>Feature sequence001 1527 160 gene locus_tag LOCUS_00010 1527 160 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_00010 2210 1569 gene locus_tag LOCUS_00020 2210 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817114.1 protein_id gnl|my_center|LOCUS_00020 2468 2214 gene locus_tag LOCUS_00030 2468 2214 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070523.1 protein_id gnl|my_center|LOCUS_00030 3188 2532 gene locus_tag LOCUS_00040 3188 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4771 3188 gene locus_tag LOCUS_00050 4771 3188 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_00050 4857 6536 gene locus_tag LOCUS_00060 4857 6536 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_00060 6523 6933 gene locus_tag LOCUS_00070 6523 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6884 7093 gene locus_tag LOCUS_00080 6884 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7100 8290 gene locus_tag LOCUS_00090 7100 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8868 8323 gene locus_tag LOCUS_00100 8868 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9005 9238 gene locus_tag LOCUS_00110 9005 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10993 9473 gene locus_tag LOCUS_00120 10993 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11736 10996 gene locus_tag LOCUS_00130 11736 10996 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_00130 12845 11736 gene locus_tag LOCUS_00140 12845 11736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14215 12842 gene locus_tag LOCUS_00150 14215 12842 CDS product Mg-protoporphyrin IX monomethyl ester oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036859.1 protein_id gnl|my_center|LOCUS_00150 14982 14212 gene locus_tag LOCUS_00160 14982 14212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496768.1 protein_id gnl|my_center|LOCUS_00160 16417 14972 gene locus_tag LOCUS_00170 16417 14972 CDS product Mg-protoporphyrin IX monomethyl ester oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036859.1 protein_id gnl|my_center|LOCUS_00170 17312 16410 gene locus_tag LOCUS_00180 17312 16410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18362 17595 gene locus_tag LOCUS_00190 18362 17595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21264 18412 gene locus_tag LOCUS_00200 gene polA 21264 18412 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_00200 21389 22618 gene locus_tag LOCUS_00210 21389 22618 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_00210 22693 22989 gene locus_tag LOCUS_00220 22693 22989 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_00220 23666 23028 gene locus_tag LOCUS_00230 23666 23028 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_00230 27032 23832 gene locus_tag LOCUS_00240 27032 23832 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 protein_id gnl|my_center|LOCUS_00240 27188 27259 gene locus_tag LOCUS_t00010 27188 27259 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 28205 27381 gene locus_tag LOCUS_00250 gene uspA 28205 27381 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_00250 28376 28843 gene locus_tag LOCUS_00260 gene rimP 28376 28843 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV6 protein_id gnl|my_center|LOCUS_00260 28858 30099 gene locus_tag LOCUS_00270 gene nusA 28858 30099 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_00270 30148 32973 gene locus_tag LOCUS_00280 gene infB 30148 32973 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 protein_id gnl|my_center|LOCUS_00280 >Feature sequence002 1525 92 gene locus_tag LOCUS_00290 1525 92 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 protein_id gnl|my_center|LOCUS_00290 2478 1540 gene locus_tag LOCUS_00300 2478 1540 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074155.1 protein_id gnl|my_center|LOCUS_00300 4316 2481 gene locus_tag LOCUS_00310 gene susA 4316 2481 CDS product neopullulanase SusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G0 protein_id gnl|my_center|LOCUS_00310 6525 4411 gene locus_tag LOCUS_00320 gene susB 6525 4411 CDS product glucan 1,4-alpha-glucosidase SusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G8JZS4 protein_id gnl|my_center|LOCUS_00320 8847 6529 gene locus_tag LOCUS_00330 8847 6529 CDS product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_00330 9508 8852 gene locus_tag LOCUS_00340 gene pgmB2 9508 8852 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_00340 10925 9519 gene locus_tag LOCUS_00350 10925 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 12148 11123 gene locus_tag LOCUS_00360 12148 11123 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_00360 12416 15298 gene locus_tag LOCUS_00370 gene susC 12416 15298 CDS product TonB-dependent receptor SusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G1 protein_id gnl|my_center|LOCUS_00370 15310 16902 gene locus_tag LOCUS_00380 15310 16902 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403138.1 protein_id gnl|my_center|LOCUS_00380 16933 17994 gene locus_tag LOCUS_00390 16933 17994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 >Feature sequence003 242 167 gene locus_tag LOCUS_t00020 242 167 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 432 1040 gene locus_tag LOCUS_00400 gene udk 432 1040 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 protein_id gnl|my_center|LOCUS_00400 1043 1408 gene locus_tag LOCUS_00410 1043 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 1420 2787 gene locus_tag LOCUS_00420 gene mutA 1420 2787 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963259.1 protein_id gnl|my_center|LOCUS_00420 2836 4995 gene locus_tag LOCUS_00430 gene mutB 2836 4995 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 protein_id gnl|my_center|LOCUS_00430 5676 5131 gene locus_tag LOCUS_00440 5676 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 5804 6889 gene locus_tag LOCUS_00450 5804 6889 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204968.1 protein_id gnl|my_center|LOCUS_00450 7113 10280 gene locus_tag LOCUS_00460 7113 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 10685 11449 gene locus_tag LOCUS_00470 gene parA 10685 11449 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_00470 11458 12357 gene locus_tag LOCUS_00480 gene parB 11458 12357 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_00480 12357 12917 gene locus_tag LOCUS_00490 12357 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_00490 12962 13660 gene locus_tag LOCUS_00500 gene dapB 12962 13660 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_00500 13718 15433 gene locus_tag LOCUS_00510 gene lepB 13718 15433 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP1 protein_id gnl|my_center|LOCUS_00510 15653 16141 gene locus_tag LOCUS_00520 15653 16141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 protein_id gnl|my_center|LOCUS_00520 17507 16476 gene locus_tag LOCUS_00530 17507 16476 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_00530 18366 17509 gene locus_tag LOCUS_00540 18366 17509 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963287.1 protein_id gnl|my_center|LOCUS_00540 >Feature sequence004 <1 648 gene locus_tag LOCUS_00550 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZI2:triosephosphate isomerase 2530 758 gene locus_tag LOCUS_00560 gene rho 2530 758 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_00560 2719 3129 gene locus_tag LOCUS_00570 2719 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_00570 3766 3311 gene locus_tag LOCUS_00580 3766 3311 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_00580 3923 4669 gene locus_tag LOCUS_00590 gene truA 3923 4669 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_00590 4709 6460 gene locus_tag LOCUS_00600 4709 6460 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_00600 6700 8088 gene locus_tag LOCUS_00610 gene lpdA2 6700 8088 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_00610 8826 8182 gene locus_tag LOCUS_00620 8826 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 9173 10279 gene locus_tag LOCUS_00630 9173 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 10281 11393 gene locus_tag LOCUS_00640 10281 11393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 11390 12241 gene locus_tag LOCUS_00650 11390 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 12382 12573 gene locus_tag LOCUS_00660 12382 12573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 12577 14040 gene locus_tag LOCUS_00670 12577 14040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 14130 14810 gene locus_tag LOCUS_00680 14130 14810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 15584 14898 gene locus_tag LOCUS_00690 gene cmk 15584 14898 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 protein_id gnl|my_center|LOCUS_00690 <16455 15769 gene locus_tag LOCUS_00700 <16455 15769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963823.1:penicillin-binding protein >Feature sequence005 2224 26 gene locus_tag LOCUS_00710 2224 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_00710 2834 2298 gene locus_tag LOCUS_00720 2834 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 4125 2875 gene locus_tag LOCUS_00730 4125 2875 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_00730 4253 4552 gene locus_tag LOCUS_00740 4253 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 4741 6273 gene locus_tag LOCUS_00750 gene purH 4741 6273 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_00750 6417 7445 gene locus_tag LOCUS_00760 gene mreB 6417 7445 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_00760 7534 8286 gene locus_tag LOCUS_00770 gene mreC 7534 8286 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 protein_id gnl|my_center|LOCUS_00770 8395 8790 gene locus_tag LOCUS_00780 gene mreD 8395 8790 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_00780 8787 10715 gene locus_tag LOCUS_00790 gene pbpA 8787 10715 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_00790 10716 11972 gene locus_tag LOCUS_00800 gene rodA 10716 11972 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_00800 12707 11973 gene locus_tag LOCUS_00810 gene nucA 12707 11973 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_00810 14935 12830 gene locus_tag LOCUS_00820 14935 12830 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_00820 >Feature sequence006 2136 1465 gene locus_tag LOCUS_00830 2136 1465 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_00830 2781 2149 gene locus_tag LOCUS_00840 2781 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 3085 2909 gene locus_tag LOCUS_00850 3085 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 4602 3085 gene locus_tag LOCUS_00860 gene gpmI 4602 3085 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_00860 7097 4686 gene locus_tag LOCUS_00870 7097 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 7288 8019 gene locus_tag LOCUS_00880 7288 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964232.1 protein_id gnl|my_center|LOCUS_00880 9621 8032 gene locus_tag LOCUS_00890 9621 8032 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964231.1 protein_id gnl|my_center|LOCUS_00890 10099 9665 gene locus_tag LOCUS_00900 gene yitI 10099 9665 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964230.1 protein_id gnl|my_center|LOCUS_00900 10286 10359 gene locus_tag LOCUS_t00030 10286 10359 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11099 10392 gene locus_tag LOCUS_00910 gene pepE 11099 10392 CDS product dipeptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_00910 11208 11984 gene locus_tag LOCUS_00920 11208 11984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964228.1 protein_id gnl|my_center|LOCUS_00920 11974 12807 gene locus_tag LOCUS_00930 11974 12807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 12824 13330 gene locus_tag LOCUS_00940 12824 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964227.1 protein_id gnl|my_center|LOCUS_00940 >Feature sequence007 4263 6104 gene locus_tag LOCUS_00950 4263 6104 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962777.1 protein_id gnl|my_center|LOCUS_00950 6156 7067 gene locus_tag LOCUS_00960 gene acdS 6156 7067 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_00960 7054 7920 gene locus_tag LOCUS_00970 7054 7920 CDS product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 protein_id gnl|my_center|LOCUS_00970 7920 9206 gene locus_tag LOCUS_00980 gene hemL 7920 9206 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW4 protein_id gnl|my_center|LOCUS_00980 9617 9246 gene locus_tag LOCUS_00990 9617 9246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963335.1 protein_id gnl|my_center|LOCUS_00990 10118 9699 gene locus_tag LOCUS_01000 10118 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 11739 10210 gene locus_tag LOCUS_01010 11739 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 13504 11807 gene locus_tag LOCUS_01020 gene lysS 13504 11807 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 protein_id gnl|my_center|LOCUS_01020 >Feature sequence008 111 1574 gene locus_tag LOCUS_01030 gene murE 111 1574 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_01030 1662 2882 gene locus_tag LOCUS_01040 gene mraY 1662 2882 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_01040 2884 4218 gene locus_tag LOCUS_01050 gene murD 2884 4218 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_01050 4297 5652 gene locus_tag LOCUS_01060 gene ftsW 4297 5652 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_01060 5702 6823 gene locus_tag LOCUS_01070 gene murG 5702 6823 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_01070 6975 8267 gene locus_tag LOCUS_01080 gene murC 6975 8267 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_01080 8305 8976 gene locus_tag LOCUS_01090 gene ftsQ 8305 8976 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964154.1 protein_id gnl|my_center|LOCUS_01090 8986 10353 gene locus_tag LOCUS_01100 gene ftsA 8986 10353 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_01100 10365 12338 gene locus_tag LOCUS_01110 gene ftsZ 10365 12338 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H191 protein_id gnl|my_center|LOCUS_01110 12475 12924 gene locus_tag LOCUS_01120 12475 12924 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_01120 13003 13079 gene locus_tag LOCUS_t00040 13003 13079 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13572 13030 gene locus_tag LOCUS_01130 13572 13030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 >Feature sequence009 1559 63 gene locus_tag LOCUS_01140 gene gltX 1559 63 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 protein_id gnl|my_center|LOCUS_01140 1996 5217 gene locus_tag LOCUS_01150 1996 5217 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_01150 5210 5629 gene locus_tag LOCUS_01160 gene ybeY 5210 5629 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_01160 5688 7559 gene locus_tag LOCUS_01170 gene mnmG 5688 7559 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_01170 7695 8543 gene locus_tag LOCUS_01180 7695 8543 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_01180 8785 9360 gene locus_tag LOCUS_01190 8785 9360 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962186.1 protein_id gnl|my_center|LOCUS_01190 9532 11817 gene locus_tag LOCUS_01200 9532 11817 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962188.1 protein_id gnl|my_center|LOCUS_01200 11948 12259 gene locus_tag LOCUS_01210 11948 12259 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962418.1 protein_id gnl|my_center|LOCUS_01210 12800 12423 gene locus_tag LOCUS_01220 12800 12423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 13226 12837 gene locus_tag LOCUS_01230 13226 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962191.1 protein_id gnl|my_center|LOCUS_01230 >Feature sequence010 1023 439 gene locus_tag LOCUS_01240 1023 439 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_01240 1888 1016 gene locus_tag LOCUS_01250 1888 1016 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_01250 2596 2093 gene locus_tag LOCUS_01260 gene kdsC 2596 2093 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_01260 3362 2604 gene locus_tag LOCUS_01270 3362 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_01270 3886 4539 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq taatcaattatcaagtttagatgt 8623 6194 gene locus_tag LOCUS_01280 gene pheT 8623 6194 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_01280 9955 8942 gene locus_tag LOCUS_01290 gene pip3 9955 8942 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970212.1 protein_id gnl|my_center|LOCUS_01290 10881 10018 gene locus_tag LOCUS_01300 10881 10018 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_01300 12267 10963 gene locus_tag LOCUS_01310 12267 10963 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403495.1 protein_id gnl|my_center|LOCUS_01310 <13438 12398 gene locus_tag LOCUS_01320 <13438 12398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764017.1:acriflavin resistance protein >Feature sequence011 <1 942 gene locus_tag LOCUS_01330 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963291.1:ATPase 1025 1219 gene locus_tag LOCUS_01340 gene ccoS 1025 1219 CDS product cytochrome oxidase maturation protein Cbb3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963292.1 protein_id gnl|my_center|LOCUS_01340 1303 3405 gene locus_tag LOCUS_01350 gene ccoN/ccoO 1303 3405 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_01350 3420 3593 gene locus_tag LOCUS_01360 gene ccoQ 3420 3593 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963295.1 protein_id gnl|my_center|LOCUS_01360 3679 4623 gene locus_tag LOCUS_01370 gene ccoP 3679 4623 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_01370 4698 6116 gene locus_tag LOCUS_01380 gene ccoG 4698 6116 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_01380 6129 6575 gene locus_tag LOCUS_01390 gene ccoH 6129 6575 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_01390 6632 7279 gene locus_tag LOCUS_01400 6632 7279 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_01400 9032 7347 gene locus_tag LOCUS_01410 9032 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 11592 9145 gene locus_tag LOCUS_01420 11592 9145 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_01420 12666 11665 gene locus_tag LOCUS_01430 12666 11665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 13146 12949 gene locus_tag LOCUS_01440 13146 12949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 >Feature sequence012 668 516 gene locus_tag LOCUS_01450 668 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 1406 711 gene locus_tag LOCUS_01460 1406 711 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_01460 2776 1427 gene locus_tag LOCUS_01470 2776 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 3762 2941 gene locus_tag LOCUS_01480 3762 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962726.1 protein_id gnl|my_center|LOCUS_01480 3839 4720 gene locus_tag LOCUS_01490 3839 4720 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962727.1 protein_id gnl|my_center|LOCUS_01490 4737 5306 gene locus_tag LOCUS_01500 4737 5306 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_01500 5483 5704 gene locus_tag LOCUS_01510 5483 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_01510 5824 9147 gene locus_tag LOCUS_01520 gene secA 5824 9147 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_01520 10427 9231 gene locus_tag LOCUS_01530 10427 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 13219 10427 gene locus_tag LOCUS_01540 gene uvrA1 13219 10427 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_01540 >Feature sequence013 1051 191 gene locus_tag LOCUS_01550 1051 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962838.1 protein_id gnl|my_center|LOCUS_01550 2064 1339 gene locus_tag LOCUS_01560 2064 1339 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962837.1 protein_id gnl|my_center|LOCUS_01560 3862 2084 gene locus_tag LOCUS_01570 3862 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_01570 4197 3868 gene locus_tag LOCUS_01580 4197 3868 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_01580 4431 4886 gene locus_tag LOCUS_01590 4431 4886 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_01590 4996 5919 gene locus_tag LOCUS_01600 4996 5919 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_01600 6123 6686 gene locus_tag LOCUS_01610 gene grpE 6123 6686 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_01610 6743 7861 gene locus_tag LOCUS_01620 gene dnaJ 6743 7861 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_01620 8022 8942 gene locus_tag LOCUS_01630 gene natA 8022 8942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_01630 8945 10243 gene locus_tag LOCUS_01640 gene natB 8945 10243 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_01640 10254 11081 gene locus_tag LOCUS_01650 10254 11081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 11092 12255 gene locus_tag LOCUS_01660 11092 12255 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_01660 >Feature sequence014 1414 1031 gene locus_tag LOCUS_01670 1414 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 1697 1395 gene locus_tag LOCUS_01680 1697 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 2503 1751 gene locus_tag LOCUS_01690 gene ste14 2503 1751 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_01690 3615 2521 gene locus_tag LOCUS_01700 gene engD 3615 2521 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC6 protein_id gnl|my_center|LOCUS_01700 4907 3708 gene locus_tag LOCUS_01710 4907 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962804.1 protein_id gnl|my_center|LOCUS_01710 5394 5044 gene locus_tag LOCUS_01720 gene fdx1 5394 5044 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_01720 5532 6590 gene locus_tag LOCUS_01730 5532 6590 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_01730 6735 7805 gene locus_tag LOCUS_01740 gene serC 6735 7805 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 protein_id gnl|my_center|LOCUS_01740 7863 8819 gene locus_tag LOCUS_01750 gene serA 7863 8819 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_01750 8911 9342 gene locus_tag LOCUS_01760 8911 9342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962798.1 protein_id gnl|my_center|LOCUS_01760 9346 9687 gene locus_tag LOCUS_01770 9346 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 protein_id gnl|my_center|LOCUS_01770 11245 9704 gene locus_tag LOCUS_01780 gene pccB 11245 9704 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_01780 <11931 11333 gene locus_tag LOCUS_01790 <11931 11333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403246.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence015 16 1023 gene locus_tag LOCUS_01800 16 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 1194 2576 gene locus_tag LOCUS_01810 1194 2576 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_01810 3725 2604 gene locus_tag LOCUS_01820 3725 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963373.1 protein_id gnl|my_center|LOCUS_01820 5028 4039 gene locus_tag LOCUS_01830 5028 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_01830 5239 5982 gene locus_tag LOCUS_01840 gene pssA 5239 5982 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_01840 5982 6830 gene locus_tag LOCUS_01850 gene yegX 5982 6830 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963370.1 protein_id gnl|my_center|LOCUS_01850 7868 7071 gene locus_tag LOCUS_01860 gene lptB 7868 7071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_01860 8340 7990 gene locus_tag LOCUS_01870 8340 7990 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_01870 9165 8344 gene locus_tag LOCUS_01880 gene tatC 9165 8344 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_01880 10130 9165 gene locus_tag LOCUS_01890 gene kdsD 10130 9165 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_01890 >Feature sequence016 1166 78 gene locus_tag LOCUS_01900 1166 78 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_01900 2371 1241 gene locus_tag LOCUS_01910 gene tgt 2371 1241 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_01910 2805 3650 gene locus_tag LOCUS_01920 gene tktA 2805 3650 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_01920 3715 4668 gene locus_tag LOCUS_01930 gene tktC 3715 4668 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_01930 4847 5125 gene locus_tag LOCUS_01940 4847 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 5357 5992 gene locus_tag LOCUS_01950 5357 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 7687 6038 gene locus_tag LOCUS_01960 gene menD 7687 6038 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_01960 7766 8260 gene locus_tag LOCUS_01970 gene yncA 7766 8260 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963787.1 protein_id gnl|my_center|LOCUS_01970 8918 8328 gene locus_tag LOCUS_01980 gene bsaA 8918 8328 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH0 protein_id gnl|my_center|LOCUS_01980 <11746 9017 gene locus_tag LOCUS_01990 <11746 9017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963539.1:cytochrome c biogenesis protein >Feature sequence017 <1 1527 gene locus_tag LOCUS_02000 <1 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962548.1:quinol:cytochrome C oxidoreductase 1547 2704 gene locus_tag LOCUS_02010 gene ctaC 1547 2704 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_02010 2736 4502 gene locus_tag LOCUS_02020 gene ctaD 2736 4502 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_02020 4577 5599 gene locus_tag LOCUS_02030 gene ruvB 4577 5599 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_02030 5601 6527 gene locus_tag LOCUS_02040 gene queG 5601 6527 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_02040 6617 7498 gene locus_tag LOCUS_02050 6617 7498 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490863.1 protein_id gnl|my_center|LOCUS_02050 7502 7924 gene locus_tag LOCUS_02060 7502 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 8008 10290 gene locus_tag LOCUS_02070 gene maeB 8008 10290 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_02070 10298 10879 gene locus_tag LOCUS_02080 gene ruvA 10298 10879 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_02080 >Feature sequence018 1459 848 gene locus_tag LOCUS_02090 gene nqrE 1459 848 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR7 protein_id gnl|my_center|LOCUS_02090 2141 1488 gene locus_tag LOCUS_02100 gene nqrD 2141 1488 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_02100 2837 2148 gene locus_tag LOCUS_02110 gene nqrC 2837 2148 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 protein_id gnl|my_center|LOCUS_02110 4000 2840 gene locus_tag LOCUS_02120 gene nqrB 4000 2840 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K8 protein_id gnl|my_center|LOCUS_02120 5352 4003 gene locus_tag LOCUS_02130 gene nqrA 5352 4003 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_02130 5547 6794 gene locus_tag LOCUS_02140 5547 6794 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_02140 6797 7894 gene locus_tag LOCUS_02150 6797 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 7898 8284 gene locus_tag LOCUS_02160 gene apaG 7898 8284 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_02160 8313 9032 gene locus_tag LOCUS_02170 8313 9032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 9164 10789 gene locus_tag LOCUS_02180 gene pruA 9164 10789 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_02180 11239 10880 gene locus_tag LOCUS_02190 11239 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 >Feature sequence019 873 1352 gene locus_tag LOCUS_02200 gene cdd 873 1352 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_02200 1515 2513 gene locus_tag LOCUS_02210 gene pdhA 1515 2513 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_02210 2519 4138 gene locus_tag LOCUS_02220 gene pdhC 2519 4138 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_02220 4346 4122 gene locus_tag LOCUS_02230 4346 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 4333 5811 gene locus_tag LOCUS_02240 4333 5811 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963148.1 protein_id gnl|my_center|LOCUS_02240 5877 6839 gene locus_tag LOCUS_02250 5877 6839 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796268.1 protein_id gnl|my_center|LOCUS_02250 6829 7515 gene locus_tag LOCUS_02260 6829 7515 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_02260 7519 8121 gene locus_tag LOCUS_02270 7519 8121 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_02270 8143 9201 gene locus_tag LOCUS_02280 gene manC 8143 9201 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_02280 9201 10586 gene locus_tag LOCUS_02290 9201 10586 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_02290 11349 10579 gene locus_tag LOCUS_02300 11349 10579 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence020 <1 1632 gene locus_tag LOCUS_02310 <1 1632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0Z9:urocanate hydratase 1707 2225 gene locus_tag LOCUS_02320 1707 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_02320 2330 3571 gene locus_tag LOCUS_02330 2330 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 3949 5244 gene locus_tag LOCUS_02340 3949 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 5332 7089 gene locus_tag LOCUS_02350 gene phhA 5332 7089 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964058.1 protein_id gnl|my_center|LOCUS_02350 7156 7464 gene locus_tag LOCUS_02360 7156 7464 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963921.1 protein_id gnl|my_center|LOCUS_02360 8638 7493 gene locus_tag LOCUS_02370 8638 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 protein_id gnl|my_center|LOCUS_02370 9180 8698 gene locus_tag LOCUS_02380 9180 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553163.1 protein_id gnl|my_center|LOCUS_02380 10373 9312 gene locus_tag LOCUS_02390 10373 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 10850 10398 gene locus_tag LOCUS_02400 10850 10398 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 protein_id gnl|my_center|LOCUS_02400 11056 10983 gene locus_tag LOCUS_t00050 11056 10983 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence021 1165 662 gene locus_tag LOCUS_02410 1165 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 1994 1170 gene locus_tag LOCUS_02420 gene pyrF 1994 1170 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_02420 2156 2344 gene locus_tag LOCUS_02430 2156 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 2365 2634 gene locus_tag LOCUS_02440 2365 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 2646 2798 gene locus_tag LOCUS_02450 2646 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 2802 3032 gene locus_tag LOCUS_02460 2802 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 3043 3372 gene locus_tag LOCUS_02470 3043 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 3383 4036 gene locus_tag LOCUS_02480 3383 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 5190 4117 gene locus_tag LOCUS_02490 gene prfA 5190 4117 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_02490 5429 7582 gene locus_tag LOCUS_02500 gene fhuA 5429 7582 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964026.1 protein_id gnl|my_center|LOCUS_02500 7603 8151 gene locus_tag LOCUS_02510 7603 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964027.1 protein_id gnl|my_center|LOCUS_02510 8184 8834 gene locus_tag LOCUS_02520 8184 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 10741 9275 gene locus_tag LOCUS_02530 gene pepD 10741 9275 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964033.1 protein_id gnl|my_center|LOCUS_02530 >Feature sequence022 43 1659 gene locus_tag LOCUS_02540 43 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 protein_id gnl|my_center|LOCUS_02540 1659 2663 gene locus_tag LOCUS_02550 gene batA 1659 2663 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_02550 2675 3718 gene locus_tag LOCUS_02560 gene batB 2675 3718 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_02560 3699 4448 gene locus_tag LOCUS_02570 gene batC 3699 4448 CDS product BatC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962308.1 protein_id gnl|my_center|LOCUS_02570 4452 6224 gene locus_tag LOCUS_02580 gene batD 4452 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_02580 6313 7071 gene locus_tag LOCUS_02590 gene batE 6313 7071 CDS product BatE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_02590 7657 7136 gene locus_tag LOCUS_02600 7657 7136 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962305.1 protein_id gnl|my_center|LOCUS_02600 7807 8163 gene locus_tag LOCUS_02610 7807 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_02610 8293 9312 gene locus_tag LOCUS_02620 gene pheS 8293 9312 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_02620 9414 9821 gene locus_tag LOCUS_02630 9414 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_02630 10243 10563 gene locus_tag LOCUS_02640 10243 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence023 2597 1914 gene locus_tag LOCUS_02650 gene tdk 2597 1914 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_02650 2649 3575 gene locus_tag LOCUS_02660 2649 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963207.1 protein_id gnl|my_center|LOCUS_02660 3973 4656 gene locus_tag LOCUS_02670 gene rsmI 3973 4656 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 protein_id gnl|my_center|LOCUS_02670 5137 6327 gene locus_tag LOCUS_02680 5137 6327 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_02680 6383 6769 gene locus_tag LOCUS_02690 6383 6769 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_02690 8482 6860 gene locus_tag LOCUS_02700 gene ade 8482 6860 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI0 protein_id gnl|my_center|LOCUS_02700 8633 10333 gene locus_tag LOCUS_02710 gene recJ 8633 10333 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_02710 >Feature sequence024 43 795 gene locus_tag LOCUS_02720 43 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 1937 876 gene locus_tag LOCUS_02730 1937 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 2091 2564 gene locus_tag LOCUS_02740 2091 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 2568 4301 gene locus_tag LOCUS_02750 2568 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 7155 4369 gene locus_tag LOCUS_02760 7155 4369 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_02760 8596 7286 gene locus_tag LOCUS_02770 gene der 8596 7286 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_02770 8800 9330 gene locus_tag LOCUS_02780 8800 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 10329 9445 gene locus_tag LOCUS_02790 gene era 10329 9445 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_02790 10447 10520 gene locus_tag LOCUS_t00060 10447 10520 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10554 10627 gene locus_tag LOCUS_t00070 10554 10627 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence025 633 490 gene locus_tag LOCUS_02800 633 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 1327 665 gene locus_tag LOCUS_02810 1327 665 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963877.1 protein_id gnl|my_center|LOCUS_02810 2204 1365 gene locus_tag LOCUS_02820 2204 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_02820 4576 2207 gene locus_tag LOCUS_02830 4576 2207 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_02830 4754 5365 gene locus_tag LOCUS_02840 4754 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 7641 5419 gene locus_tag LOCUS_02850 7641 5419 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104510.1 protein_id gnl|my_center|LOCUS_02850 8153 7797 gene locus_tag LOCUS_02860 gene rplS 8153 7797 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_02860 8967 8290 gene locus_tag LOCUS_02870 gene trmD 8967 8290 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_02870 9782 8985 gene locus_tag LOCUS_02880 9782 8985 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence026 1257 652 gene locus_tag LOCUS_02890 1257 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 1561 1803 gene locus_tag LOCUS_02900 1561 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 1919 8992 gene locus_tag LOCUS_02910 1919 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 9000 9995 gene locus_tag LOCUS_02920 9000 9995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 >Feature sequence027 1598 225 gene locus_tag LOCUS_02930 1598 225 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_02930 3339 1732 gene locus_tag LOCUS_02940 3339 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 3439 4125 gene locus_tag LOCUS_02950 3439 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 5461 4109 gene locus_tag LOCUS_02960 gene mgtE 5461 4109 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_02960 6230 5451 gene locus_tag LOCUS_02970 gene rsmA 6230 5451 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_02970 6558 6232 gene locus_tag LOCUS_02980 6558 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_02980 8467 6686 gene locus_tag LOCUS_02990 8467 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_02990 9813 8542 gene locus_tag LOCUS_03000 gene serS 9813 8542 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_03000 >Feature sequence028 353 2512 gene locus_tag LOCUS_03010 gene pnp 353 2512 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H185 protein_id gnl|my_center|LOCUS_03010 3195 2581 gene locus_tag LOCUS_03020 3195 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 3793 3188 gene locus_tag LOCUS_03030 3793 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 3890 4840 gene locus_tag LOCUS_03040 3890 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 4923 5786 gene locus_tag LOCUS_03050 gene rpoD 4923 5786 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_03050 6016 8847 gene locus_tag LOCUS_03060 6016 8847 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_03060 8926 9879 gene locus_tag LOCUS_03070 8926 9879 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797170.1 protein_id gnl|my_center|LOCUS_03070 >Feature sequence029 2141 3427 gene locus_tag LOCUS_03080 2141 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 3477 4919 gene locus_tag LOCUS_03090 gene srfJ 3477 4919 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636452.2 protein_id gnl|my_center|LOCUS_03090 4927 6462 gene locus_tag LOCUS_03100 4927 6462 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_03100 6467 7396 gene locus_tag LOCUS_03110 6467 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 7386 9077 gene locus_tag LOCUS_03120 7386 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 >Feature sequence030 447 61 gene locus_tag LOCUS_03130 447 61 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939136.1 protein_id gnl|my_center|LOCUS_03130 1407 547 gene locus_tag LOCUS_03140 1407 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964150.1 protein_id gnl|my_center|LOCUS_03140 1878 1612 gene locus_tag LOCUS_03150 1878 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03150 2477 1887 gene locus_tag LOCUS_03160 2477 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03160 2911 2477 gene locus_tag LOCUS_03170 2911 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 3281 5140 gene locus_tag LOCUS_03180 3281 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 >Feature sequence031 <1 3174 gene locus_tag LOCUS_03190 <1 3174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107780.1:SusC/RagA family TonB-linked outer membrane protein 3188 4672 gene locus_tag LOCUS_03200 3188 4672 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202497.1 protein_id gnl|my_center|LOCUS_03200 4745 5518 gene locus_tag LOCUS_03210 4745 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 5649 7598 gene locus_tag LOCUS_03220 5649 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_03220 7794 9155 gene locus_tag LOCUS_03230 7794 9155 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_03230 >Feature sequence032 <1 531 gene locus_tag LOCUS_03240 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964524.1:DNA processing protein DprA 567 3140 gene locus_tag LOCUS_03250 gene ppc 567 3140 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8N7 protein_id gnl|my_center|LOCUS_03250 3169 3795 gene locus_tag LOCUS_03260 3169 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 4822 3854 gene locus_tag LOCUS_03270 gene trpS 4822 3854 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_03270 4930 5670 gene locus_tag LOCUS_03280 4930 5670 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_03280 7420 5762 gene locus_tag LOCUS_03290 7420 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 7959 7417 gene locus_tag LOCUS_03300 7959 7417 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_03300 8372 7971 gene locus_tag LOCUS_03310 8372 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 9468 8464 gene locus_tag LOCUS_03320 gene recA 9468 8464 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_03320 >Feature sequence033 881 402 gene locus_tag LOCUS_03330 881 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 2749 1109 gene locus_tag LOCUS_03340 2749 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 4102 2759 gene locus_tag LOCUS_03350 4102 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 5189 4164 gene locus_tag LOCUS_03360 5189 4164 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_03360 5896 5186 gene locus_tag LOCUS_03370 5896 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 6347 5889 gene locus_tag LOCUS_03380 6347 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 6616 6353 gene locus_tag LOCUS_03390 6616 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 7185 6634 gene locus_tag LOCUS_03400 7185 6634 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_03400 7313 8059 gene locus_tag LOCUS_03410 7313 8059 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_03410 8139 8507 gene locus_tag LOCUS_03420 8139 8507 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963264.1 protein_id gnl|my_center|LOCUS_03420 >Feature sequence034 2795 240 gene locus_tag LOCUS_03430 gene gyrA 2795 240 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_03430 3002 5599 gene locus_tag LOCUS_03440 gene clpA 3002 5599 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_03440 5680 7047 gene locus_tag LOCUS_03450 gene rimK 5680 7047 CDS product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 protein_id gnl|my_center|LOCUS_03450 7073 7255 gene locus_tag LOCUS_03460 7073 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 7252 7833 gene locus_tag LOCUS_03470 7252 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_03470 7906 8202 gene locus_tag LOCUS_03480 7906 8202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 <9500 8254 gene locus_tag LOCUS_03490 <9500 8254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXW5:histidine ammonia-lyase >Feature sequence035 <1 557 gene locus_tag LOCUS_03500 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY77:imidazole glycerol phosphate synthase subunit HisH 589 1362 gene locus_tag LOCUS_03510 gene hisA 589 1362 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_03510 1389 2144 gene locus_tag LOCUS_03520 gene hisF 1389 2144 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_03520 2322 2921 gene locus_tag LOCUS_03530 gene hisIE 2322 2921 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 protein_id gnl|my_center|LOCUS_03530 3498 2932 gene locus_tag LOCUS_03540 3498 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 3570 3941 gene locus_tag LOCUS_03550 3570 3941 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963098.1 protein_id gnl|my_center|LOCUS_03550 4105 4794 gene locus_tag LOCUS_03560 4105 4794 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_03560 5255 4869 gene locus_tag LOCUS_03570 5255 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_03570 6602 5352 gene locus_tag LOCUS_03580 gene mscS2 6602 5352 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_03580 6880 6602 gene locus_tag LOCUS_03590 gene ydzA 6880 6602 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_03590 7485 6877 gene locus_tag LOCUS_03600 7485 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 7969 7601 gene locus_tag LOCUS_03610 7969 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 >Feature sequence036 <1 792 gene locus_tag LOCUS_03620 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962697.1:leucine dehydrogenase 876 1817 gene locus_tag LOCUS_03630 gene nusB 876 1817 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_03630 1830 2288 gene locus_tag LOCUS_03640 1830 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 2311 2577 gene locus_tag LOCUS_03650 gene yajC 2311 2577 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_03650 4895 2655 gene locus_tag LOCUS_03660 4895 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 6236 4995 gene locus_tag LOCUS_03670 gene pepT 6236 4995 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W1 protein_id gnl|my_center|LOCUS_03670 7385 6534 gene locus_tag LOCUS_03680 7385 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 8665 7388 gene locus_tag LOCUS_03690 8665 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 >Feature sequence037 1988 6 gene locus_tag LOCUS_03700 gene ftsI 1988 6 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_03700 2335 1979 gene locus_tag LOCUS_03710 2335 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964162.1 protein_id gnl|my_center|LOCUS_03710 3237 2341 gene locus_tag LOCUS_03720 gene rsmH 3237 2341 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 protein_id gnl|my_center|LOCUS_03720 3544 3224 gene locus_tag LOCUS_03730 3544 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 4030 4785 gene locus_tag LOCUS_03740 gene pcbD 4030 4785 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_03740 4822 5442 gene locus_tag LOCUS_03750 gene engB 4822 5442 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 protein_id gnl|my_center|LOCUS_03750 5830 5504 gene locus_tag LOCUS_03760 gene gldC 5830 5504 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_03760 6795 5833 gene locus_tag LOCUS_03770 gene gldB 6795 5833 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_03770 6877 7683 gene locus_tag LOCUS_03780 gene nadE 6877 7683 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 protein_id gnl|my_center|LOCUS_03780 7761 8390 gene locus_tag LOCUS_03790 7761 8390 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964170.1 protein_id gnl|my_center|LOCUS_03790 <9236 8387 gene locus_tag LOCUS_03800 <9236 8387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1B0:DNA primase >Feature sequence038 196 3003 gene locus_tag LOCUS_03810 196 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_03810 3309 6464 gene locus_tag LOCUS_03820 3309 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 6483 7907 gene locus_tag LOCUS_03830 6483 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 7942 8748 gene locus_tag LOCUS_03840 7942 8748 CDS product glycosyl hydrolase family 16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_03840 >Feature sequence039 1878 1123 gene locus_tag LOCUS_03850 1878 1123 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_03850 2321 1953 gene locus_tag LOCUS_03860 2321 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963760.1 protein_id gnl|my_center|LOCUS_03860 3706 2348 gene locus_tag LOCUS_03870 3706 2348 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_03870 4340 3717 gene locus_tag LOCUS_03880 4340 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963764.1 protein_id gnl|my_center|LOCUS_03880 4543 5457 gene locus_tag LOCUS_03890 gene glsA 4543 5457 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WD71 protein_id gnl|my_center|LOCUS_03890 5539 6090 gene locus_tag LOCUS_03900 5539 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_03900 6190 7248 gene locus_tag LOCUS_03910 6190 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_03910 7388 8047 gene locus_tag LOCUS_03920 7388 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence040 356 2923 gene locus_tag LOCUS_03930 356 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2955 3407 gene locus_tag LOCUS_03940 2955 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 3408 4175 gene locus_tag LOCUS_03950 3408 4175 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203148.1 protein_id gnl|my_center|LOCUS_03950 5773 4172 gene locus_tag LOCUS_03960 5773 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_03960 6482 5841 gene locus_tag LOCUS_03970 6482 5841 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_03970 6586 7362 gene locus_tag LOCUS_03980 6586 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 >Feature sequence041 161 604 gene locus_tag LOCUS_03990 gene rplI 161 604 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P1 protein_id gnl|my_center|LOCUS_03990 666 1139 gene locus_tag LOCUS_04000 666 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 protein_id gnl|my_center|LOCUS_04000 1141 3132 gene locus_tag LOCUS_04010 gene ligA 1141 3132 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 protein_id gnl|my_center|LOCUS_04010 3125 3823 gene locus_tag LOCUS_04020 3125 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 4759 3845 gene locus_tag LOCUS_04030 4759 3845 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_04030 5559 4771 gene locus_tag LOCUS_04040 5559 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 protein_id gnl|my_center|LOCUS_04040 5605 6123 gene locus_tag LOCUS_04050 5605 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963940.1 protein_id gnl|my_center|LOCUS_04050 6125 7003 gene locus_tag LOCUS_04060 gene dapA 6125 7003 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_04060 7101 7895 gene locus_tag LOCUS_04070 gene bamD 7101 7895 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_04070 7905 8219 gene locus_tag LOCUS_04080 7905 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence042 351 1799 gene locus_tag LOCUS_04090 gene miaB 351 1799 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_04090 1877 3136 gene locus_tag LOCUS_04100 1877 3136 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_04100 3136 3639 gene locus_tag LOCUS_04110 3136 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_04110 3689 4495 gene locus_tag LOCUS_04120 3689 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_04120 4498 4845 gene locus_tag LOCUS_04130 gene secG 4498 4845 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964085.1 protein_id gnl|my_center|LOCUS_04130 4982 5257 gene locus_tag LOCUS_04140 gene groS 4982 5257 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_04140 5317 6942 gene locus_tag LOCUS_04150 gene groL 5317 6942 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_04150 7799 7032 gene locus_tag LOCUS_04160 7799 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 <8808 7858 gene locus_tag LOCUS_04170 <8808 7858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122718.1:sulfate transporter >Feature sequence043 <1 1365 gene locus_tag LOCUS_04180 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZM6:signal recognition particle protein 1496 2377 gene locus_tag LOCUS_04190 gene folD 1496 2377 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 protein_id gnl|my_center|LOCUS_04190 2467 2880 gene locus_tag LOCUS_04200 2467 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 4531 2936 gene locus_tag LOCUS_04210 gene prfC 4531 2936 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT6 protein_id gnl|my_center|LOCUS_04210 4692 6620 gene locus_tag LOCUS_04220 4692 6620 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_04220 6621 7472 gene locus_tag LOCUS_04230 6621 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 >Feature sequence044 413 1345 gene locus_tag LOCUS_04240 413 1345 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_04240 1357 3285 gene locus_tag LOCUS_04250 1357 3285 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_04250 3307 4509 gene locus_tag LOCUS_04260 3307 4509 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268185.1 protein_id gnl|my_center|LOCUS_04260 4574 5329 gene locus_tag LOCUS_04270 4574 5329 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_04270 5346 5738 gene locus_tag LOCUS_04280 5346 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 5811 6362 gene locus_tag LOCUS_04290 5811 6362 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ08 protein_id gnl|my_center|LOCUS_04290 6364 7518 gene locus_tag LOCUS_04300 6364 7518 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963379.1 protein_id gnl|my_center|LOCUS_04300 7584 8678 gene locus_tag LOCUS_04310 7584 8678 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963378.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence045 388 2580 gene locus_tag LOCUS_04320 388 2580 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_04320 2625 2969 gene locus_tag LOCUS_04330 2625 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 3077 3457 gene locus_tag LOCUS_04340 3077 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 3532 6027 gene locus_tag LOCUS_04350 3532 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 6031 7899 gene locus_tag LOCUS_04360 6031 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence046 871 2064 gene locus_tag LOCUS_04370 gene sucC 871 2064 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_04370 2187 3044 gene locus_tag LOCUS_04380 gene nadC 2187 3044 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_04380 3048 3971 gene locus_tag LOCUS_04390 gene yfkH 3048 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_04390 3993 4556 gene locus_tag LOCUS_04400 3993 4556 CDS product chalcone isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_04400 4657 7107 gene locus_tag LOCUS_04410 gene priA 4657 7107 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 protein_id gnl|my_center|LOCUS_04410 7804 7109 gene locus_tag LOCUS_04420 7804 7109 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_04420 7955 8296 gene locus_tag LOCUS_04430 gene rpsF 7955 8296 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 protein_id gnl|my_center|LOCUS_04430 8299 8595 gene locus_tag LOCUS_04440 gene rpsR 8299 8595 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_04440 >Feature sequence047 5 1561 gene locus_tag LOCUS_04450 5 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 1682 4456 gene locus_tag LOCUS_04460 gene fpp2 1682 4456 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962408.1 protein_id gnl|my_center|LOCUS_04460 4567 7266 gene locus_tag LOCUS_04470 gene fpp1 4567 7266 CDS product metalloprotease Fpp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962407.1 protein_id gnl|my_center|LOCUS_04470 7936 7316 gene locus_tag LOCUS_04480 gene pth 7936 7316 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_04480 <8597 8028 gene locus_tag LOCUS_04490 <8597 8028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVZ1:50S ribosomal protein L25 >Feature sequence048 1088 63 gene locus_tag LOCUS_04500 1088 63 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_04500 1715 1224 gene locus_tag LOCUS_04510 1715 1224 CDS product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_04510 3624 1861 gene locus_tag LOCUS_04520 3624 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 4517 3753 gene locus_tag LOCUS_04530 gene trpA 4517 3753 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_04530 5858 4671 gene locus_tag LOCUS_04540 gene trpB 5858 4671 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_04540 6483 5842 gene locus_tag LOCUS_04550 gene trpF 6483 5842 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_04550 7265 6480 gene locus_tag LOCUS_04560 gene trpC 7265 6480 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_04560 8333 7341 gene locus_tag LOCUS_04570 gene trpD 8333 7341 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_04570 >Feature sequence049 <1 770 gene locus_tag LOCUS_04580 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1B8:putative dual-specificity RNA methyltransferase RlmN 869 1849 gene locus_tag LOCUS_04590 869 1849 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_04590 2086 1919 gene locus_tag LOCUS_04600 2086 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 4499 2115 gene locus_tag LOCUS_04610 4499 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5017 5781 gene locus_tag LOCUS_04620 5017 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 5936 6505 gene locus_tag LOCUS_04630 5936 6505 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_04630 6492 7172 gene locus_tag LOCUS_04640 6492 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964175.1 protein_id gnl|my_center|LOCUS_04640 7216 8286 gene locus_tag LOCUS_04650 7216 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964174.1 protein_id gnl|my_center|LOCUS_04650 >Feature sequence050 730 1692 gene locus_tag LOCUS_04660 730 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 2604 1696 gene locus_tag LOCUS_04670 2604 1696 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202149.1 protein_id gnl|my_center|LOCUS_04670 3402 2605 gene locus_tag LOCUS_04680 3402 2605 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657976.1 protein_id gnl|my_center|LOCUS_04680 3417 4313 gene locus_tag LOCUS_04690 3417 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 4317 5084 gene locus_tag LOCUS_04700 4317 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963748.1 protein_id gnl|my_center|LOCUS_04700 5109 5930 gene locus_tag LOCUS_04710 5109 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 6981 5920 gene locus_tag LOCUS_04720 6981 5920 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016813.1 protein_id gnl|my_center|LOCUS_04720 7079 7840 gene locus_tag LOCUS_04730 7079 7840 CDS product beta 1,4 glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016465.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence051 161 21 gene locus_tag LOCUS_04740 161 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 305 775 gene locus_tag LOCUS_04750 305 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 1374 814 gene locus_tag LOCUS_04760 1374 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1498 3684 gene locus_tag LOCUS_04770 gene glnA 1498 3684 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_04770 3757 4539 gene locus_tag LOCUS_04780 3757 4539 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962202.1 protein_id gnl|my_center|LOCUS_04780 4667 5554 gene locus_tag LOCUS_04790 4667 5554 CDS product OmpA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962844.1 protein_id gnl|my_center|LOCUS_04790 5597 6331 gene locus_tag LOCUS_04800 5597 6331 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962709.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04800 6477 7328 gene locus_tag LOCUS_04810 6477 7328 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962709.1 protein_id gnl|my_center|LOCUS_04810 >Feature sequence052 138 1334 gene locus_tag LOCUS_04820 gene kbl 138 1334 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_04820 1437 2840 gene locus_tag LOCUS_04830 1437 2840 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_04830 2904 5681 gene locus_tag LOCUS_04840 2904 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_04840 6584 5802 gene locus_tag LOCUS_04850 6584 5802 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_04850 6727 7119 gene locus_tag LOCUS_04860 6727 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 <7933 7265 gene locus_tag LOCUS_04870 <7933 7265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962330.1:Xaa-Pro aminopeptidase >Feature sequence053 <1 686 gene locus_tag LOCUS_04880 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263346.1:RNA pseudouridine synthase 1053 688 gene locus_tag LOCUS_04890 1053 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 4607 1065 gene locus_tag LOCUS_04900 4607 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 4865 6499 gene locus_tag LOCUS_04910 4865 6499 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_04910 7567 6515 gene locus_tag LOCUS_04920 gene menE 7567 6515 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence054 5449 3137 gene locus_tag LOCUS_04930 5449 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 6088 5492 gene locus_tag LOCUS_04940 6088 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 6322 7278 gene locus_tag LOCUS_04950 gene ltd 6322 7278 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_04950 7803 7282 gene locus_tag LOCUS_04960 7803 7282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence055 510 1934 gene locus_tag LOCUS_04970 510 1934 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_04970 1965 2696 gene locus_tag LOCUS_04980 gene kdsB 1965 2696 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_04980 3397 2693 gene locus_tag LOCUS_04990 3397 2693 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963127.1 protein_id gnl|my_center|LOCUS_04990 4058 3552 gene locus_tag LOCUS_05000 4058 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05000 4114 4674 gene locus_tag LOCUS_05010 4114 4674 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_05010 5206 4745 gene locus_tag LOCUS_05020 5206 4745 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_05020 5508 6662 gene locus_tag LOCUS_05030 5508 6662 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_05030 6719 7198 gene locus_tag LOCUS_05040 6719 7198 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 protein_id gnl|my_center|LOCUS_05040 7243 7755 gene locus_tag LOCUS_05050 7243 7755 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence056 <1 622 gene locus_tag LOCUS_05060 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122354.1:hydrolase 650 1594 gene locus_tag LOCUS_05070 650 1594 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZL8 protein_id gnl|my_center|LOCUS_05070 1865 6784 gene locus_tag LOCUS_05080 1865 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 7223 6864 gene locus_tag LOCUS_05090 7223 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 <7861 7318 gene locus_tag LOCUS_05100 <7861 7318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H160:histidine--tRNA ligase >Feature sequence057 1872 1090 gene locus_tag LOCUS_05110 1872 1090 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_05110 2504 1872 gene locus_tag LOCUS_05120 2504 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3810 2560 gene locus_tag LOCUS_05130 3810 2560 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_05130 3963 4508 gene locus_tag LOCUS_05140 3963 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963203.1 protein_id gnl|my_center|LOCUS_05140 4515 4736 gene locus_tag LOCUS_05150 4515 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 6130 4739 gene locus_tag LOCUS_05160 gene mnmE 6130 4739 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_05160 7763 6642 gene locus_tag LOCUS_05170 gene dnaN 7763 6642 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_05170 >Feature sequence058 295 810 gene locus_tag LOCUS_05180 295 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 810 1268 gene locus_tag LOCUS_05190 810 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 1340 2005 gene locus_tag LOCUS_05200 1340 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_05200 2141 2335 gene locus_tag LOCUS_05210 2141 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963849.1 protein_id gnl|my_center|LOCUS_05210 3324 2386 gene locus_tag LOCUS_05220 gene oxyR 3324 2386 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_05220 3423 3902 gene locus_tag LOCUS_05230 3423 3902 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_05230 3999 4289 gene locus_tag LOCUS_05240 3999 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 4357 5940 gene locus_tag LOCUS_05250 gene sulP 4357 5940 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_05250 5957 6592 gene locus_tag LOCUS_05260 gene cynT 5957 6592 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_05260 7174 6602 gene locus_tag LOCUS_05270 7174 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_05270 <7809 7277 gene locus_tag LOCUS_05280 <7809 7277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962792.1:TIGR02757 family protein >Feature sequence059 1408 2700 gene locus_tag LOCUS_05290 gene metY 1408 2700 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962432.1 protein_id gnl|my_center|LOCUS_05290 2765 3730 gene locus_tag LOCUS_05300 gene metX 2765 3730 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW98 protein_id gnl|my_center|LOCUS_05300 3739 6153 gene locus_tag LOCUS_05310 gene thrA 3739 6153 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933685.1 protein_id gnl|my_center|LOCUS_05310 6270 7442 gene locus_tag LOCUS_05320 gene metZ 6270 7442 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI7 protein_id gnl|my_center|LOCUS_05320 >Feature sequence060 10 162 gene locus_tag LOCUS_05330 10 162 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_05330 388 1368 gene locus_tag LOCUS_05340 gene ftsY 388 1368 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 protein_id gnl|my_center|LOCUS_05340 1381 1560 gene locus_tag LOCUS_05350 1381 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 2640 1582 gene locus_tag LOCUS_05360 2640 1582 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_05360 2745 3161 gene locus_tag LOCUS_05370 2745 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963536.1 protein_id gnl|my_center|LOCUS_05370 3164 3460 gene locus_tag LOCUS_05380 3164 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_05380 3963 3544 gene locus_tag LOCUS_05390 gene ndk 3963 3544 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_05390 4850 4023 gene locus_tag LOCUS_05400 4850 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_05400 6597 5002 gene locus_tag LOCUS_05410 gene bshC 6597 5002 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence061 <1 2135 gene locus_tag LOCUS_05420 <1 2135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWM2:Asp/Glu-specific dipeptidyl-peptidase 2301 2501 gene locus_tag LOCUS_05430 2301 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 2611 2826 gene locus_tag LOCUS_05440 2611 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 3240 2881 gene locus_tag LOCUS_05450 3240 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962555.1 protein_id gnl|my_center|LOCUS_05450 3543 5111 gene locus_tag LOCUS_05460 3543 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 5212 5886 gene locus_tag LOCUS_05470 5212 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 6344 6078 gene locus_tag LOCUS_05480 6344 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 6555 6806 gene locus_tag LOCUS_05490 6555 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05490 6830 7096 gene locus_tag LOCUS_05500 6830 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 7089 7361 gene locus_tag LOCUS_05510 7089 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 >Feature sequence062 <1 525 gene locus_tag LOCUS_05520 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021291.1:ATPase 658 1083 gene locus_tag LOCUS_05530 658 1083 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889463.1 protein_id gnl|my_center|LOCUS_05530 1085 1501 gene locus_tag LOCUS_05540 1085 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2516 1524 gene locus_tag LOCUS_05550 2516 1524 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963382.1 protein_id gnl|my_center|LOCUS_05550 4059 2506 gene locus_tag LOCUS_05560 4059 2506 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963383.1 protein_id gnl|my_center|LOCUS_05560 5205 4060 gene locus_tag LOCUS_05570 5205 4060 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963384.1 protein_id gnl|my_center|LOCUS_05570 6089 5202 gene locus_tag LOCUS_05580 6089 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 <7330 6089 gene locus_tag LOCUS_05590 <7330 6089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963532.1:O-acyltransferase >Feature sequence063 <1 1759 gene locus_tag LOCUS_05600 <1 1759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919618.1:TonB-dependent receptor 1874 2389 gene locus_tag LOCUS_05610 1874 2389 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_05610 2370 2813 gene locus_tag LOCUS_05620 2370 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963572.1 protein_id gnl|my_center|LOCUS_05620 2822 3349 gene locus_tag LOCUS_05630 2822 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963571.1 protein_id gnl|my_center|LOCUS_05630 3353 3886 gene locus_tag LOCUS_05640 3353 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963570.1 protein_id gnl|my_center|LOCUS_05640 4358 3915 gene locus_tag LOCUS_05650 gene crtZ 4358 3915 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_05650 5289 4450 gene locus_tag LOCUS_05660 gene crtB 5289 4450 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_05660 6752 5292 gene locus_tag LOCUS_05670 gene crtI 6752 5292 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_05670 <7317 6808 gene locus_tag LOCUS_05680 <7317 6808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963566.1:MerR family transcriptional regulator >Feature sequence064 2081 3496 gene locus_tag LOCUS_05690 gene sdaA 2081 3496 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_05690 3496 3870 gene locus_tag LOCUS_05700 gene yjgA 3496 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093444.1 protein_id gnl|my_center|LOCUS_05700 4278 3844 gene locus_tag LOCUS_05710 4278 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 5576 4290 gene locus_tag LOCUS_05720 5576 4290 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_05720 5713 6531 gene locus_tag LOCUS_05730 gene panB 5713 6531 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_05730 6553 7248 gene locus_tag LOCUS_05740 6553 7248 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_05740 >Feature sequence065 384 118 gene locus_tag LOCUS_05750 384 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05750 488 919 gene locus_tag LOCUS_05760 488 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 1021 1662 gene locus_tag LOCUS_05770 1021 1662 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ63 protein_id gnl|my_center|LOCUS_05770 2705 1770 gene locus_tag LOCUS_05780 2705 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_05780 3697 2783 gene locus_tag LOCUS_05790 3697 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_05790 5228 3945 gene locus_tag LOCUS_05800 gene gltA 5228 3945 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_05800 6728 5433 gene locus_tag LOCUS_05810 gene eno 6728 5433 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_05810 >Feature sequence066 1852 3114 gene locus_tag LOCUS_05820 gene gltP 1852 3114 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_05820 3117 3800 gene locus_tag LOCUS_05830 3117 3800 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964128.1 protein_id gnl|my_center|LOCUS_05830 5264 3810 gene locus_tag LOCUS_05840 5264 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 5355 6467 gene locus_tag LOCUS_05850 5355 6467 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_05850 6469 7209 gene locus_tag LOCUS_05860 gene mtgA 6469 7209 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H228 protein_id gnl|my_center|LOCUS_05860 >Feature sequence067 558 1385 gene locus_tag LOCUS_05870 gene pheA 558 1385 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_05870 1428 2513 gene locus_tag LOCUS_05880 1428 2513 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_05880 2601 3122 gene locus_tag LOCUS_05890 2601 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3267 4244 gene locus_tag LOCUS_05900 gene rsgA 3267 4244 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 protein_id gnl|my_center|LOCUS_05900 4308 4760 gene locus_tag LOCUS_05910 gene dtd 4308 4760 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 protein_id gnl|my_center|LOCUS_05910 4949 5275 gene locus_tag LOCUS_05920 4949 5275 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_05920 5288 5701 gene locus_tag LOCUS_05930 5288 5701 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_05930 5791 6969 gene locus_tag LOCUS_05940 gene aroA 5791 6969 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW83 protein_id gnl|my_center|LOCUS_05940 >Feature sequence068 89 1231 gene locus_tag LOCUS_05950 gene mrp 89 1231 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 protein_id gnl|my_center|LOCUS_05950 1233 1472 gene locus_tag LOCUS_05960 1233 1472 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_05960 1591 2643 gene locus_tag LOCUS_05970 1591 2643 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_05970 2645 2977 gene locus_tag LOCUS_05980 2645 2977 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_05980 3791 3009 gene locus_tag LOCUS_05990 3791 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_05990 5092 3914 gene locus_tag LOCUS_06000 gene gcdH 5092 3914 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_06000 5926 5267 gene locus_tag LOCUS_06010 5926 5267 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI6 protein_id gnl|my_center|LOCUS_06010 6562 6035 gene locus_tag LOCUS_06020 gene rimM 6562 6035 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_06020 <7218 6578 gene locus_tag LOCUS_06030 <7218 6578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWI4:30S ribosomal protein S16 >Feature sequence069 1559 579 gene locus_tag LOCUS_06040 1559 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_06040 1747 3489 gene locus_tag LOCUS_06050 1747 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 3588 6617 gene locus_tag LOCUS_06060 3588 6617 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence070 <1 1809 gene locus_tag LOCUS_06070 <1 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962568.1:signal peptide peptidase SppA 1883 4555 gene locus_tag LOCUS_06080 1883 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962569.1 protein_id gnl|my_center|LOCUS_06080 5400 4609 gene locus_tag LOCUS_06090 5400 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_06090 5562 7013 gene locus_tag LOCUS_06100 5562 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence071 1422 523 gene locus_tag LOCUS_06110 1422 523 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 protein_id gnl|my_center|LOCUS_06110 1749 2747 gene locus_tag LOCUS_06120 1749 2747 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_06120 2808 3323 gene locus_tag LOCUS_06130 2808 3323 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_06130 4104 3325 gene locus_tag LOCUS_06140 gene murI 4104 3325 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D7 protein_id gnl|my_center|LOCUS_06140 4683 4180 gene locus_tag LOCUS_06150 4683 4180 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964197.1 protein_id gnl|my_center|LOCUS_06150 5715 4708 gene locus_tag LOCUS_06160 gene skp 5715 4708 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964196.1 protein_id gnl|my_center|LOCUS_06160 <7109 5817 gene locus_tag LOCUS_06170 <7109 5817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964195.1:outer membrane protein assembly factor BamA >Feature sequence072 1182 424 gene locus_tag LOCUS_06180 1182 424 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_06180 1856 1191 gene locus_tag LOCUS_06190 1856 1191 CDS product DUF4271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962358.1 protein_id gnl|my_center|LOCUS_06190 1963 2685 gene locus_tag LOCUS_06200 1963 2685 CDS product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962342.1 protein_id gnl|my_center|LOCUS_06200 2685 4037 gene locus_tag LOCUS_06210 gene pyrC1 2685 4037 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_06210 4037 4426 gene locus_tag LOCUS_06220 4037 4426 CDS product lipoprotein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962340.1 protein_id gnl|my_center|LOCUS_06220 5399 4398 gene locus_tag LOCUS_06230 5399 4398 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_06230 5502 6809 gene locus_tag LOCUS_06240 gene tyrS 5502 6809 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 protein_id gnl|my_center|LOCUS_06240 >Feature sequence073 1600 89 gene locus_tag LOCUS_06250 1600 89 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_06250 1741 2358 gene locus_tag LOCUS_06260 gene recR 1741 2358 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_06260 2490 3284 gene locus_tag LOCUS_06270 gene wza 2490 3284 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 protein_id gnl|my_center|LOCUS_06270 3292 5754 gene locus_tag LOCUS_06280 gene wzc 3292 5754 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_06280 >Feature sequence074 87 230 gene locus_tag LOCUS_06290 87 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 912 262 gene locus_tag LOCUS_06300 gene nth 912 262 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_06300 1031 1483 gene locus_tag LOCUS_06310 1031 1483 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_06310 2380 1535 gene locus_tag LOCUS_06320 2380 1535 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962664.1 protein_id gnl|my_center|LOCUS_06320 3215 2397 gene locus_tag LOCUS_06330 gene kdsA 3215 2397 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY4 protein_id gnl|my_center|LOCUS_06330 3770 3309 gene locus_tag LOCUS_06340 3770 3309 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963795.1 protein_id gnl|my_center|LOCUS_06340 4254 3772 gene locus_tag LOCUS_06350 4254 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 4355 4921 gene locus_tag LOCUS_06360 4355 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_06360 4926 5339 gene locus_tag LOCUS_06370 4926 5339 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_06370 5419 5685 gene locus_tag LOCUS_06380 5419 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 5852 6610 gene locus_tag LOCUS_06390 5852 6610 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ8 protein_id gnl|my_center|LOCUS_06390 6614 6844 gene locus_tag LOCUS_06400 6614 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence075 1432 404 gene locus_tag LOCUS_06410 1432 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962217.1 protein_id gnl|my_center|LOCUS_06410 2365 1445 gene locus_tag LOCUS_06420 gene hemF 2365 1445 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_06420 2848 2423 gene locus_tag LOCUS_06430 2848 2423 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965763.1 protein_id gnl|my_center|LOCUS_06430 3952 2927 gene locus_tag LOCUS_06440 gene hemE 3952 2927 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 protein_id gnl|my_center|LOCUS_06440 4670 4002 gene locus_tag LOCUS_06450 gene hemD 4670 4002 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962223.1 protein_id gnl|my_center|LOCUS_06450 5380 4673 gene locus_tag LOCUS_06460 5380 4673 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760381.1 protein_id gnl|my_center|LOCUS_06460 <6844 5391 gene locus_tag LOCUS_06470 <6844 5391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109365.1:potassium transporter >Feature sequence076 357 1460 gene locus_tag LOCUS_06480 357 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 1645 2430 gene locus_tag LOCUS_06490 1645 2430 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_06490 2420 3175 gene locus_tag LOCUS_06500 2420 3175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_06500 3182 4156 gene locus_tag LOCUS_06510 3182 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 4588 4181 gene locus_tag LOCUS_06520 4588 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 5705 5022 gene locus_tag LOCUS_06530 gene cmk 5705 5022 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 protein_id gnl|my_center|LOCUS_06530 6051 5731 gene locus_tag LOCUS_06540 6051 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 <6813 6130 gene locus_tag LOCUS_06550 <6813 6130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963823.1:penicillin-binding protein >Feature sequence077 1606 1136 gene locus_tag LOCUS_06560 1606 1136 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_06560 1721 2728 gene locus_tag LOCUS_06570 gene fbp 1721 2728 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWD9 protein_id gnl|my_center|LOCUS_06570 3235 2804 gene locus_tag LOCUS_06580 3235 2804 CDS product fructose 1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962635.1 protein_id gnl|my_center|LOCUS_06580 3377 3970 gene locus_tag LOCUS_06590 3377 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_06590 3970 4398 gene locus_tag LOCUS_06600 3970 4398 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_06600 4409 5971 gene locus_tag LOCUS_06610 4409 5971 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_06610 5984 6499 gene locus_tag LOCUS_06620 5984 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence078 626 366 gene locus_tag LOCUS_06630 gene rpmA 626 366 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P8 protein_id gnl|my_center|LOCUS_06630 1073 645 gene locus_tag LOCUS_06640 1073 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 1261 2586 gene locus_tag LOCUS_06650 1261 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 2599 4650 gene locus_tag LOCUS_06660 2599 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 5565 4696 gene locus_tag LOCUS_06670 gene fjo11 5565 4696 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_06670 5676 6044 gene locus_tag LOCUS_06680 5676 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 6689 6132 gene locus_tag LOCUS_06690 gene gldD 6689 6132 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence079 326 1324 gene locus_tag LOCUS_06700 326 1324 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_06700 1328 1915 gene locus_tag LOCUS_06710 gene coaE 1328 1915 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_06710 2023 3570 gene locus_tag LOCUS_06720 gene rprX 2023 3570 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_06720 3591 4289 gene locus_tag LOCUS_06730 gene rprY 3591 4289 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_06730 4371 5174 gene locus_tag LOCUS_06740 4371 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 5916 5161 gene locus_tag LOCUS_06750 5916 5161 CDS product acyl-ACP thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048437.1 protein_id gnl|my_center|LOCUS_06750 <6653 5919 gene locus_tag LOCUS_06760 <6653 5919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0V8:tRNA dimethylallyltransferase >Feature sequence080 274 1227 gene locus_tag LOCUS_06770 274 1227 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_06770 1373 1756 gene locus_tag LOCUS_06780 1373 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_06780 1704 2144 gene locus_tag LOCUS_06790 1704 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2177 3094 gene locus_tag LOCUS_06800 gene udp 2177 3094 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_06800 3110 3490 gene locus_tag LOCUS_06810 3110 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263497.1 protein_id gnl|my_center|LOCUS_06810 3487 4020 gene locus_tag LOCUS_06820 3487 4020 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963178.1 protein_id gnl|my_center|LOCUS_06820 4042 4539 gene locus_tag LOCUS_06830 4042 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963179.1 protein_id gnl|my_center|LOCUS_06830 4577 5422 gene locus_tag LOCUS_06840 4577 5422 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_06840 5450 6379 gene locus_tag LOCUS_06850 5450 6379 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963182.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence081 230 1048 gene locus_tag LOCUS_06860 gene rnz 230 1048 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_06860 1157 1813 gene locus_tag LOCUS_06870 1157 1813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962785.1 protein_id gnl|my_center|LOCUS_06870 3270 1810 gene locus_tag LOCUS_06880 gene phrB2 3270 1810 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964141.1 protein_id gnl|my_center|LOCUS_06880 4607 3321 gene locus_tag LOCUS_06890 gene phrB1 4607 3321 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_06890 5388 4690 gene locus_tag LOCUS_06900 5388 4690 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_06900 5899 5435 gene locus_tag LOCUS_06910 5899 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence082 <1 594 gene locus_tag LOCUS_06920 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWA9:S-adenosylmethionine synthase 679 1761 gene locus_tag LOCUS_06930 679 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 4554 1810 gene locus_tag LOCUS_06940 4554 1810 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_06940 5475 4567 gene locus_tag LOCUS_06950 5475 4567 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence083 794 48 gene locus_tag LOCUS_06960 794 48 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_06960 1796 882 gene locus_tag LOCUS_06970 1796 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 2655 1804 gene locus_tag LOCUS_06980 2655 1804 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963505.1 protein_id gnl|my_center|LOCUS_06980 3204 2671 gene locus_tag LOCUS_06990 3204 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 4330 3272 gene locus_tag LOCUS_07000 gene fabH1 4330 3272 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_07000 4836 4465 gene locus_tag LOCUS_07010 4836 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963501.1 protein_id gnl|my_center|LOCUS_07010 <6356 4941 gene locus_tag LOCUS_07020 <6356 4941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZD2:glycine dehydrogenase (aminomethyl-transferring) >Feature sequence084 6169 674 gene locus_tag LOCUS_07030 6169 674 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964323.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence085 246 980 gene locus_tag LOCUS_07040 246 980 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_07040 1627 983 gene locus_tag LOCUS_07050 1627 983 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963343.1 protein_id gnl|my_center|LOCUS_07050 2672 1725 gene locus_tag LOCUS_07060 2672 1725 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_07060 3791 2751 gene locus_tag LOCUS_07070 gene pabC 3791 2751 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_07070 4333 3803 gene locus_tag LOCUS_07080 4333 3803 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_07080 5269 4487 gene locus_tag LOCUS_07090 gene dapF 5269 4487 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_07090 >Feature sequence086 4114 2012 gene locus_tag LOCUS_07100 gene feoB 4114 2012 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_07100 4347 4117 gene locus_tag LOCUS_07110 gene feoA 4347 4117 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_07110 5137 4439 gene locus_tag LOCUS_07120 5137 4439 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence087 <1 2778 gene locus_tag LOCUS_07130 <1 2778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXX6:UvrABC system protein A 2868 3593 gene locus_tag LOCUS_07140 2868 3593 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_07140 4490 3627 gene locus_tag LOCUS_07150 4490 3627 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963827.1 protein_id gnl|my_center|LOCUS_07150 4639 5457 gene locus_tag LOCUS_07160 4639 5457 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence088 2976 1705 gene locus_tag LOCUS_07170 gene purA 2976 1705 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_07170 3483 3046 gene locus_tag LOCUS_07180 gene fur 3483 3046 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_07180 5798 3579 gene locus_tag LOCUS_07190 gene relA 5798 3579 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence089 972 733 gene locus_tag LOCUS_07200 972 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 1956 1642 gene locus_tag LOCUS_07210 1956 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223286.1 protein_id gnl|my_center|LOCUS_07210 2568 2074 gene locus_tag LOCUS_07220 2568 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2913 2707 gene locus_tag LOCUS_07230 2913 2707 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791339.1 protein_id gnl|my_center|LOCUS_07230 3453 2917 gene locus_tag LOCUS_07240 3453 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4292 3627 gene locus_tag LOCUS_07250 4292 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764517.1 protein_id gnl|my_center|LOCUS_07250 4922 4446 gene locus_tag LOCUS_07260 4922 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 5284 5856 gene locus_tag LOCUS_07270 5284 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence090 1065 1844 gene locus_tag LOCUS_07280 1065 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_07280 1847 2344 gene locus_tag LOCUS_07290 gene ribH 1847 2344 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_07290 2445 2744 gene locus_tag LOCUS_07300 2445 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 2757 3425 gene locus_tag LOCUS_07310 2757 3425 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 protein_id gnl|my_center|LOCUS_07310 3507 5360 gene locus_tag LOCUS_07320 gene mutL 3507 5360 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_07320 5357 6103 gene locus_tag LOCUS_07330 5357 6103 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence091 <1 2223 gene locus_tag LOCUS_07340 <1 2223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964489.1:copper transporter 2619 2275 gene locus_tag LOCUS_07350 2619 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962526.1 protein_id gnl|my_center|LOCUS_07350 3792 2785 gene locus_tag LOCUS_07360 3792 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962448.1 protein_id gnl|my_center|LOCUS_07360 3884 5629 gene locus_tag LOCUS_07370 gene aspS 3884 5629 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_07370 5676 5909 gene locus_tag LOCUS_07380 5676 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 5991 6191 gene locus_tag LOCUS_07390 5991 6191 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence092 1578 2894 gene locus_tag LOCUS_07400 gene mvaA 1578 2894 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_07400 2909 3823 gene locus_tag LOCUS_07410 2909 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_07410 3945 3872 gene locus_tag LOCUS_t00080 3945 3872 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4068 4802 gene locus_tag LOCUS_07420 gene coaX 4068 4802 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B4 protein_id gnl|my_center|LOCUS_07420 4789 6051 gene locus_tag LOCUS_07430 4789 6051 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence093 <1 731 gene locus_tag LOCUS_07440 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963360.1:mechanosensitive ion channel protein 1393 734 gene locus_tag LOCUS_07450 1393 734 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_07450 2806 1493 gene locus_tag LOCUS_07460 2806 1493 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_07460 4119 2827 gene locus_tag LOCUS_07470 4119 2827 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_07470 4262 5653 gene locus_tag LOCUS_07480 4262 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964213.1 protein_id gnl|my_center|LOCUS_07480 6047 5781 gene locus_tag LOCUS_07490 6047 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence094 1714 1025 gene locus_tag LOCUS_07500 gene phoP 1714 1025 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_07500 1893 4610 gene locus_tag LOCUS_07510 1893 4610 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_07510 4847 4650 gene locus_tag LOCUS_07520 4847 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4744 5856 gene locus_tag LOCUS_07530 4744 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764295.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence095 397 1299 gene locus_tag LOCUS_07540 gene fjo20 397 1299 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963631.1 protein_id gnl|my_center|LOCUS_07540 1380 2105 gene locus_tag LOCUS_07550 gene aqpZ 1380 2105 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLV8 protein_id gnl|my_center|LOCUS_07550 2156 2758 gene locus_tag LOCUS_07560 2156 2758 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_07560 2942 3265 gene locus_tag LOCUS_07570 2942 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 3401 5260 gene locus_tag LOCUS_07580 3401 5260 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence096 599 1498 gene locus_tag LOCUS_07590 599 1498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_07590 1506 2345 gene locus_tag LOCUS_07600 1506 2345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_07600 2362 4380 gene locus_tag LOCUS_07610 2362 4380 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963773.1 protein_id gnl|my_center|LOCUS_07610 4425 5435 gene locus_tag LOCUS_07620 gene fjo19 4425 5435 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_07620 5483 5995 gene locus_tag LOCUS_07630 gene gldI 5483 5995 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T4 protein_id gnl|my_center|LOCUS_07630 >Feature sequence097 2189 186 gene locus_tag LOCUS_07640 2189 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 2865 2200 gene locus_tag LOCUS_07650 gene lolA 2865 2200 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_07650 5362 2852 gene locus_tag LOCUS_07660 gene ftsK 5362 2852 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_07660 5770 5396 gene locus_tag LOCUS_07670 gene dgkA 5770 5396 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963705.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence098 1137 94 gene locus_tag LOCUS_07680 1137 94 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_07680 1386 1769 gene locus_tag LOCUS_07690 1386 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2266 1817 gene locus_tag LOCUS_07700 2266 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963057.1 protein_id gnl|my_center|LOCUS_07700 3031 2369 gene locus_tag LOCUS_07710 3031 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 3201 3602 gene locus_tag LOCUS_07720 3201 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963055.1 protein_id gnl|my_center|LOCUS_07720 4073 3603 gene locus_tag LOCUS_07730 4073 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 <6022 4283 gene locus_tag LOCUS_07740 <6022 4283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY25:UvrABC system protein B >Feature sequence099 201 1199 gene locus_tag LOCUS_07750 gene gapA1 201 1199 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963588.1 protein_id gnl|my_center|LOCUS_07750 1260 3452 gene locus_tag LOCUS_07760 1260 3452 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_07760 4254 3442 gene locus_tag LOCUS_07770 gene deoD 4254 3442 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM2 protein_id gnl|my_center|LOCUS_07770 5242 4226 gene locus_tag LOCUS_07780 gene lpxK 5242 4226 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_07780 5527 5246 gene locus_tag LOCUS_07790 5527 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 5757 5503 gene locus_tag LOCUS_07800 5757 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence100 <1 966 gene locus_tag LOCUS_07810 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWQ0:aminotransferase 1207 3075 gene locus_tag LOCUS_07820 1207 3075 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963172.1 protein_id gnl|my_center|LOCUS_07820 3736 3179 gene locus_tag LOCUS_07830 gene maa 3736 3179 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123673.1 protein_id gnl|my_center|LOCUS_07830 4976 3810 gene locus_tag LOCUS_07840 4976 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 5276 5530 gene locus_tag LOCUS_07850 5276 5530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence101 987 34 gene locus_tag LOCUS_07860 987 34 CDS product organic solvent ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_07860 2099 1023 gene locus_tag LOCUS_07870 2099 1023 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_07870 3173 2145 gene locus_tag LOCUS_07880 3173 2145 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence102 <1 639 gene locus_tag LOCUS_07890 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882752.1:cytochrome ubiquinol oxidase subunit I 650 1687 gene locus_tag LOCUS_07900 gene cydB 650 1687 CDS product cytochrome D oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_07900 1792 2409 gene locus_tag LOCUS_07910 1792 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870259.1 protein_id gnl|my_center|LOCUS_07910 2508 3968 gene locus_tag LOCUS_07920 2508 3968 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_07920 4316 5632 gene locus_tag LOCUS_07930 4316 5632 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963918.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence103 762 3209 gene locus_tag LOCUS_07940 762 3209 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_07940 3293 4213 gene locus_tag LOCUS_07950 gene thrB 3293 4213 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_07950 4311 5600 gene locus_tag LOCUS_07960 4311 5600 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence104 516 139 gene locus_tag LOCUS_07970 516 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1578 604 gene locus_tag LOCUS_07980 1578 604 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_07980 2999 1590 gene locus_tag LOCUS_07990 gene speA 2999 1590 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_07990 4357 3290 gene locus_tag LOCUS_08000 gene aroB 4357 3290 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_08000 4453 5619 gene locus_tag LOCUS_08010 gene putA 4453 5619 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence105 65 1951 gene locus_tag LOCUS_08020 gene yidC 65 1951 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U2 protein_id gnl|my_center|LOCUS_08020 2009 2809 gene locus_tag LOCUS_08030 gene proC 2009 2809 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFV0 protein_id gnl|my_center|LOCUS_08030 3822 2872 gene locus_tag LOCUS_08040 3822 2872 CDS product beta-Ig-H3/fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405131.1 protein_id gnl|my_center|LOCUS_08040 4006 4767 gene locus_tag LOCUS_08050 4006 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964005.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence106 <1 783 gene locus_tag LOCUS_08060 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964529.1:cytochrome c biosynthesis protein 784 1548 gene locus_tag LOCUS_08070 784 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 protein_id gnl|my_center|LOCUS_08070 1639 2832 gene locus_tag LOCUS_08080 1639 2832 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_08080 2903 3871 gene locus_tag LOCUS_08090 2903 3871 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_08090 3987 4328 gene locus_tag LOCUS_08100 3987 4328 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004298733.1 protein_id gnl|my_center|LOCUS_08100 4423 4836 gene locus_tag LOCUS_08110 4423 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 4833 5279 gene locus_tag LOCUS_08120 4833 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence107 575 1777 gene locus_tag LOCUS_08130 575 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1928 5575 gene locus_tag LOCUS_08140 1928 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 >Feature sequence108 700 524 gene locus_tag LOCUS_08150 700 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 729 1055 gene locus_tag LOCUS_08160 729 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964062.1 protein_id gnl|my_center|LOCUS_08160 2683 1052 gene locus_tag LOCUS_08170 2683 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence109 4707 169 gene locus_tag LOCUS_08180 gene dnaE 4707 169 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_08180 5584 4859 gene locus_tag LOCUS_08190 5584 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962514.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence110 2215 1022 gene locus_tag LOCUS_08200 gene fabV 2215 1022 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N4 protein_id gnl|my_center|LOCUS_08200 3930 2278 gene locus_tag LOCUS_08210 gene recN 3930 2278 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_08210 4847 3954 gene locus_tag LOCUS_08220 4847 3954 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_08220 <5762 4837 gene locus_tag LOCUS_08230 <5762 4837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963944.1:phosphopantothenoylcysteine decarboxylase >Feature sequence111 688 23 gene locus_tag LOCUS_08240 gene sfp 688 23 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_08240 818 2134 gene locus_tag LOCUS_08250 gene ahcY 818 2134 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_08250 2343 3443 gene locus_tag LOCUS_08260 2343 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_08260 4784 3582 gene locus_tag LOCUS_08270 4784 3582 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056143.1 protein_id gnl|my_center|LOCUS_08270 5510 4905 gene locus_tag LOCUS_08280 5510 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962381.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence112 <1 828 gene locus_tag LOCUS_08290 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962292.1:outer membrane protein 908 1252 gene locus_tag LOCUS_08300 908 1252 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964186.1 protein_id gnl|my_center|LOCUS_08300 1352 2677 gene locus_tag LOCUS_08310 gene tig 1352 2677 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_08310 2786 3442 gene locus_tag LOCUS_08320 gene clpP 2786 3442 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_08320 3524 4756 gene locus_tag LOCUS_08330 gene clpX 3524 4756 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_08330 5072 4806 gene locus_tag LOCUS_08340 5072 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 <5688 4981 gene locus_tag LOCUS_08350 <5688 4981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964499.1:cell envelope biogenesis protein OmpA >Feature sequence113 61 387 gene locus_tag LOCUS_08360 61 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 585 1274 gene locus_tag LOCUS_08370 585 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963247.1 protein_id gnl|my_center|LOCUS_08370 3021 1558 gene locus_tag LOCUS_08380 3021 1558 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868291.1 protein_id gnl|my_center|LOCUS_08380 4332 3040 gene locus_tag LOCUS_08390 4332 3040 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_08390 4807 4340 gene locus_tag LOCUS_08400 4807 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 4968 4804 gene locus_tag LOCUS_08410 4968 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 <5658 5044 gene locus_tag LOCUS_08420 <5658 5044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963906.1:membrane protein >Feature sequence114 401 958 gene locus_tag LOCUS_08430 401 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_08430 958 2427 gene locus_tag LOCUS_08440 958 2427 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_08440 2443 3219 gene locus_tag LOCUS_08450 gene crt 2443 3219 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_08450 3393 4736 gene locus_tag LOCUS_08460 gene gdhA 3393 4736 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_08460 5430 4786 gene locus_tag LOCUS_08470 5430 4786 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence115 209 1777 gene locus_tag LOCUS_08480 gene dagA 209 1777 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_08480 1792 2670 gene locus_tag LOCUS_08490 1792 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963324.1 protein_id gnl|my_center|LOCUS_08490 2706 3875 gene locus_tag LOCUS_08500 2706 3875 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_08500 3949 4143 gene locus_tag LOCUS_08510 gene rpsU 3949 4143 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_08510 4210 5100 gene locus_tag LOCUS_08520 gene xerC 4210 5100 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_08520 5135 5437 gene locus_tag LOCUS_08530 5135 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence116 286 846 gene locus_tag LOCUS_08540 286 846 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963990.1 protein_id gnl|my_center|LOCUS_08540 856 1998 gene locus_tag LOCUS_08550 856 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 2012 3556 gene locus_tag LOCUS_08560 2012 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3559 4410 gene locus_tag LOCUS_08570 3559 4410 CDS product LACX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562113.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence117 82 324 gene locus_tag LOCUS_08580 82 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 826 1311 gene locus_tag LOCUS_08590 826 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2521 1322 gene locus_tag LOCUS_08600 2521 1322 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_08600 2915 2523 gene locus_tag LOCUS_08610 gene rbfA 2915 2523 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 protein_id gnl|my_center|LOCUS_08610 3036 3437 gene locus_tag LOCUS_08620 3036 3437 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_08620 3496 3570 gene locus_tag LOCUS_t00090 3496 3570 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3770 3979 gene locus_tag LOCUS_08630 3770 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 4580 3990 gene locus_tag LOCUS_08640 gene ribE 4580 3990 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence118 977 399 gene locus_tag LOCUS_08650 977 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1433 996 gene locus_tag LOCUS_08660 1433 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2070 1579 gene locus_tag LOCUS_08670 2070 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_08670 3452 2118 gene locus_tag LOCUS_08680 3452 2118 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCB8 protein_id gnl|my_center|LOCUS_08680 4918 3635 gene locus_tag LOCUS_08690 4918 3635 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709100.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence119 1099 1245 gene locus_tag LOCUS_08700 1099 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1285 2295 gene locus_tag LOCUS_08710 gene obg 1285 2295 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB7 protein_id gnl|my_center|LOCUS_08710 2481 4628 gene locus_tag LOCUS_08720 2481 4628 CDS product peptidase S46 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963485.1 protein_id gnl|my_center|LOCUS_08720 <5457 4685 gene locus_tag LOCUS_08730 <5457 4685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122194.1:alpha-2-macroglobulin >Feature sequence120 <1 2115 gene locus_tag LOCUS_08740 <1 2115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW35:transcription-repair-coupling factor 2136 2462 gene locus_tag LOCUS_08750 2136 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2683 3237 gene locus_tag LOCUS_08760 2683 3237 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_08760 4672 3311 gene locus_tag LOCUS_08770 gene radA 4672 3311 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_08770 <5435 4679 gene locus_tag LOCUS_08780 <5435 4679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962284.1:histidine kinase >Feature sequence121 <1 936 gene locus_tag LOCUS_08790 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX82:prolipoprotein diacylglyceryl transferase 1533 1072 gene locus_tag LOCUS_08800 1533 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 4535 1614 gene locus_tag LOCUS_08810 gene secDF 4535 1614 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 protein_id gnl|my_center|LOCUS_08810 <5434 4837 gene locus_tag LOCUS_08820 <5434 4837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX11:malate dehydrogenase >Feature sequence122 <1 1633 gene locus_tag LOCUS_08830 <1 1633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963727.1:DUF490 domain-containing protein 1769 2755 gene locus_tag LOCUS_08840 gene pfkA 1769 2755 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_08840 2781 3788 gene locus_tag LOCUS_08850 gene gapA3 2781 3788 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H007 protein_id gnl|my_center|LOCUS_08850 3903 4754 gene locus_tag LOCUS_08860 3903 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_08860 4847 5218 gene locus_tag LOCUS_08870 gene mgsA 4847 5218 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51339 protein_id gnl|my_center|LOCUS_08870 >Feature sequence123 2171 1542 gene locus_tag LOCUS_08880 2171 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_08880 3321 2353 gene locus_tag LOCUS_08890 gene etfA 3321 2353 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_08890 4145 3399 gene locus_tag LOCUS_08900 gene etfB 4145 3399 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_08900 4417 5394 gene locus_tag LOCUS_08910 gene pdhB 4417 5394 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence124 467 234 gene locus_tag LOCUS_08920 467 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 2939 972 gene locus_tag LOCUS_08930 2939 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4887 2953 gene locus_tag LOCUS_08940 4887 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence125 <1 1878 gene locus_tag LOCUS_08950 <1 1878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963925.1:DEAD/DEAH box helicase 1965 2738 gene locus_tag LOCUS_08960 1965 2738 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 protein_id gnl|my_center|LOCUS_08960 2857 4062 gene locus_tag LOCUS_08970 2857 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 4721 4059 gene locus_tag LOCUS_08980 gene trmH 4721 4059 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_08980 >Feature sequence126 1161 355 gene locus_tag LOCUS_08990 1161 355 CDS product glycosyl hydrolase family 16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_08990 2620 1196 gene locus_tag LOCUS_09000 2620 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence127 2071 584 gene locus_tag LOCUS_09010 2071 584 CDS product selenocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_09010 2561 2100 gene locus_tag LOCUS_09020 2561 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963236.1 protein_id gnl|my_center|LOCUS_09020 3346 2579 gene locus_tag LOCUS_09030 gene phnP 3346 2579 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_09030 3454 4926 gene locus_tag LOCUS_09040 3454 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence128 1803 406 gene locus_tag LOCUS_09050 1803 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2479 1901 gene locus_tag LOCUS_09060 2479 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 3067 2483 gene locus_tag LOCUS_09070 3067 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 4048 3209 gene locus_tag LOCUS_09080 gene menB 4048 3209 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_09080 4482 4114 gene locus_tag LOCUS_09090 4482 4114 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964018.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence129 <1 1464 gene locus_tag LOCUS_09100 <1 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964220.1:cell surface protein SprA 1602 1982 gene locus_tag LOCUS_09110 gene gcvH 1602 1982 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_09110 1951 2343 gene locus_tag LOCUS_09120 1951 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2388 3122 gene locus_tag LOCUS_09130 2388 3122 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_09130 3214 3963 gene locus_tag LOCUS_09140 3214 3963 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A441 protein_id gnl|my_center|LOCUS_09140 4040 4783 gene locus_tag LOCUS_09150 gene deoC 4040 4783 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F6 protein_id gnl|my_center|LOCUS_09150 >Feature sequence130 <1 939 gene locus_tag LOCUS_09160 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963217.1:peptidase M42 1156 1623 gene locus_tag LOCUS_09170 1156 1623 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800553.1 protein_id gnl|my_center|LOCUS_09170 1613 2137 gene locus_tag LOCUS_09180 1613 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2157 3176 gene locus_tag LOCUS_09190 2157 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 3180 3899 gene locus_tag LOCUS_09200 3180 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 4233 5003 gene locus_tag LOCUS_09210 4233 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence131 103 474 gene locus_tag LOCUS_09220 103 474 CDS product preprotein translocase SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963077.1 protein_id gnl|my_center|LOCUS_09220 947 471 gene locus_tag LOCUS_09230 947 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4433 1008 gene locus_tag LOCUS_09240 gene icmF 4433 1008 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_09240 >Feature sequence132 556 1236 gene locus_tag LOCUS_09250 556 1236 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016415.1 protein_id gnl|my_center|LOCUS_09250 1331 3730 gene locus_tag LOCUS_09260 1331 3730 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_09260 4362 3772 gene locus_tag LOCUS_09270 4362 3772 CDS product fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121856.1 protein_id gnl|my_center|LOCUS_09270 4983 4369 gene locus_tag LOCUS_09280 4983 4369 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence133 217 468 gene locus_tag LOCUS_09290 gene rpsT 217 468 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_09290 613 2409 gene locus_tag LOCUS_09300 gene typA 613 2409 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_09300 2457 2888 gene locus_tag LOCUS_09310 2457 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362012.1 protein_id gnl|my_center|LOCUS_09310 3948 2938 gene locus_tag LOCUS_09320 gene ppiB 3948 2938 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963994.1 protein_id gnl|my_center|LOCUS_09320 5044 3956 gene locus_tag LOCUS_09330 gene ppiA 5044 3956 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963995.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence134 1463 927 gene locus_tag LOCUS_09340 1463 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_09340 1533 2945 gene locus_tag LOCUS_09350 gene trmA 1533 2945 CDS product tRNA (uracil-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_09350 2948 3481 gene locus_tag LOCUS_09360 2948 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 protein_id gnl|my_center|LOCUS_09360 3507 4169 gene locus_tag LOCUS_09370 3507 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_09370 4171 4737 gene locus_tag LOCUS_09380 4171 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence135 222 1322 gene locus_tag LOCUS_09390 222 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1462 1917 gene locus_tag LOCUS_09400 1462 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1956 3056 gene locus_tag LOCUS_09410 1956 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 3707 3081 gene locus_tag LOCUS_09420 3707 3081 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 protein_id gnl|my_center|LOCUS_09420 3791 4672 gene locus_tag LOCUS_09430 3791 4672 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence136 1745 342 gene locus_tag LOCUS_09440 1745 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963192.1 protein_id gnl|my_center|LOCUS_09440 1901 3520 gene locus_tag LOCUS_09450 1901 3520 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_09450 3615 4154 gene locus_tag LOCUS_09460 gene pyrR1 3615 4154 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence137 <1 982 gene locus_tag LOCUS_09470 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H289:dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex 1607 1170 gene locus_tag LOCUS_09480 1607 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1707 2477 gene locus_tag LOCUS_09490 1707 2477 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_09490 2539 3678 gene locus_tag LOCUS_09500 2539 3678 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_09500 3665 4696 gene locus_tag LOCUS_09510 gene ansA 3665 4696 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_09510 4772 4860 gene locus_tag LOCUS_t00100 4772 4860 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence138 320 757 gene locus_tag LOCUS_09520 320 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 809 1258 gene locus_tag LOCUS_09530 809 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_09530 1486 3102 gene locus_tag LOCUS_09540 1486 3102 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962690.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence139 <1 528 gene locus_tag LOCUS_09550 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UJK7:DNA polymerase IV 2 611 1126 gene locus_tag LOCUS_09560 611 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963609.1 protein_id gnl|my_center|LOCUS_09560 2741 1311 gene locus_tag LOCUS_09570 gene pykA 2741 1311 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_09570 3220 2747 gene locus_tag LOCUS_09580 3220 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962379.1 protein_id gnl|my_center|LOCUS_09580 4066 3323 gene locus_tag LOCUS_09590 gene rnc 4066 3323 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 protein_id gnl|my_center|LOCUS_09590 <4997 4071 gene locus_tag LOCUS_09600 <4997 4071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW44:3-oxoacyl-[acyl-carrier-protein] synthase 2 >Feature sequence140 437 1096 gene locus_tag LOCUS_09610 437 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_09610 1107 1991 gene locus_tag LOCUS_09620 gene nadK 1107 1991 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_09620 2111 2794 gene locus_tag LOCUS_09630 2111 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_09630 2798 3553 gene locus_tag LOCUS_09640 gene uppS 2798 3553 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_09640 >Feature sequence141 1692 223 gene locus_tag LOCUS_09650 gene rpoN 1692 223 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_09650 3228 1783 gene locus_tag LOCUS_09660 gene asnS 3228 1783 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_09660 <4873 3350 gene locus_tag LOCUS_09670 <4873 3350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964341.1:transporter >Feature sequence142 2162 423 gene locus_tag LOCUS_09680 gene lepA 2162 423 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_09680 2549 3544 gene locus_tag LOCUS_09690 2549 3544 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_09690 3644 4390 gene locus_tag LOCUS_09700 3644 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence143 1410 685 gene locus_tag LOCUS_09710 gene gldF 1410 685 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_09710 1750 1454 gene locus_tag LOCUS_09720 gene fjo15 1750 1454 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_09720 2585 1758 gene locus_tag LOCUS_09730 gene fjo14 2585 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_09730 2692 3645 gene locus_tag LOCUS_09740 gene phoH 2692 3645 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_09740 3764 4714 gene locus_tag LOCUS_09750 gene purC 3764 4714 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_09750 >Feature sequence144 <1 743 gene locus_tag LOCUS_09760 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXP5:chorismate synthase 2331 763 gene locus_tag LOCUS_09770 2331 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence145 339 941 gene locus_tag LOCUS_09780 339 941 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_09780 949 1809 gene locus_tag LOCUS_09790 949 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44170 protein_id gnl|my_center|LOCUS_09790 1811 2425 gene locus_tag LOCUS_09800 1811 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_09800 2831 2430 gene locus_tag LOCUS_09810 2831 2430 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_09810 3034 4461 gene locus_tag LOCUS_09820 gene dnaA 3034 4461 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_09820 >Feature sequence146 743 270 gene locus_tag LOCUS_09830 gene ogt1 743 270 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN0 protein_id gnl|my_center|LOCUS_09830 1325 816 gene locus_tag LOCUS_09840 1325 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1472 2740 gene locus_tag LOCUS_09850 1472 2740 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963526.1 protein_id gnl|my_center|LOCUS_09850 2733 3422 gene locus_tag LOCUS_09860 2733 3422 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_09860 3843 3430 gene locus_tag LOCUS_09870 3843 3430 CDS product cytochrome c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962215.1 protein_id gnl|my_center|LOCUS_09870 <4778 3851 gene locus_tag LOCUS_09880 <4778 3851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVN2:delta-aminolevulinic acid dehydratase >Feature sequence147 726 349 gene locus_tag LOCUS_09890 gene crcB 726 349 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J1 protein_id gnl|my_center|LOCUS_09890 1966 731 gene locus_tag LOCUS_09900 gene hutI 1966 731 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_09900 2030 2248 gene locus_tag LOCUS_09910 2030 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09910 2312 3109 gene locus_tag LOCUS_09920 2312 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09920 3191 3361 gene locus_tag LOCUS_09930 3191 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963717.1 protein_id gnl|my_center|LOCUS_09930 <4767 3436 gene locus_tag LOCUS_09940 <4767 3436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963716.1:TonB-dependent receptor >Feature sequence148 1 255 gene locus_tag LOCUS_09950 1 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence149 >Feature sequence150 <1 747 gene locus_tag LOCUS_09960 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964423.1:competence protein ComEC 1179 754 gene locus_tag LOCUS_09970 1179 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 3026 1278 gene locus_tag LOCUS_09980 3026 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 4575 3031 gene locus_tag LOCUS_09990 4575 3031 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957619.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence151 1473 469 gene locus_tag LOCUS_10000 1473 469 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_10000 1602 2522 gene locus_tag LOCUS_10010 gene ycsN 1602 2522 CDS product putative oxidoreductase YcsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42972 protein_id gnl|my_center|LOCUS_10010 2574 2963 gene locus_tag LOCUS_10020 2574 2963 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_10020 3029 4180 gene locus_tag LOCUS_10030 3029 4180 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962316.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence152 101 24 gene locus_tag LOCUS_t00110 101 24 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 570 184 gene locus_tag LOCUS_10040 570 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963214.1 protein_id gnl|my_center|LOCUS_10040 1839 643 gene locus_tag LOCUS_10050 gene ald 1839 643 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_10050 2345 1932 gene locus_tag LOCUS_10060 2345 1932 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_10060 3948 2395 gene locus_tag LOCUS_10070 gene porX 3948 2395 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence153 383 1618 gene locus_tag LOCUS_10080 383 1618 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_10080 1615 3252 gene locus_tag LOCUS_10090 gene pgi 1615 3252 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ0 protein_id gnl|my_center|LOCUS_10090 3352 3777 gene locus_tag LOCUS_10100 3352 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_10100 3852 4301 gene locus_tag LOCUS_10110 3852 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962371.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence154 <1 939 gene locus_tag LOCUS_10120 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A6B2:glutamate dehydrogenase 1127 3346 gene locus_tag LOCUS_10130 1127 3346 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_10130 3346 4059 gene locus_tag LOCUS_10140 gene recO 3346 4059 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 protein_id gnl|my_center|LOCUS_10140 >Feature sequence155 1872 931 gene locus_tag LOCUS_10150 1872 931 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_10150 2406 1876 gene locus_tag LOCUS_10160 2406 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963274.1 protein_id gnl|my_center|LOCUS_10160 2633 2884 gene locus_tag LOCUS_10170 gene rpmE 2633 2884 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_10170 3026 4201 gene locus_tag LOCUS_10180 3026 4201 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_10180 4524 4219 gene locus_tag LOCUS_10190 4524 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence156 431 3190 gene locus_tag LOCUS_10200 431 3190 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_10200 3333 4478 gene locus_tag LOCUS_10210 3333 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence157 19 693 gene locus_tag LOCUS_10220 19 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_10220 698 1738 gene locus_tag LOCUS_10230 698 1738 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence158 873 19 gene locus_tag LOCUS_10240 gene accD 873 19 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_10240 2080 983 gene locus_tag LOCUS_10250 gene fbaA 2080 983 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_10250 4516 2099 gene locus_tag LOCUS_10260 4516 2099 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence159 <1 586 gene locus_tag LOCUS_10270 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962586.1:DUF5103 domain-containing protein 589 1668 gene locus_tag LOCUS_10280 589 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1672 2058 gene locus_tag LOCUS_10290 gene apaG 1672 2058 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_10290 2219 3844 gene locus_tag LOCUS_10300 gene pruA 2219 3844 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_10300 4419 3934 gene locus_tag LOCUS_10310 4419 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence160 146 1489 gene locus_tag LOCUS_10320 146 1489 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_10320 1815 1534 gene locus_tag LOCUS_10330 1815 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1861 2526 gene locus_tag LOCUS_10340 1861 2526 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_10340 2558 3424 gene locus_tag LOCUS_10350 2558 3424 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_10350 3432 3800 gene locus_tag LOCUS_10360 3432 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 4362 3847 gene locus_tag LOCUS_10370 4362 3847 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence161 49 243 gene locus_tag LOCUS_10380 gene rpmF 49 243 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_10380 407 1402 gene locus_tag LOCUS_10390 gene fabH3 407 1402 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_10390 1429 1914 gene locus_tag LOCUS_10400 gene accB 1429 1914 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_10400 2024 3373 gene locus_tag LOCUS_10410 gene accC 2024 3373 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_10410 4394 3432 gene locus_tag LOCUS_10420 4394 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence162 783 46 gene locus_tag LOCUS_10430 783 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1608 787 gene locus_tag LOCUS_10440 gene folP 1608 787 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_10440 1698 2237 gene locus_tag LOCUS_10450 1698 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_10450 2359 2712 gene locus_tag LOCUS_10460 2359 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2790 3878 gene locus_tag LOCUS_10470 gene tlpB 2790 3878 CDS product protein tlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963548.1 protein_id gnl|my_center|LOCUS_10470 4024 4521 gene locus_tag LOCUS_10480 gene tlpA 4024 4521 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963549.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence163 42 2111 gene locus_tag LOCUS_10490 gene pepO 42 2111 CDS product endothelin-converting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962266.1 protein_id gnl|my_center|LOCUS_10490 3269 2346 gene locus_tag LOCUS_10500 3269 2346 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_10500 4141 3272 gene locus_tag LOCUS_10510 gene yeeZ 4141 3272 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962265.1 protein_id gnl|my_center|LOCUS_10510 4573 4223 gene locus_tag LOCUS_10520 4573 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence164 <1 1437 gene locus_tag LOCUS_10530 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964301.1:ATPase 1437 1844 gene locus_tag LOCUS_10540 1437 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1844 2209 gene locus_tag LOCUS_10550 1844 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 3426 2206 gene locus_tag LOCUS_10560 3426 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963254.1 protein_id gnl|my_center|LOCUS_10560 <4639 3416 gene locus_tag LOCUS_10570 <4639 3416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963253.1:membrane protein >Feature sequence165 1 1092 gene locus_tag LOCUS_10580 1 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 2158 1157 gene locus_tag LOCUS_10590 2158 1157 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941519.1 protein_id gnl|my_center|LOCUS_10590 3157 2162 gene locus_tag LOCUS_10600 gene gpsA 3157 2162 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_10600 4587 3421 gene locus_tag LOCUS_10610 4587 3421 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962321.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence166 880 404 gene locus_tag LOCUS_10620 gene mrsB1 880 404 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963828.1 protein_id gnl|my_center|LOCUS_10620 1393 950 gene locus_tag LOCUS_10630 1393 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_10630 1462 2103 gene locus_tag LOCUS_10640 1462 2103 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_10640 2199 3008 gene locus_tag LOCUS_10650 2199 3008 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_10650 3891 3037 gene locus_tag LOCUS_10660 3891 3037 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759986.1 protein_id gnl|my_center|LOCUS_10660 4532 3891 gene locus_tag LOCUS_10670 4532 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964037.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence167 <1 781 gene locus_tag LOCUS_10680 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962917.1:beta-N-acetylglucosaminidase 784 1239 gene locus_tag LOCUS_10690 784 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_10690 1303 2433 gene locus_tag LOCUS_10700 1303 2433 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_10700 2433 2858 gene locus_tag LOCUS_10710 2433 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 3390 2896 gene locus_tag LOCUS_10720 3390 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 4375 3560 gene locus_tag LOCUS_10730 4375 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence168 1592 675 gene locus_tag LOCUS_10740 gene hemC 1592 675 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP0 protein_id gnl|my_center|LOCUS_10740 2848 1592 gene locus_tag LOCUS_10750 gene hemA 2848 1592 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 protein_id gnl|my_center|LOCUS_10750 3079 3951 gene locus_tag LOCUS_10760 3079 3951 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence169 258 668 gene locus_tag LOCUS_10770 258 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 760 1938 gene locus_tag LOCUS_10780 gene purM 760 1938 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_10780 2011 3543 gene locus_tag LOCUS_10790 gene guaA 2011 3543 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_10790 >Feature sequence170 83 871 gene locus_tag LOCUS_10800 83 871 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_10800 1248 1000 gene locus_tag LOCUS_10810 1248 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1859 1365 gene locus_tag LOCUS_10820 1859 1365 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_10820 2248 1940 gene locus_tag LOCUS_10830 2248 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_10830 <4572 2472 gene locus_tag LOCUS_10840 <4572 2472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYT9:DNA-directed RNA polymerase subunit beta' >Feature sequence171 735 337 gene locus_tag LOCUS_10850 735 337 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_10850 1202 765 gene locus_tag LOCUS_10860 1202 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3193 1307 gene locus_tag LOCUS_10870 gene htpG 3193 1307 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_10870 3313 4233 gene locus_tag LOCUS_10880 3313 4233 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence172 <1 1525 gene locus_tag LOCUS_10890 <1 1525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765451.1:alginate O-acetyltransferase 1585 1788 gene locus_tag LOCUS_10900 1585 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1895 2164 gene locus_tag LOCUS_10910 1895 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2258 3829 gene locus_tag LOCUS_10920 2258 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 3936 4142 gene locus_tag LOCUS_10930 3936 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence173 590 174 gene locus_tag LOCUS_10940 590 174 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964139.1 protein_id gnl|my_center|LOCUS_10940 883 593 gene locus_tag LOCUS_10950 883 593 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_10950 1289 954 gene locus_tag LOCUS_10960 1289 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2786 1431 gene locus_tag LOCUS_10970 2786 1431 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475806.1 protein_id gnl|my_center|LOCUS_10970 3793 2936 gene locus_tag LOCUS_10980 3793 2936 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962903.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence174 3323 1473 gene locus_tag LOCUS_10990 gene gaa 3323 1473 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence175 895 2028 gene locus_tag LOCUS_11000 895 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 2115 3332 gene locus_tag LOCUS_11010 gene rsmB 2115 3332 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence176 343 2958 gene locus_tag LOCUS_11020 gene clpB 343 2958 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0F9 protein_id gnl|my_center|LOCUS_11020 4419 3064 gene locus_tag LOCUS_11030 4419 3064 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence177 1570 2013 gene locus_tag LOCUS_11040 1570 2013 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792215.1 protein_id gnl|my_center|LOCUS_11040 2618 2010 gene locus_tag LOCUS_11050 2618 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 3316 2702 gene locus_tag LOCUS_11060 3316 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3463 3389 gene locus_tag LOCUS_t00120 3463 3389 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <4442 3796 gene locus_tag LOCUS_11070 <4442 3796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963836.1:acyl-CoA dehydrogenase >Feature sequence178 <1 892 gene locus_tag LOCUS_11080 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY93:succinate--CoA ligase [ADP-forming] subunit alpha 1219 944 gene locus_tag LOCUS_11090 gene clpS 1219 944 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_11090 2218 1385 gene locus_tag LOCUS_11100 gene prmA 2218 1385 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_11100 2296 3513 gene locus_tag LOCUS_11110 2296 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence179 829 434 gene locus_tag LOCUS_11120 829 434 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_11120 1533 829 gene locus_tag LOCUS_11130 1533 829 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_11130 2937 1582 gene locus_tag LOCUS_11140 2937 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883648.1 protein_id gnl|my_center|LOCUS_11140 4181 2955 gene locus_tag LOCUS_11150 4181 2955 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence180 668 1567 gene locus_tag LOCUS_11160 gene xerD 668 1567 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_11160 3246 1684 gene locus_tag LOCUS_11170 gene rny 3246 1684 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 protein_id gnl|my_center|LOCUS_11170 3746 3453 gene locus_tag LOCUS_11180 3746 3453 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 protein_id gnl|my_center|LOCUS_11180 4044 3754 gene locus_tag LOCUS_11190 4044 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963282.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence181 635 99 gene locus_tag LOCUS_11200 635 99 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_11200 2042 672 gene locus_tag LOCUS_11210 2042 672 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_11210 2169 2555 gene locus_tag LOCUS_11220 2169 2555 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_11220 2625 4250 gene locus_tag LOCUS_11230 gene pckA 2625 4250 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H256 protein_id gnl|my_center|LOCUS_11230 >Feature sequence182 2865 202 gene locus_tag LOCUS_11240 gene mutS 2865 202 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWN3 protein_id gnl|my_center|LOCUS_11240 3087 3614 gene locus_tag LOCUS_11250 3087 3614 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_11250 4242 3748 gene locus_tag LOCUS_11260 4242 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11260 >Feature sequence183 <1 786 gene locus_tag LOCUS_11270 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWU5:ribonucleoside-diphosphate reductase 836 1123 gene locus_tag LOCUS_11280 836 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963201.1 protein_id gnl|my_center|LOCUS_11280 1164 2510 gene locus_tag LOCUS_11290 gene dgt 1164 2510 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_11290 2599 3279 gene locus_tag LOCUS_11300 2599 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence184 1417 20 gene locus_tag LOCUS_11310 1417 20 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_11310 1609 2202 gene locus_tag LOCUS_11320 1609 2202 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_11320 2255 4072 gene locus_tag LOCUS_11330 2255 4072 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963883.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence185 3371 849 gene locus_tag LOCUS_11340 3371 849 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946759.1 protein_id gnl|my_center|LOCUS_11340 4063 3548 gene locus_tag LOCUS_11350 4063 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence186 <1 858 gene locus_tag LOCUS_11360 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963304.1:ATPase AAA 898 2007 gene locus_tag LOCUS_11370 898 2007 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962920.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence187 57 710 gene locus_tag LOCUS_11380 57 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 959 888 gene locus_tag LOCUS_t00130 959 888 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1083 3002 gene locus_tag LOCUS_11390 1083 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44135 protein_id gnl|my_center|LOCUS_11390 3006 3326 gene locus_tag LOCUS_11400 3006 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 3359 3739 gene locus_tag LOCUS_11410 3359 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11410 4095 3736 gene locus_tag LOCUS_11420 gene folB 4095 3736 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence188 1404 373 gene locus_tag LOCUS_11430 1404 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_11430 1517 3262 gene locus_tag LOCUS_11440 1517 3262 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964054.1 protein_id gnl|my_center|LOCUS_11440 3878 3267 gene locus_tag LOCUS_11450 3878 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence189 356 1486 gene locus_tag LOCUS_11460 356 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2507 1479 gene locus_tag LOCUS_11470 gene porY 2507 1479 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_11470 2803 3678 gene locus_tag LOCUS_11480 2803 3678 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_11480 3690 4067 gene locus_tag LOCUS_11490 3690 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence190 948 619 gene locus_tag LOCUS_11500 gene sufA 948 619 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_11500 1184 2044 gene locus_tag LOCUS_11510 1184 2044 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_11510 2118 3710 gene locus_tag LOCUS_11520 2118 3710 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence191 1211 447 gene locus_tag LOCUS_11530 1211 447 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_11530 1645 1268 gene locus_tag LOCUS_11540 1645 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 2513 1695 gene locus_tag LOCUS_11550 gene map 2513 1695 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_11550 2686 3963 gene locus_tag LOCUS_11560 gene cat2 2686 3963 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962593.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence192 1954 1253 gene locus_tag LOCUS_11570 1954 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_11570 2252 1962 gene locus_tag LOCUS_11580 2252 1962 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_11580 2548 3087 gene locus_tag LOCUS_11590 2548 3087 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence193 3259 2201 gene locus_tag LOCUS_11600 3259 2201 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_11600 <4239 3401 gene locus_tag LOCUS_11610 <4239 3401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYD1:ATP-dependent DNA helicase RecG >Feature sequence194 635 1057 gene locus_tag LOCUS_11620 635 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1265 1933 gene locus_tag LOCUS_11630 1265 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2105 2356 gene locus_tag LOCUS_11640 2105 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 2861 3577 gene locus_tag LOCUS_11650 2861 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence195 1931 1491 gene locus_tag LOCUS_11660 1931 1491 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_11660 3831 2059 gene locus_tag LOCUS_11670 gene fadD 3831 2059 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence196 639 187 gene locus_tag LOCUS_11680 639 187 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_11680 825 2027 gene locus_tag LOCUS_11690 825 2027 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_11690 2143 3600 gene locus_tag LOCUS_11700 2143 3600 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence197 343 975 gene locus_tag LOCUS_11710 gene queE 343 975 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_11710 1851 1144 gene locus_tag LOCUS_11720 1851 1144 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_11720 2162 3556 gene locus_tag LOCUS_11730 2162 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence198 984 316 gene locus_tag LOCUS_11740 gene folE1 984 316 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB6 protein_id gnl|my_center|LOCUS_11740 1652 999 gene locus_tag LOCUS_11750 gene mrsA 1652 999 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB5 protein_id gnl|my_center|LOCUS_11750 1805 2467 gene locus_tag LOCUS_11760 gene lolD 1805 2467 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_11760 2467 4080 gene locus_tag LOCUS_11770 2467 4080 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879752.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence199 1474 281 gene locus_tag LOCUS_11780 gene aspC2 1474 281 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_11780 1600 2919 gene locus_tag LOCUS_11790 1600 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3383 2955 gene locus_tag LOCUS_11800 3383 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963807.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence200 671 6 gene locus_tag LOCUS_11810 671 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 2323 677 gene locus_tag LOCUS_11820 2323 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 2535 3887 gene locus_tag LOCUS_11830 2535 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence201 308 718 gene locus_tag LOCUS_11840 gene ygcM 308 718 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_11840 721 1173 gene locus_tag LOCUS_11850 721 1173 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_11850 1254 2213 gene locus_tag LOCUS_11860 gene manA 1254 2213 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 protein_id gnl|my_center|LOCUS_11860 2271 2540 gene locus_tag LOCUS_11870 2271 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963895.1 protein_id gnl|my_center|LOCUS_11870 2618 2692 gene locus_tag LOCUS_t00140 2618 2692 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3459 2890 gene locus_tag LOCUS_11880 3459 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence202 1686 610 gene locus_tag LOCUS_11890 gene speB 1686 610 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_11890 3107 1815 gene locus_tag LOCUS_11900 gene kynU 3107 1815 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_11900 <4059 3242 gene locus_tag LOCUS_11910 <4059 3242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW82:S-adenosylmethionine:tRNA ribosyltransferase-isomerase >Feature sequence203 2133 136 gene locus_tag LOCUS_11920 2133 136 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962880.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence204 1954 3036 gene locus_tag LOCUS_11930 1954 3036 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_11930 3076 3666 gene locus_tag LOCUS_11940 gene haaO 3076 3666 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_11940 >Feature sequence205 168 1007 gene locus_tag LOCUS_11950 168 1007 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_11950 1560 1000 gene locus_tag LOCUS_11960 1560 1000 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_11960 1957 1682 gene locus_tag LOCUS_11970 gene hupB 1957 1682 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_11970 3081 2134 gene locus_tag LOCUS_11980 gene fmt 3081 2134 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H148 protein_id gnl|my_center|LOCUS_11980 <3947 3081 gene locus_tag LOCUS_11990 <3947 3081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362014.1:ATP-dependent DNA helicase RecQ2 >Feature sequence206 171 1118 gene locus_tag LOCUS_12000 171 1118 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081007.1 protein_id gnl|my_center|LOCUS_12000 1192 2808 gene locus_tag LOCUS_12010 1192 2808 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_12010 2808 3752 gene locus_tag LOCUS_12020 2808 3752 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence207 3305 531 gene locus_tag LOCUS_12030 gene sucA 3305 531 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence208 910 521 gene locus_tag LOCUS_12040 910 521 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_12040 1882 962 gene locus_tag LOCUS_12050 1882 962 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442797.1 protein_id gnl|my_center|LOCUS_12050 2011 3015 gene locus_tag LOCUS_12060 2011 3015 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence209 19 549 gene locus_tag LOCUS_12070 19 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 744 3206 gene locus_tag LOCUS_12080 gene lon 744 3206 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_12080 >Feature sequence210 880 305 gene locus_tag LOCUS_12090 880 305 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_12090 1128 2387 gene locus_tag LOCUS_12100 1128 2387 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_12100 3554 2436 gene locus_tag LOCUS_12110 gene yghO 3554 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence211 <1 927 gene locus_tag LOCUS_12120 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0L3:inosine-5'-monophosphate dehydrogenase 2039 963 gene locus_tag LOCUS_12130 2039 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3525 2182 gene locus_tag LOCUS_12140 gene purB 3525 2182 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_12140 >Feature sequence212 2067 379 gene locus_tag LOCUS_12150 2067 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_12150 2918 2106 gene locus_tag LOCUS_12160 2918 2106 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964568.1 protein_id gnl|my_center|LOCUS_12160 <3732 2918 gene locus_tag LOCUS_12170 <3732 2918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964568.1:membrane protein >Feature sequence213 110 36 gene locus_tag LOCUS_t00150 110 36 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 199 124 gene locus_tag LOCUS_t00160 199 124 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 296 212 gene locus_tag LOCUS_t00170 296 212 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 621 1799 gene locus_tag LOCUS_12180 621 1799 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_12180 1888 2649 gene locus_tag LOCUS_12190 1888 2649 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence214 <1 1024 gene locus_tag LOCUS_12200 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405041.1:magnesium chelatase 2696 1068 gene locus_tag LOCUS_12210 2696 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence215 <1 1282 gene locus_tag LOCUS_12220 <1 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWI1:DNA-directed DNA polymerase 1349 1924 gene locus_tag LOCUS_12230 1349 1924 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962861.1 protein_id gnl|my_center|LOCUS_12230 2032 2349 gene locus_tag LOCUS_12240 2032 2349 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_12240 2498 3490 gene locus_tag LOCUS_12250 2498 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_12250 3577 3653 gene locus_tag LOCUS_t00180 3577 3653 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence216 825 1403 gene locus_tag LOCUS_12260 825 1403 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_12260 1415 2101 gene locus_tag LOCUS_12270 1415 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 2544 2852 gene locus_tag LOCUS_12280 2544 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence217 772 3174 gene locus_tag LOCUS_12290 772 3174 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence218 131 2317 gene locus_tag LOCUS_12300 131 2317 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_12300 2786 2364 gene locus_tag LOCUS_12310 2786 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964454.1 protein_id gnl|my_center|LOCUS_12310 2941 3417 gene locus_tag LOCUS_12320 gene greA 2941 3417 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_12320 >Feature sequence219 440 1711 gene locus_tag LOCUS_12330 gene purD 440 1711 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_12330 1965 1735 gene locus_tag LOCUS_12340 1965 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2013 2942 gene locus_tag LOCUS_12350 2013 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964559.1 protein_id gnl|my_center|LOCUS_12350 3590 2937 gene locus_tag LOCUS_12360 gene upp 3590 2937 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence220 >Feature sequence221 1609 758 gene locus_tag LOCUS_12370 1609 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence222 <1 1053 gene locus_tag LOCUS_12380 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964491.1:transporter 1064 2227 gene locus_tag LOCUS_12390 1064 2227 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence223 1774 2556 gene locus_tag LOCUS_12400 gene lpxH 1774 2556 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_12400 <3614 2553 gene locus_tag LOCUS_12410 <3614 2553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037397.1:MFS transporter >Feature sequence224 1989 1288 gene locus_tag LOCUS_12420 1989 1288 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_12420 2865 2086 gene locus_tag LOCUS_12430 2865 2086 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_12430 <3606 2998 gene locus_tag LOCUS_12440 <3606 2998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962749.1:ABC transporter >Feature sequence225 1352 306 gene locus_tag LOCUS_12450 gene fjo30 1352 306 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_12450 2341 1418 gene locus_tag LOCUS_12460 gene gldN 2341 1418 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_12460 <3580 2381 gene locus_tag LOCUS_12470 <3580 2381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964073.1:gliding motility protein GldM >Feature sequence226 <1 1242 gene locus_tag LOCUS_12480 <1 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWC0:1-deoxy-D-xylulose-5-phosphate synthase 1244 2188 gene locus_tag LOCUS_12490 1244 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_12490 2253 2335 gene locus_tag LOCUS_t00190 2253 2335 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2745 3125 gene locus_tag LOCUS_12500 2745 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence227 725 99 gene locus_tag LOCUS_12510 725 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1453 779 gene locus_tag LOCUS_12520 gene trmB 1453 779 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_12520 1595 2395 gene locus_tag LOCUS_12530 1595 2395 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_12530 2395 3441 gene locus_tag LOCUS_12540 2395 3441 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence228 561 142 gene locus_tag LOCUS_12550 561 142 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064928.1 protein_id gnl|my_center|LOCUS_12550 2179 590 gene locus_tag LOCUS_12560 2179 590 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088817.1 protein_id gnl|my_center|LOCUS_12560 3508 2249 gene locus_tag LOCUS_12570 3508 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence229 1255 383 gene locus_tag LOCUS_12580 gene cphB 1255 383 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963249.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence230 1 657 gene locus_tag LOCUS_12590 1 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 723 1970 gene locus_tag LOCUS_12600 723 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964016.1 protein_id gnl|my_center|LOCUS_12600 2081 2617 gene locus_tag LOCUS_12610 2081 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 2592 3278 gene locus_tag LOCUS_12620 2592 3278 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence231 <1 938 gene locus_tag LOCUS_12630 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962821.1:helicase 1154 1726 gene locus_tag LOCUS_12640 1154 1726 CDS product 2-polyprenyl-3-methyl-5-hydroxy-6-metoxy-1,4-benzoquinol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074157.1 protein_id gnl|my_center|LOCUS_12640 2441 1851 gene locus_tag LOCUS_12650 2441 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259055.1 protein_id gnl|my_center|LOCUS_12650 3466 2501 gene locus_tag LOCUS_12660 3466 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence232 616 215 gene locus_tag LOCUS_12670 616 215 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_12670 2144 609 gene locus_tag LOCUS_12680 2144 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2728 2114 gene locus_tag LOCUS_12690 gene pnuC 2728 2114 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_12690 <3433 2725 gene locus_tag LOCUS_12700 <3433 2725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW30:geranylgeranylglyceryl phosphate synthase >Feature sequence233 1276 794 gene locus_tag LOCUS_12710 1276 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_12710 1875 1279 gene locus_tag LOCUS_12720 1875 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 2681 1890 gene locus_tag LOCUS_12730 2681 1890 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_12730 <3408 2714 gene locus_tag LOCUS_12740 <3408 2714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962913.1:Fe-S oxidoreductase >Feature sequence234 349 1623 gene locus_tag LOCUS_12750 gene phrB3 349 1623 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964143.1 protein_id gnl|my_center|LOCUS_12750 1624 3156 gene locus_tag LOCUS_12760 1624 3156 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964142.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence235 1386 2627 gene locus_tag LOCUS_12770 1386 2627 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_12770 <3390 2813 gene locus_tag LOCUS_12780 <3390 2813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H162:release factor glutamine methyltransferase >Feature sequence236 831 511 gene locus_tag LOCUS_12790 831 511 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_12790 1277 909 gene locus_tag LOCUS_12800 1277 909 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957424.1 protein_id gnl|my_center|LOCUS_12800 1422 2984 gene locus_tag LOCUS_12810 1422 2984 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107456.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence237 2281 374 gene locus_tag LOCUS_12820 2281 374 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_12820 3156 2293 gene locus_tag LOCUS_12830 3156 2293 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence238 663 469 gene locus_tag LOCUS_12840 663 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962630.1 protein_id gnl|my_center|LOCUS_12840 1257 676 gene locus_tag LOCUS_12850 1257 676 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_12850 1571 2137 gene locus_tag LOCUS_12860 1571 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence239 28 1098 gene locus_tag LOCUS_12870 28 1098 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039954.1 protein_id gnl|my_center|LOCUS_12870 1088 1483 gene locus_tag LOCUS_12880 1088 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963968.1 protein_id gnl|my_center|LOCUS_12880 2620 1475 gene locus_tag LOCUS_12890 2620 1475 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704482.1 protein_id gnl|my_center|LOCUS_12890 <3310 2598 gene locus_tag LOCUS_12900 <3310 2598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963966.1:glycosyl transferase >Feature sequence240 3310 2183 gene locus_tag LOCUS_12910 3310 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence241 1745 24 gene locus_tag LOCUS_12920 1745 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2332 2910 gene locus_tag LOCUS_12930 2332 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence242 1861 2793 gene locus_tag LOCUS_12940 gene ribF 1861 2793 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_12940 >Feature sequence243 <1 914 gene locus_tag LOCUS_12950 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000262613.1:methionine synthase 991 1947 gene locus_tag LOCUS_12960 991 1947 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU8 protein_id gnl|my_center|LOCUS_12960 2065 2454 gene locus_tag LOCUS_12970 2065 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 <3263 2535 gene locus_tag LOCUS_12980 <3263 2535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962427.1:gliding motility-associated ABC transporter ATP-binding subunit GldA >Feature sequence244 <3229 1122 gene locus_tag LOCUS_12990 <3229 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963026.1:oligopeptidase B >Feature sequence245 1364 912 gene locus_tag LOCUS_13000 1364 912 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_13000 1642 3177 gene locus_tag LOCUS_13010 1642 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence246 <1 1730 gene locus_tag LOCUS_13020 <1 1730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962262.1:peptidase M1 1801 3126 gene locus_tag LOCUS_13030 1801 3126 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVS7 protein_id gnl|my_center|LOCUS_13030 >Feature sequence247 <1 597 gene locus_tag LOCUS_13040 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H213:5'-nucleotidase SurE 608 1723 gene locus_tag LOCUS_13050 gene lpxB 608 1723 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence248 1062 169 gene locus_tag LOCUS_13060 1062 169 CDS product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962486.1 protein_id gnl|my_center|LOCUS_13060 2032 1166 gene locus_tag LOCUS_13070 2032 1166 CDS product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_13070 3111 2173 gene locus_tag LOCUS_13080 gene mvaK 3111 2173 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence249 90 1130 gene locus_tag LOCUS_13090 90 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_13090 1665 1216 gene locus_tag LOCUS_13100 1665 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_13100 2103 1681 gene locus_tag LOCUS_13110 2103 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962783.1 protein_id gnl|my_center|LOCUS_13110 2679 2137 gene locus_tag LOCUS_13120 2679 2137 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence250 1431 319 gene locus_tag LOCUS_13130 gene wecB 1431 319 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAE3 protein_id gnl|my_center|LOCUS_13130 2436 1513 gene locus_tag LOCUS_13140 2436 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 <3134 2433 gene locus_tag LOCUS_13150 <3134 2433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942157.1:glycosyl transferase >Feature sequence251 246 1055 gene locus_tag LOCUS_13160 246 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 2433 1129 gene locus_tag LOCUS_13170 gene ndh 2433 1129 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence252 >Feature sequence253 <1 1851 gene locus_tag LOCUS_13180 <1 1851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405453.1:glutaminyl-tRNA synthetase 2545 1925 gene locus_tag LOCUS_13190 2545 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence254 3 998 gene locus_tag LOCUS_13200 3 998 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_13200 1068 1904 gene locus_tag LOCUS_13210 1068 1904 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_13210 2978 1959 gene locus_tag LOCUS_13220 2978 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence255 267 569 gene locus_tag LOCUS_13230 267 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811819.1 protein_id gnl|my_center|LOCUS_13230 1096 629 gene locus_tag LOCUS_13240 1096 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1330 1142 gene locus_tag LOCUS_13250 1330 1142 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963915.1 protein_id gnl|my_center|LOCUS_13250 1648 1343 gene locus_tag LOCUS_13260 1648 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 <3059 1699 gene locus_tag LOCUS_13270 <3059 1699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963916.1:multidrug transporter AcrB >Feature sequence256 <1 774 gene locus_tag LOCUS_13280 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964486.1:peptidase M1 929 1987 gene locus_tag LOCUS_13290 929 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13290 2039 3052 gene locus_tag LOCUS_13300 2039 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13300 >Feature sequence257 583 1809 gene locus_tag LOCUS_13310 583 1809 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_13310 1904 2269 gene locus_tag LOCUS_13320 1904 2269 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence258 550 921 gene locus_tag LOCUS_13330 550 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence259 <1 1224 gene locus_tag LOCUS_13340 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067720.1:alpha/beta hydrolase 1254 2030 gene locus_tag LOCUS_13350 1254 2030 CDS product chitooligosaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118657.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence260 534 1067 gene locus_tag LOCUS_13360 534 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1768 1103 gene locus_tag LOCUS_13370 gene ung 1768 1103 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYF9 protein_id gnl|my_center|LOCUS_13370 >Feature sequence261 <1 1167 gene locus_tag LOCUS_13380 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX72:dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex 1246 2190 gene locus_tag LOCUS_13390 1246 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 2190 2822 gene locus_tag LOCUS_13400 2190 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence262 766 68 gene locus_tag LOCUS_13410 gene truB 766 68 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_13410 1551 766 gene locus_tag LOCUS_13420 gene uppP 1551 766 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H239 protein_id gnl|my_center|LOCUS_13420 1889 1626 gene locus_tag LOCUS_13430 gene fjo13 1889 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_13430 2785 1910 gene locus_tag LOCUS_13440 gene ftsX 2785 1910 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_13440 >Feature sequence263 379 167 gene locus_tag LOCUS_13450 379 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 785 396 gene locus_tag LOCUS_13460 785 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1127 825 gene locus_tag LOCUS_13470 1127 825 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_13470 1271 2635 gene locus_tag LOCUS_13480 gene hemN 1271 2635 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_13480 >Feature sequence264 226 1641 gene locus_tag LOCUS_13490 gene cca 226 1641 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_13490 1775 2734 gene locus_tag LOCUS_13500 gene ctaA 1775 2734 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H039 protein_id gnl|my_center|LOCUS_13500 >Feature sequence265 576 16 gene locus_tag LOCUS_13510 gene tag 576 16 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_13510 1225 566 gene locus_tag LOCUS_13520 1225 566 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070937.1 protein_id gnl|my_center|LOCUS_13520 2139 1318 gene locus_tag LOCUS_13530 gene tsf 2139 1318 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_13530 <2970 2278 gene locus_tag LOCUS_13540 <2970 2278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWU2:30S ribosomal protein S2 >Feature sequence266 1063 2040 gene locus_tag LOCUS_13550 gene menC 1063 2040 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence267 345 175 gene locus_tag LOCUS_13560 345 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1092 457 gene locus_tag LOCUS_13570 gene lspA 1092 457 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_13570 1555 1175 gene locus_tag LOCUS_13580 gene dksA 1555 1175 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_13580 <2965 1604 gene locus_tag LOCUS_13590 <2965 1604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW60:isoleucine--tRNA ligase >Feature sequence268 <1 837 gene locus_tag LOCUS_13600 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545909.1:UDP-N-acetyl glucosamine 2-epimerase 837 1538 gene locus_tag LOCUS_13610 gene neuA 837 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence269 303 1091 gene locus_tag LOCUS_13620 303 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1220 1927 gene locus_tag LOCUS_13630 gene pyrH 1220 1927 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_13630 1973 2536 gene locus_tag LOCUS_13640 gene frr 1973 2536 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_13640 >Feature sequence270 <1 921 gene locus_tag LOCUS_13650 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY90:polyphosphate kinase 934 1824 gene locus_tag LOCUS_13660 gene ppx 934 1824 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_13660 <2939 1849 gene locus_tag LOCUS_13670 <2939 1849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389628.1:PAS domain-containing sensor histidine kinase >Feature sequence271 >Feature sequence272 357 602 gene locus_tag LOCUS_13680 357 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 615 1118 gene locus_tag LOCUS_13690 615 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963109.1 protein_id gnl|my_center|LOCUS_13690 1138 1845 gene locus_tag LOCUS_13700 1138 1845 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888239.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence273 927 2054 gene locus_tag LOCUS_13710 gene porR 927 2054 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence274 213 1334 gene locus_tag LOCUS_13720 213 1334 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_13720 2210 1821 gene locus_tag LOCUS_13730 2210 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 protein_id gnl|my_center|LOCUS_13730 <2913 2311 gene locus_tag LOCUS_13740 <2913 2311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXE4:orotate phosphoribosyltransferase >Feature sequence275 962 729 gene locus_tag LOCUS_13750 962 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2483 1461 gene locus_tag LOCUS_13760 2483 1461 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence276 2832 634 gene locus_tag LOCUS_13770 2832 634 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence277 1407 943 gene locus_tag LOCUS_13780 gene gldH 1407 943 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_13780 2464 1421 gene locus_tag LOCUS_13790 2464 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence278 1650 1249 gene locus_tag LOCUS_13800 gene ssb 1650 1249 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H058 protein_id gnl|my_center|LOCUS_13800 2738 1689 gene locus_tag LOCUS_13810 gene mutY 2738 1689 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence279 <1 806 gene locus_tag LOCUS_13820 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY99:UDP-3-O-acylglucosamine N-acyltransferase 825 2213 gene locus_tag LOCUS_13830 gene fabZ 825 2213 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_13830 >Feature sequence280 <1 1071 gene locus_tag LOCUS_13840 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962560.1:SOS mutagenesis and repair protein UmuC 1062 1499 gene locus_tag LOCUS_13850 1062 1499 CDS product SOS-response transcriptional regulator UmuD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202621.1 protein_id gnl|my_center|LOCUS_13850 <2848 1553 gene locus_tag LOCUS_13860 <2848 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2B0:peptidylprolyl isomerase >Feature sequence281 >Feature sequence282 424 1173 gene locus_tag LOCUS_13870 424 1173 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_13870 1170 1349 gene locus_tag LOCUS_13880 1170 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1356 1805 gene locus_tag LOCUS_13890 1356 1805 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_13890 2835 1861 gene locus_tag LOCUS_13900 2835 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence283 <2835 12 gene locus_tag LOCUS_13910 <2835 12 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin >Feature sequence284 1565 1035 gene locus_tag LOCUS_13920 gene ppa 1565 1035 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH9 protein_id gnl|my_center|LOCUS_13920 <2810 1648 gene locus_tag LOCUS_13930 <2810 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962509.1:membrane protein >Feature sequence285 752 1198 gene locus_tag LOCUS_13940 752 1198 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_13940 1306 2184 gene locus_tag LOCUS_13950 1306 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 2796 2194 gene locus_tag LOCUS_13960 2796 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence286 1371 205 gene locus_tag LOCUS_13970 1371 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964174.1 protein_id gnl|my_center|LOCUS_13970 2092 1406 gene locus_tag LOCUS_13980 2092 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964175.1 protein_id gnl|my_center|LOCUS_13980 2543 2079 gene locus_tag LOCUS_13990 2543 2079 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence287 1054 449 gene locus_tag LOCUS_14000 1054 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_14000 <2793 1161 gene locus_tag LOCUS_14010 <2793 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX85:ATP-dependent zinc metalloprotease FtsH >Feature sequence288 <1 2753 gene locus_tag LOCUS_14020 <1 2753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0Y2:Fused isobutyryl-CoA mutase >Feature sequence289 452 69 gene locus_tag LOCUS_14030 452 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_14030 527 715 gene locus_tag LOCUS_14040 527 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963853.1 protein_id gnl|my_center|LOCUS_14040 750 1775 gene locus_tag LOCUS_14050 750 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963854.1 protein_id gnl|my_center|LOCUS_14050 1795 2247 gene locus_tag LOCUS_14060 1795 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence290 <1 1137 gene locus_tag LOCUS_14070 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962719.1:glycosyl transferase family 2 >Feature sequence291 966 205 gene locus_tag LOCUS_14080 gene xth 966 205 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence292 >Feature sequence293 >Feature sequence294 502 1398 gene locus_tag LOCUS_14090 502 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence295 523 1305 gene locus_tag LOCUS_14100 523 1305 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661592.1 protein_id gnl|my_center|LOCUS_14100 1749 1360 gene locus_tag LOCUS_14110 1749 1360 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962542.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence296 126 791 gene locus_tag LOCUS_14120 126 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence297 414 968 gene locus_tag LOCUS_14130 414 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_14130 1041 2459 gene locus_tag LOCUS_14140 1041 2459 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence298 287 1063 gene locus_tag LOCUS_14150 287 1063 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962446.1 protein_id gnl|my_center|LOCUS_14150 2275 1130 gene locus_tag LOCUS_14160 2275 1130 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_14160 2683 2306 gene locus_tag LOCUS_14170 2683 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence299 2015 933 gene locus_tag LOCUS_14180 gene gcvT 2015 933 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_14180 >Feature sequence300 <1 690 gene locus_tag LOCUS_14190 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PII5:diaminopimelate decarboxylase 1367 879 gene locus_tag LOCUS_14200 1367 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 <2669 1376 gene locus_tag LOCUS_14210 <2669 1376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963871.1:alkaline phosphatase family protein >Feature sequence301 1713 325 gene locus_tag LOCUS_14220 1713 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 protein_id gnl|my_center|LOCUS_14220 <2661 1966 gene locus_tag LOCUS_14230 <2661 1966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZP8:arginine--tRNA ligase >Feature sequence302 983 1717 gene locus_tag LOCUS_14240 983 1717 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_14240 1838 2494 gene locus_tag LOCUS_14250 gene tal 1838 2494 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_14250 >Feature sequence303 <1 606 gene locus_tag LOCUS_14260 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963348.1:serine protease 1271 669 gene locus_tag LOCUS_14270 1271 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence304 50 1162 gene locus_tag LOCUS_14280 50 1162 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086196.1 protein_id gnl|my_center|LOCUS_14280 1170 2351 gene locus_tag LOCUS_14290 1170 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence305 212 535 gene locus_tag LOCUS_14300 212 535 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY02 protein_id gnl|my_center|LOCUS_14300 1301 528 gene locus_tag LOCUS_14310 1301 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_14310 2480 1455 gene locus_tag LOCUS_14320 gene ltaE 2480 1455 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence306 156 782 gene locus_tag LOCUS_14330 gene ypmQ 156 782 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_14330 920 1459 gene locus_tag LOCUS_14340 gene yozB 920 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_14340 1449 1706 gene locus_tag LOCUS_14350 1449 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964212.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence307 <1 810 gene locus_tag LOCUS_14360 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962401.1:homogentisate 1,2-dioxygenase 811 1254 gene locus_tag LOCUS_14370 811 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1273 2436 gene locus_tag LOCUS_14380 gene hppD 1273 2436 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence308 >Feature sequence309 698 1351 gene locus_tag LOCUS_14390 698 1351 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962813.1 protein_id gnl|my_center|LOCUS_14390 1338 2378 gene locus_tag LOCUS_14400 1338 2378 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_14400 >Feature sequence310 1138 236 gene locus_tag LOCUS_14410 gene hemF 1138 236 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_14410 1664 1128 gene locus_tag LOCUS_14420 1664 1128 CDS product ribosomal-protein-amino-adic N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962220.1 protein_id gnl|my_center|LOCUS_14420 1952 1710 gene locus_tag LOCUS_14430 1952 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 <2596 2026 gene locus_tag LOCUS_14440 <2596 2026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVN8:uroporphyrinogen decarboxylase >Feature sequence311 459 2183 gene locus_tag LOCUS_14450 459 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence312 649 164 gene locus_tag LOCUS_14460 gene dfrA 649 164 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_14460 1121 651 gene locus_tag LOCUS_14470 1121 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1956 1132 gene locus_tag LOCUS_14480 gene thyA 1956 1132 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 protein_id gnl|my_center|LOCUS_14480 2311 1967 gene locus_tag LOCUS_14490 2311 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence313 504 1643 gene locus_tag LOCUS_14500 504 1643 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_14500 2023 2271 gene locus_tag LOCUS_14510 2023 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence314 <2560 1483 gene locus_tag LOCUS_14520 <2560 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964419.1:lipid-A-disaccharide synthase >Feature sequence315 833 1864 gene locus_tag LOCUS_14530 833 1864 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963810.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence316 232 594 gene locus_tag LOCUS_14540 232 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1236 595 gene locus_tag LOCUS_14550 gene pcm 1236 595 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_14550 1368 2333 gene locus_tag LOCUS_14560 1368 2333 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence317 41 1021 gene locus_tag LOCUS_14570 41 1021 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_14570 1107 2219 gene locus_tag LOCUS_14580 1107 2219 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086196.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence318 157 807 gene locus_tag LOCUS_14590 157 807 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546325.1 protein_id gnl|my_center|LOCUS_14590 823 1707 gene locus_tag LOCUS_14600 823 1707 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence319 <1 753 gene locus_tag LOCUS_14610 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963196.1:glutamine cyclotransferase 746 1168 gene locus_tag LOCUS_14620 746 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1955 1443 gene locus_tag LOCUS_14630 1955 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810105.1 protein_id gnl|my_center|LOCUS_14630 <2533 1958 gene locus_tag LOCUS_14640 <2533 1958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000939052.1:2-nitropropane dioxygenase >Feature sequence320 <1 512 gene locus_tag LOCUS_14650 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962476.1:alpha-amylase note possible pseudo, frameshifted 518 664 gene locus_tag LOCUS_14660 518 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 741 1961 gene locus_tag LOCUS_14670 741 1961 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_14670 2381 1962 gene locus_tag LOCUS_14680 2381 1962 CDS product sensory protein TspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962480.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence321 240 158 gene locus_tag LOCUS_t00200 240 158 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1530 406 gene locus_tag LOCUS_14690 1530 406 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence322 453 2372 gene locus_tag LOCUS_14700 453 2372 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence323 1875 877 gene locus_tag LOCUS_14710 gene lpxD 1875 877 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZZ4 protein_id gnl|my_center|LOCUS_14710 <2524 2000 gene locus_tag LOCUS_14720 <2524 2000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY00:peptide chain release factor 2 >Feature sequence324 >Feature sequence325 <2508 1145 gene locus_tag LOCUS_14730 <2508 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1P4:kynurenine 3-monooxygenase >Feature sequence326 567 190 gene locus_tag LOCUS_14740 567 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_14740 <2506 788 gene locus_tag LOCUS_14750 <2506 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0Y3:alanine--tRNA ligase >Feature sequence327 283 1275 gene locus_tag LOCUS_14760 283 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence328 2311 614 gene locus_tag LOCUS_14770 gene gldJ 2311 614 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence329 129 644 gene locus_tag LOCUS_14780 gene aroK 129 644 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 protein_id gnl|my_center|LOCUS_14780 1130 636 gene locus_tag LOCUS_14790 gene pyrR2 1130 636 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_14790 1705 1139 gene locus_tag LOCUS_14800 gene tpm 1705 1139 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_14800 2104 1706 gene locus_tag LOCUS_14810 2104 1706 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence330 >Feature sequence331 <2470 788 gene locus_tag LOCUS_14820 <2470 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2H2:glutamine--tRNA ligase >Feature sequence332 646 960 gene locus_tag LOCUS_14830 646 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 950 1294 gene locus_tag LOCUS_14840 950 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 <2469 1304 gene locus_tag LOCUS_14850 <2469 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000759455.1:amidase >Feature sequence333 <2462 1744 gene locus_tag LOCUS_14860 <2462 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963740.1:2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase >Feature sequence334 1328 654 gene locus_tag LOCUS_14870 gene birA 1328 654 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_14870 1469 1840 gene locus_tag LOCUS_14880 gene rsfS 1469 1840 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_14880 >Feature sequence335 >Feature sequence336 942 508 gene locus_tag LOCUS_14890 942 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_14890 1632 1045 gene locus_tag LOCUS_14900 gene def 1632 1045 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_14900 2189 1698 gene locus_tag LOCUS_14910 2189 1698 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_14910 >Feature sequence337 484 816 gene locus_tag LOCUS_14920 484 816 CDS product Sec-independent protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964182.1 protein_id gnl|my_center|LOCUS_14920 822 1385 gene locus_tag LOCUS_14930 822 1385 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_14930 1972 1382 gene locus_tag LOCUS_14940 1972 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence338 95 1966 gene locus_tag LOCUS_14950 95 1966 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963720.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence339 <1 2094 gene locus_tag LOCUS_14960 <1 2094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106277.1:prolyl endopeptidase >Feature sequence340 126 851 gene locus_tag LOCUS_14970 126 851 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_14970 1548 856 gene locus_tag LOCUS_14980 gene porT 1548 856 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_14980 2281 1550 gene locus_tag LOCUS_14990 gene menG 2281 1550 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_14990 >Feature sequence341 <1 567 gene locus_tag LOCUS_15000 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789686.1:aminopeptidase 569 1015 gene locus_tag LOCUS_15010 569 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1005 2186 gene locus_tag LOCUS_15020 1005 2186 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962646.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence342 <1 744 gene locus_tag LOCUS_15030 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963365.1:ATP-dependent DNA helicase RecQ 1086 841 gene locus_tag LOCUS_15040 1086 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 protein_id gnl|my_center|LOCUS_15040 1146 2192 gene locus_tag LOCUS_15050 1146 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184801.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence343 1113 22 gene locus_tag LOCUS_15060 gene atpB 1113 22 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_15060 1665 1285 gene locus_tag LOCUS_15070 1665 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1886 1665 gene locus_tag LOCUS_15080 1886 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2365 2012 gene locus_tag LOCUS_15090 2365 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence344 <1 511 gene locus_tag LOCUS_15100 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964091.1:acyl-CoA thioesterase 564 1688 gene locus_tag LOCUS_15110 564 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence345 670 1365 gene locus_tag LOCUS_15120 gene lipB 670 1365 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_15120 2021 1362 gene locus_tag LOCUS_15130 gene rnhB 2021 1362 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW0 protein_id gnl|my_center|LOCUS_15130 >Feature sequence346 589 212 gene locus_tag LOCUS_15140 589 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 876 661 gene locus_tag LOCUS_15150 876 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1404 886 gene locus_tag LOCUS_15160 1404 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 2316 1588 gene locus_tag LOCUS_15170 2316 1588 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962769.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence347 1837 1076 gene locus_tag LOCUS_15180 1837 1076 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence348 1166 711 gene locus_tag LOCUS_15190 gene coaD 1166 711 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_15190 1777 1169 gene locus_tag LOCUS_15200 1777 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 2362 1799 gene locus_tag LOCUS_15210 2362 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence349 335 9 gene locus_tag LOCUS_15220 335 9 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 protein_id gnl|my_center|LOCUS_15220 668 1777 gene locus_tag LOCUS_15230 668 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence350 1 222 gene locus_tag LOCUS_15240 1 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 234 452 gene locus_tag LOCUS_15250 234 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962825.1 protein_id gnl|my_center|LOCUS_15250 <2328 508 gene locus_tag LOCUS_15260 <2328 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203174.1:dipeptidyl carboxypeptidase II >Feature sequence351 1575 442 gene locus_tag LOCUS_15270 1575 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence352 1 861 gene locus_tag LOCUS_15280 1 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_15280 950 1522 gene locus_tag LOCUS_15290 gene gmk 950 1522 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_15290 1529 2110 gene locus_tag LOCUS_15300 gene nadD 1529 2110 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_15300 >Feature sequence353 445 2262 gene locus_tag LOCUS_15310 gene uvrC 445 2262 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_15310 >Feature sequence354 369 599 gene locus_tag LOCUS_15320 369 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_15320 1784 648 gene locus_tag LOCUS_15330 gene argK 1784 648 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962733.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence355 989 273 gene locus_tag LOCUS_15340 989 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence356 861 85 gene locus_tag LOCUS_15350 861 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1994 897 gene locus_tag LOCUS_15360 1994 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence357 <1 927 gene locus_tag LOCUS_15370 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963917.1:RND transporter >Feature sequence358 <1 579 gene locus_tag LOCUS_15380 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963835.1:acetyl-CoA acetyltransferase >Feature sequence359 940 440 gene locus_tag LOCUS_15390 940 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_15390 1363 1022 gene locus_tag LOCUS_15400 1363 1022 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_15400 1801 1388 gene locus_tag LOCUS_15410 1801 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_15410 2270 1851 gene locus_tag LOCUS_15420 gene sufE 2270 1851 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence360 452 1339 gene locus_tag LOCUS_15430 gene ilvE 452 1339 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962619.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence361 <1 521 gene locus_tag LOCUS_15440 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962893.1:tRNA (uracil-5-)-methyltransferase 672 1175 gene locus_tag LOCUS_15450 672 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 protein_id gnl|my_center|LOCUS_15450 1147 1866 gene locus_tag LOCUS_15460 1147 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence362 493 696 gene locus_tag LOCUS_15470 493 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 709 1818 gene locus_tag LOCUS_15480 709 1818 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence363 <1 1011 gene locus_tag LOCUS_15490 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962867.1:cysteine desulfurase 1550 1161 gene locus_tag LOCUS_15500 1550 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 protein_id gnl|my_center|LOCUS_15500 <2254 1652 gene locus_tag LOCUS_15510 <2254 1652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXE4:orotate phosphoribosyltransferase >Feature sequence364 1442 786 gene locus_tag LOCUS_15520 1442 786 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_15520 2025 1435 gene locus_tag LOCUS_15530 2025 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence365 1027 641 gene locus_tag LOCUS_15540 1027 641 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_15540 1147 2151 gene locus_tag LOCUS_15550 gene holA 1147 2151 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence366 >Feature sequence367 >Feature sequence368 1166 1933 gene locus_tag LOCUS_15560 1166 1933 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence369 1497 316 gene locus_tag LOCUS_15570 1497 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963930.1 protein_id gnl|my_center|LOCUS_15570 <2206 1700 gene locus_tag LOCUS_15580 <2206 1700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962840.1:fumarylacetoacetase >Feature sequence370 >Feature sequence371 316 549 gene locus_tag LOCUS_15590 316 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962889.1 protein_id gnl|my_center|LOCUS_15590 1063 611 gene locus_tag LOCUS_15600 1063 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 <2194 1085 gene locus_tag LOCUS_15610 <2194 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263137.1:choloylglycine hydrolase >Feature sequence372 >Feature sequence373 728 174 gene locus_tag LOCUS_15620 gene ruvC 728 174 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_15620 712 1689 gene locus_tag LOCUS_15630 712 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962386.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence374 1509 700 gene locus_tag LOCUS_15640 1509 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence375 632 399 gene locus_tag LOCUS_15650 632 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1096 632 gene locus_tag LOCUS_15660 1096 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1923 1105 gene locus_tag LOCUS_15670 gene murQ 1923 1105 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_15670 >Feature sequence376 <1 1467 gene locus_tag LOCUS_15680 <1 1467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVV6:glutamine--fructose-6-phosphate aminotransferase [isomerizing] >Feature sequence377 1021 8 gene locus_tag LOCUS_15690 1021 8 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_15690 2107 1064 gene locus_tag LOCUS_15700 2107 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence378 >Feature sequence379 <1 1420 gene locus_tag LOCUS_15710 <1 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962589.1:transporter >Feature sequence380 494 1258 gene locus_tag LOCUS_15720 494 1258 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence381 313 1431 gene locus_tag LOCUS_15730 gene yghO 313 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_15730 <2077 1486 gene locus_tag LOCUS_15740 <2077 1486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963911.1:8-amino-7-oxononanoate synthase >Feature sequence382 <1 603 gene locus_tag LOCUS_15750 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVL9:UPF0176 protein 603 1844 gene locus_tag LOCUS_15760 603 1844 CDS product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993821.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence383 <1 603 gene locus_tag LOCUS_15770 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVL9:UPF0176 protein 603 1844 gene locus_tag LOCUS_15780 603 1844 CDS product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993821.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence384 115 408 gene locus_tag LOCUS_15790 gene hupA 115 408 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence385 1524 988 gene locus_tag LOCUS_15800 1524 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence386 >Feature sequence387 880 221 gene locus_tag LOCUS_15810 880 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_15810 1427 954 gene locus_tag LOCUS_15820 1427 954 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404423.1 protein_id gnl|my_center|LOCUS_15820 <2050 1449 gene locus_tag LOCUS_15830 <2050 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761057.1:biopolymer transporter ExbD >Feature sequence388 1666 428 gene locus_tag LOCUS_15840 1666 428 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence389 745 332 gene locus_tag LOCUS_15850 745 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 903 1574 gene locus_tag LOCUS_15860 gene folE2 903 1574 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_15860 >Feature sequence390 <1 828 gene locus_tag LOCUS_15870 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_599653.1:ABC-type transport system permease 821 1312 gene locus_tag LOCUS_15880 821 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence391 752 105 gene locus_tag LOCUS_15890 gene sirR 752 105 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence392 <1 543 gene locus_tag LOCUS_15900 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H133:pseudouridine synthase 1025 600 gene locus_tag LOCUS_15910 1025 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15910 1360 1007 gene locus_tag LOCUS_15920 1360 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 <2031 1429 gene locus_tag LOCUS_15930 <2031 1429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964096.1:ABC transporter ATP-binding protein >Feature sequence393 79 1227 gene locus_tag LOCUS_15940 gene fjo29 79 1227 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence394 985 5 gene locus_tag LOCUS_15950 985 5 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_15950 <2022 996 gene locus_tag LOCUS_15960 <2022 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962200.1:lytic transglycosylase >Feature sequence395 >Feature sequence396 1370 231 gene locus_tag LOCUS_15970 gene hisB 1370 231 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 protein_id gnl|my_center|LOCUS_15970 <2003 1342 gene locus_tag LOCUS_15980 <2003 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY79:histidinol-phosphate aminotransferase >Feature sequence397 634 1158 gene locus_tag LOCUS_15990 634 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_15990 <2000 1199 gene locus_tag LOCUS_16000 <2000 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963153.1:aminopeptidase >Feature sequence398 1796 33 gene locus_tag LOCUS_16010 1796 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence399 381 190 gene locus_tag LOCUS_16020 381 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964519.1 protein_id gnl|my_center|LOCUS_16020 989 429 gene locus_tag LOCUS_16030 989 429 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence400 134 922 gene locus_tag LOCUS_16040 134 922 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_16040 922 1656 gene locus_tag LOCUS_16050 922 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence401 >Feature sequence402 <1985 1453 gene locus_tag LOCUS_16060 <1985 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035280.1:peptidase M23 >Feature sequence403 602 117 gene locus_tag LOCUS_16070 602 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1829 615 gene locus_tag LOCUS_16080 gene sufS 1829 615 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_16080 >Feature sequence404 144 845 gene locus_tag LOCUS_16090 144 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963278.1 protein_id gnl|my_center|LOCUS_16090 1579 842 gene locus_tag LOCUS_16100 1579 842 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109281.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence405 >Feature sequence406 426 283 gene locus_tag LOCUS_16110 426 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 599 525 gene locus_tag LOCUS_t00210 599 525 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 710 636 gene locus_tag LOCUS_t00220 710 636 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 <1967 784 gene locus_tag LOCUS_16120 <1967 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVS7:zinc metalloprotease >Feature sequence407 1848 661 gene locus_tag LOCUS_16130 gene pgk 1848 661 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_16130 >Feature sequence408 >Feature sequence409 700 257 gene locus_tag LOCUS_16140 700 257 CDS product exosortase F system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964135.1 protein_id gnl|my_center|LOCUS_16140 1166 681 gene locus_tag LOCUS_16150 1166 681 CDS product exosortase family protein XrtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964136.1 protein_id gnl|my_center|LOCUS_16150 1306 1764 gene locus_tag LOCUS_16160 1306 1764 CDS product GAF domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence410 1779 1288 gene locus_tag LOCUS_16170 gene sixA 1779 1288 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence411 1885 659 gene locus_tag LOCUS_16180 gene dbpA 1885 659 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence412 >Feature sequence413 1599 1342 gene locus_tag LOCUS_16190 1599 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence414 1262 657 gene locus_tag LOCUS_16200 gene sodA 1262 657 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_16200 >Feature sequence415 1240 299 gene locus_tag LOCUS_16210 1240 299 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_16210 1772 1245 gene locus_tag LOCUS_16220 1772 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963274.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence416 1787 792 gene locus_tag LOCUS_16230 1787 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence417 <1 1047 gene locus_tag LOCUS_16240 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXH5:phosphoribosylformylglycinamidine synthase >Feature sequence418 >Feature sequence419 1246 362 gene locus_tag LOCUS_16250 1246 362 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ30 protein_id gnl|my_center|LOCUS_16250 >Feature sequence420 >Feature sequence421 <1 501 gene locus_tag LOCUS_16260 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZQ1:3-oxoacyl-[acyl-carrier-protein] synthase 3 >Feature sequence422 >Feature sequence423 317 3 gene locus_tag LOCUS_16270 317 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1181 357 gene locus_tag LOCUS_16280 1181 357 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963219.1 protein_id gnl|my_center|LOCUS_16280 <1845 1188 gene locus_tag LOCUS_16290 <1845 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H228:monofunctional biosynthetic peptidoglycan transglycosylase >Feature sequence424 >Feature sequence425 649 164 gene locus_tag LOCUS_16300 gene dfrA 649 164 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_16300 1413 652 gene locus_tag LOCUS_16310 1413 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence426 <1836 739 gene locus_tag LOCUS_16320 <1836 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYX9:GTP cyclohydrolase 1 type 2 >Feature sequence427 <1836 613 gene locus_tag LOCUS_16330 <1836 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963253.1:membrane protein >Feature sequence428 886 1362 gene locus_tag LOCUS_16340 gene yjgM 886 1362 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence429 <1 540 gene locus_tag LOCUS_16350 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963232.1:membrane protein 537 1796 gene locus_tag LOCUS_16360 gene pyrC2 537 1796 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence430 402 968 gene locus_tag LOCUS_16370 gene efp 402 968 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_16370 >Feature sequence431 326 1609 gene locus_tag LOCUS_16380 gene eptA 326 1609 CDS product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O24867 protein_id gnl|my_center|LOCUS_16380 >Feature sequence432 1509 244 gene locus_tag LOCUS_16390 1509 244 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_16390 1707 1516 gene locus_tag LOCUS_16400 1707 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964519.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence433 849 499 gene locus_tag LOCUS_16410 gene panD 849 499 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 protein_id gnl|my_center|LOCUS_16410 1711 863 gene locus_tag LOCUS_16420 gene panC 1711 863 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 protein_id gnl|my_center|LOCUS_16420 >Feature sequence434 1433 690 gene locus_tag LOCUS_16430 1433 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence435 70 327 gene locus_tag LOCUS_16440 70 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963989.1 protein_id gnl|my_center|LOCUS_16440 332 826 gene locus_tag LOCUS_16450 332 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 861 1172 gene locus_tag LOCUS_16460 861 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 <1792 1175 gene locus_tag LOCUS_16470 <1792 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H233:leucyl/phenylalanyl-tRNA--protein transferase >Feature sequence436 <1786 1004 gene locus_tag LOCUS_16480 <1786 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZL9:lipoyl synthase >Feature sequence437 64 672 gene locus_tag LOCUS_16490 64 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 679 1290 gene locus_tag LOCUS_16500 679 1290 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence438 <1 788 gene locus_tag LOCUS_16510 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962233.1:1-acyl-sn-glycerol-3-phosphate acyltransferase >Feature sequence439 1666 1484 gene locus_tag LOCUS_16520 1666 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963197.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence440 846 160 gene locus_tag LOCUS_16530 846 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence441 1333 716 gene locus_tag LOCUS_16540 1333 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence442 >Feature sequence443 >Feature sequence444 <1 635 gene locus_tag LOCUS_16550 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962211.1:succinyl-CoA--3-ketoacid-CoA transferase >Feature sequence445 138 629 gene locus_tag LOCUS_16560 gene recX 138 629 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence446 >Feature sequence447 74 1147 gene locus_tag LOCUS_16570 74 1147 CDS product amino-acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582642.1 protein_id gnl|my_center|LOCUS_16570 <1735 1175 gene locus_tag LOCUS_16580 <1735 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963739.1:thiol:disulfide interchange protein DsbD >Feature sequence448 >Feature sequence449 >Feature sequence450 33 1292 gene locus_tag LOCUS_16590 33 1292 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963811.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence451 <1 1596 gene locus_tag LOCUS_16600 <1 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0U1:CTP synthase >Feature sequence452 <1 718 gene locus_tag LOCUS_16610 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121963.1:dipeptide epimerase 756 1559 gene locus_tag LOCUS_16620 756 1559 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence453 1430 336 gene locus_tag LOCUS_16630 1430 336 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence454 <1681 480 gene locus_tag LOCUS_16640 <1681 480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963280.1:TonB-dependent receptor >Feature sequence455 >Feature sequence456 266 793 gene locus_tag LOCUS_16650 266 793 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_16650 <1671 1038 gene locus_tag LOCUS_16660 <1671 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962567.1:2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase >Feature sequence457 362 72 gene locus_tag LOCUS_16670 362 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962900.1 protein_id gnl|my_center|LOCUS_16670 483 668 gene locus_tag LOCUS_16680 483 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 652 1212 gene locus_tag LOCUS_16690 652 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence458 >Feature sequence459 <1 759 gene locus_tag LOCUS_16700 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962776.1:thioredoxin-disulfide reductase 1182 808 gene locus_tag LOCUS_16710 1182 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence460 1534 1190 gene locus_tag LOCUS_16720 1534 1190 CDS product phosphotransfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361989.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence461 25 1413 gene locus_tag LOCUS_16730 25 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence462 <1647 433 gene locus_tag LOCUS_16740 <1647 433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963523.1:transporter >Feature sequence463 518 1504 gene locus_tag LOCUS_16750 518 1504 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964556.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence464 557 1126 gene locus_tag LOCUS_16760 gene gmk 557 1126 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_16760 >Feature sequence465 407 1123 gene locus_tag LOCUS_16770 407 1123 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence466 <1602 772 gene locus_tag LOCUS_16780 <1602 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX80:cysteine--tRNA ligase >Feature sequence467 1141 962 gene locus_tag LOCUS_16790 1141 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1469 1152 gene locus_tag LOCUS_16800 1469 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence468 >Feature sequence469 606 1535 gene locus_tag LOCUS_16810 606 1535 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence470 >Feature sequence471 1 978 gene locus_tag LOCUS_16820 1 978 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_16820 978 1310 gene locus_tag LOCUS_16830 978 1310 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence472 832 281 gene locus_tag LOCUS_16840 gene rmlC 832 281 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_16840 <1583 834 gene locus_tag LOCUS_16850 <1583 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3MEU4:glucose-1-phosphate thymidylyltransferase >Feature sequence473 >Feature sequence474 <1 946 gene locus_tag LOCUS_16860 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963714.1:abortive infection protein >Feature sequence475 <1559 678 gene locus_tag LOCUS_16870 <1559 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964536.1:nucleotidyltransferase >Feature sequence476 >Feature sequence477 125 571 gene locus_tag LOCUS_16880 125 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 679 1554 gene locus_tag LOCUS_16890 gene lipA 679 1554 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_16890 >Feature sequence478 >Feature sequence479 1071 1505 gene locus_tag LOCUS_16900 1071 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence480 101 24 gene locus_tag LOCUS_t00230 101 24 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1397 183 gene locus_tag LOCUS_16910 gene folC 1397 183 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence481 >Feature sequence482 620 81 gene locus_tag LOCUS_16920 620 81 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_16920 <1532 702 gene locus_tag LOCUS_16930 <1532 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H263:4-hydroxythreonine-4-phosphate dehydrogenase >Feature sequence483 851 24 gene locus_tag LOCUS_16940 851 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence484 >Feature sequence485 <1 858 gene locus_tag LOCUS_16950 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H294:GTPase HflX <1522 908 gene locus_tag LOCUS_16960 <1522 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362027.1:protein of unknown function precursor >Feature sequence486 >Feature sequence487 539 99 gene locus_tag LOCUS_16970 gene tadA 539 99 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_16970 599 1477 gene locus_tag LOCUS_16980 599 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence488 >Feature sequence489 430 194 gene locus_tag LOCUS_16990 gene acpP 430 194 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_16990 596 1168 gene locus_tag LOCUS_17000 gene purN 596 1168 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence490 <1 642 gene locus_tag LOCUS_17010 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964481.1:ABC transporter ATP-binding protein >Feature sequence491 386 916 gene locus_tag LOCUS_17020 386 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence492 1403 870 gene locus_tag LOCUS_17030 gene atpH 1403 870 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_17030 >Feature sequence493 359 9 gene locus_tag LOCUS_17040 359 9 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_17040 1360 380 gene locus_tag LOCUS_17050 1360 380 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence494 487 1323 gene locus_tag LOCUS_17060 487 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060