26309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 27129 26482 gene locus_tag LOCUS_12160 27129 26482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402867.1 protein_id gnl|my_center|LOCUS_12160 27744 27253 gene locus_tag LOCUS_12170 27744 27253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 29024 28095 gene locus_tag LOCUS_12180 29024 28095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 31247 29037 gene locus_tag LOCUS_12190 31247 29037 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943441.1 protein_id gnl|my_center|LOCUS_12190 31798 31352 gene locus_tag LOCUS_12200 31798 31352 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_12200 32368 31805 gene locus_tag LOCUS_12210 32368 31805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 33167 32442 gene locus_tag LOCUS_12220 33167 32442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 33909 33178 gene locus_tag LOCUS_12230 33909 33178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_12230 34715 33906 gene locus_tag LOCUS_12240 34715 33906 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938542.1 protein_id gnl|my_center|LOCUS_12240 37140 34852 gene locus_tag LOCUS_12250 37140 34852 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_12250 42029 37143 gene locus_tag LOCUS_12260 42029 37143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 42963 42121 gene locus_tag LOCUS_12270 42963 42121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 43348 42971 gene locus_tag LOCUS_12280 43348 42971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 44484 43360 gene locus_tag LOCUS_12290 44484 43360 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723610.1 protein_id gnl|my_center|LOCUS_12290 44760 44575 gene locus_tag LOCUS_12300 44760 44575 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388930.1 protein_id gnl|my_center|LOCUS_12300 45300 44821 gene locus_tag LOCUS_12310 45300 44821 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_12310 45581 46609 gene locus_tag LOCUS_12320 45581 46609 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_12320 46609 48210 gene locus_tag LOCUS_12330 gene lig2 46609 48210 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_12330 48364 50826 gene locus_tag LOCUS_12340 48364 50826 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_12340 50844 51479 gene locus_tag LOCUS_12350 50844 51479 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 protein_id gnl|my_center|LOCUS_12350 51589 52167 gene locus_tag LOCUS_12360 51589 52167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 52256 52723 gene locus_tag LOCUS_12370 52256 52723 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_12370 52927 52685 gene locus_tag LOCUS_12380 52927 52685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 53057 53884 gene locus_tag LOCUS_12390 gene pyrF 53057 53884 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_12390 53924 54724 gene locus_tag LOCUS_12400 53924 54724 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_12400 54792 55604 gene locus_tag LOCUS_12410 54792 55604 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 protein_id gnl|my_center|LOCUS_12410 56475 55765 gene locus_tag LOCUS_12420 56475 55765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_12420 56604 60029 gene locus_tag LOCUS_12430 gene icmF 56604 60029 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_12430 60049 60312 gene locus_tag LOCUS_12440 60049 60312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 61272 60727 gene locus_tag LOCUS_12450 gene pfpI 61272 60727 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090767.1 protein_id gnl|my_center|LOCUS_12450 61757 65107 gene locus_tag LOCUS_12460 61757 65107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 67411 65213 gene locus_tag LOCUS_12470 67411 65213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 67765 67550 gene locus_tag LOCUS_12480 67765 67550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 67997 69790 gene locus_tag LOCUS_12490 67997 69790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 69874 70398 gene locus_tag LOCUS_12500 69874 70398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 70468 70707 gene locus_tag LOCUS_12510 70468 70707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 71292 70726 gene locus_tag LOCUS_12520 71292 70726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 73289 71337 gene locus_tag LOCUS_12530 73289 71337 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_12530 74240 73302 gene locus_tag LOCUS_12540 gene porP 74240 73302 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_12540 76995 74245 gene locus_tag LOCUS_12550 76995 74245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 77252 79441 gene locus_tag LOCUS_12560 gene glnA 77252 79441 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_12560 79451 79900 gene locus_tag LOCUS_12570 79451 79900 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_12570 80029 80841 gene locus_tag LOCUS_12580 80029 80841 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962709.1 protein_id gnl|my_center|LOCUS_12580 80844 81293 gene locus_tag LOCUS_12590 80844 81293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 81371 82549 gene locus_tag LOCUS_12600 gene purM 81371 82549 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_12600 82554 83330 gene locus_tag LOCUS_12610 82554 83330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 83473 85005 gene locus_tag LOCUS_12620 gene guaA 83473 85005 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_12620 85115 86815 gene locus_tag LOCUS_12630 85115 86815 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963999.1 protein_id gnl|my_center|LOCUS_12630 86957 88819 gene locus_tag LOCUS_12640 86957 88819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 protein_id gnl|my_center|LOCUS_12640 88806 89210 gene locus_tag LOCUS_12650 gene osmC 88806 89210 CDS product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_12650 89511 90260 gene locus_tag LOCUS_12660 89511 90260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 90362 90547 gene locus_tag LOCUS_12670 90362 90547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 protein_id gnl|my_center|LOCUS_12670 90971 90591 gene locus_tag LOCUS_12680 90971 90591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 91270 92883 gene locus_tag LOCUS_12690 gene pyrG 91270 92883 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_12690 93059 94942 gene locus_tag LOCUS_12700 gene yidC 93059 94942 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U2 protein_id gnl|my_center|LOCUS_12700 95116 95925 gene locus_tag LOCUS_12710 gene proC 95116 95925 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFV0 protein_id gnl|my_center|LOCUS_12710 97012 96017 gene locus_tag LOCUS_12720 97012 96017 CDS product beta-Ig-H3/fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405131.1 protein_id gnl|my_center|LOCUS_12720 97255 97935 gene locus_tag LOCUS_12730 97255 97935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 97946 99133 gene locus_tag LOCUS_12740 gene mnmA 97946 99133 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_12740 99142 100077 gene locus_tag LOCUS_12750 gene yrbG 99142 100077 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_12750 100124 101734 gene locus_tag LOCUS_12760 100124 101734 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_12760 101734 102678 gene locus_tag LOCUS_12770 101734 102678 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_12770 102738 103148 gene locus_tag LOCUS_12780 102738 103148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 103205 104809 gene locus_tag LOCUS_12790 gene pafA 103205 104809 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_12790 105214 106365 gene locus_tag LOCUS_12800 105214 106365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 107684 106455 gene locus_tag LOCUS_12810 gene lysA-2 107684 106455 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728N7 protein_id gnl|my_center|LOCUS_12810 107904 109097 gene locus_tag LOCUS_12820 gene sucC 107904 109097 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_12820 109765 109385 gene locus_tag LOCUS_12830 gene yjgF 109765 109385 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_12830 112552 109793 gene locus_tag LOCUS_12840 112552 109793 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_12840 112650 113747 gene locus_tag LOCUS_12850 112650 113747 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_12850 113782 114747 gene locus_tag LOCUS_12860 113782 114747 CDS product organic solvent ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_12860 114753 116084 gene locus_tag LOCUS_12870 114753 116084 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_12870 116180 116974 gene locus_tag LOCUS_12880 116180 116974 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_12880 116976 117566 gene locus_tag LOCUS_12890 116976 117566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 117566 118048 gene locus_tag LOCUS_12900 117566 118048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_12900 118066 119286 gene locus_tag LOCUS_12910 118066 119286 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765689.1 protein_id gnl|my_center|LOCUS_12910 119395 122277 gene locus_tag LOCUS_12920 119395 122277 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_12920 122280 122735 gene locus_tag LOCUS_12930 122280 122735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_12930 122801 123937 gene locus_tag LOCUS_12940 122801 123937 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_12940 123934 124407 gene locus_tag LOCUS_12950 123934 124407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 124954 124454 gene locus_tag LOCUS_12960 124954 124454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 125801 125055 gene locus_tag LOCUS_12970 125801 125055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 126196 127266 gene locus_tag LOCUS_12980 gene aroC 126196 127266 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_12980 127404 128912 gene locus_tag LOCUS_12990 127404 128912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 129408 128977 gene locus_tag LOCUS_13000 gene yuxK 129408 128977 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_13000 131613 129445 gene locus_tag LOCUS_13010 131613 129445 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG0 protein_id gnl|my_center|LOCUS_13010 131703 132359 gene locus_tag LOCUS_13020 gene ung 131703 132359 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYF9 protein_id gnl|my_center|LOCUS_13020 133293 132361 gene locus_tag LOCUS_13030 133293 132361 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963182.1 protein_id gnl|my_center|LOCUS_13030 134167 133322 gene locus_tag LOCUS_13040 134167 133322 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_13040 135283 134177 gene locus_tag LOCUS_13050 135283 134177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 135823 135305 gene locus_tag LOCUS_13060 135823 135305 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963178.1 protein_id gnl|my_center|LOCUS_13060 136774 135908 gene locus_tag LOCUS_13070 gene udp 136774 135908 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_13070 137194 136862 gene locus_tag LOCUS_13080 137194 136862 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963176.1 protein_id gnl|my_center|LOCUS_13080 138811 137858 gene locus_tag LOCUS_13090 138811 137858 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_13090 139009 140985 gene locus_tag LOCUS_13100 gene bfmBA 139009 140985 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_13100 141892 141188 gene locus_tag LOCUS_13110 141892 141188 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_13110 142798 141980 gene locus_tag LOCUS_13120 gene panB 142798 141980 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_13120 142893 144512 gene locus_tag LOCUS_13130 142893 144512 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192092.1 protein_id gnl|my_center|LOCUS_13130 144604 145245 gene locus_tag LOCUS_13140 144604 145245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 145260 145700 gene locus_tag LOCUS_13150 145260 145700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 146875 145697 gene locus_tag LOCUS_13160 146875 145697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 148298 146877 gene locus_tag LOCUS_13170 gene sdaA 148298 146877 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_13170 148564 149466 gene locus_tag LOCUS_13180 148564 149466 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962670.1 protein_id gnl|my_center|LOCUS_13180 149663 151552 gene locus_tag LOCUS_13190 gene dnaK 149663 151552 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_13190 151609 152199 gene locus_tag LOCUS_13200 151609 152199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 154827 152290 gene locus_tag LOCUS_13210 154827 152290 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_13210 155182 155811 gene locus_tag LOCUS_13220 155182 155811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963723.1 protein_id gnl|my_center|LOCUS_13220 155887 156837 gene locus_tag LOCUS_13230 155887 156837 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939052.1 protein_id gnl|my_center|LOCUS_13230 156843 157355 gene locus_tag LOCUS_13240 156843 157355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810105.1 protein_id gnl|my_center|LOCUS_13240 157534 157352 gene locus_tag LOCUS_13250 157534 157352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 157984 157691 gene locus_tag LOCUS_13260 157984 157691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 159119 158046 gene locus_tag LOCUS_13270 159119 158046 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_13270 159397 160395 gene locus_tag LOCUS_13280 gene ykfB 159397 160395 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121963.1 protein_id gnl|my_center|LOCUS_13280 160445 161248 gene locus_tag LOCUS_13290 160445 161248 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_13290 161328 161984 gene locus_tag LOCUS_13300 gene tal 161328 161984 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_13300 163460 162057 gene locus_tag LOCUS_13310 163460 162057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963192.1 protein_id gnl|my_center|LOCUS_13310 163624 165243 gene locus_tag LOCUS_13320 163624 165243 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_13320 165706 165275 gene locus_tag LOCUS_13330 165706 165275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 165827 166369 gene locus_tag LOCUS_13340 gene pyrR1 165827 166369 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_13340 166396 167325 gene locus_tag LOCUS_13350 gene pyrB 166396 167325 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_13350 167384 167716 gene locus_tag LOCUS_13360 167384 167716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963901.1 protein_id gnl|my_center|LOCUS_13360 167781 168686 gene locus_tag LOCUS_13370 gene rnz 167781 168686 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_13370 168955 169599 gene locus_tag LOCUS_13380 gene pdxH 168955 169599 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 protein_id gnl|my_center|LOCUS_13380 172082 170229 gene locus_tag LOCUS_13390 172082 170229 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_13390 173022 172159 gene locus_tag LOCUS_13400 173022 172159 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_13400 173330 173845 gene locus_tag LOCUS_13410 gene sixA 173330 173845 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_13410 173814 175925 gene locus_tag LOCUS_13420 gene ppk 173814 175925 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY90 protein_id gnl|my_center|LOCUS_13420 175972 176862 gene locus_tag LOCUS_13430 gene ppx 175972 176862 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_13430 176849 177562 gene locus_tag LOCUS_13440 176849 177562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 177668 178543 gene locus_tag LOCUS_13450 177668 178543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 179465 178950 gene locus_tag LOCUS_13460 179465 178950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 180028 179462 gene locus_tag LOCUS_13470 180028 179462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 180561 180037 gene locus_tag LOCUS_13480 180561 180037 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976220.1 protein_id gnl|my_center|LOCUS_13480 181130 180561 gene locus_tag LOCUS_13490 181130 180561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 181533 181159 gene locus_tag LOCUS_13500 181533 181159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 182051 181623 gene locus_tag LOCUS_13510 182051 181623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 182404 182066 gene locus_tag LOCUS_13520 182404 182066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 183849 182764 gene locus_tag LOCUS_13530 183849 182764 CDS product DNA polymerase III, subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963113.1 protein_id gnl|my_center|LOCUS_13530 184826 184203 gene locus_tag LOCUS_13540 184826 184203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 185921 185034 gene locus_tag LOCUS_13550 185921 185034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 187574 187074 gene locus_tag LOCUS_13560 187574 187074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 188405 187980 gene locus_tag LOCUS_13570 188405 187980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 188792 188535 gene locus_tag LOCUS_13580 188792 188535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 189376 189086 gene locus_tag LOCUS_13590 189376 189086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 190267 189575 gene locus_tag LOCUS_13600 190267 189575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 190697 191104 gene locus_tag LOCUS_13610 190697 191104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 191709 191122 gene locus_tag LOCUS_13620 191709 191122 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_13620 192631 191801 gene locus_tag LOCUS_13630 192631 191801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 193257 192700 gene locus_tag LOCUS_13640 gene ywjB 193257 192700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45862 protein_id gnl|my_center|LOCUS_13640 193820 193392 gene locus_tag LOCUS_13650 193820 193392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 194616 194939 gene locus_tag LOCUS_13660 194616 194939 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962418.1 protein_id gnl|my_center|LOCUS_13660 195511 195017 gene locus_tag LOCUS_13670 195511 195017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 195800 198067 gene locus_tag LOCUS_13680 195800 198067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 198080 200278 gene locus_tag LOCUS_13690 198080 200278 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119822.1 protein_id gnl|my_center|LOCUS_13690 200289 200729 gene locus_tag LOCUS_13700 200289 200729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530377.1 protein_id gnl|my_center|LOCUS_13700 200733 201839 gene locus_tag LOCUS_13710 200733 201839 CDS product alkylhalidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119821.1 protein_id gnl|my_center|LOCUS_13710 201908 203482 gene locus_tag LOCUS_13720 201908 203482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918445.1 protein_id gnl|my_center|LOCUS_13720 203834 203544 gene locus_tag LOCUS_13730 203834 203544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 204440 204634 gene locus_tag LOCUS_13740 204440 204634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 205207 204635 gene locus_tag LOCUS_13750 205207 204635 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_13750 206016 205204 gene locus_tag LOCUS_13760 206016 205204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 protein_id gnl|my_center|LOCUS_13760 206602 206000 gene locus_tag LOCUS_13770 206602 206000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 206883 208310 gene locus_tag LOCUS_13780 206883 208310 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_13780 208314 208880 gene locus_tag LOCUS_13790 208314 208880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_13790 208939 209676 gene locus_tag LOCUS_13800 gene kdsB 208939 209676 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_13800 209678 210133 gene locus_tag LOCUS_13810 209678 210133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 210795 210130 gene locus_tag LOCUS_13820 gene speE 210795 210130 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962995.1 protein_id gnl|my_center|LOCUS_13820 210851 211405 gene locus_tag LOCUS_13830 210851 211405 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_13830 211468 212475 gene locus_tag LOCUS_13840 211468 212475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 213422 212940 gene locus_tag LOCUS_13850 213422 212940 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_13850 213735 214895 gene locus_tag LOCUS_13860 213735 214895 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_13860 214931 215410 gene locus_tag LOCUS_13870 214931 215410 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 protein_id gnl|my_center|LOCUS_13870 215448 215960 gene locus_tag LOCUS_13880 215448 215960 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_13880 216378 215998 gene locus_tag LOCUS_13890 216378 215998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 217422 216448 gene locus_tag LOCUS_13900 217422 216448 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_13900 218833 217430 gene locus_tag LOCUS_13910 gene speA 218833 217430 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_13910 220190 219123 gene locus_tag LOCUS_13920 gene aroB 220190 219123 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_13920 220285 221451 gene locus_tag LOCUS_13930 gene putA 220285 221451 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_13930 222622 221549 gene locus_tag LOCUS_13940 222622 221549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 223815 222688 gene locus_tag LOCUS_13950 223815 222688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 224127 223912 gene locus_tag LOCUS_13960 224127 223912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 224567 224196 gene locus_tag LOCUS_13970 224567 224196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 225117 224689 gene locus_tag LOCUS_13980 gene phnB 225117 224689 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_13980 225547 225137 gene locus_tag LOCUS_13990 225547 225137 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948145.1 protein_id gnl|my_center|LOCUS_13990 226038 225589 gene locus_tag LOCUS_14000 226038 225589 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704236.1 protein_id gnl|my_center|LOCUS_14000 226536 226105 gene locus_tag LOCUS_14010 226536 226105 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 protein_id gnl|my_center|LOCUS_14010 226791 227765 gene locus_tag LOCUS_14020 226791 227765 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063683.1 protein_id gnl|my_center|LOCUS_14020 228147 227956 gene locus_tag LOCUS_14030 228147 227956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 228769 228278 gene locus_tag LOCUS_14040 228769 228278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 229055 228912 gene locus_tag LOCUS_14050 229055 228912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 230118 229390 gene locus_tag LOCUS_14060 230118 229390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963980.1 protein_id gnl|my_center|LOCUS_14060 230751 230407 gene locus_tag LOCUS_14070 230751 230407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 231526 230990 gene locus_tag LOCUS_14080 231526 230990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 232873 231530 gene locus_tag LOCUS_14090 232873 231530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979630.1 protein_id gnl|my_center|LOCUS_14090 233896 233099 gene locus_tag LOCUS_14100 233896 233099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 234968 234327 gene locus_tag LOCUS_14110 234968 234327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 235569 235156 gene locus_tag LOCUS_14120 235569 235156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 236732 235896 gene locus_tag LOCUS_14130 236732 235896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 237364 236831 gene locus_tag LOCUS_14140 237364 236831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 238194 237538 gene locus_tag LOCUS_14150 238194 237538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 238868 238398 gene locus_tag LOCUS_14160 238868 238398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 239429 239016 gene locus_tag LOCUS_14170 239429 239016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 240066 239605 gene locus_tag LOCUS_14180 240066 239605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 240635 240081 gene locus_tag LOCUS_14190 240635 240081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence06 248 565 gene locus_tag LOCUS_14200 gene rplX 248 565 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ88 protein_id gnl|my_center|LOCUS_14200 568 1119 gene locus_tag LOCUS_14210 gene rplE 568 1119 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_14210 1123 1392 gene locus_tag LOCUS_14220 gene rpsN 1123 1392 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_14220 1497 1895 gene locus_tag LOCUS_14230 gene rpsH 1497 1895 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_14230 1912 2454 gene locus_tag LOCUS_14240 gene rplF 1912 2454 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 protein_id gnl|my_center|LOCUS_14240 2466 2816 gene locus_tag LOCUS_14250 gene rplR 2466 2816 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ83 protein_id gnl|my_center|LOCUS_14250 2823 3347 gene locus_tag LOCUS_14260 gene rpsE 2823 3347 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ82 protein_id gnl|my_center|LOCUS_14260 3361 3543 gene locus_tag LOCUS_14270 gene rpmD 3361 3543 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ81 protein_id gnl|my_center|LOCUS_14270 3555 4007 gene locus_tag LOCUS_14280 gene rplO 3555 4007 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ80 protein_id gnl|my_center|LOCUS_14280 4021 5364 gene locus_tag LOCUS_14290 gene secY 4021 5364 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ79 protein_id gnl|my_center|LOCUS_14290 5375 5590 gene locus_tag LOCUS_14300 gene infA 5375 5590 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ78 protein_id gnl|my_center|LOCUS_14300 5720 6094 gene locus_tag LOCUS_14310 gene rpsM 5720 6094 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ76 protein_id gnl|my_center|LOCUS_14310 6107 6490 gene locus_tag LOCUS_14320 gene rpsK 6107 6490 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 protein_id gnl|my_center|LOCUS_14320 6576 7181 gene locus_tag LOCUS_14330 gene rpsD 6576 7181 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ74 protein_id gnl|my_center|LOCUS_14330 7202 8194 gene locus_tag LOCUS_14340 gene rpoA 7202 8194 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_14340 8257 8748 gene locus_tag LOCUS_14350 gene rplQ 8257 8748 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ72 protein_id gnl|my_center|LOCUS_14350 8832 9515 gene locus_tag LOCUS_14360 8832 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 9579 10688 gene locus_tag LOCUS_14370 gene carA 9579 10688 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_14370 10788 12080 gene locus_tag LOCUS_14380 gene eno 10788 12080 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_14380 12280 13563 gene locus_tag LOCUS_14390 gene gltA 12280 13563 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_14390 13978 13616 gene locus_tag LOCUS_14400 13978 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 14112 15026 gene locus_tag LOCUS_14410 14112 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_14410 15098 15466 gene locus_tag LOCUS_14420 15098 15466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 15578 16486 gene locus_tag LOCUS_14430 15578 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_14430 16492 16905 gene locus_tag LOCUS_14440 16492 16905 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388926.1 protein_id gnl|my_center|LOCUS_14440 16988 17221 gene locus_tag LOCUS_14450 16988 17221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 17209 17934 gene locus_tag LOCUS_14460 gene cysH 17209 17934 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_14460 17951 18844 gene locus_tag LOCUS_14470 gene cysD 17951 18844 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ4 protein_id gnl|my_center|LOCUS_14470 18939 20195 gene locus_tag LOCUS_14480 gene cysN 18939 20195 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_14480 21095 22453 gene locus_tag LOCUS_14490 21095 22453 CDS product chromosome condensation regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964550.1 protein_id gnl|my_center|LOCUS_14490 23234 23797 gene locus_tag LOCUS_14500 23234 23797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 24038 24718 gene locus_tag LOCUS_14510 24038 24718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 24980 25429 gene locus_tag LOCUS_14520 24980 25429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 25489 25791 gene locus_tag LOCUS_14530 25489 25791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 26156 26617 gene locus_tag LOCUS_14540 26156 26617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 26848 27243 gene locus_tag LOCUS_14550 26848 27243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 27639 28376 gene locus_tag LOCUS_14560 27639 28376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 28631 29986 gene locus_tag LOCUS_14570 28631 29986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 30226 30957 gene locus_tag LOCUS_14580 30226 30957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 30967 31677 gene locus_tag LOCUS_14590 30967 31677 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962502.1 protein_id gnl|my_center|LOCUS_14590 31834 32529 gene locus_tag LOCUS_14600 31834 32529 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962502.1 protein_id gnl|my_center|LOCUS_14600 32570 33214 gene locus_tag LOCUS_14610 32570 33214 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_14610 33220 33927 gene locus_tag LOCUS_14620 33220 33927 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962502.1 protein_id gnl|my_center|LOCUS_14620 34005 34757 gene locus_tag LOCUS_14630 34005 34757 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962502.1 protein_id gnl|my_center|LOCUS_14630 35029 35286 gene locus_tag LOCUS_14640 35029 35286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 35355 36047 gene locus_tag LOCUS_14650 35355 36047 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962502.1 protein_id gnl|my_center|LOCUS_14650 36148 38718 gene locus_tag LOCUS_14660 36148 38718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962501.1 protein_id gnl|my_center|LOCUS_14660 40295 38868 gene locus_tag LOCUS_14670 40295 38868 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_14670 40967 40344 gene locus_tag LOCUS_14680 40967 40344 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ63 protein_id gnl|my_center|LOCUS_14680 41077 41433 gene locus_tag LOCUS_14690 41077 41433 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_14690 42930 41404 gene locus_tag LOCUS_14700 42930 41404 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202708.1 protein_id gnl|my_center|LOCUS_14700 43004 43624 gene locus_tag LOCUS_14710 gene recR 43004 43624 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_14710 43694 44494 gene locus_tag LOCUS_14720 gene wza 43694 44494 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 protein_id gnl|my_center|LOCUS_14720 44502 46952 gene locus_tag LOCUS_14730 gene wzc 44502 46952 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_14730 46989 47969 gene locus_tag LOCUS_14740 46989 47969 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_14740 47973 49361 gene locus_tag LOCUS_14750 gene ugd 47973 49361 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_14750 49364 50641 gene locus_tag LOCUS_14760 gene wbpO 49364 50641 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_14760 50644 52158 gene locus_tag LOCUS_14770 50644 52158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107283.1 protein_id gnl|my_center|LOCUS_14770 52133 53128 gene locus_tag LOCUS_14780 52133 53128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 53133 54197 gene locus_tag LOCUS_14790 53133 54197 CDS product MurB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039963.1 protein_id gnl|my_center|LOCUS_14790 54199 55185 gene locus_tag LOCUS_14800 54199 55185 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816707.1 protein_id gnl|my_center|LOCUS_14800 55182 56309 gene locus_tag LOCUS_14810 55182 56309 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956970.1 protein_id gnl|my_center|LOCUS_14810 56302 57462 gene locus_tag LOCUS_14820 56302 57462 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107241.1 protein_id gnl|my_center|LOCUS_14820 57617 58546 gene locus_tag LOCUS_14830 57617 58546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 58543 59412 gene locus_tag LOCUS_14840 gene ycbI 58543 59412 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905213.1 protein_id gnl|my_center|LOCUS_14840 59409 60500 gene locus_tag LOCUS_14850 59409 60500 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_14850 60490 61635 gene locus_tag LOCUS_14860 60490 61635 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957841.1 protein_id gnl|my_center|LOCUS_14860 61628 62836 gene locus_tag LOCUS_14870 61628 62836 CDS product UDP-N-acetylgalactosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704933.1 protein_id gnl|my_center|LOCUS_14870 62829 63962 gene locus_tag LOCUS_14880 62829 63962 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_14880 64001 65905 gene locus_tag LOCUS_14890 gene wbpM 64001 65905 CDS product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963409.1 protein_id gnl|my_center|LOCUS_14890 66025 66705 gene locus_tag LOCUS_14900 66025 66705 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_14900 66707 69064 gene locus_tag LOCUS_14910 66707 69064 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_14910 69802 69068 gene locus_tag LOCUS_14920 69802 69068 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_14920 70005 70751 gene locus_tag LOCUS_14930 70005 70751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964412.1 protein_id gnl|my_center|LOCUS_14930 70838 71710 gene locus_tag LOCUS_14940 70838 71710 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ30 protein_id gnl|my_center|LOCUS_14940 71807 73075 gene locus_tag LOCUS_14950 71807 73075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 73072 73794 gene locus_tag LOCUS_14960 73072 73794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 73804 74649 gene locus_tag LOCUS_14970 73804 74649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 74649 75533 gene locus_tag LOCUS_14980 74649 75533 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963392.1 protein_id gnl|my_center|LOCUS_14980 75575 76504 gene locus_tag LOCUS_14990 gene galE 75575 76504 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118537.1 protein_id gnl|my_center|LOCUS_14990 76510 77541 gene locus_tag LOCUS_15000 76510 77541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 77538 78611 gene locus_tag LOCUS_15010 77538 78611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 78608 79738 gene locus_tag LOCUS_15020 78608 79738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 80439 80621 gene locus_tag LOCUS_15030 80439 80621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 80840 81997 gene locus_tag LOCUS_15040 80840 81997 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023668.1 protein_id gnl|my_center|LOCUS_15040 82089 82964 gene locus_tag LOCUS_15050 82089 82964 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023669.1 protein_id gnl|my_center|LOCUS_15050 82966 83784 gene locus_tag LOCUS_15060 gene gumL 82966 83784 CDS product GumL protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037585.1 protein_id gnl|my_center|LOCUS_15060 83857 85254 gene locus_tag LOCUS_15070 83857 85254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963386.1 protein_id gnl|my_center|LOCUS_15070 85299 86135 gene locus_tag LOCUS_15080 85299 86135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 86203 87585 gene locus_tag LOCUS_15090 86203 87585 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_15090 87585 88466 gene locus_tag LOCUS_15100 87585 88466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 88467 89618 gene locus_tag LOCUS_15110 88467 89618 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963384.1 protein_id gnl|my_center|LOCUS_15110 89618 91156 gene locus_tag LOCUS_15120 89618 91156 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963383.1 protein_id gnl|my_center|LOCUS_15120 91146 92147 gene locus_tag LOCUS_15130 91146 92147 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963382.1 protein_id gnl|my_center|LOCUS_15130 92149 92694 gene locus_tag LOCUS_15140 92149 92694 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ08 protein_id gnl|my_center|LOCUS_15140 92696 93817 gene locus_tag LOCUS_15150 92696 93817 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963379.1 protein_id gnl|my_center|LOCUS_15150 93824 94894 gene locus_tag LOCUS_15160 93824 94894 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963378.1 protein_id gnl|my_center|LOCUS_15160 94887 96239 gene locus_tag LOCUS_15170 94887 96239 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_15170 96211 97221 gene locus_tag LOCUS_15180 96211 97221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 97262 98644 gene locus_tag LOCUS_15190 97262 98644 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_15190 99754 98624 gene locus_tag LOCUS_15200 99754 98624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963373.1 protein_id gnl|my_center|LOCUS_15200 100849 99803 gene locus_tag LOCUS_15210 100849 99803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_15210 101134 101871 gene locus_tag LOCUS_15220 gene pssA 101134 101871 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_15220 101954 102736 gene locus_tag LOCUS_15230 gene yegX 101954 102736 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963370.1 protein_id gnl|my_center|LOCUS_15230 102757 103674 gene locus_tag LOCUS_15240 102757 103674 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_15240 103716 105182 gene locus_tag LOCUS_15250 gene crtI 103716 105182 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_15250 105256 106095 gene locus_tag LOCUS_15260 gene crtB 105256 106095 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_15260 106095 106544 gene locus_tag LOCUS_15270 gene crtZ 106095 106544 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_15270 106727 107107 gene locus_tag LOCUS_15280 106727 107107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 107100 107552 gene locus_tag LOCUS_15290 107100 107552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 108018 107665 gene locus_tag LOCUS_15300 108018 107665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 108136 108885 gene locus_tag LOCUS_15310 108136 108885 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087868.1 protein_id gnl|my_center|LOCUS_15310 109107 110111 gene locus_tag LOCUS_15320 gene yjgB 109107 110111 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_15320 110223 110852 gene locus_tag LOCUS_15330 110223 110852 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_15330 110958 111614 gene locus_tag LOCUS_15340 110958 111614 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_15340 112021 112587 gene locus_tag LOCUS_15350 112021 112587 CDS product cyclic nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071750.1 protein_id gnl|my_center|LOCUS_15350 112666 113403 gene locus_tag LOCUS_15360 112666 113403 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_15360 113836 114087 gene locus_tag LOCUS_15370 113836 114087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 114410 114712 gene locus_tag LOCUS_15380 gene yrfA 114410 114712 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130388.1 protein_id gnl|my_center|LOCUS_15380 115007 115948 gene locus_tag LOCUS_15390 115007 115948 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_15390 116165 116734 gene locus_tag LOCUS_15400 116165 116734 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308861.1 protein_id gnl|my_center|LOCUS_15400 116758 117789 gene locus_tag LOCUS_15410 116758 117789 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 protein_id gnl|my_center|LOCUS_15410 118701 118471 gene locus_tag LOCUS_15420 118701 118471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 119015 120070 gene locus_tag LOCUS_15430 119015 120070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069751.1 protein_id gnl|my_center|LOCUS_15430 120239 121264 gene locus_tag LOCUS_15440 120239 121264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 121393 122067 gene locus_tag LOCUS_15450 121393 122067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 122208 123383 gene locus_tag LOCUS_15460 122208 123383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 123470 123952 gene locus_tag LOCUS_15470 123470 123952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 124651 125118 gene locus_tag LOCUS_15480 124651 125118 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038076.1 protein_id gnl|my_center|LOCUS_15480 127064 126258 gene locus_tag LOCUS_15490 gene lptB 127064 126258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_15490 127629 127285 gene locus_tag LOCUS_15500 127629 127285 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_15500 128459 127635 gene locus_tag LOCUS_15510 gene tatC 128459 127635 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_15510 129499 128459 gene locus_tag LOCUS_15520 gene kdsD 129499 128459 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_15520 129511 131706 gene locus_tag LOCUS_15530 gene recQ1 129511 131706 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 protein_id gnl|my_center|LOCUS_15530 131763 132467 gene locus_tag LOCUS_15540 131763 132467 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_15540 132457 133248 gene locus_tag LOCUS_15550 132457 133248 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_15550 133251 134279 gene locus_tag LOCUS_15560 133251 134279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 135216 134263 gene locus_tag LOCUS_15570 135216 134263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 135983 135228 gene locus_tag LOCUS_15580 135983 135228 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255958.1 protein_id gnl|my_center|LOCUS_15580 136337 136080 gene locus_tag LOCUS_15590 136337 136080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 136532 137407 gene locus_tag LOCUS_15600 136532 137407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 137631 137395 gene locus_tag LOCUS_15610 137631 137395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 protein_id gnl|my_center|LOCUS_15610 137703 138752 gene locus_tag LOCUS_15620 137703 138752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184801.1 protein_id gnl|my_center|LOCUS_15620 138791 140350 gene locus_tag LOCUS_15630 138791 140350 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_15630 140854 140432 gene locus_tag LOCUS_15640 140854 140432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253510.1 protein_id gnl|my_center|LOCUS_15640 141524 141078 gene locus_tag LOCUS_15650 141524 141078 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_15650 141841 142368 gene locus_tag LOCUS_15660 gene idi 141841 142368 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_15660 142399 142809 gene locus_tag LOCUS_15670 gene ygcM 142399 142809 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_15670 142811 143263 gene locus_tag LOCUS_15680 142811 143263 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_15680 143378 144337 gene locus_tag LOCUS_15690 gene manA 143378 144337 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 protein_id gnl|my_center|LOCUS_15690 144399 144668 gene locus_tag LOCUS_15700 144399 144668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963895.1 protein_id gnl|my_center|LOCUS_15700 144775 144849 gene locus_tag LOCUS_t00180 144775 144849 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 147011 146136 gene locus_tag LOCUS_15710 147011 146136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 protein_id gnl|my_center|LOCUS_15710 148439 147108 gene locus_tag LOCUS_15720 148439 147108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 149279 148509 gene locus_tag LOCUS_15730 149279 148509 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_15730 150117 149257 gene locus_tag LOCUS_15740 150117 149257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 151146 150379 gene locus_tag LOCUS_15750 151146 150379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 152102 151521 gene locus_tag LOCUS_15760 152102 151521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 152618 152145 gene locus_tag LOCUS_15770 152618 152145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 153848 152724 gene locus_tag LOCUS_15780 gene metC 153848 152724 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946625.1 protein_id gnl|my_center|LOCUS_15780 154595 153864 gene locus_tag LOCUS_15790 154595 153864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963060.1 protein_id gnl|my_center|LOCUS_15790 155927 154626 gene locus_tag LOCUS_15800 155927 154626 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_15800 157871 156015 gene locus_tag LOCUS_15810 157871 156015 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_15810 158850 157927 gene locus_tag LOCUS_15820 158850 157927 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682158.1 protein_id gnl|my_center|LOCUS_15820 159908 159432 gene locus_tag LOCUS_15830 159908 159432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 160183 159911 gene locus_tag LOCUS_15840 160183 159911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963064.1 protein_id gnl|my_center|LOCUS_15840 160616 160335 gene locus_tag LOCUS_15850 160616 160335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 161363 160761 gene locus_tag LOCUS_15860 161363 160761 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_15860 161764 161393 gene locus_tag LOCUS_15870 161764 161393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281604.1 protein_id gnl|my_center|LOCUS_15870 162718 161810 gene locus_tag LOCUS_15880 gene fjo20 162718 161810 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963631.1 protein_id gnl|my_center|LOCUS_15880 163933 162767 gene locus_tag LOCUS_15890 163933 162767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_15890 165333 163945 gene locus_tag LOCUS_15900 165333 163945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963629.1 protein_id gnl|my_center|LOCUS_15900 165425 166045 gene locus_tag LOCUS_15910 165425 166045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 166101 168326 gene locus_tag LOCUS_15920 166101 168326 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_15920 168723 168331 gene locus_tag LOCUS_15930 168723 168331 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_15930 169628 168825 gene locus_tag LOCUS_15940 169628 168825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 170477 169644 gene locus_tag LOCUS_15950 170477 169644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 171110 170592 gene locus_tag LOCUS_15960 171110 170592 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020073.1 protein_id gnl|my_center|LOCUS_15960 172033 171110 gene locus_tag LOCUS_15970 172033 171110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 172862 172041 gene locus_tag LOCUS_15980 172862 172041 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963866.1 protein_id gnl|my_center|LOCUS_15980 172957 175077 gene locus_tag LOCUS_15990 172957 175077 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963628.1 protein_id gnl|my_center|LOCUS_15990 176588 175974 gene locus_tag LOCUS_16000 176588 175974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_16000 176582 177208 gene locus_tag LOCUS_16010 176582 177208 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106135.1 protein_id gnl|my_center|LOCUS_16010 178701 177391 gene locus_tag LOCUS_16020 178701 177391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 180684 178798 gene locus_tag LOCUS_16030 gene htpG 180684 178798 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_16030 180860 181333 gene locus_tag LOCUS_16040 180860 181333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963626.1 protein_id gnl|my_center|LOCUS_16040 181344 182039 gene locus_tag LOCUS_16050 gene yiaD 181344 182039 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963625.1 protein_id gnl|my_center|LOCUS_16050 182715 182113 gene locus_tag LOCUS_16060 182715 182113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 182867 183796 gene locus_tag LOCUS_16070 182867 183796 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_16070 186368 183834 gene locus_tag LOCUS_16080 186368 183834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_16080 186433 187440 gene locus_tag LOCUS_16090 gene fabH2 186433 187440 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_16090 187447 187962 gene locus_tag LOCUS_16100 187447 187962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 190349 187995 gene locus_tag LOCUS_16110 190349 187995 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_16110 190530 192317 gene locus_tag LOCUS_16120 gene argS 190530 192317 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 protein_id gnl|my_center|LOCUS_16120 192465 193565 gene locus_tag LOCUS_16130 192465 193565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 193825 195171 gene locus_tag LOCUS_16140 gene cydA 193825 195171 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_16140 195186 196223 gene locus_tag LOCUS_16150 gene cydB 195186 196223 CDS product cytochrome D oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_16150 196474 196770 gene locus_tag LOCUS_16160 196474 196770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 196862 197071 gene locus_tag LOCUS_16170 196862 197071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 198197 197073 gene locus_tag LOCUS_16180 198197 197073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 198360 198941 gene locus_tag LOCUS_16190 198360 198941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 198949 199524 gene locus_tag LOCUS_16200 198949 199524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 200195 199563 gene locus_tag LOCUS_16210 200195 199563 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 protein_id gnl|my_center|LOCUS_16210 200491 202071 gene locus_tag LOCUS_16220 200491 202071 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115067.1 protein_id gnl|my_center|LOCUS_16220 202341 202589 gene locus_tag LOCUS_16230 202341 202589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 202648 202851 gene locus_tag LOCUS_16240 202648 202851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 202998 203432 gene locus_tag LOCUS_16250 202998 203432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 203434 203943 gene locus_tag LOCUS_16260 203434 203943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 204110 204715 gene locus_tag LOCUS_16270 204110 204715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 204955 205824 gene locus_tag LOCUS_16280 204955 205824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 205971 206708 gene locus_tag LOCUS_16290 205971 206708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 206970 207449 gene locus_tag LOCUS_16300 206970 207449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 207796 208656 gene locus_tag LOCUS_16310 207796 208656 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222998.1 protein_id gnl|my_center|LOCUS_16310 209243 210562 gene locus_tag LOCUS_16320 209243 210562 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963918.1 protein_id gnl|my_center|LOCUS_16320 210788 211867 gene locus_tag LOCUS_16330 210788 211867 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963917.1 protein_id gnl|my_center|LOCUS_16330 211943 215140 gene locus_tag LOCUS_16340 211943 215140 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963916.1 protein_id gnl|my_center|LOCUS_16340 215244 215432 gene locus_tag LOCUS_16350 215244 215432 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963915.1 protein_id gnl|my_center|LOCUS_16350 215953 216495 gene locus_tag LOCUS_16360 215953 216495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 216688 217659 gene locus_tag LOCUS_16370 216688 217659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 217819 218226 gene locus_tag LOCUS_16380 217819 218226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence07 1032 229 gene locus_tag LOCUS_16390 1032 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963660.1 protein_id gnl|my_center|LOCUS_16390 1123 1617 gene locus_tag LOCUS_16400 1123 1617 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868177.1 protein_id gnl|my_center|LOCUS_16400 2095 1701 gene locus_tag LOCUS_tm00010 2095 1701 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2300 3505 gene locus_tag LOCUS_16410 2300 3505 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_16410 3597 6344 gene locus_tag LOCUS_16420 3597 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_16420 6599 9598 gene locus_tag LOCUS_16430 6599 9598 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108890.1 protein_id gnl|my_center|LOCUS_16430 9610 11091 gene locus_tag LOCUS_16440 9610 11091 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_16440 11172 11951 gene locus_tag LOCUS_16450 11172 11951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 12001 13359 gene locus_tag LOCUS_16460 12001 13359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796641.1 protein_id gnl|my_center|LOCUS_16460 13359 14057 gene locus_tag LOCUS_16470 13359 14057 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_16470 14081 16384 gene locus_tag LOCUS_16480 14081 16384 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_16480 16448 18211 gene locus_tag LOCUS_16490 16448 18211 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_16490 18212 19057 gene locus_tag LOCUS_16500 18212 19057 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_16500 20583 19210 gene locus_tag LOCUS_16510 20583 19210 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_16510 20918 20619 gene locus_tag LOCUS_16520 20918 20619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 22324 21869 gene locus_tag LOCUS_16530 22324 21869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 22674 22378 gene locus_tag LOCUS_16540 22674 22378 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_16540 23343 22693 gene locus_tag LOCUS_16550 23343 22693 CDS product protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_16550 24042 23368 gene locus_tag LOCUS_16560 24042 23368 CDS product peptidoglycan peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_714690.1 protein_id gnl|my_center|LOCUS_16560 24668 24057 gene locus_tag LOCUS_16570 24668 24057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107677.1 protein_id gnl|my_center|LOCUS_16570 24818 26194 gene locus_tag LOCUS_16580 24818 26194 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_16580 26265 26612 gene locus_tag LOCUS_16590 26265 26612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 27536 26667 gene locus_tag LOCUS_16600 27536 26667 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962664.1 protein_id gnl|my_center|LOCUS_16600 28373 27555 gene locus_tag LOCUS_16610 gene kdsA 28373 27555 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY4 protein_id gnl|my_center|LOCUS_16610 28859 28476 gene locus_tag LOCUS_16620 28859 28476 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963795.1 protein_id gnl|my_center|LOCUS_16620 29414 28932 gene locus_tag LOCUS_16630 29414 28932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 29504 30067 gene locus_tag LOCUS_16640 29504 30067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_16640 30078 30491 gene locus_tag LOCUS_16650 30078 30491 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_16650 30668 31087 gene locus_tag LOCUS_16660 30668 31087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 31418 31143 gene locus_tag LOCUS_16670 gene clpS 31418 31143 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_16670 32351 31518 gene locus_tag LOCUS_16680 gene prmA 32351 31518 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_16680 32447 33664 gene locus_tag LOCUS_16690 32447 33664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 33703 34539 gene locus_tag LOCUS_16700 33703 34539 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_16700 34539 34820 gene locus_tag LOCUS_16710 34539 34820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 34824 35792 gene locus_tag LOCUS_16720 34824 35792 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_16720 35882 36304 gene locus_tag LOCUS_16730 35882 36304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 36487 37533 gene locus_tag LOCUS_16740 36487 37533 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_16740 37557 40754 gene locus_tag LOCUS_16750 37557 40754 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_16750 40784 42217 gene locus_tag LOCUS_16760 40784 42217 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_16760 43696 42524 gene locus_tag LOCUS_16770 43696 42524 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962646.1 protein_id gnl|my_center|LOCUS_16770 44132 43686 gene locus_tag LOCUS_16780 44132 43686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 45252 44134 gene locus_tag LOCUS_16790 gene pepC 45252 44134 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_16790 45386 46225 gene locus_tag LOCUS_16800 gene menB 45386 46225 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_16800 46268 46885 gene locus_tag LOCUS_16810 46268 46885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 46875 48374 gene locus_tag LOCUS_16820 46875 48374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 48391 48780 gene locus_tag LOCUS_16830 48391 48780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 48788 49675 gene locus_tag LOCUS_16840 gene menA 48788 49675 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW2 protein_id gnl|my_center|LOCUS_16840 49707 50384 gene locus_tag LOCUS_16850 49707 50384 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0P5 protein_id gnl|my_center|LOCUS_16850 50476 51501 gene locus_tag LOCUS_16860 gene menC 50476 51501 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_16860 51797 51564 gene locus_tag LOCUS_16870 51797 51564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 51976 52557 gene locus_tag LOCUS_16880 gene miaE 51976 52557 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_16880 53885 52653 gene locus_tag LOCUS_16890 53885 52653 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_16890 54154 53888 gene locus_tag LOCUS_16900 54154 53888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 54250 54762 gene locus_tag LOCUS_16910 54250 54762 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792215.1 protein_id gnl|my_center|LOCUS_16910 55844 54759 gene locus_tag LOCUS_16920 55844 54759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963854.1 protein_id gnl|my_center|LOCUS_16920 56070 55882 gene locus_tag LOCUS_16930 56070 55882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 56146 56529 gene locus_tag LOCUS_16940 56146 56529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_16940 57686 56619 gene locus_tag LOCUS_16950 57686 56619 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_16950 57880 58383 gene locus_tag LOCUS_16960 57880 58383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 58383 58811 gene locus_tag LOCUS_16970 58383 58811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 58868 59539 gene locus_tag LOCUS_16980 58868 59539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_16980 59694 59888 gene locus_tag LOCUS_16990 59694 59888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963849.1 protein_id gnl|my_center|LOCUS_16990 60859 59918 gene locus_tag LOCUS_17000 gene oxyR 60859 59918 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_17000 61175 61399 gene locus_tag LOCUS_17010 61175 61399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 61454 63031 gene locus_tag LOCUS_17020 61454 63031 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 protein_id gnl|my_center|LOCUS_17020 63051 63686 gene locus_tag LOCUS_17030 gene cynT 63051 63686 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_17030 64882 63689 gene locus_tag LOCUS_17040 64882 63689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 64975 66204 gene locus_tag LOCUS_17050 64975 66204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 66721 66323 gene locus_tag LOCUS_17060 66721 66323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 67583 66864 gene locus_tag LOCUS_17070 67583 66864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 69766 67589 gene locus_tag LOCUS_17080 69766 67589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 71775 69985 gene locus_tag LOCUS_17090 71775 69985 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_17090 72170 71820 gene locus_tag LOCUS_17100 72170 71820 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_17100 73398 72211 gene locus_tag LOCUS_17110 73398 72211 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_17110 75793 73403 gene locus_tag LOCUS_17120 75793 73403 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_17120 76260 75802 gene locus_tag LOCUS_17130 76260 75802 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_17130 78165 76393 gene locus_tag LOCUS_17140 gene fadD 78165 76393 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_17140 78607 80463 gene locus_tag LOCUS_17150 78607 80463 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963039.1 protein_id gnl|my_center|LOCUS_17150 80469 81044 gene locus_tag LOCUS_17160 80469 81044 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963038.1 protein_id gnl|my_center|LOCUS_17160 81323 81045 gene locus_tag LOCUS_17170 81323 81045 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_17170 81735 81301 gene locus_tag LOCUS_17180 81735 81301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 83048 81738 gene locus_tag LOCUS_17190 83048 81738 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_17190 83727 83068 gene locus_tag LOCUS_17200 83727 83068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_17200 84804 84085 gene locus_tag LOCUS_17210 84804 84085 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_17210 85907 84870 gene locus_tag LOCUS_17220 85907 84870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 87939 85912 gene locus_tag LOCUS_17230 87939 85912 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_17230 89040 87958 gene locus_tag LOCUS_17240 gene gcvT 89040 87958 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_17240 90017 89154 gene locus_tag LOCUS_17250 90017 89154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 91433 90144 gene locus_tag LOCUS_17260 91433 90144 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_17260 92376 91459 gene locus_tag LOCUS_17270 gene thrB 92376 91459 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_17270 94833 92386 gene locus_tag LOCUS_17280 94833 92386 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_17280 95214 96716 gene locus_tag LOCUS_17290 gene hutH1 95214 96716 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW5 protein_id gnl|my_center|LOCUS_17290 97139 96780 gene locus_tag LOCUS_17300 97139 96780 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097074.1 protein_id gnl|my_center|LOCUS_17300 97726 97151 gene locus_tag LOCUS_17310 97726 97151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_17310 98124 97738 gene locus_tag LOCUS_17320 98124 97738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 99502 98135 gene locus_tag LOCUS_17330 gene rimK 99502 98135 CDS product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 protein_id gnl|my_center|LOCUS_17330 102121 99575 gene locus_tag LOCUS_17340 gene clpA 102121 99575 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_17340 102374 104923 gene locus_tag LOCUS_17350 gene gyrA 102374 104923 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_17350 104993 106099 gene locus_tag LOCUS_17360 104993 106099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962908.1 protein_id gnl|my_center|LOCUS_17360 106929 106168 gene locus_tag LOCUS_17370 106929 106168 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_17370 108184 107009 gene locus_tag LOCUS_17380 108184 107009 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_17380 108451 108535 gene locus_tag LOCUS_t00190 108451 108535 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 108547 108622 gene locus_tag LOCUS_t00200 108547 108622 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 108636 108710 gene locus_tag LOCUS_t00210 108636 108710 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 108870 111692 gene locus_tag LOCUS_17390 108870 111692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 112382 111675 gene locus_tag LOCUS_17400 112382 111675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 112921 112382 gene locus_tag LOCUS_17410 112921 112382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 113107 113925 gene locus_tag LOCUS_17420 113107 113925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 113927 114547 gene locus_tag LOCUS_17430 113927 114547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 114568 115305 gene locus_tag LOCUS_17440 114568 115305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 115328 116632 gene locus_tag LOCUS_17450 115328 116632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 116637 117761 gene locus_tag LOCUS_17460 116637 117761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 117805 118179 gene locus_tag LOCUS_17470 117805 118179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 118195 118815 gene locus_tag LOCUS_17480 118195 118815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 118844 119824 gene locus_tag LOCUS_17490 118844 119824 CDS product OmpA/MotB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533229.1 protein_id gnl|my_center|LOCUS_17490 119906 120793 gene locus_tag LOCUS_17500 119906 120793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 121002 122687 gene locus_tag LOCUS_17510 121002 122687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 122726 125269 gene locus_tag LOCUS_17520 122726 125269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 125881 125312 gene locus_tag LOCUS_17530 125881 125312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963734.1 protein_id gnl|my_center|LOCUS_17530 127066 125888 gene locus_tag LOCUS_17540 127066 125888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 protein_id gnl|my_center|LOCUS_17540 128154 127066 gene locus_tag LOCUS_17550 128154 127066 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_17550 129173 128223 gene locus_tag LOCUS_17560 129173 128223 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963731.1 protein_id gnl|my_center|LOCUS_17560 130304 129357 gene locus_tag LOCUS_17570 130304 129357 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963731.1 protein_id gnl|my_center|LOCUS_17570 130186 130437 gene locus_tag LOCUS_17580 130186 130437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 131067 130540 gene locus_tag LOCUS_17590 131067 130540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17590 131492 131148 gene locus_tag LOCUS_17600 131492 131148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17600 132306 131671 gene locus_tag LOCUS_17610 132306 131671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_17610 133012 132308 gene locus_tag LOCUS_17620 133012 132308 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_17620 134033 133014 gene locus_tag LOCUS_17630 gene tsaD 134033 133014 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_17630 134226 138638 gene locus_tag LOCUS_17640 134226 138638 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_17640 138772 139758 gene locus_tag LOCUS_17650 gene pfkA 138772 139758 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_17650 139800 140810 gene locus_tag LOCUS_17660 gene gapA3 139800 140810 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H007 protein_id gnl|my_center|LOCUS_17660 140934 141785 gene locus_tag LOCUS_17670 140934 141785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_17670 141864 142211 gene locus_tag LOCUS_17680 gene mgsA 141864 142211 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51339 protein_id gnl|my_center|LOCUS_17680 143765 142293 gene locus_tag LOCUS_17690 143765 142293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 144818 144282 gene locus_tag LOCUS_17700 144818 144282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 145925 144846 gene locus_tag LOCUS_17710 145925 144846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 148280 146046 gene locus_tag LOCUS_17720 148280 146046 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_17720 149360 148905 gene locus_tag LOCUS_17730 149360 148905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 150063 149512 gene locus_tag LOCUS_17740 150063 149512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 153814 150155 gene locus_tag LOCUS_17750 gene purL 153814 150155 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXH5 protein_id gnl|my_center|LOCUS_17750 155546 153966 gene locus_tag LOCUS_17760 155546 153966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 156302 155667 gene locus_tag LOCUS_17770 156302 155667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 157978 156419 gene locus_tag LOCUS_17780 157978 156419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_17780 158107 158532 gene locus_tag LOCUS_17790 158107 158532 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_17790 158532 159560 gene locus_tag LOCUS_17800 gene menF 158532 159560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 protein_id gnl|my_center|LOCUS_17800 159642 160358 gene locus_tag LOCUS_17810 159642 160358 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_17810 160436 160510 gene locus_tag LOCUS_t00220 160436 160510 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 161026 160634 gene locus_tag LOCUS_17820 161026 160634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 protein_id gnl|my_center|LOCUS_17820 161692 161045 gene locus_tag LOCUS_17830 gene pyrE 161692 161045 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 protein_id gnl|my_center|LOCUS_17830 161700 162293 gene locus_tag LOCUS_17840 161700 162293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 162416 162862 gene locus_tag LOCUS_17850 162416 162862 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314059.1 protein_id gnl|my_center|LOCUS_17850 164619 162913 gene locus_tag LOCUS_17860 164619 162913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_17860 164846 166243 gene locus_tag LOCUS_17870 gene dbpA 164846 166243 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_17870 167276 166266 gene locus_tag LOCUS_17880 167276 166266 CDS product N-acetylphosphinothricin-tripetide-deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680147.1 protein_id gnl|my_center|LOCUS_17880 167282 167917 gene locus_tag LOCUS_17890 167282 167917 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 protein_id gnl|my_center|LOCUS_17890 169263 168001 gene locus_tag LOCUS_17900 169263 168001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 170880 169345 gene locus_tag LOCUS_17910 170880 169345 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881759.1 protein_id gnl|my_center|LOCUS_17910 170953 171279 gene locus_tag LOCUS_17920 170953 171279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 171849 171391 gene locus_tag LOCUS_17930 gene coaD 171849 171391 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_17930 172319 171855 gene locus_tag LOCUS_17940 172319 171855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 172939 172334 gene locus_tag LOCUS_17950 172939 172334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 173918 172947 gene locus_tag LOCUS_17960 gene ddl 173918 172947 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD5 protein_id gnl|my_center|LOCUS_17960 174009 174632 gene locus_tag LOCUS_17970 174009 174632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 174634 175677 gene locus_tag LOCUS_17980 174634 175677 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_17980 176194 175715 gene locus_tag LOCUS_17990 176194 175715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 176924 176274 gene locus_tag LOCUS_18000 176924 176274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence08 152 1156 gene locus_tag LOCUS_18010 152 1156 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_18010 1220 1735 gene locus_tag LOCUS_18020 1220 1735 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_18020 2606 1827 gene locus_tag LOCUS_18030 gene murI 2606 1827 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D7 protein_id gnl|my_center|LOCUS_18030 3181 2678 gene locus_tag LOCUS_18040 3181 2678 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964197.1 protein_id gnl|my_center|LOCUS_18040 4003 3209 gene locus_tag LOCUS_18050 gene skp 4003 3209 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964196.1 protein_id gnl|my_center|LOCUS_18050 6762 4123 gene locus_tag LOCUS_18060 gene bamA 6762 4123 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 protein_id gnl|my_center|LOCUS_18060 7510 6770 gene locus_tag LOCUS_18070 gene uppS 7510 6770 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_18070 8195 7512 gene locus_tag LOCUS_18080 8195 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_18080 9196 8318 gene locus_tag LOCUS_18090 gene nadK 9196 8318 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_18090 9887 9228 gene locus_tag LOCUS_18100 9887 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_18100 9984 10697 gene locus_tag LOCUS_18110 gene pdxJ 9984 10697 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 protein_id gnl|my_center|LOCUS_18110 10697 11458 gene locus_tag LOCUS_18120 10697 11458 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_18120 11581 12819 gene locus_tag LOCUS_18130 11581 12819 CDS product fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_18130 12837 14429 gene locus_tag LOCUS_18140 12837 14429 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_18140 14497 14850 gene locus_tag LOCUS_18150 14497 14850 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964186.1 protein_id gnl|my_center|LOCUS_18150 14972 16297 gene locus_tag LOCUS_18160 gene tig 14972 16297 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_18160 16379 17038 gene locus_tag LOCUS_18170 gene clpP 16379 17038 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_18170 17103 18335 gene locus_tag LOCUS_18180 gene clpX 17103 18335 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_18180 20015 18420 gene locus_tag LOCUS_18190 20015 18420 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_18190 21827 20364 gene locus_tag LOCUS_18200 21827 20364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_18200 21986 22777 gene locus_tag LOCUS_18210 21986 22777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_18210 23084 22785 gene locus_tag LOCUS_18220 23084 22785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 25809 23185 gene locus_tag LOCUS_18230 25809 23185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962569.1 protein_id gnl|my_center|LOCUS_18230 26617 25910 gene locus_tag LOCUS_18240 26617 25910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_18240 28488 26710 gene locus_tag LOCUS_18250 gene sppA 28488 26710 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_18250 28595 29728 gene locus_tag LOCUS_18260 28595 29728 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962567.1 protein_id gnl|my_center|LOCUS_18260 30639 29788 gene locus_tag LOCUS_18270 30639 29788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 33003 30736 gene locus_tag LOCUS_18280 33003 30736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 34346 33216 gene locus_tag LOCUS_18290 34346 33216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 34588 34394 gene locus_tag LOCUS_18300 34588 34394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 35077 34853 gene locus_tag LOCUS_18310 35077 34853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 36875 35181 gene locus_tag LOCUS_18320 36875 35181 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766785.1 protein_id gnl|my_center|LOCUS_18320 37292 37615 gene locus_tag LOCUS_18330 37292 37615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 37665 38405 gene locus_tag LOCUS_18340 37665 38405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 38646 38867 gene locus_tag LOCUS_18350 38646 38867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 38911 39960 gene locus_tag LOCUS_18360 38911 39960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 39957 40436 gene locus_tag LOCUS_18370 39957 40436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 40544 40726 gene locus_tag LOCUS_18380 40544 40726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 40757 41221 gene locus_tag LOCUS_18390 40757 41221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 41376 42005 gene locus_tag LOCUS_18400 41376 42005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 42245 42574 gene locus_tag LOCUS_18410 42245 42574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 42635 43459 gene locus_tag LOCUS_18420 42635 43459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 43503 46109 gene locus_tag LOCUS_18430 43503 46109 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_18430 46588 46445 gene locus_tag LOCUS_18440 46588 46445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 47314 46787 gene locus_tag LOCUS_18450 47314 46787 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_18450 47591 48382 gene locus_tag LOCUS_18460 47591 48382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 48889 51504 gene locus_tag LOCUS_18470 gene mutS 48889 51504 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWN3 protein_id gnl|my_center|LOCUS_18470 51642 51715 gene locus_tag LOCUS_t00230 51642 51715 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 51919 52005 gene locus_tag LOCUS_t00240 51919 52005 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 52136 52507 gene locus_tag LOCUS_18480 52136 52507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 52744 52830 gene locus_tag LOCUS_t00250 52744 52830 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 53093 53449 gene locus_tag LOCUS_18490 53093 53449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962555.1 protein_id gnl|my_center|LOCUS_18490 53742 53518 gene locus_tag LOCUS_18500 53742 53518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 56056 53897 gene locus_tag LOCUS_18510 gene dpp11 56056 53897 CDS product Asp/Glu-specific dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWM2 protein_id gnl|my_center|LOCUS_18510 56418 58685 gene locus_tag LOCUS_18520 56418 58685 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_18520 58751 59845 gene locus_tag LOCUS_18530 58751 59845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 59850 60572 gene locus_tag LOCUS_18540 gene algR 59850 60572 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_18540 61825 60575 gene locus_tag LOCUS_18550 gene kdtA 61825 60575 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_18550 61919 63049 gene locus_tag LOCUS_18560 gene porR 61919 63049 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_18560 63121 64134 gene locus_tag LOCUS_18570 gene galE 63121 64134 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_18570 64266 64484 gene locus_tag LOCUS_18580 64266 64484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 64617 65777 gene locus_tag LOCUS_18590 64617 65777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 66159 65899 gene locus_tag LOCUS_18600 66159 65899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 66847 66173 gene locus_tag LOCUS_18610 66847 66173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 67671 66853 gene locus_tag LOCUS_18620 67671 66853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 68152 67769 gene locus_tag LOCUS_18630 68152 67769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760453.1 protein_id gnl|my_center|LOCUS_18630 68918 68130 gene locus_tag LOCUS_18640 68918 68130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766739.1 protein_id gnl|my_center|LOCUS_18640 69877 68996 gene locus_tag LOCUS_18650 gene fabD 69877 68996 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_18650 70533 70003 gene locus_tag LOCUS_18660 70533 70003 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_18660 71157 70624 gene locus_tag LOCUS_18670 71157 70624 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_18670 71380 71150 gene locus_tag LOCUS_18680 71380 71150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107822.1 protein_id gnl|my_center|LOCUS_18680 71790 71383 gene locus_tag LOCUS_18690 71790 71383 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_18690 72095 71793 gene locus_tag LOCUS_18700 72095 71793 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067116.1 protein_id gnl|my_center|LOCUS_18700 72872 72159 gene locus_tag LOCUS_18710 72872 72159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766240.1 protein_id gnl|my_center|LOCUS_18710 73851 72952 gene locus_tag LOCUS_18720 73851 72952 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879043.1 protein_id gnl|my_center|LOCUS_18720 74025 74909 gene locus_tag LOCUS_18730 74025 74909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 75768 75193 gene locus_tag LOCUS_18740 75768 75193 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 protein_id gnl|my_center|LOCUS_18740 76091 75771 gene locus_tag LOCUS_18750 76091 75771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962578.1 protein_id gnl|my_center|LOCUS_18750 77258 76095 gene locus_tag LOCUS_18760 gene purT 77258 76095 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP9 protein_id gnl|my_center|LOCUS_18760 78527 77343 gene locus_tag LOCUS_18770 gene aspC1 78527 77343 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_18770 79682 78585 gene locus_tag LOCUS_18780 79682 78585 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_18780 79858 80427 gene locus_tag LOCUS_18790 gene rsmG 79858 80427 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_18790 82135 80507 gene locus_tag LOCUS_18800 gene pruA 82135 80507 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_18800 82622 82236 gene locus_tag LOCUS_18810 gene apaG 82622 82236 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_18810 83694 82627 gene locus_tag LOCUS_18820 83694 82627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 84941 83694 gene locus_tag LOCUS_18830 84941 83694 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_18830 85138 86484 gene locus_tag LOCUS_18840 gene nqrA 85138 86484 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_18840 86515 87768 gene locus_tag LOCUS_18850 gene nqrB 86515 87768 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K8 protein_id gnl|my_center|LOCUS_18850 87771 88496 gene locus_tag LOCUS_18860 gene nqrC 87771 88496 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_18860 88500 89174 gene locus_tag LOCUS_18870 gene nqrD 88500 89174 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_18870 89178 89933 gene locus_tag LOCUS_18880 gene nqrE 89178 89933 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L1 protein_id gnl|my_center|LOCUS_18880 89936 91249 gene locus_tag LOCUS_18890 gene nqrF 89936 91249 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_18890 91335 91700 gene locus_tag LOCUS_18900 91335 91700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 91678 92691 gene locus_tag LOCUS_18910 91678 92691 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_18910 92852 95566 gene locus_tag LOCUS_18920 92852 95566 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_18920 98718 95797 gene locus_tag LOCUS_18930 98718 95797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 99497 98727 gene locus_tag LOCUS_18940 99497 98727 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_18940 100597 99779 gene locus_tag LOCUS_18950 gene map 100597 99779 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_18950 100736 103087 gene locus_tag LOCUS_18960 100736 103087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 104268 103084 gene locus_tag LOCUS_18970 104268 103084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 104387 108001 gene locus_tag LOCUS_18980 104387 108001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 108853 107984 gene locus_tag LOCUS_18990 108853 107984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 108962 110236 gene locus_tag LOCUS_19000 gene cat2 108962 110236 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962593.1 protein_id gnl|my_center|LOCUS_19000 110351 110692 gene locus_tag LOCUS_19010 110351 110692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 112140 110758 gene locus_tag LOCUS_19020 112140 110758 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_19020 113493 112144 gene locus_tag LOCUS_19030 113493 112144 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_19030 115158 113497 gene locus_tag LOCUS_19040 115158 113497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_19040 115826 115155 gene locus_tag LOCUS_19050 115826 115155 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_19050 119525 115947 gene locus_tag LOCUS_19060 119525 115947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 120194 119616 gene locus_tag LOCUS_19070 120194 119616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 121054 120317 gene locus_tag LOCUS_19080 121054 120317 CDS product lipoprotein signal peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969609.1 protein_id gnl|my_center|LOCUS_19080 121760 121041 gene locus_tag LOCUS_19090 121760 121041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 123278 121761 gene locus_tag LOCUS_19100 gene gpmI 123278 121761 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_19100 125818 123386 gene locus_tag LOCUS_19110 125818 123386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 125966 126736 gene locus_tag LOCUS_19120 125966 126736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964232.1 protein_id gnl|my_center|LOCUS_19120 128311 126725 gene locus_tag LOCUS_19130 128311 126725 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964231.1 protein_id gnl|my_center|LOCUS_19130 128949 129024 gene locus_tag LOCUS_t00260 128949 129024 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 129057 129130 gene locus_tag LOCUS_t00270 129057 129130 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 129904 129173 gene locus_tag LOCUS_19140 gene pepE 129904 129173 CDS product dipeptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_19140 129994 130770 gene locus_tag LOCUS_19150 129994 130770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964228.1 protein_id gnl|my_center|LOCUS_19150 130757 131500 gene locus_tag LOCUS_19160 130757 131500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964228.1 protein_id gnl|my_center|LOCUS_19160 131490 132341 gene locus_tag LOCUS_19170 131490 132341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 132331 132834 gene locus_tag LOCUS_19180 132331 132834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964227.1 protein_id gnl|my_center|LOCUS_19180 132851 135118 gene locus_tag LOCUS_19190 132851 135118 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_19190 135223 135582 gene locus_tag LOCUS_19200 135223 135582 CDS product Sec-independent protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964182.1 protein_id gnl|my_center|LOCUS_19200 135585 136145 gene locus_tag LOCUS_19210 135585 136145 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_19210 137185 136142 gene locus_tag LOCUS_19220 137185 136142 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016813.1 protein_id gnl|my_center|LOCUS_19220 137826 137185 gene locus_tag LOCUS_19230 137826 137185 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_19230 137919 138959 gene locus_tag LOCUS_19240 gene rlmN 137919 138959 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_19240 139196 140179 gene locus_tag LOCUS_19250 139196 140179 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_19250 140424 140993 gene locus_tag LOCUS_19260 140424 140993 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_19260 140980 141717 gene locus_tag LOCUS_19270 140980 141717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964175.1 protein_id gnl|my_center|LOCUS_19270 141763 142869 gene locus_tag LOCUS_19280 141763 142869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964174.1 protein_id gnl|my_center|LOCUS_19280 142877 143206 gene locus_tag LOCUS_19290 142877 143206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 143379 144665 gene locus_tag LOCUS_19300 143379 144665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964172.1 protein_id gnl|my_center|LOCUS_19300 144672 144887 gene locus_tag LOCUS_19310 144672 144887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 144908 146191 gene locus_tag LOCUS_19320 144908 146191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964172.1 protein_id gnl|my_center|LOCUS_19320 146436 147755 gene locus_tag LOCUS_19330 146436 147755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964172.1 protein_id gnl|my_center|LOCUS_19330 147849 149834 gene locus_tag LOCUS_19340 gene dnaG 147849 149834 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_19340 150460 149831 gene locus_tag LOCUS_19350 150460 149831 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964170.1 protein_id gnl|my_center|LOCUS_19350 151363 150557 gene locus_tag LOCUS_19360 gene nadE 151363 150557 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 protein_id gnl|my_center|LOCUS_19360 151464 152420 gene locus_tag LOCUS_19370 gene gldB 151464 152420 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_19370 152420 152752 gene locus_tag LOCUS_19380 gene gldC 152420 152752 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_19380 153753 152815 gene locus_tag LOCUS_19390 153753 152815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 154446 153826 gene locus_tag LOCUS_19400 gene engB 154446 153826 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 protein_id gnl|my_center|LOCUS_19400 155242 154487 gene locus_tag LOCUS_19410 gene pcbD 155242 154487 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_19410 155753 156073 gene locus_tag LOCUS_19420 155753 156073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 156060 156956 gene locus_tag LOCUS_19430 gene rsmH 156060 156956 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 protein_id gnl|my_center|LOCUS_19430 157001 157360 gene locus_tag LOCUS_19440 157001 157360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964162.1 protein_id gnl|my_center|LOCUS_19440 157384 159336 gene locus_tag LOCUS_19450 gene ftsI 157384 159336 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_19450 159333 160796 gene locus_tag LOCUS_19460 gene murE 159333 160796 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_19460 160849 162066 gene locus_tag LOCUS_19470 gene mraY 160849 162066 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_19470 162068 163399 gene locus_tag LOCUS_19480 gene murD 162068 163399 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_19480 >Feature sequence09 259 2709 gene locus_tag LOCUS_19490 gene priA 259 2709 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 protein_id gnl|my_center|LOCUS_19490 3401 2706 gene locus_tag LOCUS_19500 3401 2706 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_19500 3551 3892 gene locus_tag LOCUS_19510 gene rpsF 3551 3892 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 protein_id gnl|my_center|LOCUS_19510 3895 4191 gene locus_tag LOCUS_19520 gene rpsR 3895 4191 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_19520 4257 4700 gene locus_tag LOCUS_19530 gene rplI 4257 4700 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P1 protein_id gnl|my_center|LOCUS_19530 4764 5237 gene locus_tag LOCUS_19540 4764 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 protein_id gnl|my_center|LOCUS_19540 5243 7243 gene locus_tag LOCUS_19550 gene ligA 5243 7243 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 protein_id gnl|my_center|LOCUS_19550 7236 7931 gene locus_tag LOCUS_19560 7236 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963951.1 protein_id gnl|my_center|LOCUS_19560 8853 7936 gene locus_tag LOCUS_19570 8853 7936 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_19570 9647 8865 gene locus_tag LOCUS_19580 9647 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 protein_id gnl|my_center|LOCUS_19580 9696 10214 gene locus_tag LOCUS_19590 9696 10214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963940.1 protein_id gnl|my_center|LOCUS_19590 10216 11094 gene locus_tag LOCUS_19600 gene dapA 10216 11094 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_19600 11191 11997 gene locus_tag LOCUS_19610 gene bamD 11191 11997 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_19610 12006 12320 gene locus_tag LOCUS_19620 12006 12320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_19620 12324 13541 gene locus_tag LOCUS_19630 gene coaBC 12324 13541 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_19630 13531 14424 gene locus_tag LOCUS_19640 13531 14424 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_19640 14453 16105 gene locus_tag LOCUS_19650 gene recN 14453 16105 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_19650 16260 17447 gene locus_tag LOCUS_19660 gene fabV 16260 17447 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N4 protein_id gnl|my_center|LOCUS_19660 18434 17829 gene locus_tag LOCUS_19670 18434 17829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764517.1 protein_id gnl|my_center|LOCUS_19670 19027 22680 gene locus_tag LOCUS_19680 19027 22680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 23272 22988 gene locus_tag LOCUS_19690 23272 22988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 23585 23322 gene locus_tag LOCUS_19700 23585 23322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 24833 23682 gene locus_tag LOCUS_19710 24833 23682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 25238 24990 gene locus_tag LOCUS_19720 25238 24990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 25753 25439 gene locus_tag LOCUS_19730 25753 25439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 26214 25750 gene locus_tag LOCUS_19740 26214 25750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 27009 26260 gene locus_tag LOCUS_19750 27009 26260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 27716 27183 gene locus_tag LOCUS_19760 27716 27183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 28436 27777 gene locus_tag LOCUS_19770 28436 27777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 29435 28863 gene locus_tag LOCUS_19780 29435 28863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 30144 29572 gene locus_tag LOCUS_19790 30144 29572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_19790 31504 30152 gene locus_tag LOCUS_19800 gene rhlE 31504 30152 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_19800 31630 31932 gene locus_tag LOCUS_19810 31630 31932 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_19810 31978 32367 gene locus_tag LOCUS_19820 31978 32367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 33144 32419 gene locus_tag LOCUS_19830 33144 32419 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_19830 36011 33180 gene locus_tag LOCUS_19840 gene uvrA2 36011 33180 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX6 protein_id gnl|my_center|LOCUS_19840 36604 36155 gene locus_tag LOCUS_19850 36604 36155 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948553.1 protein_id gnl|my_center|LOCUS_19850 36663 37184 gene locus_tag LOCUS_19860 36663 37184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 38350 37244 gene locus_tag LOCUS_19870 gene ppiA 38350 37244 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963995.1 protein_id gnl|my_center|LOCUS_19870 39388 38363 gene locus_tag LOCUS_19880 gene ppiA 39388 38363 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963995.1 protein_id gnl|my_center|LOCUS_19880 40073 39525 gene locus_tag LOCUS_19890 gene gldI 40073 39525 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T4 protein_id gnl|my_center|LOCUS_19890 41086 40076 gene locus_tag LOCUS_19900 gene fjo19 41086 40076 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_19900 41459 41088 gene locus_tag LOCUS_19910 gene crcB 41459 41088 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J1 protein_id gnl|my_center|LOCUS_19910 43461 41464 gene locus_tag LOCUS_19920 43461 41464 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963773.1 protein_id gnl|my_center|LOCUS_19920 44332 43493 gene locus_tag LOCUS_19930 44332 43493 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_19930 45234 44335 gene locus_tag LOCUS_19940 45234 44335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_19940 45568 46467 gene locus_tag LOCUS_19950 45568 46467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 46702 46541 gene locus_tag LOCUS_19960 46702 46541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 47745 46981 gene locus_tag LOCUS_19970 47745 46981 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_19970 48422 47754 gene locus_tag LOCUS_19980 gene lolD 48422 47754 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_19980 48571 49212 gene locus_tag LOCUS_19990 gene mrsA 48571 49212 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB5 protein_id gnl|my_center|LOCUS_19990 49228 49896 gene locus_tag LOCUS_20000 gene folE1 49228 49896 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB6 protein_id gnl|my_center|LOCUS_20000 49954 50256 gene locus_tag LOCUS_20010 49954 50256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962796.1 protein_id gnl|my_center|LOCUS_20010 50850 50323 gene locus_tag LOCUS_20020 50850 50323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 51230 50856 gene locus_tag LOCUS_20030 51230 50856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 51640 51317 gene locus_tag LOCUS_20040 51640 51317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 protein_id gnl|my_center|LOCUS_20040 52135 51647 gene locus_tag LOCUS_20050 52135 51647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962798.1 protein_id gnl|my_center|LOCUS_20050 52786 52154 gene locus_tag LOCUS_20060 52786 52154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962799.1 protein_id gnl|my_center|LOCUS_20060 53785 52829 gene locus_tag LOCUS_20070 gene serA 53785 52829 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_20070 54918 53848 gene locus_tag LOCUS_20080 gene serC 54918 53848 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 protein_id gnl|my_center|LOCUS_20080 56120 55062 gene locus_tag LOCUS_20090 56120 55062 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_20090 56241 56591 gene locus_tag LOCUS_20100 gene fdx1 56241 56591 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_20100 56623 57033 gene locus_tag LOCUS_20110 56623 57033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 57317 58396 gene locus_tag LOCUS_20120 57317 58396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962804.1 protein_id gnl|my_center|LOCUS_20120 58983 58450 gene locus_tag LOCUS_20130 58983 58450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 60442 59159 gene locus_tag LOCUS_20140 60442 59159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20140 61760 60399 gene locus_tag LOCUS_20150 61760 60399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20150 61950 63044 gene locus_tag LOCUS_20160 gene engD 61950 63044 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC6 protein_id gnl|my_center|LOCUS_20160 63048 63695 gene locus_tag LOCUS_20170 63048 63695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 63776 64276 gene locus_tag LOCUS_20180 63776 64276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 64308 64979 gene locus_tag LOCUS_20190 64308 64979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 64981 65664 gene locus_tag LOCUS_20200 64981 65664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938028.1 protein_id gnl|my_center|LOCUS_20200 66259 65690 gene locus_tag LOCUS_20210 66259 65690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 66463 67302 gene locus_tag LOCUS_20220 66463 67302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 68313 67360 gene locus_tag LOCUS_20230 68313 67360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 68590 70446 gene locus_tag LOCUS_20240 gene parE 68590 70446 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_20240 70522 73215 gene locus_tag LOCUS_20250 gene parC 70522 73215 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_20250 73360 74367 gene locus_tag LOCUS_20260 73360 74367 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267946.1 protein_id gnl|my_center|LOCUS_20260 74435 74797 gene locus_tag LOCUS_20270 74435 74797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 74989 75807 gene locus_tag LOCUS_20280 74989 75807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 75917 76393 gene locus_tag LOCUS_20290 75917 76393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_20290 76399 76962 gene locus_tag LOCUS_20300 76399 76962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 77057 79564 gene locus_tag LOCUS_20310 77057 79564 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 protein_id gnl|my_center|LOCUS_20310 79568 81823 gene locus_tag LOCUS_20320 79568 81823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 81972 83420 gene locus_tag LOCUS_20330 81972 83420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962728.1 protein_id gnl|my_center|LOCUS_20330 83422 85212 gene locus_tag LOCUS_20340 83422 85212 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 protein_id gnl|my_center|LOCUS_20340 86110 85340 gene locus_tag LOCUS_20350 86110 85340 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 protein_id gnl|my_center|LOCUS_20350 86549 86166 gene locus_tag LOCUS_20360 86549 86166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962882.1 protein_id gnl|my_center|LOCUS_20360 87133 86594 gene locus_tag LOCUS_20370 87133 86594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_20370 87389 87162 gene locus_tag LOCUS_20380 87389 87162 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962883.1 protein_id gnl|my_center|LOCUS_20380 88011 87394 gene locus_tag LOCUS_20390 88011 87394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 88563 88099 gene locus_tag LOCUS_20400 88563 88099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 89388 88576 gene locus_tag LOCUS_20410 gene murQ 89388 88576 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_20410 90173 89463 gene locus_tag LOCUS_20420 90173 89463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_20420 90916 90173 gene locus_tag LOCUS_20430 90916 90173 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_20430 91138 92304 gene locus_tag LOCUS_20440 91138 92304 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_20440 92316 92549 gene locus_tag LOCUS_20450 92316 92549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962889.1 protein_id gnl|my_center|LOCUS_20450 92869 92588 gene locus_tag LOCUS_20460 92869 92588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 93099 93746 gene locus_tag LOCUS_20470 93099 93746 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_20470 93750 94643 gene locus_tag LOCUS_20480 93750 94643 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_20480 94644 95021 gene locus_tag LOCUS_20490 94644 95021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 95097 95585 gene locus_tag LOCUS_20500 95097 95585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 96303 95668 gene locus_tag LOCUS_20510 96303 95668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 96759 99614 gene locus_tag LOCUS_20520 gene carB 96759 99614 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_20520 100800 99706 gene locus_tag LOCUS_20530 100800 99706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 101327 100803 gene locus_tag LOCUS_20540 101327 100803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 102222 101539 gene locus_tag LOCUS_20550 102222 101539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 103028 102504 gene locus_tag LOCUS_20560 103028 102504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 103653 102997 gene locus_tag LOCUS_20570 103653 102997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 104041 105153 gene locus_tag LOCUS_20580 104041 105153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 105850 106383 gene locus_tag LOCUS_20590 105850 106383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 109066 106424 gene locus_tag LOCUS_20600 109066 106424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 109492 109109 gene locus_tag LOCUS_20610 109492 109109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 110244 109609 gene locus_tag LOCUS_20620 110244 109609 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461763.1 protein_id gnl|my_center|LOCUS_20620 110470 113469 gene locus_tag LOCUS_20630 110470 113469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 114044 113544 gene locus_tag LOCUS_20640 114044 113544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 114706 114104 gene locus_tag LOCUS_20650 114706 114104 CDS product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028480.1 protein_id gnl|my_center|LOCUS_20650 114820 115164 gene locus_tag LOCUS_20660 114820 115164 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206336.1 protein_id gnl|my_center|LOCUS_20660 115938 115168 gene locus_tag LOCUS_20670 115938 115168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_20670 117325 116048 gene locus_tag LOCUS_20680 117325 116048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 117607 118560 gene locus_tag LOCUS_20690 gene irk 117607 118560 CDS product inward rectifier potassium channel Irk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_20690 118946 118563 gene locus_tag LOCUS_20700 gene gloA 118946 118563 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027458.1 protein_id gnl|my_center|LOCUS_20700 120046 119024 gene locus_tag LOCUS_20710 120046 119024 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_20710 120215 120970 gene locus_tag LOCUS_20720 120215 120970 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_20720 122100 120967 gene locus_tag LOCUS_20730 gene ribBA 122100 120967 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_20730 123500 122106 gene locus_tag LOCUS_20740 123500 122106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963702.1 protein_id gnl|my_center|LOCUS_20740 124212 123544 gene locus_tag LOCUS_20750 gene lolA 124212 123544 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_20750 126661 124196 gene locus_tag LOCUS_20760 gene ftsK 126661 124196 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_20760 127068 126694 gene locus_tag LOCUS_20770 gene dgkA 127068 126694 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963705.1 protein_id gnl|my_center|LOCUS_20770 127574 127077 gene locus_tag LOCUS_20780 gene tpx 127574 127077 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZY8 protein_id gnl|my_center|LOCUS_20780 127731 128297 gene locus_tag LOCUS_20790 127731 128297 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528503.1 protein_id gnl|my_center|LOCUS_20790 129003 128359 gene locus_tag LOCUS_20800 129003 128359 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_20800 130072 129257 gene locus_tag LOCUS_20810 130072 129257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 131108 130785 gene locus_tag LOCUS_20820 131108 130785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 132383 131124 gene locus_tag LOCUS_20830 gene pyrC2 132383 131124 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_20830 134137 132380 gene locus_tag LOCUS_20840 134137 132380 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_20840 135062 134631 gene locus_tag LOCUS_20850 135062 134631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963057.1 protein_id gnl|my_center|LOCUS_20850 135579 135106 gene locus_tag LOCUS_20860 135579 135106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 136418 135633 gene locus_tag LOCUS_20870 136418 135633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 136431 136868 gene locus_tag LOCUS_20880 136431 136868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963055.1 protein_id gnl|my_center|LOCUS_20880 137034 137474 gene locus_tag LOCUS_20890 137034 137474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 138630 137521 gene locus_tag LOCUS_20900 138630 137521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 139841 138639 gene locus_tag LOCUS_20910 139841 138639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 140702 139920 gene locus_tag LOCUS_20920 140702 139920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 141476 140718 gene locus_tag LOCUS_20930 141476 140718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 141655 141473 gene locus_tag LOCUS_20940 141655 141473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 144553 141773 gene locus_tag LOCUS_20950 144553 141773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 146018 145002 gene locus_tag LOCUS_20960 146018 145002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 148201 146306 gene locus_tag LOCUS_20970 148201 146306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 149705 148260 gene locus_tag LOCUS_20980 gene srfJ 149705 148260 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636452.2 protein_id gnl|my_center|LOCUS_20980 151098 149743 gene locus_tag LOCUS_20990 151098 149743 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_20990 152921 151200 gene locus_tag LOCUS_21000 152921 151200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 154404 152932 gene locus_tag LOCUS_21010 154404 152932 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108759.1 protein_id gnl|my_center|LOCUS_21010 157366 154415 gene locus_tag LOCUS_21020 157366 154415 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_21020 159287 157644 gene locus_tag LOCUS_21030 159287 157644 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108757.1 protein_id gnl|my_center|LOCUS_21030 159848 159366 gene locus_tag LOCUS_21040 159848 159366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 160446 159841 gene locus_tag LOCUS_21050 160446 159841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 162441 160453 gene locus_tag LOCUS_21060 gene uvrB 162441 160453 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY25 protein_id gnl|my_center|LOCUS_21060 >Feature sequence10 3511 1970 gene locus_tag LOCUS_21070 gene sprC 3511 1970 CDS product adhesin SprC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962195.1 protein_id gnl|my_center|LOCUS_21070 4905 3634 gene locus_tag LOCUS_21080 gene remG 4905 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962194.1 protein_id gnl|my_center|LOCUS_21080 5367 4933 gene locus_tag LOCUS_21090 gene remF 5367 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962193.1 protein_id gnl|my_center|LOCUS_21090 5933 7081 gene locus_tag LOCUS_21100 gene holB 5933 7081 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_21100 7086 7469 gene locus_tag LOCUS_21110 7086 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962191.1 protein_id gnl|my_center|LOCUS_21110 9743 7470 gene locus_tag LOCUS_21120 9743 7470 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962188.1 protein_id gnl|my_center|LOCUS_21120 10431 9835 gene locus_tag LOCUS_21130 10431 9835 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962186.1 protein_id gnl|my_center|LOCUS_21130 11523 10666 gene locus_tag LOCUS_21140 11523 10666 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_21140 13516 11639 gene locus_tag LOCUS_21150 gene mnmG 13516 11639 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_21150 14084 13665 gene locus_tag LOCUS_21160 gene ybeY 14084 13665 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_21160 17412 14077 gene locus_tag LOCUS_21170 17412 14077 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_21170 17509 18543 gene locus_tag LOCUS_21180 17509 18543 CDS product alkane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 protein_id gnl|my_center|LOCUS_21180 18615 20117 gene locus_tag LOCUS_21190 gene gltX 18615 20117 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 protein_id gnl|my_center|LOCUS_21190 20642 20151 gene locus_tag LOCUS_21200 20642 20151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 21371 20721 gene locus_tag LOCUS_21210 21371 20721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 21471 22448 gene locus_tag LOCUS_21220 21471 22448 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_21220 24580 22898 gene locus_tag LOCUS_21230 gene glnS 24580 22898 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_21230 24696 25052 gene locus_tag LOCUS_21240 gene folB 24696 25052 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_21240 25140 25211 gene locus_tag LOCUS_t00280 25140 25211 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 26032 25385 gene locus_tag LOCUS_21250 26032 25385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 26721 26035 gene locus_tag LOCUS_21260 26721 26035 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_21260 27430 26765 gene locus_tag LOCUS_21270 27430 26765 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964577.1 protein_id gnl|my_center|LOCUS_21270 29697 27520 gene locus_tag LOCUS_21280 gene rnr 29697 27520 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_21280 29900 30139 gene locus_tag LOCUS_21290 29900 30139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 32209 30737 gene locus_tag LOCUS_21300 32209 30737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 32303 32734 gene locus_tag LOCUS_21310 gene rpiB 32303 32734 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_21310 32808 33710 gene locus_tag LOCUS_21320 gene czcD 32808 33710 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964573.1 protein_id gnl|my_center|LOCUS_21320 33741 34793 gene locus_tag LOCUS_21330 33741 34793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 34986 35804 gene locus_tag LOCUS_21340 gene nnrD 34986 35804 CDS product ADP-dependent (S)-NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW4 protein_id gnl|my_center|LOCUS_21340 35938 36501 gene locus_tag LOCUS_21350 35938 36501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 36512 38635 gene locus_tag LOCUS_21360 36512 38635 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964572.1 protein_id gnl|my_center|LOCUS_21360 39538 38639 gene locus_tag LOCUS_21370 39538 38639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 40568 39522 gene locus_tag LOCUS_21380 40568 39522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 41638 40574 gene locus_tag LOCUS_21390 41638 40574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 42389 41697 gene locus_tag LOCUS_21400 42389 41697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 42853 42392 gene locus_tag LOCUS_21410 42853 42392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 43186 42986 gene locus_tag LOCUS_21420 gene tatA 43186 42986 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G3 protein_id gnl|my_center|LOCUS_21420 43381 44187 gene locus_tag LOCUS_21430 43381 44187 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_21430 44191 45678 gene locus_tag LOCUS_21440 44191 45678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_21440 45682 46560 gene locus_tag LOCUS_21450 45682 46560 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964568.1 protein_id gnl|my_center|LOCUS_21450 46604 48295 gene locus_tag LOCUS_21460 46604 48295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_21460 48303 49277 gene locus_tag LOCUS_21470 48303 49277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 49277 50293 gene locus_tag LOCUS_21480 gene rmlB 49277 50293 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_21480 50375 51238 gene locus_tag LOCUS_21490 gene rmlA 50375 51238 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU22 protein_id gnl|my_center|LOCUS_21490 51312 51863 gene locus_tag LOCUS_21500 gene rmlC 51312 51863 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_21500 51857 52768 gene locus_tag LOCUS_21510 gene rmlD 51857 52768 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_21510 52773 53879 gene locus_tag LOCUS_21520 52773 53879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 53879 54637 gene locus_tag LOCUS_21530 53879 54637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 54637 55704 gene locus_tag LOCUS_21540 54637 55704 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_21540 55717 56775 gene locus_tag LOCUS_21550 55717 56775 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_21550 56776 57510 gene locus_tag LOCUS_21560 56776 57510 CDS product polyprenol phosphate mannosyl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_21560 57516 59351 gene locus_tag LOCUS_21570 57516 59351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 59403 59963 gene locus_tag LOCUS_21580 59403 59963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 60035 60709 gene locus_tag LOCUS_21590 60035 60709 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078432.1 protein_id gnl|my_center|LOCUS_21590 60690 61964 gene locus_tag LOCUS_21600 60690 61964 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022165.1 protein_id gnl|my_center|LOCUS_21600 61966 62775 gene locus_tag LOCUS_21610 61966 62775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 62765 63997 gene locus_tag LOCUS_21620 62765 63997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 65036 63969 gene locus_tag LOCUS_21630 65036 63969 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546846.1 protein_id gnl|my_center|LOCUS_21630 65091 66254 gene locus_tag LOCUS_21640 65091 66254 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808446.1 protein_id gnl|my_center|LOCUS_21640 66285 67385 gene locus_tag LOCUS_21650 gene rgpAc 66285 67385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269004.1 protein_id gnl|my_center|LOCUS_21650 67567 68688 gene locus_tag LOCUS_21660 67567 68688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 68690 69673 gene locus_tag LOCUS_21670 68690 69673 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_21670 69675 71039 gene locus_tag LOCUS_21680 gene wcaJ 69675 71039 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_21680 71039 71791 gene locus_tag LOCUS_21690 71039 71791 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964562.1 protein_id gnl|my_center|LOCUS_21690 73098 71788 gene locus_tag LOCUS_21700 gene capK 73098 71788 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964561.1 protein_id gnl|my_center|LOCUS_21700 73214 74485 gene locus_tag LOCUS_21710 gene purD 73214 74485 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_21710 74741 74511 gene locus_tag LOCUS_21720 74741 74511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 74788 75714 gene locus_tag LOCUS_21730 74788 75714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964559.1 protein_id gnl|my_center|LOCUS_21730 76362 75709 gene locus_tag LOCUS_21740 gene upp 76362 75709 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_21740 76436 77041 gene locus_tag LOCUS_21750 76436 77041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_21750 77053 78093 gene locus_tag LOCUS_21760 77053 78093 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964556.1 protein_id gnl|my_center|LOCUS_21760 78733 78083 gene locus_tag LOCUS_21770 78733 78083 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_21770 79053 80021 gene locus_tag LOCUS_21780 gene trpS 79053 80021 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_21780 80719 80075 gene locus_tag LOCUS_21790 80719 80075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 81380 80712 gene locus_tag LOCUS_21800 81380 80712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 81498 82058 gene locus_tag LOCUS_21810 81498 82058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_21810 84700 82124 gene locus_tag LOCUS_21820 gene ppc 84700 82124 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8N7 protein_id gnl|my_center|LOCUS_21820 85909 84797 gene locus_tag LOCUS_21830 gene smf 85909 84797 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_21830 87046 85988 gene locus_tag LOCUS_21840 87046 85988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_21840 88121 87132 gene locus_tag LOCUS_21850 gene hemB 88121 87132 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN2 protein_id gnl|my_center|LOCUS_21850 88225 90786 gene locus_tag LOCUS_21860 88225 90786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 90847 91482 gene locus_tag LOCUS_21870 90847 91482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 91485 93368 gene locus_tag LOCUS_21880 91485 93368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 94383 93481 gene locus_tag LOCUS_21890 94383 93481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962217.1 protein_id gnl|my_center|LOCUS_21890 95422 94520 gene locus_tag LOCUS_21900 gene hemF 95422 94520 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_21900 96028 95456 gene locus_tag LOCUS_21910 96028 95456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962219.1 protein_id gnl|my_center|LOCUS_21910 97096 96065 gene locus_tag LOCUS_21920 gene hemE 97096 96065 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 protein_id gnl|my_center|LOCUS_21920 97798 97130 gene locus_tag LOCUS_21930 gene hemD 97798 97130 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962223.1 protein_id gnl|my_center|LOCUS_21930 98515 97799 gene locus_tag LOCUS_21940 98515 97799 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 protein_id gnl|my_center|LOCUS_21940 100269 98527 gene locus_tag LOCUS_21950 100269 98527 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_21950 101202 100282 gene locus_tag LOCUS_21960 gene hemC 101202 100282 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP0 protein_id gnl|my_center|LOCUS_21960 102459 101212 gene locus_tag LOCUS_21970 gene hemA 102459 101212 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 protein_id gnl|my_center|LOCUS_21970 102688 103560 gene locus_tag LOCUS_21980 102688 103560 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_21980 103677 104714 gene locus_tag LOCUS_21990 gene hemH 103677 104714 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_21990 104714 106066 gene locus_tag LOCUS_22000 104714 106066 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_22000 106056 106607 gene locus_tag LOCUS_22010 106056 106607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_22010 106667 108079 gene locus_tag LOCUS_22020 106667 108079 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_22020 108116 108886 gene locus_tag LOCUS_22030 gene crt 108116 108886 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_22030 108898 110490 gene locus_tag LOCUS_22040 108898 110490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 111156 110512 gene locus_tag LOCUS_22050 111156 110512 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_22050 112222 111230 gene locus_tag LOCUS_22060 112222 111230 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_22060 112961 112227 gene locus_tag LOCUS_22070 gene plsC 112961 112227 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_22070 113459 113049 gene locus_tag LOCUS_22080 gene yqiW 113459 113049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_22080 114699 113563 gene locus_tag LOCUS_22090 gene crtY 114699 113563 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_22090 114827 115312 gene locus_tag LOCUS_22100 114827 115312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963609.1 protein_id gnl|my_center|LOCUS_22100 117569 115317 gene locus_tag LOCUS_22110 117569 115317 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_22110 117659 118306 gene locus_tag LOCUS_22120 gene sirR 117659 118306 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_22120 118309 119127 gene locus_tag LOCUS_22130 118309 119127 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_22130 119174 119569 gene locus_tag LOCUS_22140 119174 119569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 120559 119705 gene locus_tag LOCUS_22150 120559 119705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 122707 120599 gene locus_tag LOCUS_22160 gene feoB 122707 120599 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_22160 122947 122711 gene locus_tag LOCUS_22170 gene feoA 122947 122711 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_22170 123691 123029 gene locus_tag LOCUS_22180 123691 123029 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_22180 123772 127248 gene locus_tag LOCUS_22190 123772 127248 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_22190 127310 130168 gene locus_tag LOCUS_22200 127310 130168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 130233 132317 gene locus_tag LOCUS_22210 gene pepO 130233 132317 CDS product endothelin-converting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962266.1 protein_id gnl|my_center|LOCUS_22210 133310 132387 gene locus_tag LOCUS_22220 gene yedA 133310 132387 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038991.1 protein_id gnl|my_center|LOCUS_22220 134149 133313 gene locus_tag LOCUS_22230 gene yeeZ 134149 133313 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962265.1 protein_id gnl|my_center|LOCUS_22230 135575 134142 gene locus_tag LOCUS_22240 135575 134142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 136003 135566 gene locus_tag LOCUS_22250 136003 135566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 136395 136045 gene locus_tag LOCUS_22260 136395 136045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_22260 136934 136398 gene locus_tag LOCUS_22270 136934 136398 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 protein_id gnl|my_center|LOCUS_22270 137469 136990 gene locus_tag LOCUS_22280 137469 136990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 138995 137469 gene locus_tag LOCUS_22290 138995 137469 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_22290 139145 140932 gene locus_tag LOCUS_22300 139145 140932 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_22300 141145 141468 gene locus_tag LOCUS_22310 141145 141468 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_22310 141535 141975 gene locus_tag LOCUS_22320 141535 141975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 142871 141972 gene locus_tag LOCUS_22330 142871 141972 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326200.1 protein_id gnl|my_center|LOCUS_22330 144263 142875 gene locus_tag LOCUS_22340 144263 142875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 144977 144354 gene locus_tag LOCUS_22350 144977 144354 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765580.1 protein_id gnl|my_center|LOCUS_22350 145696 144977 gene locus_tag LOCUS_22360 145696 144977 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_22360 145811 146563 gene locus_tag LOCUS_22370 145811 146563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 147318 146560 gene locus_tag LOCUS_22380 147318 146560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 147475 148161 gene locus_tag LOCUS_22390 147475 148161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 148261 150615 gene locus_tag LOCUS_22400 148261 150615 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_22400 150632 151633 gene locus_tag LOCUS_22410 150632 151633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 151597 151881 gene locus_tag LOCUS_22420 151597 151881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 151859 152827 gene locus_tag LOCUS_22430 151859 152827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 152840 155011 gene locus_tag LOCUS_22440 152840 155011 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963981.1 protein_id gnl|my_center|LOCUS_22440 155102 155254 gene locus_tag LOCUS_22450 155102 155254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 155322 155471 gene locus_tag LOCUS_22460 155322 155471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 155550 155702 gene locus_tag LOCUS_22470 155550 155702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence11 1075 1584 gene locus_tag LOCUS_22480 1075 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 4141 1661 gene locus_tag LOCUS_22490 4141 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 4439 4152 gene locus_tag LOCUS_22500 4439 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 4451 5800 gene locus_tag LOCUS_22510 4451 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 5845 6204 gene locus_tag LOCUS_22520 5845 6204 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525197.1 protein_id gnl|my_center|LOCUS_22520 6270 6557 gene locus_tag LOCUS_22530 gene parD-1 6270 6557 CDS product antitoxin ParD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918759.1 protein_id gnl|my_center|LOCUS_22530 6557 6853 gene locus_tag LOCUS_22540 gene parE1 6557 6853 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHG7 protein_id gnl|my_center|LOCUS_22540 7339 7007 gene locus_tag LOCUS_22550 7339 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22550 8792 7245 gene locus_tag LOCUS_22560 8792 7245 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22560 10508 9036 gene locus_tag LOCUS_22570 gene guaB 10508 9036 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_22570 11390 10587 gene locus_tag LOCUS_22580 11390 10587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 12293 11922 gene locus_tag LOCUS_22590 12293 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 12743 12453 gene locus_tag LOCUS_22600 12743 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 13272 12706 gene locus_tag LOCUS_22610 13272 12706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 15009 13315 gene locus_tag LOCUS_22620 gene abiR 15009 13315 CDS product putative abortive infection phage resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_268450.1 protein_id gnl|my_center|LOCUS_22620 16004 15288 gene locus_tag LOCUS_22630 16004 15288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870221.1 protein_id gnl|my_center|LOCUS_22630 16920 16414 gene locus_tag LOCUS_22640 16920 16414 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_22640 17623 17069 gene locus_tag LOCUS_22650 17623 17069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 18743 17718 gene locus_tag LOCUS_22660 18743 17718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 19685 18882 gene locus_tag LOCUS_22670 19685 18882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 20332 20018 gene locus_tag LOCUS_22680 20332 20018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 21358 20570 gene locus_tag LOCUS_22690 21358 20570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 22610 21681 gene locus_tag LOCUS_22700 22610 21681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 24053 22656 gene locus_tag LOCUS_22710 24053 22656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 24791 24390 gene locus_tag LOCUS_22720 24791 24390 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 protein_id gnl|my_center|LOCUS_22720 25911 25012 gene locus_tag LOCUS_22730 25911 25012 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962922.1 protein_id gnl|my_center|LOCUS_22730 26002 26622 gene locus_tag LOCUS_22740 26002 26622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 27672 26761 gene locus_tag LOCUS_22750 27672 26761 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_22750 28598 27720 gene locus_tag LOCUS_22760 28598 27720 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706541.1 protein_id gnl|my_center|LOCUS_22760 29855 28908 gene locus_tag LOCUS_22770 29855 28908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 30746 30156 gene locus_tag LOCUS_22780 30746 30156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 31232 30807 gene locus_tag LOCUS_22790 31232 30807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 31901 31404 gene locus_tag LOCUS_22800 31901 31404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 33632 33180 gene locus_tag LOCUS_22810 33632 33180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 34388 33651 gene locus_tag LOCUS_22820 gene dltE 34388 33651 CDS product putative oxidoreductase DltE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39577 protein_id gnl|my_center|LOCUS_22820 34810 34385 gene locus_tag LOCUS_22830 34810 34385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 35455 34880 gene locus_tag LOCUS_22840 35455 34880 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_22840 36962 36801 gene locus_tag LOCUS_22850 36962 36801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 37493 37305 gene locus_tag LOCUS_22860 37493 37305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 37870 37646 gene locus_tag LOCUS_22870 37870 37646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 38834 38238 gene locus_tag LOCUS_22880 38834 38238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 39816 38989 gene locus_tag LOCUS_22890 39816 38989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 42595 40160 gene locus_tag LOCUS_22900 gene fecA 42595 40160 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_22900 43862 42576 gene locus_tag LOCUS_22910 43862 42576 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_22910 45064 43949 gene locus_tag LOCUS_22920 gene irpA 45064 43949 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_22920 46332 45130 gene locus_tag LOCUS_22930 46332 45130 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_22930 46757 47227 gene locus_tag LOCUS_22940 46757 47227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 47618 47241 gene locus_tag LOCUS_22950 47618 47241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 48493 47630 gene locus_tag LOCUS_22960 gene mvaB 48493 47630 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_22960 49582 48524 gene locus_tag LOCUS_22970 gene pyrD 49582 48524 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_22970 50117 49623 gene locus_tag LOCUS_22980 50117 49623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963236.1 protein_id gnl|my_center|LOCUS_22980 50895 50122 gene locus_tag LOCUS_22990 gene phnP 50895 50122 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_22990 50994 52460 gene locus_tag LOCUS_23000 50994 52460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_23000 53078 52626 gene locus_tag LOCUS_23010 53078 52626 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_23010 53151 53810 gene locus_tag LOCUS_23020 gene nth 53151 53810 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_23020 53974 53831 gene locus_tag LOCUS_23030 53974 53831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 54711 54031 gene locus_tag LOCUS_23040 54711 54031 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_23040 54814 54632 gene locus_tag LOCUS_23050 54814 54632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 59857 54860 gene locus_tag LOCUS_23060 59857 54860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 62099 60081 gene locus_tag LOCUS_23070 62099 60081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 64225 62288 gene locus_tag LOCUS_23080 64225 62288 CDS product putative glucosamine-6-phosphate deaminase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB53 protein_id gnl|my_center|LOCUS_23080 65880 64300 gene locus_tag LOCUS_23090 65880 64300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797527.1 protein_id gnl|my_center|LOCUS_23090 68917 65891 gene locus_tag LOCUS_23100 68917 65891 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_23100 69214 70254 gene locus_tag LOCUS_23110 69214 70254 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_23110 70244 70942 gene locus_tag LOCUS_23120 70244 70942 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_23120 72879 71014 gene locus_tag LOCUS_23130 72879 71014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 74325 72910 gene locus_tag LOCUS_23140 74325 72910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 76241 74349 gene locus_tag LOCUS_23150 76241 74349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 78786 76417 gene locus_tag LOCUS_23160 78786 76417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 81312 79168 gene locus_tag LOCUS_23170 81312 79168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 82194 81436 gene locus_tag LOCUS_23180 82194 81436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 84526 82202 gene locus_tag LOCUS_23190 84526 82202 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_23190 86256 84604 gene locus_tag LOCUS_23200 86256 84604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 87824 86271 gene locus_tag LOCUS_23210 87824 86271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 89342 87837 gene locus_tag LOCUS_23220 89342 87837 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_23220 92443 89354 gene locus_tag LOCUS_23230 92443 89354 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_23230 95378 92634 gene locus_tag LOCUS_23240 95378 92634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_23240 96797 95556 gene locus_tag LOCUS_23250 96797 95556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 97165 99957 gene locus_tag LOCUS_23260 gene uvrA1 97165 99957 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_23260 100019 100306 gene locus_tag LOCUS_23270 100019 100306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 100432 100905 gene locus_tag LOCUS_23280 gene rlmH 100432 100905 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_23280 101019 100837 gene locus_tag LOCUS_23290 101019 100837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 101066 101551 gene locus_tag LOCUS_23300 101066 101551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962817.1 protein_id gnl|my_center|LOCUS_23300 102233 101607 gene locus_tag LOCUS_23310 102233 101607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 103185 102358 gene locus_tag LOCUS_23320 gene folP 103185 102358 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_23320 103361 103903 gene locus_tag LOCUS_23330 103361 103903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_23330 104021 105136 gene locus_tag LOCUS_23340 104021 105136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_23340 105136 105534 gene locus_tag LOCUS_23350 105136 105534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 105644 106141 gene locus_tag LOCUS_23360 gene tlpA 105644 106141 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963549.1 protein_id gnl|my_center|LOCUS_23360 106141 106890 gene locus_tag LOCUS_23370 gene tpiA 106141 106890 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI2 protein_id gnl|my_center|LOCUS_23370 107008 107796 gene locus_tag LOCUS_23380 107008 107796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 107876 110398 gene locus_tag LOCUS_23390 107876 110398 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_23390 110439 110639 gene locus_tag LOCUS_23400 110439 110639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 110710 111426 gene locus_tag LOCUS_23410 110710 111426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 111848 113698 gene locus_tag LOCUS_23420 111848 113698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 114114 114707 gene locus_tag LOCUS_23430 114114 114707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 115339 116082 gene locus_tag LOCUS_23440 115339 116082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963980.1 protein_id gnl|my_center|LOCUS_23440 117474 116581 gene locus_tag LOCUS_23450 gene pell 117474 116581 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890741.1 protein_id gnl|my_center|LOCUS_23450 117971 118801 gene locus_tag LOCUS_23460 117971 118801 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_23460 118840 119850 gene locus_tag LOCUS_23470 118840 119850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 119881 120957 gene locus_tag LOCUS_23480 119881 120957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947919.1 protein_id gnl|my_center|LOCUS_23480 121312 121956 gene locus_tag LOCUS_23490 121312 121956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 121953 122378 gene locus_tag LOCUS_23500 121953 122378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 124543 123008 gene locus_tag LOCUS_23510 124543 123008 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_23510 124706 127417 gene locus_tag LOCUS_23520 124706 127417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 127796 127536 gene locus_tag LOCUS_23530 127796 127536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 127859 128542 gene locus_tag LOCUS_23540 127859 128542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 129067 130524 gene locus_tag LOCUS_23550 gene putP 129067 130524 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_23550 130514 130948 gene locus_tag LOCUS_23560 130514 130948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 131064 132194 gene locus_tag LOCUS_23570 131064 132194 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 protein_id gnl|my_center|LOCUS_23570 132187 133335 gene locus_tag LOCUS_23580 gene alr 132187 133335 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_23580 133337 134410 gene locus_tag LOCUS_23590 133337 134410 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_23590 136609 134486 gene locus_tag LOCUS_23600 gene dsbD 136609 134486 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_23600 137913 136609 gene locus_tag LOCUS_23610 gene tilS 137913 136609 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_23610 138304 137951 gene locus_tag LOCUS_23620 138304 137951 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_23620 139745 138447 gene locus_tag LOCUS_23630 gene pabB 139745 138447 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_23630 140001 142223 gene locus_tag LOCUS_23640 gene icd 140001 142223 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038863.1 protein_id gnl|my_center|LOCUS_23640 142981 142310 gene locus_tag LOCUS_23650 142981 142310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 143111 145489 gene locus_tag LOCUS_23660 143111 145489 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_23660 145494 146318 gene locus_tag LOCUS_23670 145494 146318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_23670 146359 147021 gene locus_tag LOCUS_23680 146359 147021 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963877.1 protein_id gnl|my_center|LOCUS_23680 147587 147018 gene locus_tag LOCUS_23690 147587 147018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence12 86 1948 gene locus_tag LOCUS_23700 86 1948 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_23700 2506 2027 gene locus_tag LOCUS_23710 2506 2027 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_23710 2581 3198 gene locus_tag LOCUS_23720 2581 3198 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022240.1 protein_id gnl|my_center|LOCUS_23720 4328 3885 gene locus_tag LOCUS_23730 4328 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 4718 4365 gene locus_tag LOCUS_23740 4718 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 5539 4787 gene locus_tag LOCUS_23750 5539 4787 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_23750 9050 5541 gene locus_tag LOCUS_23760 9050 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 12484 9119 gene locus_tag LOCUS_23770 12484 9119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_23770 13840 12587 gene locus_tag LOCUS_23780 gene lysC 13840 12587 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_23780 14382 13906 gene locus_tag LOCUS_23790 14382 13906 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_23790 14612 15616 gene locus_tag LOCUS_23800 gene fbp 14612 15616 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWD9 protein_id gnl|my_center|LOCUS_23800 16100 15675 gene locus_tag LOCUS_23810 16100 15675 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_23810 16259 16465 gene locus_tag LOCUS_23820 16259 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 17147 16470 gene locus_tag LOCUS_23830 gene rsmI 17147 16470 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 protein_id gnl|my_center|LOCUS_23830 18004 17150 gene locus_tag LOCUS_23840 18004 17150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963207.1 protein_id gnl|my_center|LOCUS_23840 18106 18711 gene locus_tag LOCUS_23850 gene tdk 18106 18711 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_23850 18712 21153 gene locus_tag LOCUS_23860 gene mur/alr 18712 21153 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_23860 21221 21625 gene locus_tag LOCUS_23870 gene mscL 21221 21625 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K46 protein_id gnl|my_center|LOCUS_23870 21784 22773 gene locus_tag LOCUS_23880 gene asd 21784 22773 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_23880 23467 22832 gene locus_tag LOCUS_23890 23467 22832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 23892 23665 gene locus_tag LOCUS_23900 23892 23665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 23995 26343 gene locus_tag LOCUS_23910 23995 26343 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201930.1 protein_id gnl|my_center|LOCUS_23910 26356 26916 gene locus_tag LOCUS_23920 26356 26916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 27025 29154 gene locus_tag LOCUS_23930 27025 29154 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_23930 29228 29890 gene locus_tag LOCUS_23940 29228 29890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 29997 30290 gene locus_tag LOCUS_23950 29997 30290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 31148 30348 gene locus_tag LOCUS_23960 31148 30348 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_23960 32237 31275 gene locus_tag LOCUS_23970 32237 31275 CDS product beta-Ig-H3/fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405131.1 protein_id gnl|my_center|LOCUS_23970 33145 32261 gene locus_tag LOCUS_23980 33145 32261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 33087 33335 gene locus_tag LOCUS_23990 33087 33335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 34053 33319 gene locus_tag LOCUS_24000 gene mtgA 34053 33319 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H228 protein_id gnl|my_center|LOCUS_24000 35169 34057 gene locus_tag LOCUS_24010 35169 34057 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_24010 35861 35169 gene locus_tag LOCUS_24020 35861 35169 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964128.1 protein_id gnl|my_center|LOCUS_24020 37086 35863 gene locus_tag LOCUS_24030 gene gltP 37086 35863 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_24030 37387 41001 gene locus_tag LOCUS_24040 37387 41001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 41124 43019 gene locus_tag LOCUS_24050 gene pop 41124 43019 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964457.1 protein_id gnl|my_center|LOCUS_24050 43099 43611 gene locus_tag LOCUS_24060 43099 43611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962280.1 protein_id gnl|my_center|LOCUS_24060 45000 43648 gene locus_tag LOCUS_24070 gene accC 45000 43648 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_24070 45616 45113 gene locus_tag LOCUS_24080 gene accB 45616 45113 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_24080 46635 45637 gene locus_tag LOCUS_24090 gene fabH3 46635 45637 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_24090 46990 46796 gene locus_tag LOCUS_24100 gene rpmF 46990 46796 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_24100 47533 47000 gene locus_tag LOCUS_24110 47533 47000 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_24110 48664 47621 gene locus_tag LOCUS_24120 gene pdxA 48664 47621 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_24120 48724 49314 gene locus_tag LOCUS_24130 gene ribE 48724 49314 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_24130 49804 49730 gene locus_tag LOCUS_t00290 49804 49730 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 50264 49863 gene locus_tag LOCUS_24140 50264 49863 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_24140 50434 50826 gene locus_tag LOCUS_24150 gene rbfA 50434 50826 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 protein_id gnl|my_center|LOCUS_24150 50829 52028 gene locus_tag LOCUS_24160 50829 52028 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_24160 52244 53497 gene locus_tag LOCUS_24170 52244 53497 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362019.1 protein_id gnl|my_center|LOCUS_24170 53502 54497 gene locus_tag LOCUS_24180 53502 54497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 54576 54863 gene locus_tag LOCUS_24190 54576 54863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 55058 55402 gene locus_tag LOCUS_24200 55058 55402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 55496 57667 gene locus_tag LOCUS_24210 55496 57667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 57846 58133 gene locus_tag LOCUS_24220 57846 58133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 58452 59582 gene locus_tag LOCUS_24230 58452 59582 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 protein_id gnl|my_center|LOCUS_24230 59584 60081 gene locus_tag LOCUS_24240 59584 60081 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544978.1 protein_id gnl|my_center|LOCUS_24240 60242 60162 gene locus_tag LOCUS_t00300 60242 60162 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 60420 61361 gene locus_tag LOCUS_24250 gene prsA 60420 61361 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_24250 61439 62041 gene locus_tag LOCUS_24260 gene rplY 61439 62041 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 protein_id gnl|my_center|LOCUS_24260 62241 62861 gene locus_tag LOCUS_24270 gene pth 62241 62861 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_24270 62910 63443 gene locus_tag LOCUS_24280 62910 63443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 66746 63498 gene locus_tag LOCUS_24290 gene fpp1 66746 63498 CDS product metalloprotease Fpp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962407.1 protein_id gnl|my_center|LOCUS_24290 67189 66926 gene locus_tag LOCUS_24300 67189 66926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 67486 67641 gene locus_tag LOCUS_24310 67486 67641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 67829 67644 gene locus_tag LOCUS_24320 67829 67644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24320 68407 68222 gene locus_tag LOCUS_24330 68407 68222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24330 69362 68973 gene locus_tag LOCUS_24340 69362 68973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24340 69784 69620 gene locus_tag LOCUS_24350 69784 69620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24350 70154 72217 gene locus_tag LOCUS_24360 70154 72217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 72324 73253 gene locus_tag LOCUS_24370 gene ribF 72324 73253 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_24370 73253 74551 gene locus_tag LOCUS_24380 73253 74551 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_24380 74698 75072 gene locus_tag LOCUS_24390 74698 75072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 75138 76223 gene locus_tag LOCUS_24400 gene bioB 75138 76223 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_24400 76296 77159 gene locus_tag LOCUS_24410 76296 77159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 78582 77194 gene locus_tag LOCUS_24420 78582 77194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_24420 82768 78686 gene locus_tag LOCUS_24430 82768 78686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 87631 82916 gene locus_tag LOCUS_24440 87631 82916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 87744 88232 gene locus_tag LOCUS_24450 gene recX 87744 88232 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_24450 88307 89353 gene locus_tag LOCUS_24460 gene thiL 88307 89353 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_24460 91005 89461 gene locus_tag LOCUS_24470 gene glyS 91005 89461 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2A9 protein_id gnl|my_center|LOCUS_24470 91899 91066 gene locus_tag LOCUS_24480 91899 91066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964516.1 protein_id gnl|my_center|LOCUS_24480 91932 92645 gene locus_tag LOCUS_24490 91932 92645 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_24490 92715 94328 gene locus_tag LOCUS_24500 92715 94328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_24500 95097 94270 gene locus_tag LOCUS_24510 95097 94270 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_24510 95233 96159 gene locus_tag LOCUS_24520 95233 96159 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_24520 96244 98142 gene locus_tag LOCUS_24530 gene purF 96244 98142 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_24530 99167 98559 gene locus_tag LOCUS_24540 gene sodA 99167 98559 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_24540 99276 102437 gene locus_tag LOCUS_24550 99276 102437 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_24550 102468 103664 gene locus_tag LOCUS_24560 gene kbl 102468 103664 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_24560 103766 105169 gene locus_tag LOCUS_24570 103766 105169 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_24570 105235 108024 gene locus_tag LOCUS_24580 105235 108024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_24580 108803 108021 gene locus_tag LOCUS_24590 108803 108021 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_24590 108881 109846 gene locus_tag LOCUS_24600 108881 109846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 110373 109885 gene locus_tag LOCUS_24610 110373 109885 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_24610 110827 111177 gene locus_tag LOCUS_24620 110827 111177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 112557 111265 gene locus_tag LOCUS_24630 gene pepP 112557 111265 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_24630 113298 112699 gene locus_tag LOCUS_24640 113298 112699 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762221.1 protein_id gnl|my_center|LOCUS_24640 113406 116204 gene locus_tag LOCUS_24650 113406 116204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 116499 116251 gene locus_tag LOCUS_24660 116499 116251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 116646 118727 gene locus_tag LOCUS_24670 116646 118727 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692046.1 protein_id gnl|my_center|LOCUS_24670 119164 118733 gene locus_tag LOCUS_24680 119164 118733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 120274 119165 gene locus_tag LOCUS_24690 120274 119165 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_24690 120666 120373 gene locus_tag LOCUS_24700 120666 120373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 120887 120657 gene locus_tag LOCUS_24710 120887 120657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 122309 121023 gene locus_tag LOCUS_24720 122309 121023 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787342.1 protein_id gnl|my_center|LOCUS_24720 123934 122333 gene locus_tag LOCUS_24730 gene aceB 123934 122333 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HM57 protein_id gnl|my_center|LOCUS_24730 124056 125537 gene locus_tag LOCUS_24740 124056 125537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 125685 126632 gene locus_tag LOCUS_24750 125685 126632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 126645 126878 gene locus_tag LOCUS_24760 126645 126878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 126982 127917 gene locus_tag LOCUS_24770 126982 127917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 127910 128098 gene locus_tag LOCUS_24780 127910 128098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 128101 129177 gene locus_tag LOCUS_24790 128101 129177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 130539 129184 gene locus_tag LOCUS_24800 130539 129184 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475806.1 protein_id gnl|my_center|LOCUS_24800 130830 131705 gene locus_tag LOCUS_24810 130830 131705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 131846 132712 gene locus_tag LOCUS_24820 131846 132712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 132730 134739 gene locus_tag LOCUS_24830 gene sdhA 132730 134739 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_24830 134746 135504 gene locus_tag LOCUS_24840 gene sdhB 134746 135504 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_24840 136168 135575 gene locus_tag LOCUS_24850 gene lspA 136168 135575 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_24850 136631 136251 gene locus_tag LOCUS_24860 gene dksA 136631 136251 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_24860 140092 136691 gene locus_tag LOCUS_24870 gene ileS 140092 136691 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_24870 140413 141450 gene locus_tag LOCUS_24880 140413 141450 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_24880 141607 142074 gene locus_tag LOCUS_24890 141607 142074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 142288 142746 gene locus_tag LOCUS_24900 142288 142746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 142920 143405 gene locus_tag LOCUS_24910 142920 143405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence13 14 101 gene locus_tag LOCUS_r00010 14 101 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 73 percent of the 5S ribosomal RNA 954 322 gene locus_tag LOCUS_24920 gene nth 954 322 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F482 protein_id gnl|my_center|LOCUS_24920 2170 1031 gene locus_tag LOCUS_24930 2170 1031 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_24930 2264 3328 gene locus_tag LOCUS_24940 2264 3328 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_24940 4172 3321 gene locus_tag LOCUS_24950 4172 3321 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_24950 4805 4212 gene locus_tag LOCUS_24960 4805 4212 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258084.1 protein_id gnl|my_center|LOCUS_24960 4980 6206 gene locus_tag LOCUS_24970 4980 6206 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_24970 6232 7602 gene locus_tag LOCUS_24980 6232 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883648.1 protein_id gnl|my_center|LOCUS_24980 7651 8355 gene locus_tag LOCUS_24990 7651 8355 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_24990 8355 8750 gene locus_tag LOCUS_25000 8355 8750 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_25000 8888 9694 gene locus_tag LOCUS_25010 8888 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 9822 11036 gene locus_tag LOCUS_25020 gene folC 9822 11036 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_25020 11096 11171 gene locus_tag LOCUS_t00310 11096 11171 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11383 11468 gene locus_tag LOCUS_t00320 11383 11468 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11966 11580 gene locus_tag LOCUS_25030 11966 11580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 12096 13004 gene locus_tag LOCUS_25040 12096 13004 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528028.1 protein_id gnl|my_center|LOCUS_25040 13015 13266 gene locus_tag LOCUS_25050 13015 13266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 13988 13356 gene locus_tag LOCUS_25060 13988 13356 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 protein_id gnl|my_center|LOCUS_25060 14090 14455 gene locus_tag LOCUS_25070 14090 14455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 14546 15310 gene locus_tag LOCUS_25080 14546 15310 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_25080 15330 16244 gene locus_tag LOCUS_25090 15330 16244 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_25090 16323 16889 gene locus_tag LOCUS_25100 16323 16889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 17005 17502 gene locus_tag LOCUS_25110 17005 17502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 17512 17847 gene locus_tag LOCUS_25120 17512 17847 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 protein_id gnl|my_center|LOCUS_25120 17940 18992 gene locus_tag LOCUS_25130 17940 18992 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_25130 19004 19678 gene locus_tag LOCUS_25140 19004 19678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 19784 22933 gene locus_tag LOCUS_25150 19784 22933 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_25150 22946 24388 gene locus_tag LOCUS_25160 22946 24388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_25160 24396 25730 gene locus_tag LOCUS_25170 24396 25730 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943755.1 protein_id gnl|my_center|LOCUS_25170 25715 26542 gene locus_tag LOCUS_25180 25715 26542 CDS product metallophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_25180 26544 27146 gene locus_tag LOCUS_25190 26544 27146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_25190 27146 27961 gene locus_tag LOCUS_25200 gene deoD 27146 27961 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH2 protein_id gnl|my_center|LOCUS_25200 27995 28963 gene locus_tag LOCUS_25210 27995 28963 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_25210 29063 29881 gene locus_tag LOCUS_25220 29063 29881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 29890 30762 gene locus_tag LOCUS_25230 29890 30762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 30767 31777 gene locus_tag LOCUS_25240 30767 31777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 31803 32639 gene locus_tag LOCUS_25250 31803 32639 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768221.1 protein_id gnl|my_center|LOCUS_25250 32664 33464 gene locus_tag LOCUS_25260 32664 33464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_25260 33475 34050 gene locus_tag LOCUS_25270 33475 34050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 34295 35023 gene locus_tag LOCUS_25280 34295 35023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 36064 35072 gene locus_tag LOCUS_25290 36064 35072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 37230 36067 gene locus_tag LOCUS_25300 37230 36067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 37466 38164 gene locus_tag LOCUS_25310 37466 38164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 38171 39085 gene locus_tag LOCUS_25320 38171 39085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 39154 40446 gene locus_tag LOCUS_25330 39154 40446 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812847.1 protein_id gnl|my_center|LOCUS_25330 40446 42308 gene locus_tag LOCUS_25340 40446 42308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 42377 42784 gene locus_tag LOCUS_25350 42377 42784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 42781 43479 gene locus_tag LOCUS_25360 42781 43479 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_25360 43479 44963 gene locus_tag LOCUS_25370 43479 44963 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_25370 44966 46297 gene locus_tag LOCUS_25380 44966 46297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_25380 46394 46618 gene locus_tag LOCUS_25390 46394 46618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 48001 46721 gene locus_tag LOCUS_25400 gene murF 48001 46721 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_25400 49765 48068 gene locus_tag LOCUS_25410 gene gldJ 49765 48068 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_25410 49975 53844 gene locus_tag LOCUS_25420 gene porU 49975 53844 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_25420 53882 55078 gene locus_tag LOCUS_25430 gene porV 53882 55078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_25430 55143 55625 gene locus_tag LOCUS_25440 gene cdd 55143 55625 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_25440 55794 56792 gene locus_tag LOCUS_25450 gene pdhA 55794 56792 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_25450 56798 58438 gene locus_tag LOCUS_25460 gene pdhC 56798 58438 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_25460 58576 58965 gene locus_tag LOCUS_25470 58576 58965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_25470 59036 60016 gene locus_tag LOCUS_25480 59036 60016 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108159.1 protein_id gnl|my_center|LOCUS_25480 60019 60699 gene locus_tag LOCUS_25490 60019 60699 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_25490 60703 61305 gene locus_tag LOCUS_25500 60703 61305 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_25500 61313 62368 gene locus_tag LOCUS_25510 gene manC 61313 62368 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_25510 62380 63768 gene locus_tag LOCUS_25520 62380 63768 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170201.1 protein_id gnl|my_center|LOCUS_25520 64535 63765 gene locus_tag LOCUS_25530 64535 63765 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_25530 65194 64532 gene locus_tag LOCUS_25540 65194 64532 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_25540 66412 65402 gene locus_tag LOCUS_25550 66412 65402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 66715 66957 gene locus_tag LOCUS_25560 66715 66957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 68629 66929 gene locus_tag LOCUS_25570 68629 66929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 69487 68636 gene locus_tag LOCUS_25580 69487 68636 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963505.1 protein_id gnl|my_center|LOCUS_25580 69875 69504 gene locus_tag LOCUS_25590 69875 69504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 70399 69872 gene locus_tag LOCUS_25600 70399 69872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 70539 71819 gene locus_tag LOCUS_25610 70539 71819 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918189.1 protein_id gnl|my_center|LOCUS_25610 72963 71905 gene locus_tag LOCUS_25620 gene fabH1 72963 71905 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_25620 73240 76089 gene locus_tag LOCUS_25630 73240 76089 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963634.1 protein_id gnl|my_center|LOCUS_25630 76113 76865 gene locus_tag LOCUS_25640 76113 76865 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_25640 77059 78450 gene locus_tag LOCUS_25650 77059 78450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 78596 80944 gene locus_tag LOCUS_25660 78596 80944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 81019 81453 gene locus_tag LOCUS_25670 81019 81453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 81755 82237 gene locus_tag LOCUS_25680 81755 82237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 82915 82544 gene locus_tag LOCUS_25690 82915 82544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963501.1 protein_id gnl|my_center|LOCUS_25690 83172 84668 gene locus_tag LOCUS_25700 83172 84668 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_25700 84665 85990 gene locus_tag LOCUS_25710 gene xylA 84665 85990 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M2 protein_id gnl|my_center|LOCUS_25710 86024 87445 gene locus_tag LOCUS_25720 gene xylE 86024 87445 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_25720 87446 89752 gene locus_tag LOCUS_25730 87446 89752 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_25730 89760 90737 gene locus_tag LOCUS_25740 89760 90737 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYB8 protein_id gnl|my_center|LOCUS_25740 90833 94993 gene locus_tag LOCUS_25750 90833 94993 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_25750 95388 98492 gene locus_tag LOCUS_25760 95388 98492 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_25760 98543 100066 gene locus_tag LOCUS_25770 98543 100066 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108889.1 protein_id gnl|my_center|LOCUS_25770 100138 101199 gene locus_tag LOCUS_25780 100138 101199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 101403 102677 gene locus_tag LOCUS_25790 101403 102677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 102706 105336 gene locus_tag LOCUS_25800 102706 105336 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039175.1 protein_id gnl|my_center|LOCUS_25800 107159 105501 gene locus_tag LOCUS_25810 107159 105501 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_25810 107403 107179 gene locus_tag LOCUS_25820 107403 107179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 109227 107536 gene locus_tag LOCUS_25830 109227 107536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 109625 109903 gene locus_tag LOCUS_25840 109625 109903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 109986 111833 gene locus_tag LOCUS_25850 109986 111833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 111840 112766 gene locus_tag LOCUS_25860 111840 112766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 112756 112929 gene locus_tag LOCUS_25870 112756 112929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 112931 114028 gene locus_tag LOCUS_25880 112931 114028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 114163 115176 gene locus_tag LOCUS_25890 114163 115176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 115927 115424 gene locus_tag LOCUS_25900 115927 115424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 116477 116067 gene locus_tag LOCUS_25910 116477 116067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 117576 116809 gene locus_tag LOCUS_25920 117576 116809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence14 380 90 gene locus_tag LOCUS_25930 gene rplW 380 90 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ97 protein_id gnl|my_center|LOCUS_25930 1018 389 gene locus_tag LOCUS_25940 gene rplD 1018 389 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_25940 1635 1018 gene locus_tag LOCUS_25950 gene rplC 1635 1018 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ99 protein_id gnl|my_center|LOCUS_25950 2160 1855 gene locus_tag LOCUS_25960 gene rpsJ 2160 1855 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_25960 4328 2172 gene locus_tag LOCUS_25970 gene fusA 4328 2172 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 protein_id gnl|my_center|LOCUS_25970 4822 4346 gene locus_tag LOCUS_25980 gene rpsG 4822 4346 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_25980 5251 4847 gene locus_tag LOCUS_25990 gene rpsL 5251 4847 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 protein_id gnl|my_center|LOCUS_25990 5487 7151 gene locus_tag LOCUS_26000 5487 7151 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963474.1 protein_id gnl|my_center|LOCUS_26000 7247 10402 gene locus_tag LOCUS_26010 7247 10402 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_26010 10413 11837 gene locus_tag LOCUS_26020 10413 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_26020 11822 12781 gene locus_tag LOCUS_26030 11822 12781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 12789 13721 gene locus_tag LOCUS_26040 12789 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 13784 14521 gene locus_tag LOCUS_26050 13784 14521 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_26050 15417 14659 gene locus_tag LOCUS_26060 15417 14659 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963478.1 protein_id gnl|my_center|LOCUS_26060 15545 16108 gene locus_tag LOCUS_26070 15545 16108 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766588.1 protein_id gnl|my_center|LOCUS_26070 16195 16677 gene locus_tag LOCUS_26080 16195 16677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198489.1 protein_id gnl|my_center|LOCUS_26080 16757 18034 gene locus_tag LOCUS_26090 16757 18034 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_26090 18778 18041 gene locus_tag LOCUS_26100 18778 18041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 19469 18780 gene locus_tag LOCUS_26110 19469 18780 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_26110 20038 19553 gene locus_tag LOCUS_26120 20038 19553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 21332 20031 gene locus_tag LOCUS_26130 21332 20031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 21963 21334 gene locus_tag LOCUS_26140 21963 21334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860736.1 protein_id gnl|my_center|LOCUS_26140 22488 22030 gene locus_tag LOCUS_26150 22488 22030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454240.1 protein_id gnl|my_center|LOCUS_26150 22991 22488 gene locus_tag LOCUS_26160 22991 22488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 23729 23046 gene locus_tag LOCUS_26170 gene radC 23729 23046 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_26170 23778 24494 gene locus_tag LOCUS_26180 gene yijF 23778 24494 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647907.1 protein_id gnl|my_center|LOCUS_26180 25936 24581 gene locus_tag LOCUS_26190 25936 24581 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_26190 26679 25981 gene locus_tag LOCUS_26200 26679 25981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963484.1 protein_id gnl|my_center|LOCUS_26200 26877 27344 gene locus_tag LOCUS_26210 26877 27344 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 protein_id gnl|my_center|LOCUS_26210 27697 27386 gene locus_tag LOCUS_26220 27697 27386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 27809 28132 gene locus_tag LOCUS_26230 27809 28132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 28153 28527 gene locus_tag LOCUS_26240 28153 28527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962611.1 protein_id gnl|my_center|LOCUS_26240 29743 28598 gene locus_tag LOCUS_26250 29743 28598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 30887 29886 gene locus_tag LOCUS_26260 gene obg 30887 29886 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB7 protein_id gnl|my_center|LOCUS_26260 32285 31164 gene locus_tag LOCUS_26270 32285 31164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 32386 32922 gene locus_tag LOCUS_26280 32386 32922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963491.1 protein_id gnl|my_center|LOCUS_26280 33015 34169 gene locus_tag LOCUS_26290 gene purK 33015 34169 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_26290 34522 35004 gene locus_tag LOCUS_26300 gene purE 34522 35004 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_26300 35592 37619 gene locus_tag LOCUS_26310 gene dcp1 35592 37619 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_26310 37660 38898 gene locus_tag LOCUS_26320 gene pepT 37660 38898 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W1 protein_id gnl|my_center|LOCUS_26320 38955 39536 gene locus_tag LOCUS_26330 38955 39536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 39533 40153 gene locus_tag LOCUS_26340 39533 40153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 40494 40210 gene locus_tag LOCUS_26350 gene yajC 40494 40210 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_26350 41058 40504 gene locus_tag LOCUS_26360 41058 40504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_26360 42027 41080 gene locus_tag LOCUS_26370 gene nusB 42027 41080 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_26370 43212 42106 gene locus_tag LOCUS_26380 gene vdh 43212 42106 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_26380 43404 45152 gene locus_tag LOCUS_26390 43404 45152 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_26390 45223 45597 gene locus_tag LOCUS_26400 45223 45597 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_26400 45992 45648 gene locus_tag LOCUS_26410 gene csaA 45992 45648 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_26410 46443 45982 gene locus_tag LOCUS_26420 46443 45982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_26420 46566 47120 gene locus_tag LOCUS_26430 46566 47120 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_26430 47169 47549 gene locus_tag LOCUS_26440 47169 47549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 48016 47564 gene locus_tag LOCUS_26450 48016 47564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 49158 48226 gene locus_tag LOCUS_26460 gene ppiC 49158 48226 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_26460 49273 49731 gene locus_tag LOCUS_26470 49273 49731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 49880 50599 gene locus_tag LOCUS_26480 gene yoxD 49880 50599 CDS product putative oxidoreductase YoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14802 protein_id gnl|my_center|LOCUS_26480 50686 51489 gene locus_tag LOCUS_26490 50686 51489 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_26490 51486 51698 gene locus_tag LOCUS_26500 51486 51698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 52783 51941 gene locus_tag LOCUS_26510 52783 51941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766198.1 protein_id gnl|my_center|LOCUS_26510 52987 53664 gene locus_tag LOCUS_26520 gene trmD 52987 53664 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_26520 53834 54187 gene locus_tag LOCUS_26530 gene rplS 53834 54187 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_26530 54324 54698 gene locus_tag LOCUS_26540 54324 54698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 56172 54769 gene locus_tag LOCUS_26550 gene lpdA1 56172 54769 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_26550 56507 56310 gene locus_tag LOCUS_26560 56507 56310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 57018 56551 gene locus_tag LOCUS_26570 57018 56551 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_26570 57168 58370 gene locus_tag LOCUS_26580 57168 58370 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_26580 58456 59811 gene locus_tag LOCUS_26590 58456 59811 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_26590 59906 61375 gene locus_tag LOCUS_26600 59906 61375 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_26600 61528 63711 gene locus_tag LOCUS_26610 gene katG1 61528 63711 CDS product catalase-peroxidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E981 protein_id gnl|my_center|LOCUS_26610 63956 64591 gene locus_tag LOCUS_26620 63956 64591 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963839.1 protein_id gnl|my_center|LOCUS_26620 64670 64978 gene locus_tag LOCUS_26630 64670 64978 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_26630 65028 65288 gene locus_tag LOCUS_26640 65028 65288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_26640 68167 65438 gene locus_tag LOCUS_26650 68167 65438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 69338 68670 gene locus_tag LOCUS_26660 69338 68670 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140007.1 protein_id gnl|my_center|LOCUS_26660 69924 69307 gene locus_tag LOCUS_26670 gene arsC 69924 69307 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_26670 70616 70083 gene locus_tag LOCUS_26680 70616 70083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_26680 70951 70607 gene locus_tag LOCUS_26690 70951 70607 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_26690 71098 72006 gene locus_tag LOCUS_26700 71098 72006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 73840 72071 gene locus_tag LOCUS_26710 gene rpsA 73840 72071 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963900.1 protein_id gnl|my_center|LOCUS_26710 74529 74059 gene locus_tag LOCUS_26720 74529 74059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 75217 74534 gene locus_tag LOCUS_26730 gene cmk 75217 74534 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 protein_id gnl|my_center|LOCUS_26730 76308 75292 gene locus_tag LOCUS_26740 gene porQ 76308 75292 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_26740 77169 76321 gene locus_tag LOCUS_26750 77169 76321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672055.1 protein_id gnl|my_center|LOCUS_26750 79750 77297 gene locus_tag LOCUS_26760 gene lon 79750 77297 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_26760 80953 79949 gene locus_tag LOCUS_26770 80953 79949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 82283 80994 gene locus_tag LOCUS_26780 82283 80994 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_26780 83078 82347 gene locus_tag LOCUS_26790 83078 82347 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_26790 83259 84119 gene locus_tag LOCUS_26800 83259 84119 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963827.1 protein_id gnl|my_center|LOCUS_26800 84734 84174 gene locus_tag LOCUS_26810 84734 84174 CDS product chalcone isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_26810 85362 84832 gene locus_tag LOCUS_26820 85362 84832 CDS product chalcone isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964030.1 protein_id gnl|my_center|LOCUS_26820 86345 85419 gene locus_tag LOCUS_26830 gene yfkH 86345 85419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_26830 87202 86345 gene locus_tag LOCUS_26840 gene nadC 87202 86345 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_26840 87650 87309 gene locus_tag LOCUS_26850 87650 87309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963785.1 protein_id gnl|my_center|LOCUS_26850 89405 87738 gene locus_tag LOCUS_26860 gene menD 89405 87738 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_26860 89509 90009 gene locus_tag LOCUS_26870 gene yncA 89509 90009 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963787.1 protein_id gnl|my_center|LOCUS_26870 90598 90011 gene locus_tag LOCUS_26880 gene bsaA 90598 90011 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH0 protein_id gnl|my_center|LOCUS_26880 90706 91062 gene locus_tag LOCUS_26890 90706 91062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 91605 91141 gene locus_tag LOCUS_26900 91605 91141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 91733 92239 gene locus_tag LOCUS_26910 91733 92239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 92292 92624 gene locus_tag LOCUS_26920 92292 92624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 92628 93617 gene locus_tag LOCUS_26930 92628 93617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 93614 93970 gene locus_tag LOCUS_26940 93614 93970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 93954 94775 gene locus_tag LOCUS_26950 93954 94775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 94778 95686 gene locus_tag LOCUS_26960 94778 95686 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033982.1 protein_id gnl|my_center|LOCUS_26960 95683 96027 gene locus_tag LOCUS_26970 95683 96027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 96039 96425 gene locus_tag LOCUS_26980 96039 96425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 96592 97542 gene locus_tag LOCUS_26990 96592 97542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220886.1 protein_id gnl|my_center|LOCUS_26990 97542 98000 gene locus_tag LOCUS_27000 97542 98000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 99236 98022 gene locus_tag LOCUS_27010 99236 98022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 100198 99257 gene locus_tag LOCUS_27020 100198 99257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 101285 100191 gene locus_tag LOCUS_27030 101285 100191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence15 2160 316 gene locus_tag LOCUS_27040 2160 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 3192 2326 gene locus_tag LOCUS_27050 3192 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 4558 3212 gene locus_tag LOCUS_27060 gene purB 4558 3212 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_27060 5513 4731 gene locus_tag LOCUS_27070 5513 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 6036 5506 gene locus_tag LOCUS_27080 6036 5506 CDS product RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_27080 6147 6755 gene locus_tag LOCUS_27090 6147 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 6811 7467 gene locus_tag LOCUS_27100 gene trmH 6811 7467 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_27100 8554 7538 gene locus_tag LOCUS_27110 8554 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 9115 8678 gene locus_tag LOCUS_27120 9115 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 9590 9132 gene locus_tag LOCUS_27130 9590 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 10721 9948 gene locus_tag LOCUS_27140 10721 9948 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 protein_id gnl|my_center|LOCUS_27140 12658 10811 gene locus_tag LOCUS_27150 12658 10811 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_27150 12840 13451 gene locus_tag LOCUS_27160 12840 13451 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_27160 14004 13423 gene locus_tag LOCUS_27170 14004 13423 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_27170 14879 14004 gene locus_tag LOCUS_27180 14879 14004 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_27180 14962 15594 gene locus_tag LOCUS_27190 14962 15594 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 protein_id gnl|my_center|LOCUS_27190 15637 16329 gene locus_tag LOCUS_27200 15637 16329 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963019.1 protein_id gnl|my_center|LOCUS_27200 16466 16385 gene locus_tag LOCUS_t00330 16466 16385 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 17825 16650 gene locus_tag LOCUS_27210 17825 16650 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_27210 19366 17957 gene locus_tag LOCUS_27220 19366 17957 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_27220 20212 19427 gene locus_tag LOCUS_27230 20212 19427 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_27230 20868 20212 gene locus_tag LOCUS_27240 20868 20212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 21977 20973 gene locus_tag LOCUS_27250 21977 20973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 22136 23047 gene locus_tag LOCUS_27260 22136 23047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 23047 23607 gene locus_tag LOCUS_27270 23047 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 23607 24110 gene locus_tag LOCUS_27280 23607 24110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963203.1 protein_id gnl|my_center|LOCUS_27280 24214 28533 gene locus_tag LOCUS_27290 24214 28533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 28678 28857 gene locus_tag LOCUS_27300 28678 28857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 28826 29047 gene locus_tag LOCUS_27310 28826 29047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 29198 30319 gene locus_tag LOCUS_27320 29198 30319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_27320 30624 32081 gene locus_tag LOCUS_27330 30624 32081 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_27330 32351 32082 gene locus_tag LOCUS_27340 32351 32082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 32946 32356 gene locus_tag LOCUS_27350 32946 32356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 33782 32985 gene locus_tag LOCUS_27360 33782 32985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 33943 35547 gene locus_tag LOCUS_27370 33943 35547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 35673 35951 gene locus_tag LOCUS_27380 35673 35951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 37015 36137 gene locus_tag LOCUS_27390 37015 36137 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_27390 37856 37170 gene locus_tag LOCUS_27400 37856 37170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_27400 38332 37844 gene locus_tag LOCUS_27410 38332 37844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962860.1 protein_id gnl|my_center|LOCUS_27410 38747 38349 gene locus_tag LOCUS_27420 gene mrsB1 38747 38349 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963828.1 protein_id gnl|my_center|LOCUS_27420 39336 38878 gene locus_tag LOCUS_27430 39336 38878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 39860 39417 gene locus_tag LOCUS_27440 39860 39417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_27440 39906 40574 gene locus_tag LOCUS_27450 39906 40574 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_27450 40665 41468 gene locus_tag LOCUS_27460 40665 41468 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_27460 43368 41839 gene locus_tag LOCUS_27470 43368 41839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 46116 43540 gene locus_tag LOCUS_27480 46116 43540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 46677 46477 gene locus_tag LOCUS_27490 46677 46477 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566084.1 protein_id gnl|my_center|LOCUS_27490 48620 46893 gene locus_tag LOCUS_27500 48620 46893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 56441 48747 gene locus_tag LOCUS_27510 56441 48747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 57055 58797 gene locus_tag LOCUS_27520 57055 58797 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789735.1 protein_id gnl|my_center|LOCUS_27520 59823 58957 gene locus_tag LOCUS_27530 59823 58957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 protein_id gnl|my_center|LOCUS_27530 60941 60159 gene locus_tag LOCUS_27540 60941 60159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 62690 61113 gene locus_tag LOCUS_27550 62690 61113 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071266.1 protein_id gnl|my_center|LOCUS_27550 63519 62974 gene locus_tag LOCUS_27560 63519 62974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 63842 63693 gene locus_tag LOCUS_27570 63842 63693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 65868 64075 gene locus_tag LOCUS_27580 65868 64075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023602.1 protein_id gnl|my_center|LOCUS_27580 66131 65871 gene locus_tag LOCUS_27590 66131 65871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 67086 66136 gene locus_tag LOCUS_27600 67086 66136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963669.1 protein_id gnl|my_center|LOCUS_27600 69221 67095 gene locus_tag LOCUS_27610 69221 67095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963646.1 protein_id gnl|my_center|LOCUS_27610 72139 69254 gene locus_tag LOCUS_27620 gene hsdR 72139 69254 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205999.1 protein_id gnl|my_center|LOCUS_27620 72648 72148 gene locus_tag LOCUS_27630 72648 72148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 73220 72657 gene locus_tag LOCUS_27640 73220 72657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 74485 73223 gene locus_tag LOCUS_27650 74485 73223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 76047 74485 gene locus_tag LOCUS_27660 gene hsdM 76047 74485 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205995.1 protein_id gnl|my_center|LOCUS_27660 77764 76550 gene locus_tag LOCUS_27670 77764 76550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 78090 77893 gene locus_tag LOCUS_27680 78090 77893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 79146 78109 gene locus_tag LOCUS_27690 79146 78109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 79769 79149 gene locus_tag LOCUS_27700 79769 79149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 80539 81180 gene locus_tag LOCUS_27710 80539 81180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 81460 81708 gene locus_tag LOCUS_27720 81460 81708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 82602 82171 gene locus_tag LOCUS_27730 82602 82171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 82801 83358 gene locus_tag LOCUS_27740 82801 83358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963138.1 protein_id gnl|my_center|LOCUS_27740 83438 86290 gene locus_tag LOCUS_27750 83438 86290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 86388 86966 gene locus_tag LOCUS_27760 86388 86966 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_27760 87109 88317 gene locus_tag LOCUS_27770 87109 88317 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_27770 88340 91510 gene locus_tag LOCUS_27780 88340 91510 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932956.1 protein_id gnl|my_center|LOCUS_27780 91596 92942 gene locus_tag LOCUS_27790 91596 92942 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932955.1 protein_id gnl|my_center|LOCUS_27790 93013 93381 gene locus_tag LOCUS_27800 93013 93381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 93684 94331 gene locus_tag LOCUS_27810 93684 94331 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090041.1 protein_id gnl|my_center|LOCUS_27810 94815 95291 gene locus_tag LOCUS_27820 94815 95291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 95479 98595 gene locus_tag LOCUS_27830 95479 98595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence16 511 1236 gene locus_tag LOCUS_27840 511 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1263 4544 gene locus_tag LOCUS_27850 1263 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 4626 5723 gene locus_tag LOCUS_27860 4626 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 5726 6481 gene locus_tag LOCUS_27870 5726 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 6471 7508 gene locus_tag LOCUS_27880 6471 7508 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989659.1 protein_id gnl|my_center|LOCUS_27880 8557 7505 gene locus_tag LOCUS_27890 8557 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 10243 8558 gene locus_tag LOCUS_27900 10243 8558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020700.1 protein_id gnl|my_center|LOCUS_27900 11616 10246 gene locus_tag LOCUS_27910 11616 10246 CDS product Mg-protoporphyrin IX monomethyl ester oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036859.1 protein_id gnl|my_center|LOCUS_27910 12389 11613 gene locus_tag LOCUS_27920 12389 11613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 13824 12379 gene locus_tag LOCUS_27930 13824 12379 CDS product Mg-protoporphyrin IX monomethyl ester oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036859.1 protein_id gnl|my_center|LOCUS_27930 14725 13817 gene locus_tag LOCUS_27940 14725 13817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 16022 14829 gene locus_tag LOCUS_27950 16022 14829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707324.1 protein_id gnl|my_center|LOCUS_27950 16426 16037 gene locus_tag LOCUS_27960 16426 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 19366 16526 gene locus_tag LOCUS_27970 gene polA 19366 16526 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_27970 19774 21240 gene locus_tag LOCUS_27980 19774 21240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 21452 22900 gene locus_tag LOCUS_27990 21452 22900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 23039 24271 gene locus_tag LOCUS_28000 23039 24271 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_28000 24324 24620 gene locus_tag LOCUS_28010 24324 24620 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_28010 25288 24617 gene locus_tag LOCUS_28020 25288 24617 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_28020 28575 25366 gene locus_tag LOCUS_28030 28575 25366 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 protein_id gnl|my_center|LOCUS_28030 28724 28795 gene locus_tag LOCUS_t00340 28724 28795 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 29656 28832 gene locus_tag LOCUS_28040 gene uspA 29656 28832 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_28040 29792 30295 gene locus_tag LOCUS_28050 gene rimP 29792 30295 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV6 protein_id gnl|my_center|LOCUS_28050 30309 31547 gene locus_tag LOCUS_28060 gene nusA 30309 31547 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_28060 31598 34414 gene locus_tag LOCUS_28070 gene infB 31598 34414 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 protein_id gnl|my_center|LOCUS_28070 36866 34668 gene locus_tag LOCUS_28080 36866 34668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_28080 37264 36875 gene locus_tag LOCUS_28090 37264 36875 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962542.1 protein_id gnl|my_center|LOCUS_28090 37483 38796 gene locus_tag LOCUS_28100 gene actA 37483 38796 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_28100 38833 41868 gene locus_tag LOCUS_28110 gene actB 38833 41868 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_28110 41899 43311 gene locus_tag LOCUS_28120 gene actC 41899 43311 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_28120 43316 43840 gene locus_tag LOCUS_28130 gene actD 43316 43840 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_28130 43849 44394 gene locus_tag LOCUS_28140 gene actE 43849 44394 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_28140 44470 45780 gene locus_tag LOCUS_28150 gene actF 44470 45780 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_28150 45800 46963 gene locus_tag LOCUS_28160 gene ctaC 45800 46963 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_28160 46991 48760 gene locus_tag LOCUS_28170 gene ctaD 46991 48760 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_28170 48835 49857 gene locus_tag LOCUS_28180 gene ruvB 48835 49857 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_28180 49871 51202 gene locus_tag LOCUS_28190 49871 51202 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_28190 51252 51614 gene locus_tag LOCUS_28200 51252 51614 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_28200 51676 52602 gene locus_tag LOCUS_28210 gene queG 51676 52602 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_28210 52634 55648 gene locus_tag LOCUS_28220 52634 55648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 55694 58156 gene locus_tag LOCUS_28230 55694 58156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963442.1 protein_id gnl|my_center|LOCUS_28230 58283 60577 gene locus_tag LOCUS_28240 gene maeB 58283 60577 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_28240 60607 61188 gene locus_tag LOCUS_28250 gene ruvA 60607 61188 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_28250 61192 68415 gene locus_tag LOCUS_28260 gene sprA 61192 68415 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_28260 68535 68915 gene locus_tag LOCUS_28270 gene gcvH 68535 68915 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_28270 68989 69255 gene locus_tag LOCUS_28280 68989 69255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 69319 70065 gene locus_tag LOCUS_28290 69319 70065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 70179 70955 gene locus_tag LOCUS_28300 70179 70955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 71033 71776 gene locus_tag LOCUS_28310 gene deoC 71033 71776 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F6 protein_id gnl|my_center|LOCUS_28310 71778 73883 gene locus_tag LOCUS_28320 71778 73883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964216.1 protein_id gnl|my_center|LOCUS_28320 74028 74879 gene locus_tag LOCUS_28330 gene ctaB 74028 74879 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_28330 74881 75468 gene locus_tag LOCUS_28340 gene ctaE 74881 75468 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_28340 75513 76496 gene locus_tag LOCUS_28350 75513 76496 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_28350 76516 76866 gene locus_tag LOCUS_28360 76516 76866 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_28360 76954 77658 gene locus_tag LOCUS_28370 76954 77658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964209.1 protein_id gnl|my_center|LOCUS_28370 77666 78292 gene locus_tag LOCUS_28380 gene ypmQ 77666 78292 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_28380 78432 78962 gene locus_tag LOCUS_28390 gene yozB 78432 78962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_28390 78955 79233 gene locus_tag LOCUS_28400 78955 79233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 80627 79236 gene locus_tag LOCUS_28410 80627 79236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964213.1 protein_id gnl|my_center|LOCUS_28410 80729 82162 gene locus_tag LOCUS_28420 80729 82162 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_28420 82166 83473 gene locus_tag LOCUS_28430 82166 83473 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_28430 83577 84236 gene locus_tag LOCUS_28440 83577 84236 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_28440 85060 84242 gene locus_tag LOCUS_28450 gene mscS3 85060 84242 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963360.1 protein_id gnl|my_center|LOCUS_28450 87077 85041 gene locus_tag LOCUS_28460 gene yyaL 87077 85041 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_28460 87336 87136 gene locus_tag LOCUS_28470 87336 87136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_28470 87495 89735 gene locus_tag LOCUS_28480 87495 89735 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A666 protein_id gnl|my_center|LOCUS_28480 90682 89783 gene locus_tag LOCUS_28490 90682 89783 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 protein_id gnl|my_center|LOCUS_28490 >Feature sequence17 276 614 gene locus_tag LOCUS_28500 276 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 1362 1108 gene locus_tag LOCUS_28510 1362 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2312 1494 gene locus_tag LOCUS_28520 2312 1494 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788692.1 protein_id gnl|my_center|LOCUS_28520 2850 2332 gene locus_tag LOCUS_28530 2850 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3524 2862 gene locus_tag LOCUS_28540 3524 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 5683 3530 gene locus_tag LOCUS_28550 5683 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 6137 5703 gene locus_tag LOCUS_28560 6137 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 8216 6189 gene locus_tag LOCUS_28570 8216 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 8554 8273 gene locus_tag LOCUS_28580 8554 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 9541 8567 gene locus_tag LOCUS_28590 9541 8567 CDS product cysteine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903919.1 protein_id gnl|my_center|LOCUS_28590 9559 9747 gene locus_tag LOCUS_28600 9559 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 10364 9792 gene locus_tag LOCUS_28610 gene phnA 10364 9792 CDS product PhnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 protein_id gnl|my_center|LOCUS_28610 10861 10367 gene locus_tag LOCUS_28620 10861 10367 CDS product OmpA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962318.1 protein_id gnl|my_center|LOCUS_28620 11622 10897 gene locus_tag LOCUS_28630 gene pphA 11622 10897 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 protein_id gnl|my_center|LOCUS_28630 11819 12010 gene locus_tag LOCUS_28640 11819 12010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 12038 12199 gene locus_tag LOCUS_28650 12038 12199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 12220 12396 gene locus_tag LOCUS_28660 12220 12396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 12417 12599 gene locus_tag LOCUS_28670 12417 12599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 12621 12803 gene locus_tag LOCUS_28680 12621 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 12893 14878 gene locus_tag LOCUS_28690 12893 14878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 14890 15567 gene locus_tag LOCUS_28700 14890 15567 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810448.1 protein_id gnl|my_center|LOCUS_28700 16033 15581 gene locus_tag LOCUS_28710 16033 15581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28710 16721 16047 gene locus_tag LOCUS_28720 16721 16047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28720 16889 17893 gene locus_tag LOCUS_28730 16889 17893 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_28730 17976 18842 gene locus_tag LOCUS_28740 17976 18842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_28740 18844 20466 gene locus_tag LOCUS_28750 18844 20466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 protein_id gnl|my_center|LOCUS_28750 20463 21467 gene locus_tag LOCUS_28760 gene batA 20463 21467 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_28760 21480 22517 gene locus_tag LOCUS_28770 gene batB 21480 22517 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_28770 22507 23292 gene locus_tag LOCUS_28780 22507 23292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 23276 25054 gene locus_tag LOCUS_28790 gene batD 23276 25054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_28790 25060 25824 gene locus_tag LOCUS_28800 gene batE 25060 25824 CDS product BatE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_28800 25925 27319 gene locus_tag LOCUS_28810 25925 27319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 27889 27341 gene locus_tag LOCUS_28820 27889 27341 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962305.1 protein_id gnl|my_center|LOCUS_28820 28028 28384 gene locus_tag LOCUS_28830 28028 28384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_28830 28708 29727 gene locus_tag LOCUS_28840 gene pheS 28708 29727 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_28840 29818 30225 gene locus_tag LOCUS_28850 29818 30225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_28850 30337 33096 gene locus_tag LOCUS_28860 30337 33096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 34070 33093 gene locus_tag LOCUS_28870 34070 33093 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941519.1 protein_id gnl|my_center|LOCUS_28870 35235 34243 gene locus_tag LOCUS_28880 gene gpsA 35235 34243 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_28880 35499 37049 gene locus_tag LOCUS_28890 35499 37049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 38153 37056 gene locus_tag LOCUS_28900 38153 37056 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765630.1 protein_id gnl|my_center|LOCUS_28900 39325 38159 gene locus_tag LOCUS_28910 39325 38159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107436.1 protein_id gnl|my_center|LOCUS_28910 40701 39523 gene locus_tag LOCUS_28920 40701 39523 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962321.1 protein_id gnl|my_center|LOCUS_28920 41500 40706 gene locus_tag LOCUS_28930 41500 40706 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962923.1 protein_id gnl|my_center|LOCUS_28930 41565 42533 gene locus_tag LOCUS_28940 41565 42533 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962922.1 protein_id gnl|my_center|LOCUS_28940 42733 45471 gene locus_tag LOCUS_28950 42733 45471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 45662 46402 gene locus_tag LOCUS_28960 45662 46402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 46395 47408 gene locus_tag LOCUS_28970 46395 47408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 47458 48153 gene locus_tag LOCUS_28980 47458 48153 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_28980 48226 49056 gene locus_tag LOCUS_28990 gene nadR 48226 49056 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072072.1 protein_id gnl|my_center|LOCUS_28990 49133 49978 gene locus_tag LOCUS_29000 49133 49978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_29000 50011 50658 gene locus_tag LOCUS_29010 50011 50658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705801.1 protein_id gnl|my_center|LOCUS_29010 50661 51626 gene locus_tag LOCUS_29020 50661 51626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989333.1 protein_id gnl|my_center|LOCUS_29020 51663 52226 gene locus_tag LOCUS_29030 51663 52226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 52234 52671 gene locus_tag LOCUS_29040 52234 52671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118447.1 protein_id gnl|my_center|LOCUS_29040 52668 53075 gene locus_tag LOCUS_29050 52668 53075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029235.1 protein_id gnl|my_center|LOCUS_29050 53178 53864 gene locus_tag LOCUS_29060 gene npdA 53178 53864 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 protein_id gnl|my_center|LOCUS_29060 53939 54130 gene locus_tag LOCUS_29070 53939 54130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29070 54224 54448 gene locus_tag LOCUS_29080 54224 54448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29080 54515 55063 gene locus_tag LOCUS_29090 gene kptA 54515 55063 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R5N7 protein_id gnl|my_center|LOCUS_29090 55066 55800 gene locus_tag LOCUS_29100 gene pphA 55066 55800 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 protein_id gnl|my_center|LOCUS_29100 55927 56262 gene locus_tag LOCUS_29110 55927 56262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 56265 57128 gene locus_tag LOCUS_29120 56265 57128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 57129 58199 gene locus_tag LOCUS_29130 57129 58199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 58204 58665 gene locus_tag LOCUS_29140 58204 58665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 59002 60453 gene locus_tag LOCUS_29150 gene nadV 59002 60453 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072073.1 protein_id gnl|my_center|LOCUS_29150 61078 60497 gene locus_tag LOCUS_29160 gene nadD 61078 60497 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_29160 61508 61143 gene locus_tag LOCUS_29170 61508 61143 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_29170 62152 61580 gene locus_tag LOCUS_29180 gene gmk 62152 61580 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_29180 63081 62233 gene locus_tag LOCUS_29190 63081 62233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_29190 64077 63184 gene locus_tag LOCUS_29200 64077 63184 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_29200 64430 64077 gene locus_tag LOCUS_29210 64430 64077 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_29210 64845 64480 gene locus_tag LOCUS_29220 64845 64480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 64984 65484 gene locus_tag LOCUS_29230 64984 65484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_29230 65515 66660 gene locus_tag LOCUS_29240 65515 66660 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_29240 67522 66740 gene locus_tag LOCUS_29250 67522 66740 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962446.1 protein_id gnl|my_center|LOCUS_29250 67749 69092 gene locus_tag LOCUS_29260 gene gdhA 67749 69092 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_29260 69204 71489 gene locus_tag LOCUS_29270 69204 71489 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_29270 71489 72202 gene locus_tag LOCUS_29280 gene recO 71489 72202 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 protein_id gnl|my_center|LOCUS_29280 72378 77336 gene locus_tag LOCUS_29290 72378 77336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 77715 77395 gene locus_tag LOCUS_29300 77715 77395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 78426 77719 gene locus_tag LOCUS_29310 78426 77719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 79000 78455 gene locus_tag LOCUS_29320 79000 78455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 80836 79184 gene locus_tag LOCUS_29330 80836 79184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 81634 81035 gene locus_tag LOCUS_29340 81634 81035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 82295 81684 gene locus_tag LOCUS_29350 82295 81684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 82966 82547 gene locus_tag LOCUS_29360 82966 82547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 84336 83074 gene locus_tag LOCUS_29370 84336 83074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 84969 84496 gene locus_tag LOCUS_29380 84969 84496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229734.1 protein_id gnl|my_center|LOCUS_29380 85656 85012 gene locus_tag LOCUS_29390 85656 85012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208448.1 protein_id gnl|my_center|LOCUS_29390 86124 85900 gene locus_tag LOCUS_29400 86124 85900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 86376 86137 gene locus_tag LOCUS_29410 86376 86137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 86853 86413 gene locus_tag LOCUS_29420 86853 86413 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070933.1 protein_id gnl|my_center|LOCUS_29420 87610 87053 gene locus_tag LOCUS_29430 87610 87053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence18 <1 1349 gene locus_tag LOCUS_29440 <1 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962196.1:cell surface protein SprD 1463 11959 gene locus_tag LOCUS_29450 gene sprB 1463 11959 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962197.1 protein_id gnl|my_center|LOCUS_29450 12016 12975 gene locus_tag LOCUS_29460 gene sprF 12016 12975 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962198.1 protein_id gnl|my_center|LOCUS_29460 13058 14248 gene locus_tag LOCUS_29470 gene pgk 13058 14248 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_29470 14303 15796 gene locus_tag LOCUS_29480 gene mltD 14303 15796 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962200.1 protein_id gnl|my_center|LOCUS_29480 15809 16789 gene locus_tag LOCUS_29490 15809 16789 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_29490 16869 17321 gene locus_tag LOCUS_29500 gene elaA 16869 17321 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_29500 18139 17318 gene locus_tag LOCUS_29510 18139 17318 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962202.1 protein_id gnl|my_center|LOCUS_29510 19776 18142 gene locus_tag LOCUS_29520 gene prc 19776 18142 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 protein_id gnl|my_center|LOCUS_29520 20615 19776 gene locus_tag LOCUS_29530 20615 19776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680721.1 protein_id gnl|my_center|LOCUS_29530 21050 20679 gene locus_tag LOCUS_29540 gene rnpA 21050 20679 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 protein_id gnl|my_center|LOCUS_29540 21623 21189 gene locus_tag LOCUS_29550 21623 21189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 22254 21811 gene locus_tag LOCUS_29560 22254 21811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 22749 22267 gene locus_tag LOCUS_29570 22749 22267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 23446 23039 gene locus_tag LOCUS_29580 23446 23039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 24769 23456 gene locus_tag LOCUS_29590 24769 23456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 25747 24830 gene locus_tag LOCUS_29600 25747 24830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 26918 25881 gene locus_tag LOCUS_29610 26918 25881 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 protein_id gnl|my_center|LOCUS_29610 27250 26924 gene locus_tag LOCUS_29620 27250 26924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 27722 27267 gene locus_tag LOCUS_29630 27722 27267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 28225 27749 gene locus_tag LOCUS_29640 28225 27749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 30477 28492 gene locus_tag LOCUS_29650 30477 28492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 30559 30738 gene locus_tag LOCUS_29660 30559 30738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 30755 31783 gene locus_tag LOCUS_29670 30755 31783 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118048.1 protein_id gnl|my_center|LOCUS_29670 32537 31785 gene locus_tag LOCUS_29680 gene ste14 32537 31785 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_29680 32642 33412 gene locus_tag LOCUS_29690 32642 33412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_29690 35026 33473 gene locus_tag LOCUS_29700 gene pcd 35026 33473 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_29700 35772 35233 gene locus_tag LOCUS_29710 gene haaO 35772 35233 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_29710 36973 35867 gene locus_tag LOCUS_29720 36973 35867 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_29720 37113 39947 gene locus_tag LOCUS_29730 37113 39947 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_29730 39959 40579 gene locus_tag LOCUS_29740 39959 40579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 40586 41974 gene locus_tag LOCUS_29750 40586 41974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964329.1 protein_id gnl|my_center|LOCUS_29750 42068 43306 gene locus_tag LOCUS_29760 gene hflX 42068 43306 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 protein_id gnl|my_center|LOCUS_29760 44302 43349 gene locus_tag LOCUS_29770 44302 43349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 45239 44328 gene locus_tag LOCUS_29780 45239 44328 CDS product protein of unknown function precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362027.1 protein_id gnl|my_center|LOCUS_29780 45861 45355 gene locus_tag LOCUS_29790 45861 45355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_29790 47708 45873 gene locus_tag LOCUS_29800 gene msbA 47708 45873 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036606.1 protein_id gnl|my_center|LOCUS_29800 48104 47781 gene locus_tag LOCUS_29810 48104 47781 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_29810 48603 48181 gene locus_tag LOCUS_29820 gene sufE 48603 48181 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_29820 49113 48607 gene locus_tag LOCUS_29830 49113 48607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 50350 49130 gene locus_tag LOCUS_29840 gene sufS 50350 49130 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_29840 50594 51142 gene locus_tag LOCUS_29850 50594 51142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 52565 51204 gene locus_tag LOCUS_29860 gene sufD 52565 51204 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_29860 53004 52636 gene locus_tag LOCUS_29870 53004 52636 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_29870 53785 53036 gene locus_tag LOCUS_29880 gene sufC 53785 53036 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_29880 54281 53796 gene locus_tag LOCUS_29890 54281 53796 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497633.1 protein_id gnl|my_center|LOCUS_29890 54681 54274 gene locus_tag LOCUS_29900 54681 54274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 56133 54685 gene locus_tag LOCUS_29910 gene sufB 56133 54685 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_29910 56471 56142 gene locus_tag LOCUS_29920 gene sufA 56471 56142 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_29920 56641 57501 gene locus_tag LOCUS_29930 56641 57501 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_29930 57582 59177 gene locus_tag LOCUS_29940 57582 59177 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_29940 59253 61136 gene locus_tag LOCUS_29950 59253 61136 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_29950 61893 61195 gene locus_tag LOCUS_29960 61893 61195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 62161 65679 gene locus_tag LOCUS_29970 62161 65679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 65734 68148 gene locus_tag LOCUS_29980 65734 68148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 68159 68494 gene locus_tag LOCUS_29990 68159 68494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 68847 69476 gene locus_tag LOCUS_30000 68847 69476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 69479 69877 gene locus_tag LOCUS_30010 69479 69877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 70135 70707 gene locus_tag LOCUS_30020 70135 70707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 70658 70885 gene locus_tag LOCUS_30030 70658 70885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 71178 71738 gene locus_tag LOCUS_30040 71178 71738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 71746 72153 gene locus_tag LOCUS_30050 71746 72153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 72477 73010 gene locus_tag LOCUS_30060 72477 73010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 73015 73314 gene locus_tag LOCUS_30070 73015 73314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 73688 74329 gene locus_tag LOCUS_30080 73688 74329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 74332 74751 gene locus_tag LOCUS_30090 gene yokK 74332 74751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31996 protein_id gnl|my_center|LOCUS_30090 74912 75355 gene locus_tag LOCUS_30100 74912 75355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 75373 75726 gene locus_tag LOCUS_30110 75373 75726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456753.1 protein_id gnl|my_center|LOCUS_30110 76023 76574 gene locus_tag LOCUS_30120 76023 76574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 76574 76879 gene locus_tag LOCUS_30130 76574 76879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 77070 77651 gene locus_tag LOCUS_30140 77070 77651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 77658 77945 gene locus_tag LOCUS_30150 77658 77945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 78369 78659 gene locus_tag LOCUS_30160 78369 78659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 78664 78933 gene locus_tag LOCUS_30170 78664 78933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 79584 79733 gene locus_tag LOCUS_30180 79584 79733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 79755 80189 gene locus_tag LOCUS_30190 79755 80189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 80249 80962 gene locus_tag LOCUS_30200 80249 80962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 80959 81267 gene locus_tag LOCUS_30210 80959 81267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 81329 82003 gene locus_tag LOCUS_30220 81329 82003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 82021 82563 gene locus_tag LOCUS_30230 82021 82563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 82621 82752 gene locus_tag LOCUS_30240 82621 82752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 82754 83221 gene locus_tag LOCUS_30250 82754 83221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence19 2166 1822 gene locus_tag LOCUS_30260 2166 1822 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964132.1 protein_id gnl|my_center|LOCUS_30260 4452 2212 gene locus_tag LOCUS_30270 4452 2212 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_30270 4910 4503 gene locus_tag LOCUS_30280 4910 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964134.1 protein_id gnl|my_center|LOCUS_30280 6310 4955 gene locus_tag LOCUS_30290 6310 4955 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947965.1 protein_id gnl|my_center|LOCUS_30290 7134 6307 gene locus_tag LOCUS_30300 7134 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423269.1 protein_id gnl|my_center|LOCUS_30300 7598 7167 gene locus_tag LOCUS_30310 7598 7167 CDS product exosortase F system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964135.1 protein_id gnl|my_center|LOCUS_30310 8046 7591 gene locus_tag LOCUS_30320 8046 7591 CDS product exosortase family protein XrtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964136.1 protein_id gnl|my_center|LOCUS_30320 8275 8093 gene locus_tag LOCUS_30330 8275 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 8217 8672 gene locus_tag LOCUS_30340 8217 8672 CDS product GAF domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_30340 8896 9165 gene locus_tag LOCUS_30350 gene rpsO 8896 9165 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H184 protein_id gnl|my_center|LOCUS_30350 9297 11465 gene locus_tag LOCUS_30360 gene pnp 9297 11465 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H185 protein_id gnl|my_center|LOCUS_30360 11587 11976 gene locus_tag LOCUS_30370 11587 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 12041 13330 gene locus_tag LOCUS_30380 12041 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 13342 13899 gene locus_tag LOCUS_30390 13342 13899 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_30390 13896 15383 gene locus_tag LOCUS_30400 13896 15383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 16680 15607 gene locus_tag LOCUS_30410 16680 15607 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_30410 16784 17731 gene locus_tag LOCUS_30420 16784 17731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 17824 18687 gene locus_tag LOCUS_30430 gene rpoD 17824 18687 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_30430 18936 19595 gene locus_tag LOCUS_30440 gene rpe 18936 19595 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_30440 20056 19637 gene locus_tag LOCUS_30450 20056 19637 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939136.1 protein_id gnl|my_center|LOCUS_30450 20946 20146 gene locus_tag LOCUS_30460 20946 20146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964150.1 protein_id gnl|my_center|LOCUS_30460 21426 21076 gene locus_tag LOCUS_30470 21426 21076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 21782 22699 gene locus_tag LOCUS_30480 21782 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 22692 23408 gene locus_tag LOCUS_30490 22692 23408 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_30490 23623 25365 gene locus_tag LOCUS_30500 23623 25365 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 protein_id gnl|my_center|LOCUS_30500 25531 27720 gene locus_tag LOCUS_30510 25531 27720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 27786 28682 gene locus_tag LOCUS_30520 27786 28682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011283.1 protein_id gnl|my_center|LOCUS_30520 29779 28697 gene locus_tag LOCUS_30530 29779 28697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_30530 29878 30450 gene locus_tag LOCUS_30540 29878 30450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 30703 33759 gene locus_tag LOCUS_30550 30703 33759 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107956.1 protein_id gnl|my_center|LOCUS_30550 34029 37157 gene locus_tag LOCUS_30560 34029 37157 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108634.1 protein_id gnl|my_center|LOCUS_30560 37168 38730 gene locus_tag LOCUS_30570 37168 38730 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_30570 38747 41095 gene locus_tag LOCUS_30580 38747 41095 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920890.1 protein_id gnl|my_center|LOCUS_30580 41097 42740 gene locus_tag LOCUS_30590 41097 42740 CDS product N-acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109363.1 protein_id gnl|my_center|LOCUS_30590 42745 44442 gene locus_tag LOCUS_30600 gene betC 42745 44442 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118653.1 protein_id gnl|my_center|LOCUS_30600 44504 46075 gene locus_tag LOCUS_30610 gene betC 44504 46075 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118653.1 protein_id gnl|my_center|LOCUS_30610 46119 47597 gene locus_tag LOCUS_30620 46119 47597 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_30620 47646 49382 gene locus_tag LOCUS_30630 47646 49382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 49379 51046 gene locus_tag LOCUS_30640 49379 51046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 51122 53227 gene locus_tag LOCUS_30650 51122 53227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 53364 53717 gene locus_tag LOCUS_30660 53364 53717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 53734 55134 gene locus_tag LOCUS_30670 53734 55134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 55247 56656 gene locus_tag LOCUS_30680 55247 56656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 56658 58142 gene locus_tag LOCUS_30690 56658 58142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 59835 59029 gene locus_tag LOCUS_30700 59835 59029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 60060 59848 gene locus_tag LOCUS_30710 60060 59848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 60490 60062 gene locus_tag LOCUS_30720 60490 60062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 60993 60487 gene locus_tag LOCUS_30730 60993 60487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 62030 61125 gene locus_tag LOCUS_30740 62030 61125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 63310 62036 gene locus_tag LOCUS_30750 63310 62036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 63708 63313 gene locus_tag LOCUS_30760 63708 63313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 63961 63716 gene locus_tag LOCUS_30770 63961 63716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 64208 63966 gene locus_tag LOCUS_30780 64208 63966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 64415 64212 gene locus_tag LOCUS_30790 64415 64212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 65409 64741 gene locus_tag LOCUS_30800 65409 64741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 67069 65417 gene locus_tag LOCUS_30810 67069 65417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 67305 67111 gene locus_tag LOCUS_30820 67305 67111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 67630 68580 gene locus_tag LOCUS_30830 67630 68580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 69058 69471 gene locus_tag LOCUS_30840 69058 69471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 70055 69468 gene locus_tag LOCUS_30850 70055 69468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 70542 70042 gene locus_tag LOCUS_30860 70542 70042 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763624.1 protein_id gnl|my_center|LOCUS_30860 71369 70551 gene locus_tag LOCUS_30870 71369 70551 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640443.1 protein_id gnl|my_center|LOCUS_30870 71670 73244 gene locus_tag LOCUS_30880 71670 73244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 73564 74970 gene locus_tag LOCUS_30890 73564 74970 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362019.1 protein_id gnl|my_center|LOCUS_30890 75023 75907 gene locus_tag LOCUS_30900 75023 75907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 76007 76297 gene locus_tag LOCUS_30910 76007 76297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 76440 76847 gene locus_tag LOCUS_30920 76440 76847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 76852 77505 gene locus_tag LOCUS_30930 76852 77505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 77516 78223 gene locus_tag LOCUS_30940 77516 78223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 78922 78503 gene locus_tag LOCUS_30950 78922 78503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 79878 79072 gene locus_tag LOCUS_30960 79878 79072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 80571 80017 gene locus_tag LOCUS_30970 80571 80017 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_30970 81224 80799 gene locus_tag LOCUS_30980 81224 80799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206140.1 protein_id gnl|my_center|LOCUS_30980 82298 81537 gene locus_tag LOCUS_30990 82298 81537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 >Feature sequence20 805 377 gene locus_tag LOCUS_31000 805 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 2135 978 gene locus_tag LOCUS_31010 2135 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 2920 2336 gene locus_tag LOCUS_31020 2920 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 3407 3165 gene locus_tag LOCUS_31030 3407 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 4862 3789 gene locus_tag LOCUS_31040 4862 3789 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304146.1 protein_id gnl|my_center|LOCUS_31040 5894 4971 gene locus_tag LOCUS_31050 5894 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 6529 5936 gene locus_tag LOCUS_31060 6529 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 7792 6551 gene locus_tag LOCUS_31070 7792 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 9852 8614 gene locus_tag LOCUS_31080 9852 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_31080 11095 9977 gene locus_tag LOCUS_31090 11095 9977 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_31090 12326 11148 gene locus_tag LOCUS_31100 12326 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 13102 12329 gene locus_tag LOCUS_31110 13102 12329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 14036 13095 gene locus_tag LOCUS_31120 14036 13095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 15005 14043 gene locus_tag LOCUS_31130 15005 14043 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108173.1 protein_id gnl|my_center|LOCUS_31130 15027 15767 gene locus_tag LOCUS_31140 15027 15767 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_31140 17468 15768 gene locus_tag LOCUS_31150 17468 15768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 17820 18662 gene locus_tag LOCUS_31160 17820 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_31160 18659 19768 gene locus_tag LOCUS_31170 18659 19768 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963975.1 protein_id gnl|my_center|LOCUS_31170 19761 21062 gene locus_tag LOCUS_31180 gene wzxE 19761 21062 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963976.1 protein_id gnl|my_center|LOCUS_31180 21052 22047 gene locus_tag LOCUS_31190 21052 22047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 22947 22072 gene locus_tag LOCUS_31200 22947 22072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 23000 24079 gene locus_tag LOCUS_31210 gene cap 23000 24079 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881062.1 protein_id gnl|my_center|LOCUS_31210 24076 24480 gene locus_tag LOCUS_31220 24076 24480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963968.1 protein_id gnl|my_center|LOCUS_31220 25426 24464 gene locus_tag LOCUS_31230 25426 24464 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_31230 26499 25606 gene locus_tag LOCUS_31240 26499 25606 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_31240 26550 27365 gene locus_tag LOCUS_31250 26550 27365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 28051 27368 gene locus_tag LOCUS_31260 gene ftsE 28051 27368 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_31260 28294 31251 gene locus_tag LOCUS_31270 28294 31251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_31270 31309 33066 gene locus_tag LOCUS_31280 31309 33066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_31280 33069 33665 gene locus_tag LOCUS_31290 33069 33665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 33970 34788 gene locus_tag LOCUS_31300 33970 34788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 34935 35384 gene locus_tag LOCUS_31310 34935 35384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_31310 35620 37293 gene locus_tag LOCUS_31320 gene asnB 35620 37293 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706472.1 protein_id gnl|my_center|LOCUS_31320 38288 37425 gene locus_tag LOCUS_31330 38288 37425 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_31330 38799 40739 gene locus_tag LOCUS_31340 gene gyrB 38799 40739 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX10 protein_id gnl|my_center|LOCUS_31340 40740 41738 gene locus_tag LOCUS_31350 40740 41738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 41764 42696 gene locus_tag LOCUS_31360 gene mdh 41764 42696 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX11 protein_id gnl|my_center|LOCUS_31360 42877 45849 gene locus_tag LOCUS_31370 gene secDF 42877 45849 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 protein_id gnl|my_center|LOCUS_31370 45950 46450 gene locus_tag LOCUS_31380 45950 46450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 47110 46457 gene locus_tag LOCUS_31390 47110 46457 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045135.1 protein_id gnl|my_center|LOCUS_31390 47759 47079 gene locus_tag LOCUS_31400 47759 47079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 49109 48591 gene locus_tag LOCUS_31410 49109 48591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 49284 50141 gene locus_tag LOCUS_31420 49284 50141 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962903.1 protein_id gnl|my_center|LOCUS_31420 50187 50759 gene locus_tag LOCUS_31430 50187 50759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 51987 50752 gene locus_tag LOCUS_31440 gene hutI 51987 50752 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_31440 52059 53129 gene locus_tag LOCUS_31450 gene corA 52059 53129 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H3 protein_id gnl|my_center|LOCUS_31450 53323 54618 gene locus_tag LOCUS_31460 53323 54618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 54608 55171 gene locus_tag LOCUS_31470 54608 55171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 55175 56173 gene locus_tag LOCUS_31480 55175 56173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 56170 57282 gene locus_tag LOCUS_31490 56170 57282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 58694 57312 gene locus_tag LOCUS_31500 gene fumC 58694 57312 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_31500 58820 58987 gene locus_tag LOCUS_31510 58820 58987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 61466 59046 gene locus_tag LOCUS_31520 61466 59046 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_31520 61933 61583 gene locus_tag LOCUS_31530 61933 61583 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_31530 62097 62909 gene locus_tag LOCUS_31540 gene yyaK 62097 62909 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_31540 62926 63996 gene locus_tag LOCUS_31550 gene menE 62926 63996 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_31550 65623 64004 gene locus_tag LOCUS_31560 65623 64004 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_31560 65772 65626 gene locus_tag LOCUS_31570 65772 65626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 66343 65759 gene locus_tag LOCUS_31580 66343 65759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_31580 68039 66372 gene locus_tag LOCUS_31590 68039 66372 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263346.1 protein_id gnl|my_center|LOCUS_31590 69036 68125 gene locus_tag LOCUS_31600 69036 68125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 70636 69203 gene locus_tag LOCUS_31610 70636 69203 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963148.1 protein_id gnl|my_center|LOCUS_31610 70713 70943 gene locus_tag LOCUS_31620 70713 70943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 72599 70956 gene locus_tag LOCUS_31630 72599 70956 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_31630 73051 72701 gene locus_tag LOCUS_31640 73051 72701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 73257 73772 gene locus_tag LOCUS_31650 73257 73772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 73842 74546 gene locus_tag LOCUS_31660 73842 74546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 75022 74615 gene locus_tag LOCUS_31670 75022 74615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 77185 75362 gene locus_tag LOCUS_31680 77185 75362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 77452 78627 gene locus_tag LOCUS_31690 77452 78627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 78796 79317 gene locus_tag LOCUS_31700 78796 79317 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922201.1 protein_id gnl|my_center|LOCUS_31700 79335 79994 gene locus_tag LOCUS_31710 79335 79994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 80003 80500 gene locus_tag LOCUS_31720 80003 80500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 80513 81250 gene locus_tag LOCUS_31730 80513 81250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 >Feature sequence21 <1 1009 gene locus_tag LOCUS_31740 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin 1062 1982 gene locus_tag LOCUS_31750 1062 1982 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_31750 2084 4030 gene locus_tag LOCUS_31760 2084 4030 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_31760 4130 6142 gene locus_tag LOCUS_31770 4130 6142 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_31770 6142 6990 gene locus_tag LOCUS_31780 6142 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 6974 8329 gene locus_tag LOCUS_31790 gene surA 6974 8329 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT1 protein_id gnl|my_center|LOCUS_31790 8549 9502 gene locus_tag LOCUS_31800 8549 9502 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_31800 9509 10057 gene locus_tag LOCUS_31810 9509 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 10232 12493 gene locus_tag LOCUS_31820 10232 12493 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_31820 12646 13038 gene locus_tag LOCUS_31830 12646 13038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 13696 13935 gene locus_tag LOCUS_31840 13696 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 14421 14918 gene locus_tag LOCUS_31850 14421 14918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 16241 15105 gene locus_tag LOCUS_31860 16241 15105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 17811 20075 gene locus_tag LOCUS_31870 gene acnA 17811 20075 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_31870 20192 21598 gene locus_tag LOCUS_31880 gene glgA 20192 21598 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H964 protein_id gnl|my_center|LOCUS_31880 21602 22864 gene locus_tag LOCUS_31890 gene glgC 21602 22864 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_31890 22866 24773 gene locus_tag LOCUS_31900 gene glgB 22866 24773 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHB1 protein_id gnl|my_center|LOCUS_31900 24822 27239 gene locus_tag LOCUS_31910 24822 27239 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_31910 27431 28993 gene locus_tag LOCUS_31920 27431 28993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 29295 29756 gene locus_tag LOCUS_31930 29295 29756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 30304 31185 gene locus_tag LOCUS_31940 30304 31185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 31593 32909 gene locus_tag LOCUS_31950 31593 32909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 33341 34084 gene locus_tag LOCUS_31960 33341 34084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963980.1 protein_id gnl|my_center|LOCUS_31960 34410 34105 gene locus_tag LOCUS_31970 34410 34105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 34553 35143 gene locus_tag LOCUS_31980 34553 35143 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_31980 35215 36510 gene locus_tag LOCUS_31990 35215 36510 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 protein_id gnl|my_center|LOCUS_31990 36732 37400 gene locus_tag LOCUS_32000 36732 37400 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_32000 39889 37397 gene locus_tag LOCUS_32010 39889 37397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 41050 39905 gene locus_tag LOCUS_32020 41050 39905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 41671 41111 gene locus_tag LOCUS_32030 41671 41111 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_32030 42707 41664 gene locus_tag LOCUS_32040 gene iaaA 42707 41664 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_32040 43087 42707 gene locus_tag LOCUS_32050 43087 42707 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_32050 44470 43091 gene locus_tag LOCUS_32060 gene rmuC 44470 43091 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_32060 44617 45033 gene locus_tag LOCUS_32070 44617 45033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 45103 45660 gene locus_tag LOCUS_32080 45103 45660 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H133 protein_id gnl|my_center|LOCUS_32080 45662 46099 gene locus_tag LOCUS_32090 45662 46099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 46301 47548 gene locus_tag LOCUS_32100 46301 47548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 48344 47625 gene locus_tag LOCUS_32110 48344 47625 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120630.1 protein_id gnl|my_center|LOCUS_32110 49239 48460 gene locus_tag LOCUS_32120 49239 48460 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 protein_id gnl|my_center|LOCUS_32120 49375 50055 gene locus_tag LOCUS_32130 49375 50055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 50422 50186 gene locus_tag LOCUS_32140 50422 50186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 51468 50899 gene locus_tag LOCUS_32150 51468 50899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 51946 51479 gene locus_tag LOCUS_32160 51946 51479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 52714 52007 gene locus_tag LOCUS_32170 52714 52007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 53404 52730 gene locus_tag LOCUS_32180 53404 52730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 53814 53470 gene locus_tag LOCUS_32190 53814 53470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 54278 53817 gene locus_tag LOCUS_32200 54278 53817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 55995 54610 gene locus_tag LOCUS_32210 55995 54610 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707747.1 protein_id gnl|my_center|LOCUS_32210 57486 56695 gene locus_tag LOCUS_32220 57486 56695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 57980 57483 gene locus_tag LOCUS_32230 57980 57483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 58283 58050 gene locus_tag LOCUS_32240 58283 58050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 58883 58329 gene locus_tag LOCUS_32250 58883 58329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 59408 58929 gene locus_tag LOCUS_32260 59408 58929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 60669 59617 gene locus_tag LOCUS_32270 60669 59617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363239.1 protein_id gnl|my_center|LOCUS_32270 61001 60801 gene locus_tag LOCUS_32280 61001 60801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32280 62134 61646 gene locus_tag LOCUS_32290 62134 61646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 62542 62210 gene locus_tag LOCUS_32300 62542 62210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 63205 62852 gene locus_tag LOCUS_32310 63205 62852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 64463 63834 gene locus_tag LOCUS_32320 64463 63834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 66477 65029 gene locus_tag LOCUS_32330 66477 65029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 67240 66815 gene locus_tag LOCUS_32340 67240 66815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 67782 68648 gene locus_tag LOCUS_32350 67782 68648 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228665.1 protein_id gnl|my_center|LOCUS_32350 70383 69448 gene locus_tag LOCUS_32360 gene arsM 70383 69448 CDS product arsenite S-adenosylmethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_32360 70526 70735 gene locus_tag LOCUS_32370 70526 70735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 71293 70745 gene locus_tag LOCUS_32380 gene sigZ 71293 70745 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05409 protein_id gnl|my_center|LOCUS_32380 73270 71819 gene locus_tag LOCUS_32390 73270 71819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 74269 73676 gene locus_tag LOCUS_32400 74269 73676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 76208 75048 gene locus_tag LOCUS_32410 76208 75048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 76751 76395 gene locus_tag LOCUS_32420 76751 76395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 >Feature sequence22 1392 202 gene locus_tag LOCUS_32430 gene aspC2 1392 202 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_32430 1520 2866 gene locus_tag LOCUS_32440 1520 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 3292 2906 gene locus_tag LOCUS_32450 3292 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963807.1 protein_id gnl|my_center|LOCUS_32450 3580 6210 gene locus_tag LOCUS_32460 gene valS 3580 6210 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H092 protein_id gnl|my_center|LOCUS_32460 6421 9441 gene locus_tag LOCUS_32470 6421 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 9623 14260 gene locus_tag LOCUS_32480 9623 14260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 14392 15879 gene locus_tag LOCUS_32490 14392 15879 CDS product selenocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_32490 16104 17375 gene locus_tag LOCUS_32500 16104 17375 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_32500 17917 17453 gene locus_tag LOCUS_32510 17917 17453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 18551 18147 gene locus_tag LOCUS_32520 18551 18147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 18896 20017 gene locus_tag LOCUS_32530 18896 20017 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_32530 22463 20058 gene locus_tag LOCUS_32540 22463 20058 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_32540 25365 22642 gene locus_tag LOCUS_32550 25365 22642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962879.1 protein_id gnl|my_center|LOCUS_32550 25638 27596 gene locus_tag LOCUS_32560 25638 27596 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962880.1 protein_id gnl|my_center|LOCUS_32560 27708 28136 gene locus_tag LOCUS_32570 27708 28136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 28274 29836 gene locus_tag LOCUS_32580 28274 29836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 30192 31880 gene locus_tag LOCUS_32590 30192 31880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 31882 32541 gene locus_tag LOCUS_32600 31882 32541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 32730 36035 gene locus_tag LOCUS_32610 32730 36035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 37434 37276 gene locus_tag LOCUS_32620 37434 37276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 39052 37532 gene locus_tag LOCUS_32630 gene eptA 39052 37532 CDS product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O24867 protein_id gnl|my_center|LOCUS_32630 39908 39039 gene locus_tag LOCUS_32640 39908 39039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 40681 39923 gene locus_tag LOCUS_32650 40681 39923 CDS product phospholipid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964451.1 protein_id gnl|my_center|LOCUS_32650 41861 40962 gene locus_tag LOCUS_32660 41861 40962 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560563.1 protein_id gnl|my_center|LOCUS_32660 44353 41885 gene locus_tag LOCUS_32670 44353 41885 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_32670 45049 44540 gene locus_tag LOCUS_32680 45049 44540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 46092 45061 gene locus_tag LOCUS_32690 46092 45061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 47116 46280 gene locus_tag LOCUS_32700 47116 46280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_32700 49463 47121 gene locus_tag LOCUS_32710 49463 47121 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_32710 50503 50063 gene locus_tag LOCUS_32720 50503 50063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 51860 53146 gene locus_tag LOCUS_32730 51860 53146 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_32730 53143 54042 gene locus_tag LOCUS_32740 53143 54042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 54259 54564 gene locus_tag LOCUS_32750 54259 54564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809723.1 protein_id gnl|my_center|LOCUS_32750 54692 55885 gene locus_tag LOCUS_32760 54692 55885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962655.1 protein_id gnl|my_center|LOCUS_32760 56329 57117 gene locus_tag LOCUS_32770 56329 57117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 57744 57226 gene locus_tag LOCUS_32780 57744 57226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 58107 59654 gene locus_tag LOCUS_32790 gene hsdM 58107 59654 CDS product type I restriction enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199604.1 protein_id gnl|my_center|LOCUS_32790 59651 60850 gene locus_tag LOCUS_32800 59651 60850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 60859 62013 gene locus_tag LOCUS_32810 gene prrC 60859 62013 CDS product anticodon nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217540.1 protein_id gnl|my_center|LOCUS_32810 62000 65107 gene locus_tag LOCUS_32820 62000 65107 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706627.1 protein_id gnl|my_center|LOCUS_32820 65354 66646 gene locus_tag LOCUS_32830 65354 66646 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362019.1 protein_id gnl|my_center|LOCUS_32830 66698 67912 gene locus_tag LOCUS_32840 66698 67912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 68014 68301 gene locus_tag LOCUS_32850 68014 68301 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962557.1 protein_id gnl|my_center|LOCUS_32850 68305 68580 gene locus_tag LOCUS_32860 68305 68580 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964270.1 protein_id gnl|my_center|LOCUS_32860 >Feature sequence23 5040 70 gene locus_tag LOCUS_32870 5040 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 6620 5376 gene locus_tag LOCUS_32880 gene ilvA 6620 5376 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT3 protein_id gnl|my_center|LOCUS_32880 8176 6698 gene locus_tag LOCUS_32890 gene ilvC 8176 6698 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9D5 protein_id gnl|my_center|LOCUS_32890 8825 8238 gene locus_tag LOCUS_32900 gene ilvH 8825 8238 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_32900 10576 8828 gene locus_tag LOCUS_32910 gene ilvB 10576 8828 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_32910 12266 10587 gene locus_tag LOCUS_32920 gene ilvD 12266 10587 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q02139 protein_id gnl|my_center|LOCUS_32920 13173 12268 gene locus_tag LOCUS_32930 gene ilvE 13173 12268 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962619.1 protein_id gnl|my_center|LOCUS_32930 14289 13759 gene locus_tag LOCUS_32940 14289 13759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_32940 16374 14389 gene locus_tag LOCUS_32950 gene hutU 16374 14389 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_32950 16738 16562 gene locus_tag LOCUS_32960 16738 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 16855 17181 gene locus_tag LOCUS_32970 16855 17181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964062.1 protein_id gnl|my_center|LOCUS_32970 18593 17184 gene locus_tag LOCUS_32980 18593 17184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 19396 18776 gene locus_tag LOCUS_32990 19396 18776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32990 20464 19538 gene locus_tag LOCUS_33000 20464 19538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33000 22314 20485 gene locus_tag LOCUS_33010 22314 20485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33010 22949 22461 gene locus_tag LOCUS_33020 22949 22461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 29088 23146 gene locus_tag LOCUS_33030 29088 23146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 29285 29112 gene locus_tag LOCUS_33040 29285 29112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 29601 31454 gene locus_tag LOCUS_33050 29601 31454 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962777.1 protein_id gnl|my_center|LOCUS_33050 31514 32407 gene locus_tag LOCUS_33060 gene acdS 31514 32407 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_33060 32404 33261 gene locus_tag LOCUS_33070 32404 33261 CDS product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 protein_id gnl|my_center|LOCUS_33070 33261 34547 gene locus_tag LOCUS_33080 gene hemL 33261 34547 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW4 protein_id gnl|my_center|LOCUS_33080 34904 34578 gene locus_tag LOCUS_33090 34904 34578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 35407 34985 gene locus_tag LOCUS_33100 35407 34985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 35532 35909 gene locus_tag LOCUS_33110 35532 35909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962738.1 protein_id gnl|my_center|LOCUS_33110 36028 36813 gene locus_tag LOCUS_33120 36028 36813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962739.1 protein_id gnl|my_center|LOCUS_33120 37054 38097 gene locus_tag LOCUS_33130 37054 38097 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_33130 38102 39058 gene locus_tag LOCUS_33140 38102 39058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_33140 40801 39104 gene locus_tag LOCUS_33150 gene lysS 40801 39104 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 protein_id gnl|my_center|LOCUS_33150 41015 41821 gene locus_tag LOCUS_33160 41015 41821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 41823 42524 gene locus_tag LOCUS_33170 gene lipB 41823 42524 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_33170 43223 42564 gene locus_tag LOCUS_33180 gene rnhB 43223 42564 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW0 protein_id gnl|my_center|LOCUS_33180 43470 46463 gene locus_tag LOCUS_33190 43470 46463 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_33190 46473 47984 gene locus_tag LOCUS_33200 46473 47984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 47996 48853 gene locus_tag LOCUS_33210 47996 48853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 48927 50825 gene locus_tag LOCUS_33220 48927 50825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 50997 52844 gene locus_tag LOCUS_33230 50997 52844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_33230 53061 54422 gene locus_tag LOCUS_33240 53061 54422 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_33240 54534 55802 gene locus_tag LOCUS_33250 54534 55802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_33250 55835 56053 gene locus_tag LOCUS_33260 55835 56053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_33260 56137 57957 gene locus_tag LOCUS_33270 gene snf 56137 57957 CDS product sodium:calcium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_33270 57976 58134 gene locus_tag LOCUS_33280 57976 58134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 58344 59060 gene locus_tag LOCUS_33290 58344 59060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963324.1 protein_id gnl|my_center|LOCUS_33290 59098 60267 gene locus_tag LOCUS_33300 59098 60267 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_33300 60538 60732 gene locus_tag LOCUS_33310 gene rpsU 60538 60732 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_33310 60799 61695 gene locus_tag LOCUS_33320 gene xerC 60799 61695 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_33320 61730 62032 gene locus_tag LOCUS_33330 61730 62032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_33330 62124 62198 gene locus_tag LOCUS_t00350 62124 62198 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 62232 62313 gene locus_tag LOCUS_t00360 62232 62313 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence24 509 4297 gene locus_tag LOCUS_33340 509 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871158.1 protein_id gnl|my_center|LOCUS_33340 4437 5351 gene locus_tag LOCUS_33350 4437 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 6057 7442 gene locus_tag LOCUS_33360 6057 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 7567 9399 gene locus_tag LOCUS_33370 7567 9399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 9504 9956 gene locus_tag LOCUS_33380 9504 9956 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 protein_id gnl|my_center|LOCUS_33380 10840 10169 gene locus_tag LOCUS_33390 10840 10169 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_33390 11607 10837 gene locus_tag LOCUS_33400 11607 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 12233 11577 gene locus_tag LOCUS_33410 12233 11577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 12603 12289 gene locus_tag LOCUS_33420 12603 12289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 13201 12746 gene locus_tag LOCUS_33430 13201 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 13437 13907 gene locus_tag LOCUS_33440 13437 13907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553163.1 protein_id gnl|my_center|LOCUS_33440 13979 15124 gene locus_tag LOCUS_33450 13979 15124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 protein_id gnl|my_center|LOCUS_33450 15521 15129 gene locus_tag LOCUS_33460 15521 15129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 16588 15701 gene locus_tag LOCUS_33470 16588 15701 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_33470 16650 17618 gene locus_tag LOCUS_33480 16650 17618 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_33480 18566 17856 gene locus_tag LOCUS_33490 18566 17856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 18929 18636 gene locus_tag LOCUS_33500 18929 18636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 19688 19053 gene locus_tag LOCUS_33510 19688 19053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 22313 20385 gene locus_tag LOCUS_33520 22313 20385 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_33520 22382 22771 gene locus_tag LOCUS_33530 22382 22771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_33530 23831 22773 gene locus_tag LOCUS_33540 gene fjo30 23831 22773 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_33540 24789 23902 gene locus_tag LOCUS_33550 gene gldN 24789 23902 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_33550 26378 24834 gene locus_tag LOCUS_33560 gene gldM 26378 24834 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_33560 27076 26432 gene locus_tag LOCUS_33570 gene gldL 27076 26432 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_33570 28505 27135 gene locus_tag LOCUS_33580 gene gldK 28505 27135 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_33580 29799 28651 gene locus_tag LOCUS_33590 gene fjo29 29799 28651 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_33590 32301 29803 gene locus_tag LOCUS_33600 gene topA 32301 29803 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_33600 32557 34008 gene locus_tag LOCUS_33610 gene miaB 32557 34008 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_33610 34103 35374 gene locus_tag LOCUS_33620 34103 35374 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_33620 35414 35878 gene locus_tag LOCUS_33630 35414 35878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_33630 35895 36722 gene locus_tag LOCUS_33640 35895 36722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_33640 36726 37088 gene locus_tag LOCUS_33650 gene secG 36726 37088 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964085.1 protein_id gnl|my_center|LOCUS_33650 37228 37503 gene locus_tag LOCUS_33660 gene groS 37228 37503 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_33660 37574 39205 gene locus_tag LOCUS_33670 gene groL 37574 39205 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_33670 40599 39331 gene locus_tag LOCUS_33680 40599 39331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 41142 40609 gene locus_tag LOCUS_33690 41142 40609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 42343 41291 gene locus_tag LOCUS_33700 42343 41291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 43016 42357 gene locus_tag LOCUS_33710 43016 42357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016606.1 protein_id gnl|my_center|LOCUS_33710 43648 43022 gene locus_tag LOCUS_33720 43648 43022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 43936 43664 gene locus_tag LOCUS_33730 43936 43664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 44458 44069 gene locus_tag LOCUS_33740 44458 44069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 44910 44524 gene locus_tag LOCUS_33750 44910 44524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 45848 44982 gene locus_tag LOCUS_33760 45848 44982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 47259 45877 gene locus_tag LOCUS_33770 47259 45877 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962350.1 protein_id gnl|my_center|LOCUS_33770 47872 47696 gene locus_tag LOCUS_33780 47872 47696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 48905 48168 gene locus_tag LOCUS_33790 48905 48168 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_33790 <49532 48902 gene locus_tag LOCUS_33800 <49532 48902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963634.1:histidine kinase >Feature sequence25 859 173 gene locus_tag LOCUS_33810 859 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_33810 974 2029 gene locus_tag LOCUS_33820 974 2029 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_33820 2039 3967 gene locus_tag LOCUS_33830 2039 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 3969 4667 gene locus_tag LOCUS_33840 3969 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 4764 6107 gene locus_tag LOCUS_33850 4764 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 6368 7066 gene locus_tag LOCUS_33860 6368 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 7560 7126 gene locus_tag LOCUS_33870 7560 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 8635 7691 gene locus_tag LOCUS_33880 gene purC 8635 7691 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_33880 9262 8750 gene locus_tag LOCUS_33890 9262 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 9901 9440 gene locus_tag LOCUS_33900 9901 9440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 10733 9915 gene locus_tag LOCUS_33910 10733 9915 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963219.1 protein_id gnl|my_center|LOCUS_33910 12290 10851 gene locus_tag LOCUS_33920 12290 10851 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250835.1 protein_id gnl|my_center|LOCUS_33920 13515 12565 gene locus_tag LOCUS_33930 gene phoH 13515 12565 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_33930 13709 14539 gene locus_tag LOCUS_33940 gene fjo14 13709 14539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_33940 14543 14839 gene locus_tag LOCUS_33950 gene fjo15 14543 14839 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_33950 15043 15687 gene locus_tag LOCUS_33960 gene gldF 15043 15687 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_33960 15687 17369 gene locus_tag LOCUS_33970 gene gldG 15687 17369 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_33970 17456 18574 gene locus_tag LOCUS_33980 gene dnaN 17456 18574 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_33980 18838 19581 gene locus_tag LOCUS_33990 18838 19581 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261101.1 protein_id gnl|my_center|LOCUS_33990 21431 19650 gene locus_tag LOCUS_34000 21431 19650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_34000 21637 22380 gene locus_tag LOCUS_34010 21637 22380 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480502.1 protein_id gnl|my_center|LOCUS_34010 22611 24005 gene locus_tag LOCUS_34020 gene mnmE 22611 24005 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_34020 24038 27082 gene locus_tag LOCUS_34030 24038 27082 CDS product type I endonuclease-methyltransferase fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_34030 27063 27761 gene locus_tag LOCUS_34040 27063 27761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 28580 28098 gene locus_tag LOCUS_34050 28580 28098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 28579 28752 gene locus_tag LOCUS_34060 28579 28752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 28776 29270 gene locus_tag LOCUS_34070 28776 29270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 29270 29914 gene locus_tag LOCUS_34080 29270 29914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 30703 30053 gene locus_tag LOCUS_34090 30703 30053 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965552.1 protein_id gnl|my_center|LOCUS_34090 32576 30762 gene locus_tag LOCUS_34100 32576 30762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 32997 32644 gene locus_tag LOCUS_34110 32997 32644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 34009 32987 gene locus_tag LOCUS_34120 34009 32987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 35088 34066 gene locus_tag LOCUS_34130 35088 34066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 35601 35092 gene locus_tag LOCUS_34140 35601 35092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 36461 35598 gene locus_tag LOCUS_34150 36461 35598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 38985 36472 gene locus_tag LOCUS_34160 38985 36472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 40737 38989 gene locus_tag LOCUS_34170 40737 38989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 41692 40745 gene locus_tag LOCUS_34180 41692 40745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 42606 41704 gene locus_tag LOCUS_34190 42606 41704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 43256 42627 gene locus_tag LOCUS_34200 43256 42627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 44240 43272 gene locus_tag LOCUS_34210 44240 43272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 46044 45151 gene locus_tag LOCUS_34220 46044 45151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 <47016 46045 gene locus_tag LOCUS_34230 <47016 46045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin >Feature sequence26 380 159 gene locus_tag LOCUS_34240 380 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 1153 809 gene locus_tag LOCUS_34250 1153 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 1611 1159 gene locus_tag LOCUS_34260 1611 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 1980 1618 gene locus_tag LOCUS_34270 1980 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 2087 2500 gene locus_tag LOCUS_34280 2087 2500 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968638.1 protein_id gnl|my_center|LOCUS_34280 3469 2924 gene locus_tag LOCUS_34290 3469 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 4849 3827 gene locus_tag LOCUS_34300 4849 3827 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_34300 5987 4851 gene locus_tag LOCUS_34310 5987 4851 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_34310 6180 6431 gene locus_tag LOCUS_34320 6180 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 6464 6970 gene locus_tag LOCUS_34330 gene cobU 6464 6970 CDS product cobinamide kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963579.1 protein_id gnl|my_center|LOCUS_34330 6976 7623 gene locus_tag LOCUS_34340 6976 7623 CDS product ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_34340 7855 9531 gene locus_tag LOCUS_34350 gene bluB 7855 9531 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL0 protein_id gnl|my_center|LOCUS_34350 9544 10140 gene locus_tag LOCUS_34360 9544 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 10142 10924 gene locus_tag LOCUS_34370 gene cobS 10142 10924 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZK9 protein_id gnl|my_center|LOCUS_34370 10909 11433 gene locus_tag LOCUS_34380 gene gpmA 10909 11433 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963576.1 protein_id gnl|my_center|LOCUS_34380 11960 13879 gene locus_tag LOCUS_34390 gene btuB 11960 13879 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVI9 protein_id gnl|my_center|LOCUS_34390 15368 13935 gene locus_tag LOCUS_34400 15368 13935 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_34400 15569 16060 gene locus_tag LOCUS_34410 15569 16060 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_34410 16041 16478 gene locus_tag LOCUS_34420 16041 16478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 16447 17013 gene locus_tag LOCUS_34430 16447 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963571.1 protein_id gnl|my_center|LOCUS_34430 17042 17569 gene locus_tag LOCUS_34440 17042 17569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963570.1 protein_id gnl|my_center|LOCUS_34440 17689 17606 gene locus_tag LOCUS_t00370 17689 17606 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17805 17732 gene locus_tag LOCUS_t00380 17805 17732 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 17906 17833 gene locus_tag LOCUS_t00390 17906 17833 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18036 18551 gene locus_tag LOCUS_34450 gene aroK 18036 18551 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 protein_id gnl|my_center|LOCUS_34450 19037 18543 gene locus_tag LOCUS_34460 gene pyrR2 19037 18543 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_34460 19628 19047 gene locus_tag LOCUS_34470 gene tpm 19628 19047 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_34470 20001 19612 gene locus_tag LOCUS_34480 20001 19612 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_34480 20072 21031 gene locus_tag LOCUS_34490 20072 21031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963560.1 protein_id gnl|my_center|LOCUS_34490 22060 21107 gene locus_tag LOCUS_34500 gene tktC 22060 21107 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_34500 22987 22079 gene locus_tag LOCUS_34510 gene tktA 22987 22079 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_34510 24453 23071 gene locus_tag LOCUS_34520 24453 23071 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388221.1 protein_id gnl|my_center|LOCUS_34520 24766 24467 gene locus_tag LOCUS_34530 24766 24467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 24943 26073 gene locus_tag LOCUS_34540 gene tgt 24943 26073 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_34540 26194 27219 gene locus_tag LOCUS_34550 26194 27219 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_34550 27206 28117 gene locus_tag LOCUS_34560 27206 28117 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_34560 28168 29121 gene locus_tag LOCUS_34570 gene accA 28168 29121 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_34570 29274 30824 gene locus_tag LOCUS_34580 gene dnaB 29274 30824 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_34580 31420 30893 gene locus_tag LOCUS_34590 31420 30893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 <33219 31535 gene locus_tag LOCUS_34600 <33219 31535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence27 86 1954 gene locus_tag LOCUS_34610 86 1954 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_34610 2726 4483 gene locus_tag LOCUS_34620 gene phhA 2726 4483 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964058.1 protein_id gnl|my_center|LOCUS_34620 6244 4622 gene locus_tag LOCUS_34630 6244 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 6353 6661 gene locus_tag LOCUS_34640 6353 6661 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963921.1 protein_id gnl|my_center|LOCUS_34640 7391 6762 gene locus_tag LOCUS_34650 7391 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 protein_id gnl|my_center|LOCUS_34650 8349 7402 gene locus_tag LOCUS_34660 8349 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_34660 8445 8840 gene locus_tag LOCUS_34670 8445 8840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 8881 9489 gene locus_tag LOCUS_34680 gene ychE 8881 9489 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 protein_id gnl|my_center|LOCUS_34680 10290 9553 gene locus_tag LOCUS_34690 10290 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 12991 10310 gene locus_tag LOCUS_34700 gene alaS 12991 10310 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 protein_id gnl|my_center|LOCUS_34700 13200 14177 gene locus_tag LOCUS_34710 13200 14177 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_34710 14242 14574 gene locus_tag LOCUS_34720 14242 14574 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_34720 14585 15178 gene locus_tag LOCUS_34730 14585 15178 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964048.1 protein_id gnl|my_center|LOCUS_34730 15186 15623 gene locus_tag LOCUS_34740 15186 15623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_34740 15623 16426 gene locus_tag LOCUS_34750 15623 16426 CDS product methanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964050.1 protein_id gnl|my_center|LOCUS_34750 16579 17463 gene locus_tag LOCUS_34760 16579 17463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 20235 17539 gene locus_tag LOCUS_34770 20235 17539 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_34770 21526 20405 gene locus_tag LOCUS_34780 gene leuB 21526 20405 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M0 protein_id gnl|my_center|LOCUS_34780 22147 21539 gene locus_tag LOCUS_34790 22147 21539 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_34790 23535 22150 gene locus_tag LOCUS_34800 gene leuC 23535 22150 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QP1 protein_id gnl|my_center|LOCUS_34800 24708 23542 gene locus_tag LOCUS_34810 24708 23542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 24864 26408 gene locus_tag LOCUS_34820 24864 26408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 protein_id gnl|my_center|LOCUS_34820 26554 27441 gene locus_tag LOCUS_34830 26554 27441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 28817 27507 gene locus_tag LOCUS_34840 gene der 28817 27507 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_34840 28976 29464 gene locus_tag LOCUS_34850 28976 29464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 30346 29465 gene locus_tag LOCUS_34860 gene era 30346 29465 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_34860 30676 30749 gene locus_tag LOCUS_t00400 30676 30749 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence28 261 971 gene locus_tag LOCUS_34870 261 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 1107 2654 gene locus_tag LOCUS_34880 1107 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203168.1 protein_id gnl|my_center|LOCUS_34880 2887 5682 gene locus_tag LOCUS_34890 2887 5682 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_34890 5741 6778 gene locus_tag LOCUS_34900 5741 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 7057 7647 gene locus_tag LOCUS_34910 7057 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 7740 7982 gene locus_tag LOCUS_34920 7740 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 7993 8514 gene locus_tag LOCUS_34930 7993 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 8597 9718 gene locus_tag LOCUS_34940 8597 9718 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140568.1 protein_id gnl|my_center|LOCUS_34940 9880 10374 gene locus_tag LOCUS_34950 9880 10374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 11161 12336 gene locus_tag LOCUS_34960 11161 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 12403 12807 gene locus_tag LOCUS_34970 12403 12807 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_34970 12973 13533 gene locus_tag LOCUS_34980 12973 13533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 13913 14218 gene locus_tag LOCUS_34990 13913 14218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 14396 15112 gene locus_tag LOCUS_35000 14396 15112 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_35000 18160 15236 gene locus_tag LOCUS_35010 18160 15236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 19224 18340 gene locus_tag LOCUS_35020 gene prfB 19224 18340 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_35020 19487 20512 gene locus_tag LOCUS_35030 gene ltaE 19487 20512 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_35030 20673 20876 gene locus_tag LOCUS_35040 20673 20876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963849.1 protein_id gnl|my_center|LOCUS_35040 21960 21016 gene locus_tag LOCUS_35050 gene lgt 21960 21016 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX82 protein_id gnl|my_center|LOCUS_35050 22297 22109 gene locus_tag LOCUS_35060 22297 22109 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX81 protein_id gnl|my_center|LOCUS_35060 23957 22473 gene locus_tag LOCUS_35070 gene cysS 23957 22473 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_35070 24910 24239 gene locus_tag LOCUS_35080 gene folE2 24910 24239 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_35080 >Feature sequence29 417 953 gene locus_tag LOCUS_35090 417 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 1122 1442 gene locus_tag LOCUS_35100 1122 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 1448 1765 gene locus_tag LOCUS_35110 1448 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 1999 2406 gene locus_tag LOCUS_35120 1999 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 2575 3609 gene locus_tag LOCUS_35130 2575 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 3826 4221 gene locus_tag LOCUS_35140 3826 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 4525 4908 gene locus_tag LOCUS_35150 4525 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 5100 5483 gene locus_tag LOCUS_35160 5100 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 5743 5516 gene locus_tag LOCUS_35170 5743 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 6672 6364 gene locus_tag LOCUS_35180 6672 6364 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XXD9 protein_id gnl|my_center|LOCUS_35180 9260 6741 gene locus_tag LOCUS_35190 9260 6741 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_35190 10161 9250 gene locus_tag LOCUS_35200 10161 9250 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 protein_id gnl|my_center|LOCUS_35200 10720 10205 gene locus_tag LOCUS_35210 10720 10205 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156585.1 protein_id gnl|my_center|LOCUS_35210 11017 12051 gene locus_tag LOCUS_35220 11017 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 12193 13530 gene locus_tag LOCUS_35230 gene ffh 12193 13530 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 protein_id gnl|my_center|LOCUS_35230 13593 14474 gene locus_tag LOCUS_35240 gene folD 13593 14474 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 protein_id gnl|my_center|LOCUS_35240 14752 14537 gene locus_tag LOCUS_35250 14752 14537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 16420 14825 gene locus_tag LOCUS_35260 gene prfC 16420 14825 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT6 protein_id gnl|my_center|LOCUS_35260 >Feature sequence30 2236 1310 gene locus_tag LOCUS_35270 2236 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 3267 2413 gene locus_tag LOCUS_35280 3267 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 4223 3501 gene locus_tag LOCUS_35290 4223 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 4789 4352 gene locus_tag LOCUS_35300 4789 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 5077 5322 gene locus_tag LOCUS_35310 5077 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 6374 5394 gene locus_tag LOCUS_35320 6374 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 7267 6455 gene locus_tag LOCUS_35330 7267 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362021.1 protein_id gnl|my_center|LOCUS_35330 7461 10304 gene locus_tag LOCUS_35340 gene gcvP 7461 10304 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_35340 10647 10988 gene locus_tag LOCUS_35350 10647 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350