>Feature sequence001 2406 1060 gene locus_tag LOCUS_00010 gene suc1 2406 1060 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_00010 3747 2419 gene locus_tag LOCUS_00020 3747 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 6970 3740 gene locus_tag LOCUS_00030 6970 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 10203 6970 gene locus_tag LOCUS_00040 10203 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 10828 10253 gene locus_tag LOCUS_00050 10828 10253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 13982 10815 gene locus_tag LOCUS_00060 13982 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 15757 14135 gene locus_tag LOCUS_00070 15757 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_00070 18671 15777 gene locus_tag LOCUS_00080 18671 15777 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_00080 18913 19938 gene locus_tag LOCUS_00090 gene ccpA 18913 19938 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356351.1 protein_id gnl|my_center|LOCUS_00090 20949 19930 gene locus_tag LOCUS_00100 gene ruvB 20949 19930 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_00100 22799 21009 gene locus_tag LOCUS_00110 gene ctaD 22799 21009 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_00110 23819 22812 gene locus_tag LOCUS_00120 gene ctaC 23819 22812 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_00120 <25275 23894 gene locus_tag LOCUS_00130 <25275 23894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962548.1:quinol:cytochrome C oxidoreductase >Feature sequence002 <1 801 gene locus_tag LOCUS_00140 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265899.1:aminoacyl-histidine dipeptidase 1328 804 gene locus_tag LOCUS_00150 1328 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 1928 1395 gene locus_tag LOCUS_00160 1928 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 3543 2026 gene locus_tag LOCUS_00170 3543 2026 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028586.1 protein_id gnl|my_center|LOCUS_00170 4309 3611 gene locus_tag LOCUS_00180 4309 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 6030 4312 gene locus_tag LOCUS_00190 6030 4312 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_00190 7959 6052 gene locus_tag LOCUS_00200 7959 6052 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RM0 protein_id gnl|my_center|LOCUS_00200 10365 8296 gene locus_tag LOCUS_00210 gene yyaL 10365 8296 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_00210 13710 10420 gene locus_tag LOCUS_00220 13710 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 15350 13878 gene locus_tag LOCUS_00230 15350 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_00230 18455 15357 gene locus_tag LOCUS_00240 18455 15357 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_00240 20708 18594 gene locus_tag LOCUS_00250 20708 18594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 22079 20787 gene locus_tag LOCUS_00260 22079 20787 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921026.1 protein_id gnl|my_center|LOCUS_00260 22835 22092 gene locus_tag LOCUS_00270 22835 22092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 23598 22861 gene locus_tag LOCUS_00280 23598 22861 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_00280 24606 23767 gene locus_tag LOCUS_00290 24606 23767 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084226.1 protein_id gnl|my_center|LOCUS_00290 >Feature sequence003 561 292 gene locus_tag LOCUS_00300 gene rpsO 561 292 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H184 protein_id gnl|my_center|LOCUS_00300 1507 650 gene locus_tag LOCUS_00310 gene accD 1507 650 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_00310 2590 1520 gene locus_tag LOCUS_00320 gene fbaA 2590 1520 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_00320 5164 2624 gene locus_tag LOCUS_00330 5164 2624 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_00330 5201 5926 gene locus_tag LOCUS_00340 5201 5926 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_00340 6739 5927 gene locus_tag LOCUS_00350 gene porT 6739 5927 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_00350 6864 8213 gene locus_tag LOCUS_00360 6864 8213 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_00360 8213 9712 gene locus_tag LOCUS_00370 8213 9712 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_00370 10995 9709 gene locus_tag LOCUS_00380 10995 9709 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_00380 11735 10992 gene locus_tag LOCUS_00390 11735 10992 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_00390 12653 11823 gene locus_tag LOCUS_00400 12653 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 14180 12663 gene locus_tag LOCUS_00410 14180 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 17498 14277 gene locus_tag LOCUS_00420 17498 14277 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 protein_id gnl|my_center|LOCUS_00420 18325 17705 gene locus_tag LOCUS_00430 18325 17705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 18807 19181 gene locus_tag LOCUS_00440 gene rpsL 18807 19181 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 protein_id gnl|my_center|LOCUS_00440 19203 19682 gene locus_tag LOCUS_00450 gene rpsG 19203 19682 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_00450 >Feature sequence004 978 121 gene locus_tag LOCUS_00460 978 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 1072 1656 gene locus_tag LOCUS_00470 1072 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 2471 1653 gene locus_tag LOCUS_00480 2471 1653 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211372.1 protein_id gnl|my_center|LOCUS_00480 2614 4101 gene locus_tag LOCUS_00490 gene glpK 2614 4101 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2I6 protein_id gnl|my_center|LOCUS_00490 4102 5658 gene locus_tag LOCUS_00500 gene glpA 4102 5658 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_00500 5655 6398 gene locus_tag LOCUS_00510 gene glpF 5655 6398 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_00510 6887 6591 gene locus_tag LOCUS_00520 6887 6591 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 protein_id gnl|my_center|LOCUS_00520 7195 6893 gene locus_tag LOCUS_00530 7195 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 7274 8935 gene locus_tag LOCUS_00540 7274 8935 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_00540 10078 8942 gene locus_tag LOCUS_00550 10078 8942 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_00550 11406 10105 gene locus_tag LOCUS_00560 gene rocD 11406 10105 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_00560 11603 13012 gene locus_tag LOCUS_00570 gene trmA 11603 13012 CDS product tRNA (uracil-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_00570 13009 13518 gene locus_tag LOCUS_00580 13009 13518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 protein_id gnl|my_center|LOCUS_00580 13484 14209 gene locus_tag LOCUS_00590 13484 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_00590 15377 14202 gene locus_tag LOCUS_00600 15377 14202 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_00600 15433 16098 gene locus_tag LOCUS_00610 15433 16098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_00610 16466 16885 gene locus_tag LOCUS_00620 16466 16885 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254076.1 protein_id gnl|my_center|LOCUS_00620 18568 16982 gene locus_tag LOCUS_00630 18568 16982 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 protein_id gnl|my_center|LOCUS_00630 19256 18579 gene locus_tag LOCUS_00640 19256 18579 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998217.1 protein_id gnl|my_center|LOCUS_00640 20146 19439 gene locus_tag LOCUS_00650 20146 19439 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203675.1 protein_id gnl|my_center|LOCUS_00650 20756 21015 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tagaagtatcccagtttccaatgtcttgattaaat >Feature sequence005 2109 1204 gene locus_tag LOCUS_00660 gene hemF 2109 1204 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_00660 3137 2106 gene locus_tag LOCUS_00670 gene hemE 3137 2106 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 protein_id gnl|my_center|LOCUS_00670 3791 3138 gene locus_tag LOCUS_00680 gene hemD 3791 3138 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962223.1 protein_id gnl|my_center|LOCUS_00680 4705 3791 gene locus_tag LOCUS_00690 gene hemC 4705 3791 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP0 protein_id gnl|my_center|LOCUS_00690 5882 4692 gene locus_tag LOCUS_00700 gene hemA 5882 4692 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 protein_id gnl|my_center|LOCUS_00700 6073 6954 gene locus_tag LOCUS_00710 6073 6954 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_00710 6964 7995 gene locus_tag LOCUS_00720 gene hemH 6964 7995 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_00720 7997 9337 gene locus_tag LOCUS_00730 7997 9337 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_00730 9406 12537 gene locus_tag LOCUS_00740 9406 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 12542 13096 gene locus_tag LOCUS_00750 12542 13096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_00750 13083 14552 gene locus_tag LOCUS_00760 13083 14552 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_00760 14963 14553 gene locus_tag LOCUS_00770 gene yqiW 14963 14553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_00770 15033 15755 gene locus_tag LOCUS_00780 15033 15755 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656803.1 protein_id gnl|my_center|LOCUS_00780 15759 16337 gene locus_tag LOCUS_00790 15759 16337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_00790 16371 16790 gene locus_tag LOCUS_00800 16371 16790 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_00800 16987 16793 gene locus_tag LOCUS_00810 16987 16793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 17567 16992 gene locus_tag LOCUS_00820 17567 16992 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_00820 17652 18233 gene locus_tag LOCUS_00830 17652 18233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_00830 >Feature sequence006 388 1026 gene locus_tag LOCUS_00840 388 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 1065 2069 gene locus_tag LOCUS_00850 1065 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 2206 3165 gene locus_tag LOCUS_00860 2206 3165 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_00860 3617 3162 gene locus_tag LOCUS_00870 3617 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 3674 4804 gene locus_tag LOCUS_00880 gene glxK 3674 4804 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209537.1 protein_id gnl|my_center|LOCUS_00880 4807 6108 gene locus_tag LOCUS_00890 4807 6108 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086363.1 protein_id gnl|my_center|LOCUS_00890 7934 6111 gene locus_tag LOCUS_00900 7934 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 8555 7947 gene locus_tag LOCUS_00910 8555 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 8853 9692 gene locus_tag LOCUS_00920 gene panC 8853 9692 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 protein_id gnl|my_center|LOCUS_00920 9682 10656 gene locus_tag LOCUS_00930 9682 10656 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_00930 10653 12008 gene locus_tag LOCUS_00940 gene radA 10653 12008 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_00940 12069 13409 gene locus_tag LOCUS_00950 gene gdhA 12069 13409 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_00950 13419 14138 gene locus_tag LOCUS_00960 gene recO 13419 14138 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 protein_id gnl|my_center|LOCUS_00960 14122 16596 gene locus_tag LOCUS_00970 14122 16596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_00970 >Feature sequence007 1342 131 gene locus_tag LOCUS_00980 1342 131 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706362.1 protein_id gnl|my_center|LOCUS_00980 1869 1414 gene locus_tag LOCUS_00990 1869 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 2532 2089 gene locus_tag LOCUS_01000 2532 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 3100 2600 gene locus_tag LOCUS_01010 3100 2600 CDS product UPF0316 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8F1 protein_id gnl|my_center|LOCUS_01010 6235 3107 gene locus_tag LOCUS_01020 6235 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 6306 6977 gene locus_tag LOCUS_01030 6306 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 8239 7304 gene locus_tag LOCUS_01040 8239 7304 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_01040 10670 8256 gene locus_tag LOCUS_01050 10670 8256 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_01050 11691 11038 gene locus_tag LOCUS_01060 11691 11038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 12246 11740 gene locus_tag LOCUS_01070 12246 11740 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963696.1 protein_id gnl|my_center|LOCUS_01070 12283 12708 gene locus_tag LOCUS_01080 12283 12708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 12740 13537 gene locus_tag LOCUS_01090 gene dltE 12740 13537 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_01090 14134 13544 gene locus_tag LOCUS_01100 14134 13544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 15010 14189 gene locus_tag LOCUS_01110 15010 14189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 <18408 15132 gene locus_tag LOCUS_01120 <18408 15132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011183344.1:lipoprotein >Feature sequence008 490 1101 gene locus_tag LOCUS_01130 gene pth 490 1101 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_01130 1805 1098 gene locus_tag LOCUS_01140 1805 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 5665 1802 gene locus_tag LOCUS_01150 5665 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 5744 6673 gene locus_tag LOCUS_01160 gene ribF 5744 6673 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_01160 6708 7982 gene locus_tag LOCUS_01170 gene serS 6708 7982 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_01170 7979 8290 gene locus_tag LOCUS_01180 7979 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 8287 9069 gene locus_tag LOCUS_01190 gene rsmA 8287 9069 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_01190 9041 10405 gene locus_tag LOCUS_01200 gene mgtE 9041 10405 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_01200 10407 11339 gene locus_tag LOCUS_01210 10407 11339 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_01210 12579 11326 gene locus_tag LOCUS_01220 gene lysC 12579 11326 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_01220 13067 12576 gene locus_tag LOCUS_01230 13067 12576 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_01230 13909 13136 gene locus_tag LOCUS_01240 13909 13136 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_01240 14667 13906 gene locus_tag LOCUS_01250 gene pdxJ 14667 13906 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 protein_id gnl|my_center|LOCUS_01250 14752 15618 gene locus_tag LOCUS_01260 gene nadK 14752 15618 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_01260 15732 16364 gene locus_tag LOCUS_01270 15732 16364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_01270 >Feature sequence009 2000 63 gene locus_tag LOCUS_01280 2000 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 2359 2015 gene locus_tag LOCUS_01290 2359 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 2777 2349 gene locus_tag LOCUS_01300 2777 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 2943 3341 gene locus_tag LOCUS_01310 gene rbfA 2943 3341 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 protein_id gnl|my_center|LOCUS_01310 3344 4537 gene locus_tag LOCUS_01320 3344 4537 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_01320 5477 4539 gene locus_tag LOCUS_01330 5477 4539 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_01330 5679 7475 gene locus_tag LOCUS_01340 gene lepA 5679 7475 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_01340 9403 7484 gene locus_tag LOCUS_01350 9403 7484 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259450.1 protein_id gnl|my_center|LOCUS_01350 9540 10391 gene locus_tag LOCUS_01360 9540 10391 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_01360 10434 12281 gene locus_tag LOCUS_01370 10434 12281 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_01370 12271 12621 gene locus_tag LOCUS_01380 12271 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 12937 12605 gene locus_tag LOCUS_01390 12937 12605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 13482 13054 gene locus_tag LOCUS_01400 gene rpiB 13482 13054 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_01400 13936 16152 gene locus_tag LOCUS_01410 gene rnr 13936 16152 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_01410 >Feature sequence010 <1 704 gene locus_tag LOCUS_01420 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963039.1:sulfatase 694 1572 gene locus_tag LOCUS_01430 694 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107505.1 protein_id gnl|my_center|LOCUS_01430 1649 2761 gene locus_tag LOCUS_01440 1649 2761 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_01440 2832 3572 gene locus_tag LOCUS_01450 2832 3572 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_01450 3576 4793 gene locus_tag LOCUS_01460 3576 4793 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_01460 4795 6015 gene locus_tag LOCUS_01470 4795 6015 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_01470 6026 6712 gene locus_tag LOCUS_01480 6026 6712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_01480 6753 7895 gene locus_tag LOCUS_01490 6753 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_01490 7899 8186 gene locus_tag LOCUS_01500 7899 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 8291 8218 gene locus_tag LOCUS_t00010 8291 8218 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8394 9125 gene locus_tag LOCUS_01510 gene coaX 8394 9125 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B4 protein_id gnl|my_center|LOCUS_01510 9122 10375 gene locus_tag LOCUS_01520 9122 10375 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_01520 10388 11773 gene locus_tag LOCUS_01530 10388 11773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 11737 12333 gene locus_tag LOCUS_01540 11737 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 12548 13822 gene locus_tag LOCUS_01550 12548 13822 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_01550 >Feature sequence011 217 801 gene locus_tag LOCUS_01560 217 801 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986299.1 protein_id gnl|my_center|LOCUS_01560 3264 820 gene locus_tag LOCUS_01570 3264 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_01570 3547 4599 gene locus_tag LOCUS_01580 3547 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 4706 6184 gene locus_tag LOCUS_01590 4706 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 6188 7114 gene locus_tag LOCUS_01600 6188 7114 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448524.1 protein_id gnl|my_center|LOCUS_01600 8044 7109 gene locus_tag LOCUS_01610 gene thrB 8044 7109 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM4 protein_id gnl|my_center|LOCUS_01610 9501 8047 gene locus_tag LOCUS_01620 gene thrC2 9501 8047 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967249.1 protein_id gnl|my_center|LOCUS_01620 10460 9516 gene locus_tag LOCUS_01630 10460 9516 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967250.1 protein_id gnl|my_center|LOCUS_01630 10571 10981 gene locus_tag LOCUS_01640 10571 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 11072 12406 gene locus_tag LOCUS_01650 11072 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 12408 14015 gene locus_tag LOCUS_01660 12408 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 >Feature sequence012 2354 48 gene locus_tag LOCUS_01670 gene mrcA 2354 48 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_01670 2844 2344 gene locus_tag LOCUS_01680 gene gldH 2844 2344 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_01680 3938 2907 gene locus_tag LOCUS_01690 gene yceA 3938 2907 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL9 protein_id gnl|my_center|LOCUS_01690 5302 3977 gene locus_tag LOCUS_01700 5302 3977 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_01700 5397 6404 gene locus_tag LOCUS_01710 gene recA 5397 6404 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_01710 7033 6419 gene locus_tag LOCUS_01720 7033 6419 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_01720 7306 8274 gene locus_tag LOCUS_01730 gene trpS 7306 8274 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_01730 8325 9284 gene locus_tag LOCUS_01740 8325 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 protein_id gnl|my_center|LOCUS_01740 10514 9297 gene locus_tag LOCUS_01750 10514 9297 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_01750 11299 10514 gene locus_tag LOCUS_01760 11299 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 12300 11302 gene locus_tag LOCUS_01770 12300 11302 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_01770 12780 12346 gene locus_tag LOCUS_01780 gene dut 12780 12346 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_01780 13710 12847 gene locus_tag LOCUS_01790 gene atpG 13710 12847 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_01790 <14298 13720 gene locus_tag LOCUS_01800 <14298 13720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2D7:ATP synthase subunit alpha >Feature sequence013 369 145 gene locus_tag LOCUS_01810 369 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 1554 577 gene locus_tag LOCUS_01820 1554 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 1507 1428 gene locus_tag LOCUS_t00020 1507 1428 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 1789 2037 gene locus_tag LOCUS_01830 1789 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 2182 2571 gene locus_tag LOCUS_01840 2182 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_01840 2950 2591 gene locus_tag LOCUS_01850 2950 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_01850 3446 3015 gene locus_tag LOCUS_01860 3446 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 3543 4136 gene locus_tag LOCUS_01870 3543 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_01870 4329 4586 gene locus_tag LOCUS_01880 4329 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 6278 4671 gene locus_tag LOCUS_01890 6278 4671 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887610.1 protein_id gnl|my_center|LOCUS_01890 6485 6613 gene locus_tag LOCUS_01900 6485 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 6889 6698 gene locus_tag LOCUS_01910 6889 6698 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071803.1 protein_id gnl|my_center|LOCUS_01910 7677 7429 gene locus_tag LOCUS_01920 7677 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 8486 7806 gene locus_tag LOCUS_01930 8486 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 8585 9259 gene locus_tag LOCUS_01940 8585 9259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 9259 9519 gene locus_tag LOCUS_01950 9259 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 9532 9738 gene locus_tag LOCUS_01960 9532 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 10035 10322 gene locus_tag LOCUS_01970 10035 10322 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_01970 10977 10345 gene locus_tag LOCUS_01980 10977 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 11664 11134 gene locus_tag LOCUS_01990 11664 11134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546171.1 protein_id gnl|my_center|LOCUS_01990 11909 11661 gene locus_tag LOCUS_02000 11909 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 12578 11916 gene locus_tag LOCUS_02010 12578 11916 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_02010 12823 12587 gene locus_tag LOCUS_02020 12823 12587 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980242.1 protein_id gnl|my_center|LOCUS_02020 13443 12832 gene locus_tag LOCUS_02030 13443 12832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 >Feature sequence014 1 231 gene locus_tag LOCUS_02040 1 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 645 232 gene locus_tag LOCUS_02050 645 232 CDS product fructose 1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962635.1 protein_id gnl|my_center|LOCUS_02050 753 1682 gene locus_tag LOCUS_02060 753 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_02060 1666 2583 gene locus_tag LOCUS_02070 1666 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_02070 3370 2600 gene locus_tag LOCUS_02080 3370 2600 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_02080 3911 3414 gene locus_tag LOCUS_02090 3911 3414 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_02090 6232 3908 gene locus_tag LOCUS_02100 6232 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 7460 6237 gene locus_tag LOCUS_02110 gene mscS2 7460 6237 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_02110 8916 7480 gene locus_tag LOCUS_02120 8916 7480 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485353.1 protein_id gnl|my_center|LOCUS_02120 10196 9159 gene locus_tag LOCUS_02130 10196 9159 CDS product alkane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 protein_id gnl|my_center|LOCUS_02130 11497 10238 gene locus_tag LOCUS_02140 gene kynU 11497 10238 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK35 protein_id gnl|my_center|LOCUS_02140 11591 12136 gene locus_tag LOCUS_02150 11591 12136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 12133 13029 gene locus_tag LOCUS_02160 12133 13029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 >Feature sequence015 2542 143 gene locus_tag LOCUS_02170 2542 143 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_02170 3213 2656 gene locus_tag LOCUS_02180 3213 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 3621 3295 gene locus_tag LOCUS_02190 3621 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 3661 5076 gene locus_tag LOCUS_02200 3661 5076 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887004.1 protein_id gnl|my_center|LOCUS_02200 6539 5073 gene locus_tag LOCUS_02210 6539 5073 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_02210 6966 6544 gene locus_tag LOCUS_02220 6966 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143007.1 protein_id gnl|my_center|LOCUS_02220 7073 7738 gene locus_tag LOCUS_02230 7073 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 7829 8767 gene locus_tag LOCUS_02240 gene trxB1 7829 8767 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_02240 9171 8764 gene locus_tag LOCUS_02250 9171 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 10922 9156 gene locus_tag LOCUS_02260 10922 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 13095 11170 gene locus_tag LOCUS_02270 13095 11170 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_02270 <13813 13099 gene locus_tag LOCUS_02280 <13813 13099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964071.1:FAD-dependent oxidoreductase >Feature sequence016 132 1013 gene locus_tag LOCUS_02290 132 1013 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_02290 2387 999 gene locus_tag LOCUS_02300 2387 999 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_02300 2464 3048 gene locus_tag LOCUS_02310 2464 3048 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_02310 3053 4729 gene locus_tag LOCUS_02320 gene ggt 3053 4729 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_02320 4794 7625 gene locus_tag LOCUS_02330 gene uvrA2 4794 7625 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX6 protein_id gnl|my_center|LOCUS_02330 7630 10425 gene locus_tag LOCUS_02340 7630 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962879.1 protein_id gnl|my_center|LOCUS_02340 10467 12869 gene locus_tag LOCUS_02350 10467 12869 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_02350 <13807 12866 gene locus_tag LOCUS_02360 <13807 12866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963198.1:DNA polymerase III subunit delta >Feature sequence017 <1 2292 gene locus_tag LOCUS_02370 <1 2292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0Y3:alanine--tRNA ligase 2310 3203 gene locus_tag LOCUS_02380 gene acdS 2310 3203 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_02380 3236 3988 gene locus_tag LOCUS_02390 3236 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 3989 5275 gene locus_tag LOCUS_02400 gene hemL 3989 5275 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW4 protein_id gnl|my_center|LOCUS_02400 6963 5272 gene locus_tag LOCUS_02410 gene lysS 6963 5272 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 protein_id gnl|my_center|LOCUS_02410 7205 7915 gene locus_tag LOCUS_02420 gene lipB 7205 7915 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_02420 10335 7912 gene locus_tag LOCUS_02430 10335 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 10954 10355 gene locus_tag LOCUS_02440 gene rnhB 10954 10355 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN7 protein_id gnl|my_center|LOCUS_02440 11036 13192 gene locus_tag LOCUS_02450 11036 13192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_02450 >Feature sequence018 2440 977 gene locus_tag LOCUS_02460 gene murE 2440 977 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_02460 4335 2437 gene locus_tag LOCUS_02470 gene ftsI 4335 2437 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_02470 4712 4401 gene locus_tag LOCUS_02480 4712 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 5619 4705 gene locus_tag LOCUS_02490 gene rsmH 5619 4705 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 protein_id gnl|my_center|LOCUS_02490 6073 5609 gene locus_tag LOCUS_02500 gene mraZ 6073 5609 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_02500 6246 7013 gene locus_tag LOCUS_02510 gene pcbD 6246 7013 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_02510 7017 7613 gene locus_tag LOCUS_02520 gene engB 7017 7613 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 protein_id gnl|my_center|LOCUS_02520 7948 7616 gene locus_tag LOCUS_02530 gene gldC 7948 7616 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_02530 9060 7939 gene locus_tag LOCUS_02540 gene gldB 9060 7939 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_02540 8989 9780 gene locus_tag LOCUS_02550 gene nadE 8989 9780 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 protein_id gnl|my_center|LOCUS_02550 11733 9775 gene locus_tag LOCUS_02560 gene dnaG 11733 9775 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_02560 12752 11772 gene locus_tag LOCUS_02570 12752 11772 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_02570 <13582 12787 gene locus_tag LOCUS_02580 <13582 12787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1B8:putative dual-specificity RNA methyltransferase RlmN >Feature sequence019 1221 2360 gene locus_tag LOCUS_02590 1221 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 3827 2616 gene locus_tag LOCUS_02600 gene folC 3827 2616 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_02600 4685 3831 gene locus_tag LOCUS_02610 4685 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964028.1 protein_id gnl|my_center|LOCUS_02610 5070 4675 gene locus_tag LOCUS_02620 5070 4675 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_02620 5745 5074 gene locus_tag LOCUS_02630 5745 5074 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_02630 7126 5798 gene locus_tag LOCUS_02640 7126 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883648.1 protein_id gnl|my_center|LOCUS_02640 8238 7207 gene locus_tag LOCUS_02650 8238 7207 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_02650 8443 12945 gene locus_tag LOCUS_02660 gene gltA 8443 12945 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_02660 >Feature sequence020 1184 207 gene locus_tag LOCUS_02670 1184 207 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_02670 1790 1224 gene locus_tag LOCUS_02680 gene ctaE 1790 1224 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_02680 2660 1800 gene locus_tag LOCUS_02690 gene ctaB 2660 1800 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_02690 3493 2786 gene locus_tag LOCUS_02700 3493 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 3971 3588 gene locus_tag LOCUS_02710 gene gcvH 3971 3588 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_02710 11417 4023 gene locus_tag LOCUS_02720 gene sprA 11417 4023 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_02720 12006 11425 gene locus_tag LOCUS_02730 gene ruvA 12006 11425 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_02730 <13348 12006 gene locus_tag LOCUS_02740 <13348 12006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964222.1:malic enzyme >Feature sequence021 900 631 gene locus_tag LOCUS_02750 900 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 3702 1000 gene locus_tag LOCUS_02760 3702 1000 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_02760 4540 3728 gene locus_tag LOCUS_02770 4540 3728 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_02770 4727 5104 gene locus_tag LOCUS_02780 4727 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 6342 5143 gene locus_tag LOCUS_02790 6342 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_02790 6831 6343 gene locus_tag LOCUS_02800 6831 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 7592 6843 gene locus_tag LOCUS_02810 7592 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 7742 8785 gene locus_tag LOCUS_02820 7742 8785 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_02820 8791 9828 gene locus_tag LOCUS_02830 8791 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_02830 10751 9825 gene locus_tag LOCUS_02840 gene ghrA 10751 9825 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRR3 protein_id gnl|my_center|LOCUS_02840 11248 10799 gene locus_tag LOCUS_02850 11248 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 11302 11733 gene locus_tag LOCUS_02860 11302 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_02860 11726 11905 gene locus_tag LOCUS_02870 11726 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 >Feature sequence022 2818 44 gene locus_tag LOCUS_02880 gene sucA 2818 44 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_02880 2983 4239 gene locus_tag LOCUS_02890 gene umuC 2983 4239 CDS product SOS mutagenesis and repair protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_02890 4236 4667 gene locus_tag LOCUS_02900 4236 4667 CDS product SOS-response transcriptional regulator UmuD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202621.1 protein_id gnl|my_center|LOCUS_02900 5840 4671 gene locus_tag LOCUS_02910 5840 4671 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_02910 8248 5852 gene locus_tag LOCUS_02920 8248 5852 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_02920 8357 8653 gene locus_tag LOCUS_02930 8357 8653 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383618.1 protein_id gnl|my_center|LOCUS_02930 10726 8774 gene locus_tag LOCUS_02940 10726 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 11577 10729 gene locus_tag LOCUS_02950 11577 10729 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_02950 12322 11672 gene locus_tag LOCUS_02960 12322 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 >Feature sequence023 1936 866 gene locus_tag LOCUS_02970 gene mvaD 1936 866 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_02970 2804 2058 gene locus_tag LOCUS_02980 2804 2058 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015900.1 protein_id gnl|my_center|LOCUS_02980 4197 2818 gene locus_tag LOCUS_02990 4197 2818 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 protein_id gnl|my_center|LOCUS_02990 6512 4230 gene locus_tag LOCUS_03000 6512 4230 CDS product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_03000 7164 6514 gene locus_tag LOCUS_03010 gene pgmB2 7164 6514 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_03010 7579 7256 gene locus_tag LOCUS_03020 7579 7256 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_03020 7831 7589 gene locus_tag LOCUS_03030 7831 7589 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_03030 8970 7837 gene locus_tag LOCUS_03040 gene mrp 8970 7837 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 protein_id gnl|my_center|LOCUS_03040 9372 9025 gene locus_tag LOCUS_03050 gene ogt2 9372 9025 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_03050 10042 9365 gene locus_tag LOCUS_03060 gene trmB 10042 9365 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_03060 11121 10099 gene locus_tag LOCUS_03070 gene phoR 11121 10099 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_03070 11833 11129 gene locus_tag LOCUS_03080 gene phoP 11833 11129 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_03080 >Feature sequence024 668 597 gene locus_tag LOCUS_t00030 668 597 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1055 696 gene locus_tag LOCUS_03090 gene folB 1055 696 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_03090 1133 2803 gene locus_tag LOCUS_03100 gene glnS 1133 2803 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_03100 3742 2804 gene locus_tag LOCUS_03110 3742 2804 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_03110 5232 3739 gene locus_tag LOCUS_03120 gene gltX 5232 3739 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 protein_id gnl|my_center|LOCUS_03120 5297 5710 gene locus_tag LOCUS_03130 gene ybeY 5297 5710 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DSY7 protein_id gnl|my_center|LOCUS_03130 5720 7591 gene locus_tag LOCUS_03140 gene mnmG 5720 7591 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_03140 7591 8451 gene locus_tag LOCUS_03150 7591 8451 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_03150 9527 8448 gene locus_tag LOCUS_03160 gene holB 9527 8448 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_03160 9655 10836 gene locus_tag LOCUS_03170 gene pgk 9655 10836 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_03170 10876 11871 gene locus_tag LOCUS_03180 10876 11871 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_03180 12069 11875 gene locus_tag LOCUS_03190 12069 11875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 >Feature sequence025 1532 141 gene locus_tag LOCUS_03200 1532 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_03200 1641 1723 gene locus_tag LOCUS_t00040 1641 1723 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2503 1763 gene locus_tag LOCUS_03210 2503 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 2547 3578 gene locus_tag LOCUS_03220 2547 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 4703 3597 gene locus_tag LOCUS_03230 4703 3597 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_03230 6036 4750 gene locus_tag LOCUS_03240 6036 4750 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_03240 6148 7278 gene locus_tag LOCUS_03250 gene porR 6148 7278 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_03250 8162 7281 gene locus_tag LOCUS_03260 gene fabD 8162 7281 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_03260 8696 8163 gene locus_tag LOCUS_03270 gene dfrA 8696 8163 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_03270 8806 9885 gene locus_tag LOCUS_03280 8806 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 10719 9895 gene locus_tag LOCUS_03290 gene thyA 10719 9895 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 protein_id gnl|my_center|LOCUS_03290 11432 10818 gene locus_tag LOCUS_03300 11432 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_03300 >Feature sequence026 365 1021 gene locus_tag LOCUS_03310 gene rpe 365 1021 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_03310 1032 1724 gene locus_tag LOCUS_03320 1032 1724 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016817.1 protein_id gnl|my_center|LOCUS_03320 2023 1949 gene locus_tag LOCUS_t00050 2023 1949 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2487 2038 gene locus_tag LOCUS_03330 2487 2038 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_03330 4527 2509 gene locus_tag LOCUS_03340 gene ftsZ 4527 2509 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H191 protein_id gnl|my_center|LOCUS_03340 5861 4542 gene locus_tag LOCUS_03350 gene ftsA 5861 4542 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_03350 6571 5867 gene locus_tag LOCUS_03360 6571 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 7899 6568 gene locus_tag LOCUS_03370 gene murC 7899 6568 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_03370 8984 7896 gene locus_tag LOCUS_03380 gene murG 8984 7896 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_03380 10158 8971 gene locus_tag LOCUS_03390 gene ftsW 10158 8971 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_03390 11492 10155 gene locus_tag LOCUS_03400 gene murD 11492 10155 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_03400 >Feature sequence027 234 1091 gene locus_tag LOCUS_03410 234 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_03410 1091 1663 gene locus_tag LOCUS_03420 gene gmk 1091 1663 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_03420 1660 2244 gene locus_tag LOCUS_03430 gene nadD 1660 2244 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_03430 3530 2241 gene locus_tag LOCUS_03440 3530 2241 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_03440 4072 3563 gene locus_tag LOCUS_03450 4072 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_03450 4400 4077 gene locus_tag LOCUS_03460 4400 4077 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_03460 4830 4402 gene locus_tag LOCUS_03470 gene sufE 4830 4402 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_03470 6057 4843 gene locus_tag LOCUS_03480 gene sufS 6057 4843 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_03480 7373 6057 gene locus_tag LOCUS_03490 gene sufD 7373 6057 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_03490 8122 7373 gene locus_tag LOCUS_03500 gene sufC 8122 7373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_03500 9581 8136 gene locus_tag LOCUS_03510 gene sufB 9581 8136 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_03510 9921 9592 gene locus_tag LOCUS_03520 gene sufA 9921 9592 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_03520 11341 10016 gene locus_tag LOCUS_03530 11341 10016 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583646.1 protein_id gnl|my_center|LOCUS_03530 >Feature sequence028 <1 538 gene locus_tag LOCUS_03540 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2F2:phosphoribosylamine--glycine ligase 763 533 gene locus_tag LOCUS_03550 763 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 803 1732 gene locus_tag LOCUS_03560 803 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1791 2408 gene locus_tag LOCUS_03570 1791 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_03570 2413 3453 gene locus_tag LOCUS_03580 2413 3453 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964556.1 protein_id gnl|my_center|LOCUS_03580 4481 3450 gene locus_tag LOCUS_03590 gene paaE 4481 3450 CDS product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_03590 4617 6092 gene locus_tag LOCUS_03600 4617 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 6094 6789 gene locus_tag LOCUS_03610 6094 6789 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_03610 6846 9320 gene locus_tag LOCUS_03620 gene sprE 6846 9320 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_03620 9328 9723 gene locus_tag LOCUS_03630 9328 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_03630 10449 10210 gene locus_tag LOCUS_03640 10449 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 10595 11503 gene locus_tag LOCUS_03650 10595 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence029 101 625 gene locus_tag LOCUS_03660 101 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 1072 620 gene locus_tag LOCUS_03670 1072 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03670 1381 1085 gene locus_tag LOCUS_03680 1381 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03680 3125 1371 gene locus_tag LOCUS_03690 gene batD 3125 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_03690 3903 3130 gene locus_tag LOCUS_03700 gene batC 3903 3130 CDS product BatC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962308.1 protein_id gnl|my_center|LOCUS_03700 4943 3906 gene locus_tag LOCUS_03710 gene batB 4943 3906 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_03710 5642 4947 gene locus_tag LOCUS_03720 5642 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 5641 5838 gene locus_tag LOCUS_03730 5641 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 7575 5953 gene locus_tag LOCUS_03740 7575 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 protein_id gnl|my_center|LOCUS_03740 8445 7576 gene locus_tag LOCUS_03750 8445 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_03750 9455 8457 gene locus_tag LOCUS_03760 9455 8457 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_03760 9598 10470 gene locus_tag LOCUS_03770 9598 10470 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442797.1 protein_id gnl|my_center|LOCUS_03770 10479 11228 gene locus_tag LOCUS_03780 10479 11228 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_03780 >Feature sequence030 354 965 gene locus_tag LOCUS_03790 354 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 1006 1644 gene locus_tag LOCUS_03800 1006 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 2302 1658 gene locus_tag LOCUS_03810 2302 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 2464 3210 gene locus_tag LOCUS_03820 gene etfB 2464 3210 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_03820 3221 4177 gene locus_tag LOCUS_03830 gene etfA 3221 4177 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_03830 5679 4411 gene locus_tag LOCUS_03840 5679 4411 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763524.1 protein_id gnl|my_center|LOCUS_03840 6298 5708 gene locus_tag LOCUS_03850 gene ribE 6298 5708 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_03850 6364 7359 gene locus_tag LOCUS_03860 gene pdxA 6364 7359 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_03860 7435 7956 gene locus_tag LOCUS_03870 7435 7956 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_03870 8270 9280 gene locus_tag LOCUS_03880 gene fabH3 8270 9280 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_03880 9292 9756 gene locus_tag LOCUS_03890 gene accB 9292 9756 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_03890 9768 11102 gene locus_tag LOCUS_03900 gene accC 9768 11102 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence031 <1 760 gene locus_tag LOCUS_03910 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963565.1:lycopene cyclase 1731 757 gene locus_tag LOCUS_03920 1731 757 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_03920 1836 2441 gene locus_tag LOCUS_03930 1836 2441 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_03930 2438 3775 gene locus_tag LOCUS_03940 2438 3775 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_03940 3782 4951 gene locus_tag LOCUS_03950 3782 4951 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_03950 4967 8422 gene locus_tag LOCUS_03960 4967 8422 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_03960 8452 10203 gene locus_tag LOCUS_03970 gene aspS 8452 10203 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_03970 10208 10474 gene locus_tag LOCUS_03980 10208 10474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 10542 10733 gene locus_tag LOCUS_03990 10542 10733 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_03990 >Feature sequence032 167 1024 gene locus_tag LOCUS_04000 167 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 1187 1900 gene locus_tag LOCUS_04010 1187 1900 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_04010 3675 1981 gene locus_tag LOCUS_04020 3675 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107196.1 protein_id gnl|my_center|LOCUS_04020 6762 3685 gene locus_tag LOCUS_04030 6762 3685 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_04030 9129 7177 gene locus_tag LOCUS_04040 9129 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 <10736 9437 gene locus_tag LOCUS_04050 <10736 9437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088455.1:serine hydrolase >Feature sequence033 <1 711 gene locus_tag LOCUS_04060 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228459.1:peptidase M20 1498 713 gene locus_tag LOCUS_04070 1498 713 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_04070 1810 1499 gene locus_tag LOCUS_04080 1810 1499 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_04080 3401 1821 gene locus_tag LOCUS_04090 3401 1821 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_04090 3582 3752 gene locus_tag LOCUS_04100 3582 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3755 3934 gene locus_tag LOCUS_04110 3755 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 3965 5566 gene locus_tag LOCUS_04120 3965 5566 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115067.1 protein_id gnl|my_center|LOCUS_04120 5653 6120 gene locus_tag LOCUS_04130 5653 6120 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PCT6 protein_id gnl|my_center|LOCUS_04130 6158 6577 gene locus_tag LOCUS_04140 6158 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 6580 7029 gene locus_tag LOCUS_04150 6580 7029 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462564.1 protein_id gnl|my_center|LOCUS_04150 7055 7867 gene locus_tag LOCUS_04160 7055 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 8386 8159 gene locus_tag LOCUS_04170 8386 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 8513 10585 gene locus_tag LOCUS_04180 8513 10585 CDS product folate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141367.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence034 181 417 gene locus_tag LOCUS_04190 gene rpmB 181 417 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_04190 427 609 gene locus_tag LOCUS_04200 gene rpmG 427 609 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_04200 612 806 gene locus_tag LOCUS_04210 612 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 965 2131 gene locus_tag LOCUS_04220 gene ftsY 965 2131 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 protein_id gnl|my_center|LOCUS_04220 4595 2136 gene locus_tag LOCUS_04230 4595 2136 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_04230 4710 6317 gene locus_tag LOCUS_04240 gene bshC 4710 6317 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_04240 6377 7906 gene locus_tag LOCUS_04250 gene guaA 6377 7906 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_04250 7920 9650 gene locus_tag LOCUS_04260 7920 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 >Feature sequence035 <1 678 gene locus_tag LOCUS_04270 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW35:transcription-repair-coupling factor 1315 656 gene locus_tag LOCUS_04280 1315 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 1448 3493 gene locus_tag LOCUS_04290 gene metG 1448 3493 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_04290 3958 3494 gene locus_tag LOCUS_04300 3958 3494 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706073.1 protein_id gnl|my_center|LOCUS_04300 4057 4854 gene locus_tag LOCUS_04310 gene yeeZ 4057 4854 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962265.1 protein_id gnl|my_center|LOCUS_04310 5386 4859 gene locus_tag LOCUS_04320 5386 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 6044 5400 gene locus_tag LOCUS_04330 6044 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 7513 6047 gene locus_tag LOCUS_04340 7513 6047 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160471.1 protein_id gnl|my_center|LOCUS_04340 8207 7506 gene locus_tag LOCUS_04350 8207 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 8347 9180 gene locus_tag LOCUS_04360 8347 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence036 814 524 gene locus_tag LOCUS_04370 814 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 1344 868 gene locus_tag LOCUS_04380 gene ribH 1344 868 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_04380 2108 1344 gene locus_tag LOCUS_04390 2108 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_04390 2219 3301 gene locus_tag LOCUS_04400 gene recF 2219 3301 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_04400 3305 3736 gene locus_tag LOCUS_04410 3305 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 3741 4037 gene locus_tag LOCUS_04420 3741 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933934.1 protein_id gnl|my_center|LOCUS_04420 4453 4034 gene locus_tag LOCUS_04430 gene ndk 4453 4034 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_04430 4547 5548 gene locus_tag LOCUS_04440 gene fjo19 4547 5548 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_04440 5635 6081 gene locus_tag LOCUS_04450 5635 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 6092 7111 gene locus_tag LOCUS_04460 gene ppiC 6092 7111 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_04460 7177 8169 gene locus_tag LOCUS_04470 7177 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence037 1629 1012 gene locus_tag LOCUS_04480 gene trpF 1629 1012 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_04480 2410 1619 gene locus_tag LOCUS_04490 gene trpC 2410 1619 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_04490 3402 2410 gene locus_tag LOCUS_04500 gene trpD 3402 2410 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_04500 3970 3407 gene locus_tag LOCUS_04510 gene pabA 3970 3407 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_04510 5374 3974 gene locus_tag LOCUS_04520 gene trpE 5374 3974 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_04520 5601 5906 gene locus_tag LOCUS_04530 5601 5906 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_04530 5918 6145 gene locus_tag LOCUS_04540 5918 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_04540 6232 7812 gene locus_tag LOCUS_04550 gene dagA 6232 7812 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_04550 7894 8088 gene locus_tag LOCUS_04560 gene rpsU 7894 8088 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_04560 8157 9053 gene locus_tag LOCUS_04570 gene xerC 8157 9053 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_04570 9069 9368 gene locus_tag LOCUS_04580 9069 9368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 9636 9403 gene locus_tag LOCUS_04590 9636 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 10005 10079 gene locus_tag LOCUS_t00060 10005 10079 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence038 1517 2068 gene locus_tag LOCUS_04600 1517 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04600 2126 2353 gene locus_tag LOCUS_04610 gene feoA 2126 2353 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_04610 2355 4451 gene locus_tag LOCUS_04620 gene feoB 2355 4451 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_04620 5880 4585 gene locus_tag LOCUS_04630 gene pepP 5880 4585 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_04630 5973 8801 gene locus_tag LOCUS_04640 5973 8801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 8952 9602 gene locus_tag LOCUS_04650 gene sdhC 8952 9602 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_04650 >Feature sequence039 <1 1496 gene locus_tag LOCUS_04660 <1 1496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWU5:ribonucleoside-diphosphate reductase 3817 1544 gene locus_tag LOCUS_04670 3817 1544 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A666 protein_id gnl|my_center|LOCUS_04670 4984 3827 gene locus_tag LOCUS_04680 4984 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 5204 6520 gene locus_tag LOCUS_04690 gene dgt 5204 6520 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_04690 6553 7791 gene locus_tag LOCUS_04700 6553 7791 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_04700 7838 8134 gene locus_tag LOCUS_04710 7838 8134 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_04710 <9958 8137 gene locus_tag LOCUS_04720 <9958 8137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962469.1:membrane protein >Feature sequence040 <1 721 gene locus_tag LOCUS_04730 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963604.1:DUF4856 domain-containing protein 803 1999 gene locus_tag LOCUS_04740 gene irpA 803 1999 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_04740 3091 3429 gene locus_tag LOCUS_04750 3091 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 3410 5845 gene locus_tag LOCUS_04760 gene fecA 3410 5845 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_04760 7396 5852 gene locus_tag LOCUS_04770 7396 5852 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405542.1 protein_id gnl|my_center|LOCUS_04770 8552 7407 gene locus_tag LOCUS_04780 8552 7407 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_04780 <9845 8563 gene locus_tag LOCUS_04790 <9845 8563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963159.1:deoxyribodipyrimidine photo-lyase >Feature sequence041 528 2084 gene locus_tag LOCUS_04800 gene porX 528 2084 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_04800 2096 2503 gene locus_tag LOCUS_04810 2096 2503 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_04810 2506 2862 gene locus_tag LOCUS_04820 2506 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963214.1 protein_id gnl|my_center|LOCUS_04820 4022 2859 gene locus_tag LOCUS_04830 gene putA 4022 2859 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_04830 4109 5176 gene locus_tag LOCUS_04840 gene aroB 4109 5176 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_04840 7761 5173 gene locus_tag LOCUS_04850 gene ppc 7761 5173 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8N7 protein_id gnl|my_center|LOCUS_04850 8252 7770 gene locus_tag LOCUS_04860 8252 7770 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 protein_id gnl|my_center|LOCUS_04860 9459 8350 gene locus_tag LOCUS_04870 9459 8350 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence042 21 800 gene locus_tag LOCUS_04880 21 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 793 1683 gene locus_tag LOCUS_04890 793 1683 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_04890 1734 3386 gene locus_tag LOCUS_04900 gene recN 1734 3386 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_04900 3414 4223 gene locus_tag LOCUS_04910 3414 4223 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_04910 4239 5195 gene locus_tag LOCUS_04920 4239 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 5192 5788 gene locus_tag LOCUS_04930 gene coaE 5192 5788 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_04930 5887 7443 gene locus_tag LOCUS_04940 gene rprX 5887 7443 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_04940 7445 8143 gene locus_tag LOCUS_04950 gene rprY 7445 8143 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_04950 9038 8133 gene locus_tag LOCUS_04960 gene xerD 9038 8133 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_04960 >Feature sequence043 753 424 gene locus_tag LOCUS_04970 753 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_04970 1579 776 gene locus_tag LOCUS_04980 gene bamD 1579 776 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_04980 2517 1642 gene locus_tag LOCUS_04990 gene dapA 2517 1642 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_04990 3044 2517 gene locus_tag LOCUS_05000 3044 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 5046 3037 gene locus_tag LOCUS_05010 gene ligA 5046 3037 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 protein_id gnl|my_center|LOCUS_05010 5885 5043 gene locus_tag LOCUS_05020 gene prmC 5885 5043 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_05020 6361 5882 gene locus_tag LOCUS_05030 gene yjgM 6361 5882 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_05030 6417 7466 gene locus_tag LOCUS_05040 gene ribD 6417 7466 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_05040 7843 7445 gene locus_tag LOCUS_05050 7843 7445 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence044 984 2081 gene locus_tag LOCUS_05060 984 2081 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_05060 2125 3057 gene locus_tag LOCUS_05070 2125 3057 CDS product organic solvent ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_05070 3077 4402 gene locus_tag LOCUS_05080 3077 4402 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_05080 4417 4860 gene locus_tag LOCUS_05090 4417 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_05090 4871 5650 gene locus_tag LOCUS_05100 4871 5650 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_05100 5652 6137 gene locus_tag LOCUS_05110 5652 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_05110 >Feature sequence045 779 198 gene locus_tag LOCUS_05120 779 198 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_05120 1618 848 gene locus_tag LOCUS_05130 gene yfhH 1618 848 CDS product steroid 5-alpha reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905448.1 protein_id gnl|my_center|LOCUS_05130 2696 1806 gene locus_tag LOCUS_05140 2696 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 2949 3905 gene locus_tag LOCUS_05150 2949 3905 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097747.1 protein_id gnl|my_center|LOCUS_05150 4774 4001 gene locus_tag LOCUS_05160 4774 4001 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120554.1 protein_id gnl|my_center|LOCUS_05160 4873 5442 gene locus_tag LOCUS_05170 gene yceI 4873 5442 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_05170 5518 6453 gene locus_tag LOCUS_05180 5518 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 7414 6587 gene locus_tag LOCUS_05190 7414 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 7480 7839 gene locus_tag LOCUS_05200 7480 7839 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088312.1 protein_id gnl|my_center|LOCUS_05200 8592 7879 gene locus_tag LOCUS_05210 8592 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence046 554 1312 gene locus_tag LOCUS_05220 gene pssA 554 1312 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_05220 2370 1321 gene locus_tag LOCUS_05230 gene menE 2370 1321 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_05230 3420 2371 gene locus_tag LOCUS_05240 gene menC 3420 2371 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_05240 4345 3422 gene locus_tag LOCUS_05250 gene menA 4345 3422 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW2 protein_id gnl|my_center|LOCUS_05250 5181 4360 gene locus_tag LOCUS_05260 gene menB 5181 4360 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WQ8 protein_id gnl|my_center|LOCUS_05260 6989 5229 gene locus_tag LOCUS_05270 gene menD 6989 5229 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_05270 7976 7026 gene locus_tag LOCUS_05280 gene menF 7976 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 protein_id gnl|my_center|LOCUS_05280 <8683 8083 gene locus_tag LOCUS_05290 <8683 8083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWG7:demethylmenaquinone methyltransferase >Feature sequence047 461 1249 gene locus_tag LOCUS_05300 461 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05300 2877 1255 gene locus_tag LOCUS_05310 2877 1255 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_05310 2970 4343 gene locus_tag LOCUS_05320 2970 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963192.1 protein_id gnl|my_center|LOCUS_05320 4993 4340 gene locus_tag LOCUS_05330 gene tal 4993 4340 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_05330 5808 5005 gene locus_tag LOCUS_05340 5808 5005 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_05340 5995 7020 gene locus_tag LOCUS_05350 5995 7020 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_05350 7013 7426 gene locus_tag LOCUS_05360 7013 7426 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 protein_id gnl|my_center|LOCUS_05360 <8666 7412 gene locus_tag LOCUS_05370 <8666 7412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXG2:serine hydroxymethyltransferase >Feature sequence048 197 1585 gene locus_tag LOCUS_05380 gene mnmE 197 1585 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_05380 1846 1586 gene locus_tag LOCUS_05390 1846 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 2084 3229 gene locus_tag LOCUS_05400 2084 3229 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N14 protein_id gnl|my_center|LOCUS_05400 4186 3341 gene locus_tag LOCUS_05410 4186 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919108.1 protein_id gnl|my_center|LOCUS_05410 5226 4186 gene locus_tag LOCUS_05420 gene galT 5226 4186 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31764 protein_id gnl|my_center|LOCUS_05420 6347 5226 gene locus_tag LOCUS_05430 6347 5226 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAU4 protein_id gnl|my_center|LOCUS_05430 8092 6494 gene locus_tag LOCUS_05440 8092 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence049 336 1079 gene locus_tag LOCUS_05450 336 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 1094 1612 gene locus_tag LOCUS_05460 1094 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 1620 3965 gene locus_tag LOCUS_05470 1620 3965 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_05470 4046 4318 gene locus_tag LOCUS_05480 4046 4318 CDS product Sec-independent protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964182.1 protein_id gnl|my_center|LOCUS_05480 4956 4315 gene locus_tag LOCUS_05490 4956 4315 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_05490 5592 4981 gene locus_tag LOCUS_05500 5592 4981 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_05500 5846 5598 gene locus_tag LOCUS_05510 5846 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 6156 5863 gene locus_tag LOCUS_05520 6156 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 6457 7590 gene locus_tag LOCUS_05530 6457 7590 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_05530 <8524 7564 gene locus_tag LOCUS_05540 <8524 7564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZF0:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence050 250 1479 gene locus_tag LOCUS_05550 250 1479 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763621.1 protein_id gnl|my_center|LOCUS_05550 1472 2749 gene locus_tag LOCUS_05560 1472 2749 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_05560 2774 3913 gene locus_tag LOCUS_05570 2774 3913 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_05570 3943 5355 gene locus_tag LOCUS_05580 3943 5355 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_05580 5364 6047 gene locus_tag LOCUS_05590 5364 6047 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_05590 7100 6213 gene locus_tag LOCUS_05600 7100 6213 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 protein_id gnl|my_center|LOCUS_05600 7169 7678 gene locus_tag LOCUS_05610 7169 7678 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_05610 8234 7725 gene locus_tag LOCUS_05620 8234 7725 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964197.1 protein_id gnl|my_center|LOCUS_05620 >Feature sequence051 2621 2355 gene locus_tag LOCUS_05630 2621 2355 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_05630 3070 2726 gene locus_tag LOCUS_05640 gene rplT 3070 2726 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_05640 3355 3158 gene locus_tag LOCUS_05650 gene rpmI 3355 3158 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_05650 3857 3381 gene locus_tag LOCUS_05660 gene infC 3857 3381 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP1 protein_id gnl|my_center|LOCUS_05660 5899 3953 gene locus_tag LOCUS_05670 gene thrS 5899 3953 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 protein_id gnl|my_center|LOCUS_05670 6194 5958 gene locus_tag LOCUS_05680 6194 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 7006 6191 gene locus_tag LOCUS_05690 gene murQ 7006 6191 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABH7 protein_id gnl|my_center|LOCUS_05690 8247 7021 gene locus_tag LOCUS_05700 gene icd 8247 7021 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R4 protein_id gnl|my_center|LOCUS_05700 >Feature sequence052 2560 794 gene locus_tag LOCUS_05710 gene dld 2560 794 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSR0 protein_id gnl|my_center|LOCUS_05710 5962 2801 gene locus_tag LOCUS_05720 5962 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 7115 6558 gene locus_tag LOCUS_05730 7115 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 7436 7209 gene locus_tag LOCUS_05740 7436 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 >Feature sequence053 905 552 gene locus_tag LOCUS_05750 905 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 2221 926 gene locus_tag LOCUS_05760 gene nqrF 2221 926 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_05760 2842 2225 gene locus_tag LOCUS_05770 gene nqrE 2842 2225 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR7 protein_id gnl|my_center|LOCUS_05770 3541 2849 gene locus_tag LOCUS_05780 gene nqrD 3541 2849 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 protein_id gnl|my_center|LOCUS_05780 4277 3546 gene locus_tag LOCUS_05790 gene nqrC 4277 3546 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 protein_id gnl|my_center|LOCUS_05790 5440 4283 gene locus_tag LOCUS_05800 gene nqrB 5440 4283 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K8 protein_id gnl|my_center|LOCUS_05800 6797 5451 gene locus_tag LOCUS_05810 gene nqrA 6797 5451 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence054 475 4695 gene locus_tag LOCUS_05820 475 4695 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_05820 4791 5774 gene locus_tag LOCUS_05830 gene pfkA 4791 5774 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_05830 5795 6793 gene locus_tag LOCUS_05840 gene gapA3 5795 6793 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H007 protein_id gnl|my_center|LOCUS_05840 6796 7659 gene locus_tag LOCUS_05850 6796 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence055 1717 2514 gene locus_tag LOCUS_05860 1717 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 2528 4846 gene locus_tag LOCUS_05870 gene xloA 2528 4846 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_05870 6709 4922 gene locus_tag LOCUS_05880 6709 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 7714 7019 gene locus_tag LOCUS_05890 7714 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence056 124 711 gene locus_tag LOCUS_05900 124 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 750 1706 gene locus_tag LOCUS_05910 750 1706 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_05910 1693 3399 gene locus_tag LOCUS_05920 1693 3399 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 protein_id gnl|my_center|LOCUS_05920 3401 5221 gene locus_tag LOCUS_05930 gene msbA 3401 5221 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_05930 5242 6459 gene locus_tag LOCUS_05940 gene rsmB 5242 6459 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence057 3054 862 gene locus_tag LOCUS_05950 3054 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 3501 3064 gene locus_tag LOCUS_05960 3501 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 4523 3648 gene locus_tag LOCUS_05970 4523 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 6091 4772 gene locus_tag LOCUS_05980 6091 4772 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107635.1 protein_id gnl|my_center|LOCUS_05980 7428 6097 gene locus_tag LOCUS_05990 7428 6097 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_05990 >Feature sequence058 715 32 gene locus_tag LOCUS_06000 715 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 714 1358 gene locus_tag LOCUS_06010 714 1358 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_06010 1375 2178 gene locus_tag LOCUS_06020 1375 2178 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_06020 2720 2181 gene locus_tag LOCUS_06030 gene sodC 2720 2181 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D0 protein_id gnl|my_center|LOCUS_06030 5883 2731 gene locus_tag LOCUS_06040 5883 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_06040 6024 7013 gene locus_tag LOCUS_06050 6024 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 7010 7546 gene locus_tag LOCUS_06060 7010 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 >Feature sequence059 1026 1790 gene locus_tag LOCUS_06070 1026 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 1791 2342 gene locus_tag LOCUS_06080 1791 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 2382 2990 gene locus_tag LOCUS_06090 2382 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 3508 2999 gene locus_tag LOCUS_06100 3508 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4024 3653 gene locus_tag LOCUS_06110 4024 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 4953 4093 gene locus_tag LOCUS_06120 gene tesB 4953 4093 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105107.1 protein_id gnl|my_center|LOCUS_06120 5616 4954 gene locus_tag LOCUS_06130 5616 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 7040 5616 gene locus_tag LOCUS_06140 7040 5616 CDS product glutamate carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860725.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence060 835 2163 gene locus_tag LOCUS_06150 gene tig 835 2163 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_06150 2205 2867 gene locus_tag LOCUS_06160 gene clpP 2205 2867 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_06160 2877 4106 gene locus_tag LOCUS_06170 gene clpX 2877 4106 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_06170 5621 4107 gene locus_tag LOCUS_06180 5621 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_06180 5664 6455 gene locus_tag LOCUS_06190 5664 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_06190 7180 6452 gene locus_tag LOCUS_06200 7180 6452 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_06200 >Feature sequence061 1956 2029 gene locus_tag LOCUS_t00070 1956 2029 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3602 2139 gene locus_tag LOCUS_06210 3602 2139 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_06210 4727 3603 gene locus_tag LOCUS_06220 4727 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_06220 4869 5336 gene locus_tag LOCUS_06230 gene rimP 4869 5336 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV6 protein_id gnl|my_center|LOCUS_06230 5347 6579 gene locus_tag LOCUS_06240 gene nusA 5347 6579 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_06240 >Feature sequence062 381 860 gene locus_tag LOCUS_06250 381 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 1718 936 gene locus_tag LOCUS_06260 1718 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_06260 2502 1720 gene locus_tag LOCUS_06270 2502 1720 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RE15 protein_id gnl|my_center|LOCUS_06270 2544 3566 gene locus_tag LOCUS_06280 gene lpxK 2544 3566 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_06280 4540 3596 gene locus_tag LOCUS_06290 gene lipA 4540 3596 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_06290 5777 4572 gene locus_tag LOCUS_06300 5777 4572 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263870.1 protein_id gnl|my_center|LOCUS_06300 6319 5774 gene locus_tag LOCUS_06310 6319 5774 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_06310 6549 6343 gene locus_tag LOCUS_06320 6549 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 7101 6601 gene locus_tag LOCUS_06330 7101 6601 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962389.1 protein_id gnl|my_center|LOCUS_06330 >Feature sequence063 1643 2053 gene locus_tag LOCUS_06340 1643 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 2096 3823 gene locus_tag LOCUS_06350 2096 3823 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_06350 3825 5210 gene locus_tag LOCUS_06360 3825 5210 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence064 1156 731 gene locus_tag LOCUS_06370 1156 731 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_06370 1215 1847 gene locus_tag LOCUS_06380 gene queE 1215 1847 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_06380 2541 1834 gene locus_tag LOCUS_06390 2541 1834 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_06390 3703 2534 gene locus_tag LOCUS_06400 3703 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_06400 3716 4951 gene locus_tag LOCUS_06410 3716 4951 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_06410 4969 5946 gene locus_tag LOCUS_06420 4969 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 6438 5947 gene locus_tag LOCUS_06430 6438 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 >Feature sequence065 241 89 gene locus_tag LOCUS_06440 241 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 380 1492 gene locus_tag LOCUS_06450 gene nagX 380 1492 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_06450 1507 2604 gene locus_tag LOCUS_06460 1507 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 2623 3789 gene locus_tag LOCUS_06470 2623 3789 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969965.1 protein_id gnl|my_center|LOCUS_06470 3909 3835 gene locus_tag LOCUS_t00080 3909 3835 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4689 3970 gene locus_tag LOCUS_06480 4689 3970 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_06480 5833 4679 gene locus_tag LOCUS_06490 gene metC 5833 4679 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391447.1 protein_id gnl|my_center|LOCUS_06490 6342 5833 gene locus_tag LOCUS_06500 6342 5833 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Q0 protein_id gnl|my_center|LOCUS_06500 6747 6433 gene locus_tag LOCUS_06510 6747 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence066 1493 222 gene locus_tag LOCUS_06520 1493 222 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_06520 1936 1514 gene locus_tag LOCUS_06530 gene ssb 1936 1514 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H058 protein_id gnl|my_center|LOCUS_06530 3027 1978 gene locus_tag LOCUS_06540 gene mutY 3027 1978 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_06540 3141 3431 gene locus_tag LOCUS_06550 gene hupA 3141 3431 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_06550 3694 5247 gene locus_tag LOCUS_06560 gene cafA 3694 5247 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_06560 5307 5777 gene locus_tag LOCUS_06570 gene recX 5307 5777 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_06570 6061 5786 gene locus_tag LOCUS_06580 6061 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 <7061 6061 gene locus_tag LOCUS_06590 <7061 6061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVV9:ATP synthase subunit beta >Feature sequence067 171 821 gene locus_tag LOCUS_06600 gene nth 171 821 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_06600 1596 979 gene locus_tag LOCUS_06610 1596 979 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_06610 1732 4530 gene locus_tag LOCUS_06620 gene uvrA1 1732 4530 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_06620 5976 4519 gene locus_tag LOCUS_06630 5976 4519 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022292.1 protein_id gnl|my_center|LOCUS_06630 <7049 5976 gene locus_tag LOCUS_06640 <7049 5976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963906.1:membrane protein >Feature sequence068 <1 615 gene locus_tag LOCUS_06650 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963494.1:peptidase M3 1399 584 gene locus_tag LOCUS_06660 1399 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 1509 4361 gene locus_tag LOCUS_06670 gene gcvP 1509 4361 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_06670 4472 5533 gene locus_tag LOCUS_06680 gene fabH1 4472 5533 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_06680 5581 6318 gene locus_tag LOCUS_06690 5581 6318 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence069 119 45 gene locus_tag LOCUS_t00090 119 45 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 864 124 gene locus_tag LOCUS_06700 864 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 2213 888 gene locus_tag LOCUS_06710 2213 888 CDS product putative aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702442.1 protein_id gnl|my_center|LOCUS_06710 3896 2223 gene locus_tag LOCUS_06720 3896 2223 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074413.1 protein_id gnl|my_center|LOCUS_06720 4027 4689 gene locus_tag LOCUS_06730 4027 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 4994 4692 gene locus_tag LOCUS_06740 4994 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 5833 4997 gene locus_tag LOCUS_06750 5833 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 5979 6485 gene locus_tag LOCUS_06760 5979 6485 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964325.1 protein_id gnl|my_center|LOCUS_06760 6497 6952 gene locus_tag LOCUS_06770 6497 6952 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_06770 >Feature sequence070 944 810 gene locus_tag LOCUS_06780 944 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 1135 1629 gene locus_tag LOCUS_06790 1135 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2533 1619 gene locus_tag LOCUS_06800 gene lpqC 2533 1619 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_06800 2758 3504 gene locus_tag LOCUS_06810 2758 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 3587 4642 gene locus_tag LOCUS_06820 3587 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 4649 5479 gene locus_tag LOCUS_06830 4649 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 6948 5476 gene locus_tag LOCUS_06840 6948 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence071 372 1637 gene locus_tag LOCUS_06850 gene metY 372 1637 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962432.1 protein_id gnl|my_center|LOCUS_06850 1650 2606 gene locus_tag LOCUS_06860 gene metX 1650 2606 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW98 protein_id gnl|my_center|LOCUS_06860 2619 3044 gene locus_tag LOCUS_06870 2619 3044 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_06870 3944 3048 gene locus_tag LOCUS_06880 gene gldA 3944 3048 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_06880 4204 5034 gene locus_tag LOCUS_06890 gene pheA 4204 5034 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_06890 5036 6178 gene locus_tag LOCUS_06900 gene aspC3 5036 6178 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 protein_id gnl|my_center|LOCUS_06900 >Feature sequence072 36 350 gene locus_tag LOCUS_06910 36 350 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_06910 2443 464 gene locus_tag LOCUS_06920 gene bfmBA 2443 464 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_06920 4614 2479 gene locus_tag LOCUS_06930 4614 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 4694 5044 gene locus_tag LOCUS_06940 4694 5044 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978313.1 protein_id gnl|my_center|LOCUS_06940 5715 5041 gene locus_tag LOCUS_06950 gene ung2 5715 5041 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_06950 >Feature sequence073 1057 1764 gene locus_tag LOCUS_06960 1057 1764 CDS product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962342.1 protein_id gnl|my_center|LOCUS_06960 1775 3112 gene locus_tag LOCUS_06970 gene pyrC1 1775 3112 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_06970 3109 3495 gene locus_tag LOCUS_06980 3109 3495 CDS product lipoprotein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962340.1 protein_id gnl|my_center|LOCUS_06980 4465 3512 gene locus_tag LOCUS_06990 4465 3512 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_06990 4543 5838 gene locus_tag LOCUS_07000 gene tyrS 4543 5838 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 protein_id gnl|my_center|LOCUS_07000 <6766 5831 gene locus_tag LOCUS_07010 <6766 5831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962301.1:acyltransferase >Feature sequence074 181 906 gene locus_tag LOCUS_07020 181 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 1907 903 gene locus_tag LOCUS_07030 1907 903 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_07030 2793 1909 gene locus_tag LOCUS_07040 2793 1909 CDS product steroid 5-alpha reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732640.1 protein_id gnl|my_center|LOCUS_07040 3967 2852 gene locus_tag LOCUS_07050 gene hisC 3967 2852 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185Y8 protein_id gnl|my_center|LOCUS_07050 5538 3979 gene locus_tag LOCUS_07060 5538 3979 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919430.1 protein_id gnl|my_center|LOCUS_07060 5713 6441 gene locus_tag LOCUS_07070 5713 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence075 382 32 gene locus_tag LOCUS_07080 gene rplS 382 32 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_07080 1170 493 gene locus_tag LOCUS_07090 gene trmD 1170 493 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_07090 2577 1207 gene locus_tag LOCUS_07100 gene degP/Q 2577 1207 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_07100 2668 3444 gene locus_tag LOCUS_07110 gene dapF 2668 3444 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_07110 3447 3911 gene locus_tag LOCUS_07120 3447 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 3908 4957 gene locus_tag LOCUS_07130 gene pabC 3908 4957 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_07130 5673 4954 gene locus_tag LOCUS_07140 5673 4954 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_07140 6061 5666 gene locus_tag LOCUS_07150 6061 5666 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 protein_id gnl|my_center|LOCUS_07150 <6688 6124 gene locus_tag LOCUS_07160 <6688 6124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYW8:chromosomal replication initiator protein DnaA >Feature sequence076 <1 544 gene locus_tag LOCUS_07170 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361998.1:biotin--[acetyl-CoA-carboxylase] ligase 1191 541 gene locus_tag LOCUS_07180 gene pyrE 1191 541 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 protein_id gnl|my_center|LOCUS_07180 1192 1824 gene locus_tag LOCUS_07190 1192 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2240 1779 gene locus_tag LOCUS_07200 gene coaD 2240 1779 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_07200 3257 2262 gene locus_tag LOCUS_07210 gene ddl 3257 2262 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD5 protein_id gnl|my_center|LOCUS_07210 3320 3874 gene locus_tag LOCUS_07220 3320 3874 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962813.1 protein_id gnl|my_center|LOCUS_07220 3871 4893 gene locus_tag LOCUS_07230 3871 4893 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_07230 4977 5726 gene locus_tag LOCUS_07240 4977 5726 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ8 protein_id gnl|my_center|LOCUS_07240 6442 5732 gene locus_tag LOCUS_07250 6442 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 6549 6622 gene locus_tag LOCUS_t00100 6549 6622 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence077 2588 792 gene locus_tag LOCUS_07260 2588 792 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143441.1 protein_id gnl|my_center|LOCUS_07260 3974 2601 gene locus_tag LOCUS_07270 gene melA 3974 2601 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34645 protein_id gnl|my_center|LOCUS_07270 5008 4037 gene locus_tag LOCUS_07280 5008 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 5916 5005 gene locus_tag LOCUS_07290 5916 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 <6618 5924 gene locus_tag LOCUS_07300 <6618 5924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000209109.1:TIGR02453 family protein >Feature sequence078 1575 133 gene locus_tag LOCUS_07310 1575 133 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 protein_id gnl|my_center|LOCUS_07310 3095 2274 gene locus_tag LOCUS_07320 3095 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 5473 3098 gene locus_tag LOCUS_07330 5473 3098 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_07330 5576 6103 gene locus_tag LOCUS_07340 5576 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 6357 6175 gene locus_tag LOCUS_07350 6357 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence079 <1 1047 gene locus_tag LOCUS_07360 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXW3:aminomethyltransferase 1054 1875 gene locus_tag LOCUS_07370 1054 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 1916 2629 gene locus_tag LOCUS_07380 1916 2629 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_07380 3183 2632 gene locus_tag LOCUS_07390 3183 2632 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_07390 3913 3176 gene locus_tag LOCUS_07400 gene kdsB 3913 3176 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_07400 5382 3961 gene locus_tag LOCUS_07410 5382 3961 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_07410 5545 6135 gene locus_tag LOCUS_07420 5545 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence080 543 995 gene locus_tag LOCUS_07430 543 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 1046 1984 gene locus_tag LOCUS_07440 gene yrbG 1046 1984 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_07440 3049 2039 gene locus_tag LOCUS_07450 gene glnII 3049 2039 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_07450 3314 4483 gene locus_tag LOCUS_07460 gene purM 3314 4483 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_07460 4517 5593 gene locus_tag LOCUS_07470 gene prfA 4517 5593 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_07470 5590 6417 gene locus_tag LOCUS_07480 gene pyrF 5590 6417 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence081 1853 390 gene locus_tag LOCUS_07490 1853 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_07490 1925 2692 gene locus_tag LOCUS_07500 gene phnP 1925 2692 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_07500 2706 3197 gene locus_tag LOCUS_07510 2706 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963236.1 protein_id gnl|my_center|LOCUS_07510 3840 3184 gene locus_tag LOCUS_07520 3840 3184 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_07520 5038 3842 gene locus_tag LOCUS_07530 gene pyrC2 5038 3842 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_07530 5944 5183 gene locus_tag LOCUS_07540 5944 5183 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_07540 <6544 5937 gene locus_tag LOCUS_07550 <6544 5937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXB4:lipoprotein-releasing system ATP-binding protein LolD >Feature sequence082 <1 1612 gene locus_tag LOCUS_07560 <1 1612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404296.1:peptidase M14 2877 1624 gene locus_tag LOCUS_07570 gene ilvA 2877 1624 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT3 protein_id gnl|my_center|LOCUS_07570 4286 2883 gene locus_tag LOCUS_07580 gene ilvC 4286 2883 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN4 protein_id gnl|my_center|LOCUS_07580 4891 4361 gene locus_tag LOCUS_07590 4891 4361 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761035.1 protein_id gnl|my_center|LOCUS_07590 6540 4894 gene locus_tag LOCUS_07600 gene ilvB 6540 4894 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_07600 >Feature sequence083 1544 1083 gene locus_tag LOCUS_07610 gene fur 1544 1083 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_07610 3767 1572 gene locus_tag LOCUS_07620 gene relA 3767 1572 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_07620 4587 3811 gene locus_tag LOCUS_07630 4587 3811 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_07630 5924 4611 gene locus_tag LOCUS_07640 5924 4611 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_07640 <6473 5931 gene locus_tag LOCUS_07650 <6473 5931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118165.1:N-acetylglucosamine-6-phosphate deacetylase >Feature sequence084 2790 142 gene locus_tag LOCUS_07660 2790 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_07660 3279 3947 gene locus_tag LOCUS_07670 gene ftsE 3279 3947 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_07670 5750 3948 gene locus_tag LOCUS_07680 gene typA 5750 3948 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence085 1739 3952 gene locus_tag LOCUS_07690 1739 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 3953 4405 gene locus_tag LOCUS_07700 3953 4405 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867224.1 protein_id gnl|my_center|LOCUS_07700 4412 5008 gene locus_tag LOCUS_07710 4412 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187489.1 protein_id gnl|my_center|LOCUS_07710 <6252 5031 gene locus_tag LOCUS_07720 <6252 5031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066164.1:catalase-peroxidase >Feature sequence086 776 1213 gene locus_tag LOCUS_07730 776 1213 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_07730 1665 1931 gene locus_tag LOCUS_07740 1665 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 3159 2041 gene locus_tag LOCUS_07750 3159 2041 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_07750 4421 3141 gene locus_tag LOCUS_07760 4421 3141 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_07760 4566 5108 gene locus_tag LOCUS_07770 4566 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 >Feature sequence087 279 728 gene locus_tag LOCUS_07780 279 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 735 1355 gene locus_tag LOCUS_07790 735 1355 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_07790 1357 1839 gene locus_tag LOCUS_07800 1357 1839 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_07800 1913 2530 gene locus_tag LOCUS_07810 1913 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_07810 3964 2531 gene locus_tag LOCUS_07820 gene rpoN 3964 2531 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_07820 5427 4012 gene locus_tag LOCUS_07830 gene asnS 5427 4012 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_07830 <6184 5490 gene locus_tag LOCUS_07840 <6184 5490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964341.1:transporter >Feature sequence088 707 144 gene locus_tag LOCUS_07850 gene ygfA 707 144 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_07850 787 2529 gene locus_tag LOCUS_07860 gene uvrC 787 2529 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_07860 2572 3390 gene locus_tag LOCUS_07870 2572 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_07870 3466 4761 gene locus_tag LOCUS_07880 3466 4761 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence089 1015 119 gene locus_tag LOCUS_07890 1015 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_07890 2320 1016 gene locus_tag LOCUS_07900 gene mvaA 2320 1016 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_07900 2446 4608 gene locus_tag LOCUS_07910 gene pepX1 2446 4608 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence090 133 963 gene locus_tag LOCUS_07920 133 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 2351 966 gene locus_tag LOCUS_07930 gene hisS 2351 966 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H160 protein_id gnl|my_center|LOCUS_07930 2862 2377 gene locus_tag LOCUS_07940 2862 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 protein_id gnl|my_center|LOCUS_07940 3365 2916 gene locus_tag LOCUS_07950 gene rplI 3365 2916 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P1 protein_id gnl|my_center|LOCUS_07950 3674 3378 gene locus_tag LOCUS_07960 gene rpsR 3674 3378 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_07960 4016 3678 gene locus_tag LOCUS_07970 gene rpsF 4016 3678 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 protein_id gnl|my_center|LOCUS_07970 <6147 4109 gene locus_tag LOCUS_07980 <6147 4109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0P5:primosomal protein N' >Feature sequence091 1487 180 gene locus_tag LOCUS_07990 gene murA 1487 180 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 protein_id gnl|my_center|LOCUS_07990 2150 1500 gene locus_tag LOCUS_08000 2150 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_08000 2487 2209 gene locus_tag LOCUS_08010 2487 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 2543 3082 gene locus_tag LOCUS_08020 2543 3082 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_08020 3079 4776 gene locus_tag LOCUS_08030 gene recQ2 3079 4776 CDS product ATP-dependent DNA helicase RecQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 protein_id gnl|my_center|LOCUS_08030 4805 5749 gene locus_tag LOCUS_08040 gene fmt 4805 5749 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H148 protein_id gnl|my_center|LOCUS_08040 >Feature sequence092 2146 449 gene locus_tag LOCUS_08050 gene recJ 2146 449 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_08050 2824 2150 gene locus_tag LOCUS_08060 gene rsmI 2824 2150 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YL7 protein_id gnl|my_center|LOCUS_08060 3470 2838 gene locus_tag LOCUS_08070 3470 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 3534 4139 gene locus_tag LOCUS_08080 gene tdk 3534 4139 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_08080 4136 5218 gene locus_tag LOCUS_08090 4136 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence093 3253 1541 gene locus_tag LOCUS_08100 3253 1541 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262768.1 protein_id gnl|my_center|LOCUS_08100 3518 3270 gene locus_tag LOCUS_08110 3518 3270 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_08110 4338 3601 gene locus_tag LOCUS_08120 4338 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence094 1397 921 gene locus_tag LOCUS_08130 1397 921 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_08130 2043 1399 gene locus_tag LOCUS_08140 gene pdxH 2043 1399 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 protein_id gnl|my_center|LOCUS_08140 2972 2070 gene locus_tag LOCUS_08150 gene rnz 2972 2070 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_08150 3302 2976 gene locus_tag LOCUS_08160 3302 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 4243 3302 gene locus_tag LOCUS_08170 gene pyrB 4243 3302 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_08170 4785 4243 gene locus_tag LOCUS_08180 gene pyrR1 4785 4243 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_08180 <6012 4885 gene locus_tag LOCUS_08190 <6012 4885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963900.1:30S ribosomal protein S1 >Feature sequence095 399 1382 gene locus_tag LOCUS_08200 gene hemB 399 1382 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN2 protein_id gnl|my_center|LOCUS_08200 1379 2527 gene locus_tag LOCUS_08210 1379 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 3566 2529 gene locus_tag LOCUS_08220 gene tas 3566 2529 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962241.1 protein_id gnl|my_center|LOCUS_08220 4471 3575 gene locus_tag LOCUS_08230 4471 3575 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_08230 5242 4481 gene locus_tag LOCUS_08240 gene xth 5242 4481 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_08240 <5898 5345 gene locus_tag LOCUS_08250 <5898 5345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2A9:glycine--tRNA ligase >Feature sequence096 1537 584 gene locus_tag LOCUS_08260 gene tktC 1537 584 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_08260 2393 1548 gene locus_tag LOCUS_08270 gene tktA 2393 1548 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_08270 2544 3674 gene locus_tag LOCUS_08280 gene tgt 2544 3674 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_08280 3676 4749 gene locus_tag LOCUS_08290 3676 4749 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_08290 4736 5650 gene locus_tag LOCUS_08300 4736 5650 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence097 536 3064 gene locus_tag LOCUS_08310 536 3064 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_08310 3084 4586 gene locus_tag LOCUS_08320 3084 4586 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203446.1 protein_id gnl|my_center|LOCUS_08320 4612 5208 gene locus_tag LOCUS_08330 4612 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence098 1366 2298 gene locus_tag LOCUS_08340 1366 2298 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_08340 2273 3235 gene locus_tag LOCUS_08350 2273 3235 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_08350 3213 3959 gene locus_tag LOCUS_08360 gene aroE 3213 3959 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_08360 4031 4207 gene locus_tag LOCUS_08370 4031 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence099 <1 1063 gene locus_tag LOCUS_08380 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962749.1:ABC transporter 2114 1056 gene locus_tag LOCUS_08390 2114 1056 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_08390 2348 2635 gene locus_tag LOCUS_08400 2348 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 3576 2767 gene locus_tag LOCUS_08410 3576 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263015.1 protein_id gnl|my_center|LOCUS_08410 4098 3634 gene locus_tag LOCUS_08420 4098 3634 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_08420 4250 5497 gene locus_tag LOCUS_08430 4250 5497 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259114.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence100 1136 690 gene locus_tag LOCUS_08440 1136 690 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_08440 3004 1241 gene locus_tag LOCUS_08450 gene fadD 3004 1241 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_08450 <5721 3069 gene locus_tag LOCUS_08460 <5721 3069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXH5:phosphoribosylformylglycinamidine synthase >Feature sequence101 1669 2586 gene locus_tag LOCUS_08470 1669 2586 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_08470 2598 4745 gene locus_tag LOCUS_08480 2598 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence102 179 802 gene locus_tag LOCUS_08490 179 802 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_08490 2036 846 gene locus_tag LOCUS_08500 gene kbl 2036 846 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_08500 2084 2998 gene locus_tag LOCUS_08510 gene ltd 2084 2998 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_08510 4444 2978 gene locus_tag LOCUS_08520 gene phrB2 4444 2978 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964141.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence103 1088 312 gene locus_tag LOCUS_08530 1088 312 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_08530 1492 1085 gene locus_tag LOCUS_08540 1492 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 2084 1494 gene locus_tag LOCUS_08550 gene def 2084 1494 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_08550 2503 2081 gene locus_tag LOCUS_08560 2503 2081 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_08560 2593 3399 gene locus_tag LOCUS_08570 gene dapD 2593 3399 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_08570 4309 3401 gene locus_tag LOCUS_08580 4309 3401 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_08580 4385 5422 gene locus_tag LOCUS_08590 4385 5422 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016813.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence104 <1 942 gene locus_tag LOCUS_08600 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964076.1:arginase 1035 2393 gene locus_tag LOCUS_08610 gene gldK 1035 2393 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_08610 2433 3092 gene locus_tag LOCUS_08620 gene gldL 2433 3092 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_08620 3118 4710 gene locus_tag LOCUS_08630 gene gldM 3118 4710 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence105 <1 1511 gene locus_tag LOCUS_08640 <1 1511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYT6:peptide chain release factor 3 1834 1526 gene locus_tag LOCUS_08650 1834 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_08650 <5375 1843 gene locus_tag LOCUS_08660 <5375 1843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYT9:DNA-directed RNA polymerase subunit beta' >Feature sequence106 301 501 gene locus_tag LOCUS_08670 301 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 2272 536 gene locus_tag LOCUS_08680 gene ygaD 2272 536 CDS product putative multidrug export ATP-binding/permease protein YgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71082 protein_id gnl|my_center|LOCUS_08680 3553 2336 gene locus_tag LOCUS_08690 3553 2336 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_08690 4120 3569 gene locus_tag LOCUS_08700 4120 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 4323 4982 gene locus_tag LOCUS_08710 4323 4982 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_08710 5212 5286 gene locus_tag LOCUS_t00110 5212 5286 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence107 <1 942 gene locus_tag LOCUS_08720 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962575.1:UDP-glucose 4-epimerase 979 1863 gene locus_tag LOCUS_08730 979 1863 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_08730 3350 1860 gene locus_tag LOCUS_08740 3350 1860 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence108 1216 569 gene locus_tag LOCUS_08750 1216 569 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_08750 2251 1226 gene locus_tag LOCUS_08760 2251 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964016.1 protein_id gnl|my_center|LOCUS_08760 3243 2260 gene locus_tag LOCUS_08770 3243 2260 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_08770 3289 3930 gene locus_tag LOCUS_08780 gene pcm 3289 3930 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_08780 4634 4152 gene locus_tag LOCUS_08790 gene smpB 4634 4152 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 protein_id gnl|my_center|LOCUS_08790 >Feature sequence109 1526 4072 gene locus_tag LOCUS_08800 gene clpA 1526 4072 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence110 88 16 gene locus_tag LOCUS_t00120 88 16 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2733 163 gene locus_tag LOCUS_08810 gene mutS 2733 163 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWN3 protein_id gnl|my_center|LOCUS_08810 2852 3382 gene locus_tag LOCUS_08820 2852 3382 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_08820 4493 3372 gene locus_tag LOCUS_08830 4493 3372 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962567.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence111 2734 1406 gene locus_tag LOCUS_08840 2734 1406 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250835.1 protein_id gnl|my_center|LOCUS_08840 4422 2800 gene locus_tag LOCUS_08850 4422 2800 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_08850 >Feature sequence112 1008 418 gene locus_tag LOCUS_08860 1008 418 CDS product SOUL heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022600.1 protein_id gnl|my_center|LOCUS_08860 1222 998 gene locus_tag LOCUS_08870 1222 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1315 3402 gene locus_tag LOCUS_08880 1315 3402 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918909.1 protein_id gnl|my_center|LOCUS_08880 4525 3395 gene locus_tag LOCUS_08890 4525 3395 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence113 1628 141 gene locus_tag LOCUS_08900 1628 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2310 1633 gene locus_tag LOCUS_08910 2310 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2506 3498 gene locus_tag LOCUS_08920 gene lpxD 2506 3498 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZZ4 protein_id gnl|my_center|LOCUS_08920 4218 3514 gene locus_tag LOCUS_08930 gene agaI 4218 3514 CDS product putative galactosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42912 protein_id gnl|my_center|LOCUS_08930 <4999 4229 gene locus_tag LOCUS_08940 <4999 4229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964485.1:peptidase S8 >Feature sequence114 1486 2454 gene locus_tag LOCUS_08950 1486 2454 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_08950 2470 3675 gene locus_tag LOCUS_08960 2470 3675 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858692.1 protein_id gnl|my_center|LOCUS_08960 3668 4798 gene locus_tag LOCUS_08970 3668 4798 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122159.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence115 1989 835 gene locus_tag LOCUS_08980 1989 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 2139 3710 gene locus_tag LOCUS_08990 2139 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 4359 3673 gene locus_tag LOCUS_09000 4359 3673 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence116 494 324 gene locus_tag LOCUS_09010 494 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1223 549 gene locus_tag LOCUS_09020 1223 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3662 1236 gene locus_tag LOCUS_09030 gene pheT 3662 1236 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_09030 <4819 3719 gene locus_tag LOCUS_09040 <4819 3719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYD1:ATP-dependent DNA helicase RecG >Feature sequence117 <1 1130 gene locus_tag LOCUS_09050 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZ68:citrate synthase 1542 1120 gene locus_tag LOCUS_09060 1542 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1622 3388 gene locus_tag LOCUS_09070 gene argS 1622 3388 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 protein_id gnl|my_center|LOCUS_09070 >Feature sequence118 75 626 gene locus_tag LOCUS_09080 75 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 619 1440 gene locus_tag LOCUS_09090 gene map 619 1440 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_09090 1443 2195 gene locus_tag LOCUS_09100 1443 2195 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_09100 2219 2812 gene locus_tag LOCUS_09110 2219 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_09110 2812 3510 gene locus_tag LOCUS_09120 2812 3510 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_09120 3547 3951 gene locus_tag LOCUS_09130 3547 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403019.1 protein_id gnl|my_center|LOCUS_09130 3971 4654 gene locus_tag LOCUS_09140 3971 4654 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence119 2283 2504 gene locus_tag LOCUS_09150 2283 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 3883 2507 gene locus_tag LOCUS_09160 gene aldH 3883 2507 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY15 protein_id gnl|my_center|LOCUS_09160 <4718 3886 gene locus_tag LOCUS_09170 <4718 3886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090363.1:sugar phosphate isomerase >Feature sequence120 <1 1166 gene locus_tag LOCUS_09180 <1 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783769.1:signal peptidase I 1163 1747 gene locus_tag LOCUS_09190 1163 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_09190 2282 1758 gene locus_tag LOCUS_09200 2282 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2419 2577 gene locus_tag LOCUS_09210 2419 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 3346 2606 gene locus_tag LOCUS_09220 3346 2606 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_09220 <4670 3346 gene locus_tag LOCUS_09230 <4670 3346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYR1:DNA mismatch repair protein MutL >Feature sequence121 451 1989 gene locus_tag LOCUS_09240 gene pcd 451 1989 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_09240 2070 2384 gene locus_tag LOCUS_09250 2070 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 2407 3441 gene locus_tag LOCUS_09260 gene gpsA 2407 3441 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_09260 4454 3438 gene locus_tag LOCUS_09270 gene pheS 4454 3438 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_09270 >Feature sequence122 788 93 gene locus_tag LOCUS_09280 788 93 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_09280 2077 785 gene locus_tag LOCUS_09290 2077 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 3042 2128 gene locus_tag LOCUS_09300 3042 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 4056 3049 gene locus_tag LOCUS_09310 gene obg 4056 3049 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB7 protein_id gnl|my_center|LOCUS_09310 <4623 4058 gene locus_tag LOCUS_09320 <4623 4058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZB9:adenylate kinase >Feature sequence123 1308 52 gene locus_tag LOCUS_09330 gene fabF 1308 52 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_09330 1554 1324 gene locus_tag LOCUS_09340 gene acpP 1554 1324 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_09340 1704 2282 gene locus_tag LOCUS_09350 gene purN 1704 2282 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_09350 2279 2734 gene locus_tag LOCUS_09360 gene rnhA 2279 2734 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_09360 2787 3707 gene locus_tag LOCUS_09370 2787 3707 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence124 <1 1025 gene locus_tag LOCUS_09380 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003021415.1:gamma-glutamyltranspeptidase 1025 1780 gene locus_tag LOCUS_09390 1025 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086844.1 protein_id gnl|my_center|LOCUS_09390 1782 2747 gene locus_tag LOCUS_09400 1782 2747 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931393.1 protein_id gnl|my_center|LOCUS_09400 3680 2760 gene locus_tag LOCUS_09410 3680 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 >Feature sequence125 <1 2604 gene locus_tag LOCUS_09420 <1 2604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405586.1:T9SS C-terminal target domain-containing protein 2760 3170 gene locus_tag LOCUS_09430 2760 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 4261 3263 gene locus_tag LOCUS_09440 4261 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence126 801 25 gene locus_tag LOCUS_09450 801 25 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203148.1 protein_id gnl|my_center|LOCUS_09450 833 1978 gene locus_tag LOCUS_09460 833 1978 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 protein_id gnl|my_center|LOCUS_09460 2754 2008 gene locus_tag LOCUS_09470 gene sdhB 2754 2008 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_09470 <4444 2758 gene locus_tag LOCUS_09480 <4444 2758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962273.1:succinate dehydrogenase >Feature sequence127 2018 840 gene locus_tag LOCUS_09490 gene acd 2018 840 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_09490 2813 2031 gene locus_tag LOCUS_09500 2813 2031 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_09500 3302 2817 gene locus_tag LOCUS_09510 gene nodN 3302 2817 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086244.1 protein_id gnl|my_center|LOCUS_09510 4073 3330 gene locus_tag LOCUS_09520 4073 3330 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence128 <1 1164 gene locus_tag LOCUS_09530 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H296:bifunctional purine biosynthesis protein PurH 1200 2219 gene locus_tag LOCUS_09540 gene mreB 1200 2219 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_09540 2359 3015 gene locus_tag LOCUS_09550 gene mreC 2359 3015 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 protein_id gnl|my_center|LOCUS_09550 3015 3515 gene locus_tag LOCUS_09560 3015 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence129 1160 801 gene locus_tag LOCUS_09570 1160 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2801 1194 gene locus_tag LOCUS_09580 gene pckA 2801 1194 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109906.1 protein_id gnl|my_center|LOCUS_09580 <4254 2930 gene locus_tag LOCUS_09590 <4254 2930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071882.1:membrane protein >Feature sequence130 <1 3679 gene locus_tag LOCUS_09600 <1 3679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWI1:DNA-directed DNA polymerase 3767 4084 gene locus_tag LOCUS_09610 3767 4084 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_09610 4168 4242 gene locus_tag LOCUS_t00130 4168 4242 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence131 792 136 gene locus_tag LOCUS_09620 792 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence132 1689 1072 gene locus_tag LOCUS_09630 gene recR 1689 1072 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_09630 1714 3246 gene locus_tag LOCUS_09640 1714 3246 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_09640 3573 3208 gene locus_tag LOCUS_09650 3573 3208 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_09650 <4221 3567 gene locus_tag LOCUS_09660 <4221 3567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZQ1:3-oxoacyl-[acyl-carrier-protein] synthase 3 >Feature sequence133 588 166 gene locus_tag LOCUS_09670 588 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1275 595 gene locus_tag LOCUS_09680 1275 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2221 1292 gene locus_tag LOCUS_09690 2221 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2453 4033 gene locus_tag LOCUS_09700 2453 4033 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence134 1380 676 gene locus_tag LOCUS_09710 gene truB 1380 676 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_09710 2146 1367 gene locus_tag LOCUS_09720 gene uppP 2146 1367 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_09720 2391 2146 gene locus_tag LOCUS_09730 gene fjo13 2391 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_09730 3256 2378 gene locus_tag LOCUS_09740 gene ftsX 3256 2378 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_09740 >Feature sequence135 1473 1330 gene locus_tag LOCUS_09750 1473 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1653 2720 gene locus_tag LOCUS_09760 1653 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963908.1 protein_id gnl|my_center|LOCUS_09760 2729 3865 gene locus_tag LOCUS_09770 gene yghO 2729 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence136 <1 730 gene locus_tag LOCUS_09780 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX10:DNA gyrase subunit B 746 1681 gene locus_tag LOCUS_09790 gene mdh 746 1681 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX11 protein_id gnl|my_center|LOCUS_09790 >Feature sequence137 <1 1442 gene locus_tag LOCUS_09800 <1 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964422.1:tail-specific protease 2582 1461 gene locus_tag LOCUS_09810 gene rodA 2582 1461 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_09810 <4047 2713 gene locus_tag LOCUS_09820 <4047 2713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964508.1:penicillin-binding protein 2 >Feature sequence138 <1 1289 gene locus_tag LOCUS_09830 <1 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703431.1:Xaa-Pro aminopeptidase 2581 1286 gene locus_tag LOCUS_09840 2581 1286 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_09840 3504 2581 gene locus_tag LOCUS_09850 gene thrB 3504 2581 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_09850 4037 3507 gene locus_tag LOCUS_09860 4037 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence139 1944 775 gene locus_tag LOCUS_09870 1944 775 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_09870 2348 1944 gene locus_tag LOCUS_09880 2348 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 2868 2527 gene locus_tag LOCUS_09890 2868 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence140 3502 1622 gene locus_tag LOCUS_09900 gene htpG 3502 1622 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_09900 >Feature sequence141 895 272 gene locus_tag LOCUS_09910 895 272 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932936.1 protein_id gnl|my_center|LOCUS_09910 1892 912 gene locus_tag LOCUS_09920 1892 912 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_09920 2175 1951 gene locus_tag LOCUS_09930 2175 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 2411 3877 gene locus_tag LOCUS_09940 gene guaB 2411 3877 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_09940 >Feature sequence142 748 209 gene locus_tag LOCUS_09950 748 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1476 751 gene locus_tag LOCUS_09960 1476 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 2515 1586 gene locus_tag LOCUS_09970 2515 1586 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence143 60 2498 gene locus_tag LOCUS_09980 60 2498 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529751.1 protein_id gnl|my_center|LOCUS_09980 3203 2502 gene locus_tag LOCUS_09990 3203 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 3288 3812 gene locus_tag LOCUS_10000 3288 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence144 1565 54 gene locus_tag LOCUS_10010 gene gpmI 1565 54 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_10010 1655 2587 gene locus_tag LOCUS_10020 gene rsgA 1655 2587 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 protein_id gnl|my_center|LOCUS_10020 2584 3036 gene locus_tag LOCUS_10030 gene dtd 2584 3036 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 protein_id gnl|my_center|LOCUS_10030 <3945 3037 gene locus_tag LOCUS_10040 <3945 3037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H136:UDP-N-acetylenolpyruvoylglucosamine reductase >Feature sequence145 552 1904 gene locus_tag LOCUS_10050 552 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2640 1873 gene locus_tag LOCUS_10060 2640 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3099 2650 gene locus_tag LOCUS_10070 3099 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence146 468 3497 gene locus_tag LOCUS_10080 468 3497 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence147 650 132 gene locus_tag LOCUS_10090 gene mrsB1 650 132 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963828.1 protein_id gnl|my_center|LOCUS_10090 736 2082 gene locus_tag LOCUS_10100 736 2082 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence148 <1 1481 gene locus_tag LOCUS_10110 <1 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXZ1:chaperone protein DnaK 1534 1947 gene locus_tag LOCUS_10120 1534 1947 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_10120 2049 2969 gene locus_tag LOCUS_10130 gene yyaK 2049 2969 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_10130 2998 3177 gene locus_tag LOCUS_10140 2998 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence149 <1 928 gene locus_tag LOCUS_10150 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXF1:chaperone protein DnaJ 1001 1846 gene locus_tag LOCUS_10160 1001 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1849 3012 gene locus_tag LOCUS_10170 1849 3012 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence150 1200 289 gene locus_tag LOCUS_10180 1200 289 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_10180 2677 1235 gene locus_tag LOCUS_10190 2677 1235 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence151 1971 883 gene locus_tag LOCUS_10200 1971 883 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_10200 2713 1994 gene locus_tag LOCUS_10210 2713 1994 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_10210 <3813 2715 gene locus_tag LOCUS_10220 <3813 2715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H010:tRNA N6-adenosine threonylcarbamoyltransferase >Feature sequence152 201 611 gene locus_tag LOCUS_10230 201 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704230.1 protein_id gnl|my_center|LOCUS_10230 1893 616 gene locus_tag LOCUS_10240 gene gltP 1893 616 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_10240 2979 1909 gene locus_tag LOCUS_10250 gene aroC 2979 1909 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_10250 >Feature sequence153 <1 608 gene locus_tag LOCUS_10260 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY97:acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase 611 1174 gene locus_tag LOCUS_10270 gene efp 611 1174 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_10270 1199 2071 gene locus_tag LOCUS_10280 gene sucD 1199 2071 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_10280 2072 2818 gene locus_tag LOCUS_10290 2072 2818 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_10290 2861 3679 gene locus_tag LOCUS_10300 2861 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887127.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence154 1370 540 gene locus_tag LOCUS_10310 gene fjo14 1370 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_10310 1465 2415 gene locus_tag LOCUS_10320 gene phoH 1465 2415 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_10320 2419 3360 gene locus_tag LOCUS_10330 gene purC 2419 3360 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_10330 >Feature sequence155 <3670 2863 gene locus_tag LOCUS_10340 <3670 2863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962543.1:cytochrome c >Feature sequence156 1952 858 gene locus_tag LOCUS_10350 gene engD 1952 858 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC6 protein_id gnl|my_center|LOCUS_10350 2306 1959 gene locus_tag LOCUS_10360 gene fdx1 2306 1959 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_10360 2364 3377 gene locus_tag LOCUS_10370 2364 3377 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence157 1216 2094 gene locus_tag LOCUS_10380 1216 2094 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 protein_id gnl|my_center|LOCUS_10380 2286 2894 gene locus_tag LOCUS_10390 2286 2894 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_10390 <3596 2904 gene locus_tag LOCUS_10400 <3596 2904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q53WD3:carbohydrate deacetylase >Feature sequence158 <1 647 gene locus_tag LOCUS_10410 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963116.1:exopolyphosphatase 1202 636 gene locus_tag LOCUS_10420 1202 636 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963114.1 protein_id gnl|my_center|LOCUS_10420 2326 1253 gene locus_tag LOCUS_10430 2326 1253 CDS product DNA polymerase III, subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963113.1 protein_id gnl|my_center|LOCUS_10430 3244 2699 gene locus_tag LOCUS_10440 3244 2699 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence159 1555 362 gene locus_tag LOCUS_10450 gene argD 1555 362 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_10450 3165 1552 gene locus_tag LOCUS_10460 3165 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_10460 3521 3231 gene locus_tag LOCUS_10470 3521 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence160 164 985 gene locus_tag LOCUS_10480 gene tsf 164 985 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_10480 1053 1616 gene locus_tag LOCUS_10490 gene tag 1053 1616 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_10490 2005 1613 gene locus_tag LOCUS_10500 2005 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_10500 2230 3249 gene locus_tag LOCUS_10510 gene porY 2230 3249 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence161 >Feature sequence162 474 1667 gene locus_tag LOCUS_10520 474 1667 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 protein_id gnl|my_center|LOCUS_10520 1677 2795 gene locus_tag LOCUS_10530 1677 2795 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence163 <1 1007 gene locus_tag LOCUS_10540 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962373.1:amidophosphoribosyltransferase 1637 1026 gene locus_tag LOCUS_10550 gene sodA 1637 1026 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_10550 >Feature sequence164 2496 3392 gene locus_tag LOCUS_10560 2496 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence165 196 1197 gene locus_tag LOCUS_10570 gene pdhA 196 1197 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_10570 1199 2803 gene locus_tag LOCUS_10580 gene pdhC 1199 2803 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_10580 >Feature sequence166 57 2240 gene locus_tag LOCUS_10590 57 2240 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_10590 2701 2237 gene locus_tag LOCUS_10600 2701 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 2761 3237 gene locus_tag LOCUS_10610 gene greA 2761 3237 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_10610 >Feature sequence167 <1 2873 gene locus_tag LOCUS_10620 <1 2873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107964.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence168 1281 532 gene locus_tag LOCUS_10630 gene tpiA 1281 532 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI2 protein_id gnl|my_center|LOCUS_10630 1824 1288 gene locus_tag LOCUS_10640 1824 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_10640 1888 2709 gene locus_tag LOCUS_10650 gene folP 1888 2709 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_10650 >Feature sequence169 443 2050 gene locus_tag LOCUS_10660 443 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 2199 3320 gene locus_tag LOCUS_10670 2199 3320 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VS5 protein_id gnl|my_center|LOCUS_10670 >Feature sequence170 83 2620 gene locus_tag LOCUS_10680 gene bamA 83 2620 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence171 109 1782 gene locus_tag LOCUS_10690 109 1782 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705768.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence172 55 384 gene locus_tag LOCUS_10700 55 384 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_10700 385 1620 gene locus_tag LOCUS_10710 gene aroA 385 1620 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW83 protein_id gnl|my_center|LOCUS_10710 1679 2734 gene locus_tag LOCUS_10720 gene queA 1679 2734 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_10720 >Feature sequence173 2747 12 gene locus_tag LOCUS_10730 2747 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence174 >Feature sequence175 <1 703 gene locus_tag LOCUS_10740 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962582.1:fatty acid desaturase 719 1906 gene locus_tag LOCUS_10750 gene aspC1 719 1906 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_10750 2991 1909 gene locus_tag LOCUS_10760 2991 1909 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence176 1045 470 gene locus_tag LOCUS_10770 1045 470 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_10770 1520 1047 gene locus_tag LOCUS_10780 gene rlmH 1520 1047 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_10780 1656 2519 gene locus_tag LOCUS_10790 gene yfkH 1656 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence177 1738 1583 gene locus_tag LOCUS_10800 1738 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2681 1923 gene locus_tag LOCUS_10810 2681 1923 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_10810 2837 2709 gene locus_tag LOCUS_10820 2837 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2993 2850 gene locus_tag LOCUS_10830 2993 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence178 244 98 gene locus_tag LOCUS_10840 244 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 777 364 gene locus_tag LOCUS_10850 777 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 <3131 774 gene locus_tag LOCUS_10860 <3131 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962810.1:DNA topoisomerase IV subunit A >Feature sequence179 89 538 gene locus_tag LOCUS_10870 gene crtZ 89 538 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_10870 1931 531 gene locus_tag LOCUS_10880 gene surA 1931 531 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT1 protein_id gnl|my_center|LOCUS_10880 2709 1891 gene locus_tag LOCUS_10890 2709 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence180 90 1760 gene locus_tag LOCUS_10900 gene asnB 90 1760 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence181 166 918 gene locus_tag LOCUS_10910 166 918 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_10910 2048 915 gene locus_tag LOCUS_10920 gene ribBA 2048 915 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence182 670 1068 gene locus_tag LOCUS_10930 670 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 <3104 1063 gene locus_tag LOCUS_10940 <3104 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWV8:translation initiation factor IF-2 >Feature sequence183 <1 1339 gene locus_tag LOCUS_10950 <1 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974050.1:PIG-L domain-containing protein >Feature sequence184 940 449 gene locus_tag LOCUS_10960 940 449 CDS product GAF domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_10960 1039 1725 gene locus_tag LOCUS_10970 1039 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1744 2163 gene locus_tag LOCUS_10980 1744 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence185 909 1790 gene locus_tag LOCUS_10990 909 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence186 <1 667 gene locus_tag LOCUS_11000 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962785.1:ABC transporter ATP-binding protein 719 1771 gene locus_tag LOCUS_11010 719 1771 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_11010 2695 1778 gene locus_tag LOCUS_11020 2695 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence187 407 1552 gene locus_tag LOCUS_11030 407 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence188 <1 1407 gene locus_tag LOCUS_11040 <1 1407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964133.1:TonB-dependent receptor 1423 1782 gene locus_tag LOCUS_11050 1423 1782 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964132.1 protein_id gnl|my_center|LOCUS_11050 <3007 1819 gene locus_tag LOCUS_11060 <3007 1819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H125:60 kDa chaperonin >Feature sequence189 30 1097 gene locus_tag LOCUS_11070 gene serC 30 1097 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 protein_id gnl|my_center|LOCUS_11070 1103 2056 gene locus_tag LOCUS_11080 gene serA 1103 2056 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_11080 2905 2375 gene locus_tag LOCUS_11090 gene msrA 2905 2375 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_11090 >Feature sequence190 203 1135 gene locus_tag LOCUS_11100 gene nusB 203 1135 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_11100 1181 1687 gene locus_tag LOCUS_11110 1181 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_11110 1691 1987 gene locus_tag LOCUS_11120 gene yajC 1691 1987 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence191 942 10 gene locus_tag LOCUS_11130 gene ppiC 942 10 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_11130 <2923 1008 gene locus_tag LOCUS_11140 <2923 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963365.1:ATP-dependent DNA helicase RecQ >Feature sequence192 1804 1031 gene locus_tag LOCUS_11150 gene lpxH 1804 1031 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_11150 <2917 1826 gene locus_tag LOCUS_11160 <2917 1826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962525.1:cystathionine beta-lyase >Feature sequence193 >Feature sequence194 <1 752 gene locus_tag LOCUS_11170 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8AB53:putative glucosamine-6-phosphate deaminase-like protein 754 1452 gene locus_tag LOCUS_11180 754 1452 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_11180 1449 2774 gene locus_tag LOCUS_11190 1449 2774 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence195 323 63 gene locus_tag LOCUS_11200 gene rpmA 323 63 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P8 protein_id gnl|my_center|LOCUS_11200 852 334 gene locus_tag LOCUS_11210 852 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1293 925 gene locus_tag LOCUS_11220 1293 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_11220 2328 1321 gene locus_tag LOCUS_11230 gene rmlB 2328 1321 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_11230 <2880 2315 gene locus_tag LOCUS_11240 <2880 2315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107282.1:NAD(P)-dependent oxidoreductase >Feature sequence196 375 1571 gene locus_tag LOCUS_11250 gene mntH 375 1571 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_11250 1610 2326 gene locus_tag LOCUS_11260 1610 2326 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HH05 protein_id gnl|my_center|LOCUS_11260 >Feature sequence197 >Feature sequence198 <1 934 gene locus_tag LOCUS_11270 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H289:dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex 1278 931 gene locus_tag LOCUS_11280 1278 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1421 2161 gene locus_tag LOCUS_11290 1421 2161 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_11290 <2824 2163 gene locus_tag LOCUS_11300 <2824 2163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405586.1:T9SS C-terminal target domain-containing protein >Feature sequence199 >Feature sequence200 2198 1053 gene locus_tag LOCUS_11310 2198 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence201 138 662 gene locus_tag LOCUS_11320 gene rimM 138 662 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_11320 710 1885 gene locus_tag LOCUS_11330 gene gcdH 710 1885 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_11330 2620 2030 gene locus_tag LOCUS_11340 2620 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence202 <1 1051 gene locus_tag LOCUS_11350 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108338.1:histidinol-phosphatase 2321 1065 gene locus_tag LOCUS_11360 2321 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence203 549 1064 gene locus_tag LOCUS_11370 gene kdsC 549 1064 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_11370 1069 1653 gene locus_tag LOCUS_11380 1069 1653 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_11380 >Feature sequence204 <1 2284 gene locus_tag LOCUS_11390 <1 2284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962462.1:DNA polymerase I >Feature sequence205 1817 207 gene locus_tag LOCUS_11400 1817 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence206 308 233 gene locus_tag LOCUS_t00140 308 233 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1171 479 gene locus_tag LOCUS_11410 1171 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1319 1906 gene locus_tag LOCUS_11420 1319 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2040 1968 gene locus_tag LOCUS_t00150 2040 1968 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2543 2295 gene locus_tag LOCUS_11430 2543 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence207 >Feature sequence208 682 101 gene locus_tag LOCUS_11440 682 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1080 703 gene locus_tag LOCUS_11450 gene dksA 1080 703 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_11450 <2679 1081 gene locus_tag LOCUS_11460 <2679 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW60:isoleucine--tRNA ligase >Feature sequence209 77 715 gene locus_tag LOCUS_11470 77 715 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 protein_id gnl|my_center|LOCUS_11470 721 2535 gene locus_tag LOCUS_11480 721 2535 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932396.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence210 1427 1080 gene locus_tag LOCUS_11490 1427 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1551 2273 gene locus_tag LOCUS_11500 1551 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence211 1208 513 gene locus_tag LOCUS_11510 gene dapB 1208 513 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_11510 1761 1213 gene locus_tag LOCUS_11520 1761 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_11520 2632 1754 gene locus_tag LOCUS_11530 gene parB 2632 1754 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence212 374 1060 gene locus_tag LOCUS_11540 gene folE2 374 1060 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_11540 1053 2531 gene locus_tag LOCUS_11550 gene cysS 1053 2531 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_11550 >Feature sequence213 465 10 gene locus_tag LOCUS_11560 465 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1296 667 gene locus_tag LOCUS_11570 1296 667 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172128.1 protein_id gnl|my_center|LOCUS_11570 1669 1331 gene locus_tag LOCUS_11580 1669 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 2007 1666 gene locus_tag LOCUS_11590 2007 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 <2628 1997 gene locus_tag LOCUS_11600 <2628 1997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005172134.1:lipoprotein >Feature sequence214 428 2182 gene locus_tag LOCUS_11610 428 2182 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence215 <1 672 gene locus_tag LOCUS_11620 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963756.1:tRNA nucleotidyltransferase 665 1690 gene locus_tag LOCUS_11630 665 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1687 2169 gene locus_tag LOCUS_11640 1687 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence216 1702 677 gene locus_tag LOCUS_11650 gene ltaE 1702 677 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_11650 <2519 1705 gene locus_tag LOCUS_11660 <2519 1705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070915.1:periplasmic metalloprotease >Feature sequence217 1247 1873 gene locus_tag LOCUS_11670 1247 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence218 <1 1602 gene locus_tag LOCUS_11680 <1 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963026.1:oligopeptidase B >Feature sequence219 >Feature sequence220 965 204 gene locus_tag LOCUS_11690 965 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 <2452 1082 gene locus_tag LOCUS_11700 <2452 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962850.1:collagen-binding protein >Feature sequence221 >Feature sequence222 <1 1238 gene locus_tag LOCUS_11710 <1 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000858692.1:nucleoside permease 1231 2361 gene locus_tag LOCUS_11720 1231 2361 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970271.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence223 >Feature sequence224 <1 1509 gene locus_tag LOCUS_11730 <1 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202214.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence225 <1 902 gene locus_tag LOCUS_11740 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142120.1:phosphoribulokinase 877 1530 gene locus_tag LOCUS_11750 877 1530 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902869.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence226 2281 830 gene locus_tag LOCUS_11760 2281 830 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence227 495 1271 gene locus_tag LOCUS_11770 gene surE 495 1271 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_11770 1264 1545 gene locus_tag LOCUS_11780 1264 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence228 1093 584 gene locus_tag LOCUS_11790 1093 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_11790 1407 2198 gene locus_tag LOCUS_11800 1407 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence229 2403 1447 gene locus_tag LOCUS_11810 gene accA 2403 1447 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_11810 >Feature sequence230 907 1677 gene locus_tag LOCUS_11820 907 1677 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963758.1 protein_id gnl|my_center|LOCUS_11820 1685 2173 gene locus_tag LOCUS_11830 1685 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence231 143 958 gene locus_tag LOCUS_11840 143 958 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_11840 2007 967 gene locus_tag LOCUS_11850 gene thiL 2007 967 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_11850 >Feature sequence232 1492 584 gene locus_tag LOCUS_11860 1492 584 CDS product CDP-abequose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561952.1 protein_id gnl|my_center|LOCUS_11860 1952 1500 gene locus_tag LOCUS_11870 1952 1500 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045300.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence233 <1 1222 gene locus_tag LOCUS_11880 <1 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963704.1:DNA translocase FtsK 1209 1853 gene locus_tag LOCUS_11890 1209 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence234 <1 579 gene locus_tag LOCUS_11900 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108084.1:peptidase M23 583 2076 gene locus_tag LOCUS_11910 583 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence235 <1 598 gene locus_tag LOCUS_11920 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H128:carbamoyl-phosphate synthase (glutamine-hydrolyzing) 2072 606 gene locus_tag LOCUS_11930 2072 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence236 1447 620 gene locus_tag LOCUS_11940 1447 620 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_11940 <2284 1484 gene locus_tag LOCUS_11950 <2284 1484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964019.1:exonuclease >Feature sequence237 2 490 gene locus_tag LOCUS_11960 2 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 487 1047 gene locus_tag LOCUS_11970 gene ruvC 487 1047 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_11970 1167 2234 gene locus_tag LOCUS_11980 1167 2234 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence238 <2261 632 gene locus_tag LOCUS_11990 <2261 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202214.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence239 532 870 gene locus_tag LOCUS_12000 532 870 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763126.1 protein_id gnl|my_center|LOCUS_12000 878 2095 gene locus_tag LOCUS_12010 878 2095 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_12010 >Feature sequence240 >Feature sequence241 <1 1097 gene locus_tag LOCUS_12020 <1 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962584.1:1-pyrroline-5-carboxylate dehydrogenase 1720 1079 gene locus_tag LOCUS_12030 gene rsmG 1720 1079 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_12030 >Feature sequence242 1690 230 gene locus_tag LOCUS_12040 1690 230 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence243 <1 856 gene locus_tag LOCUS_12050 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038867.1:N-acyl-L-amino acid amidohydrolase >Feature sequence244 <2213 283 gene locus_tag LOCUS_12060 <2213 283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962910.1:organic solvent tolerance protein OstA >Feature sequence245 413 1609 gene locus_tag LOCUS_12070 gene mnmA 413 1609 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_12070 >Feature sequence246 364 1137 gene locus_tag LOCUS_12080 364 1137 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_12080 1144 1752 gene locus_tag LOCUS_12090 1144 1752 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence247 381 1076 gene locus_tag LOCUS_12100 gene cutC 381 1076 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCA5 protein_id gnl|my_center|LOCUS_12100 1155 1694 gene locus_tag LOCUS_12110 1155 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence248 146 1717 gene locus_tag LOCUS_12120 146 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence249 929 249 gene locus_tag LOCUS_12130 929 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 <2168 929 gene locus_tag LOCUS_12140 <2168 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963836.1:acyl-CoA dehydrogenase >Feature sequence250 <1 936 gene locus_tag LOCUS_12150 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64PZ0:zinc metalloprotease 1438 1593 gene locus_tag LOCUS_12160 1438 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence251 445 257 gene locus_tag LOCUS_12170 445 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963853.1 protein_id gnl|my_center|LOCUS_12170 531 917 gene locus_tag LOCUS_12180 531 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_12180 1971 925 gene locus_tag LOCUS_12190 1971 925 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_12190 >Feature sequence252 1971 994 gene locus_tag LOCUS_12200 gene nrdB 1971 994 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence253 1802 129 gene locus_tag LOCUS_12210 gene atsA 1802 129 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122139.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence254 >Feature sequence255 101 1222 gene locus_tag LOCUS_12220 101 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_12220 1222 1626 gene locus_tag LOCUS_12230 1222 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1629 1946 gene locus_tag LOCUS_12240 1629 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence256 >Feature sequence257 51 398 gene locus_tag LOCUS_12250 gene csaA 51 398 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355771.1 protein_id gnl|my_center|LOCUS_12250 1471 404 gene locus_tag LOCUS_12260 gene leuB 1471 404 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M0 protein_id gnl|my_center|LOCUS_12260 <2046 1468 gene locus_tag LOCUS_12270 <2046 1468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789843.1:2-isopropylmalate synthase >Feature sequence258 1536 562 gene locus_tag LOCUS_12280 1536 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_12280 1958 1536 gene locus_tag LOCUS_12290 1958 1536 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence259 >Feature sequence260 114 1988 gene locus_tag LOCUS_12300 114 1988 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918824.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence261 <1991 998 gene locus_tag LOCUS_12310 <1991 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108510.1:alpha-galactosidase >Feature sequence262 96 644 gene locus_tag LOCUS_12320 96 644 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_12320 1474 641 gene locus_tag LOCUS_12330 1474 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1871 1479 gene locus_tag LOCUS_12340 1871 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence263 >Feature sequence264 2 1444 gene locus_tag LOCUS_12350 2 1444 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence265 <1 620 gene locus_tag LOCUS_12360 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW47:pyruvate kinase 633 1079 gene locus_tag LOCUS_12370 633 1079 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962372.1 protein_id gnl|my_center|LOCUS_12370 <1926 1083 gene locus_tag LOCUS_12380 <1926 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072178.1:isoaspartyl peptidase/L-asparaginase >Feature sequence266 566 3 gene locus_tag LOCUS_12390 gene gldD 566 3 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_12390 1822 566 gene locus_tag LOCUS_12400 1822 566 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence267 869 219 gene locus_tag LOCUS_12410 869 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence268 1370 588 gene locus_tag LOCUS_12420 1370 588 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence269 >Feature sequence270 >Feature sequence271 <1 717 gene locus_tag LOCUS_12430 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942076.1:sodium/solute symporter serine/threonine phosphatase >Feature sequence272 <1 823 gene locus_tag LOCUS_12440 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963229.1:gliding motility-associated ABC transporter substrate-binding protein GldG >Feature sequence273 >Feature sequence274 173 862 gene locus_tag LOCUS_12450 gene rplA 173 862 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU3 protein_id gnl|my_center|LOCUS_12450 888 1403 gene locus_tag LOCUS_12460 gene rplJ 888 1403 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU2 protein_id gnl|my_center|LOCUS_12460 >Feature sequence275 <1769 1131 gene locus_tag LOCUS_12470 <1769 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705346.1:nucleoside-diphosphate sugar epimerase >Feature sequence276 1702 113 gene locus_tag LOCUS_12480 1702 113 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence277 <1755 45 gene locus_tag LOCUS_12490 <1755 45 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143091.1:serine hydrolase >Feature sequence278 <1 694 gene locus_tag LOCUS_12500 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962693.1:protein translocase subunit SecDF 1562 711 gene locus_tag LOCUS_12510 gene lgt 1562 711 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG9 protein_id gnl|my_center|LOCUS_12510 >Feature sequence279 <1751 488 gene locus_tag LOCUS_12520 <1751 488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY90:polyphosphate kinase >Feature sequence280 >Feature sequence281 190 570 gene locus_tag LOCUS_12530 190 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 536 958 gene locus_tag LOCUS_12540 536 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962882.1 protein_id gnl|my_center|LOCUS_12540 1182 1048 gene locus_tag LOCUS_12550 1182 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 <1738 1189 gene locus_tag LOCUS_12560 <1738 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin >Feature sequence282 1244 1104 gene locus_tag LOCUS_12570 1244 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1501 1241 gene locus_tag LOCUS_12580 1501 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence283 >Feature sequence284 468 28 gene locus_tag LOCUS_12590 468 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1567 584 gene locus_tag LOCUS_12600 1567 584 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265797.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence285 >Feature sequence286 >Feature sequence287 360 845 gene locus_tag LOCUS_12610 gene purE 360 845 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_12610 >Feature sequence288 503 1147 gene locus_tag LOCUS_12620 503 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 <1686 1150 gene locus_tag LOCUS_12630 <1686 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962522.1:multidrug transporter >Feature sequence289 48 1343 gene locus_tag LOCUS_12640 gene eno 48 1343 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_12640 >Feature sequence290 90 314 gene locus_tag LOCUS_12650 90 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 393 1388 gene locus_tag LOCUS_12660 gene gnl 393 1388 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123882.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence291 <1655 194 gene locus_tag LOCUS_12670 <1655 194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963739.1:thiol:disulfide interchange protein DsbD >Feature sequence292 <1 510 gene locus_tag LOCUS_12680 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWS3:uridylate kinase 515 1066 gene locus_tag LOCUS_12690 gene frr 515 1066 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_12690 >Feature sequence293 648 1205 gene locus_tag LOCUS_12700 648 1205 CDS product translation factor Sua5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence294 507 1616 gene locus_tag LOCUS_12710 gene carA 507 1616 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_12710 >Feature sequence295 <1616 651 gene locus_tag LOCUS_12720 <1616 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX63:protein translocase subunit SecA >Feature sequence296 >Feature sequence297 >Feature sequence298 8 1255 gene locus_tag LOCUS_12730 8 1255 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence299 93 833 gene locus_tag LOCUS_12740 gene rnc 93 833 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 protein_id gnl|my_center|LOCUS_12740 826 1284 gene locus_tag LOCUS_12750 826 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962379.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence300 >Feature sequence301 >Feature sequence302 >Feature sequence303 1186 815 gene locus_tag LOCUS_12760 gene rsfS 1186 815 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_12760 >Feature sequence304 >Feature sequence305 309 383 gene locus_tag LOCUS_t00160 309 383 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 833 612 gene locus_tag LOCUS_12770 833 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12770 1004 861 gene locus_tag LOCUS_12780 1004 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780