>Feature sequence0001 2106 1156 gene locus_tag LOCUS_00010 2106 1156 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931815.1 protein_id gnl|my_center|LOCUS_00010 2393 2163 gene locus_tag LOCUS_00020 2393 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_00020 3708 2413 gene locus_tag LOCUS_00030 3708 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_00030 4117 3752 gene locus_tag LOCUS_00040 4117 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5173 4190 gene locus_tag LOCUS_00050 5173 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6546 5407 gene locus_tag LOCUS_00060 6546 5407 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_00060 6659 7945 gene locus_tag LOCUS_00070 6659 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_00070 8566 8045 gene locus_tag LOCUS_00080 8566 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10693 8648 gene locus_tag LOCUS_00090 10693 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11564 11070 gene locus_tag LOCUS_00100 11564 11070 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_00100 11593 12303 gene locus_tag LOCUS_00110 11593 12303 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_00110 >Feature sequence0002 666 19 gene locus_tag LOCUS_00120 666 19 CDS product DUF4271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962358.1 protein_id gnl|my_center|LOCUS_00120 792 1532 gene locus_tag LOCUS_00130 792 1532 CDS product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962342.1 protein_id gnl|my_center|LOCUS_00130 1532 2872 gene locus_tag LOCUS_00140 gene pyrC1 1532 2872 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_00140 2869 3312 gene locus_tag LOCUS_00150 2869 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 4301 3276 gene locus_tag LOCUS_00160 4301 3276 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_00160 4378 5676 gene locus_tag LOCUS_00170 gene tyrS 4378 5676 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 protein_id gnl|my_center|LOCUS_00170 6198 5683 gene locus_tag LOCUS_00180 6198 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 7236 6205 gene locus_tag LOCUS_00190 7236 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 8211 7237 gene locus_tag LOCUS_00200 8211 7237 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_00200 9244 8300 gene locus_tag LOCUS_00210 9244 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 9465 10148 gene locus_tag LOCUS_00220 gene phoP 9465 10148 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_00220 >Feature sequence0003 3 581 gene locus_tag LOCUS_00230 3 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 1677 1261 gene locus_tag LOCUS_00240 1677 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 2194 1679 gene locus_tag LOCUS_00250 2194 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 2391 2191 gene locus_tag LOCUS_00260 2391 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 2651 2388 gene locus_tag LOCUS_00270 2651 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 3418 2648 gene locus_tag LOCUS_00280 3418 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 3612 3415 gene locus_tag LOCUS_00290 3612 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 5295 3973 gene locus_tag LOCUS_00300 5295 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 6104 5562 gene locus_tag LOCUS_00310 6104 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 6502 6882 gene locus_tag LOCUS_00320 6502 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 6879 7784 gene locus_tag LOCUS_00330 6879 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 8169 8651 gene locus_tag LOCUS_00340 8169 8651 CDS product DNA N-6-adenine-methyltransferase of bacteriophage inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254197.1 protein_id gnl|my_center|LOCUS_00340 8648 9154 gene locus_tag LOCUS_00350 8648 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 9114 10178 gene locus_tag LOCUS_00360 9114 10178 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8J6 protein_id gnl|my_center|LOCUS_00360 >Feature sequence0004 1000 185 gene locus_tag LOCUS_00370 1000 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963207.1 protein_id gnl|my_center|LOCUS_00370 1101 1739 gene locus_tag LOCUS_00380 gene tdk 1101 1739 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_00380 1743 2852 gene locus_tag LOCUS_00390 1743 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 2934 3344 gene locus_tag LOCUS_00400 gene mscL 2934 3344 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K46 protein_id gnl|my_center|LOCUS_00400 3481 4470 gene locus_tag LOCUS_00410 gene asd 3481 4470 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_00410 4543 4941 gene locus_tag LOCUS_00420 4543 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 5067 6395 gene locus_tag LOCUS_00430 5067 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 6423 8036 gene locus_tag LOCUS_00440 6423 8036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142244.1 protein_id gnl|my_center|LOCUS_00440 8461 8279 gene locus_tag LOCUS_00450 8461 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 >Feature sequence0005 <1 1048 gene locus_tag LOCUS_00460 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVL5:phosphoglycerate kinase 1159 2709 gene locus_tag LOCUS_00470 gene mltD 1159 2709 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962200.1 protein_id gnl|my_center|LOCUS_00470 2734 3708 gene locus_tag LOCUS_00480 2734 3708 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_00480 3971 3783 gene locus_tag LOCUS_00490 3971 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 4087 4953 gene locus_tag LOCUS_00500 4087 4953 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_00500 4960 6456 gene locus_tag LOCUS_00510 4960 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_00510 6493 8181 gene locus_tag LOCUS_00520 6493 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_00520 >Feature sequence0006 1730 906 gene locus_tag LOCUS_00530 1730 906 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_00530 1822 2598 gene locus_tag LOCUS_00540 1822 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 2603 3223 gene locus_tag LOCUS_00550 2603 3223 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_00550 3277 5313 gene locus_tag LOCUS_00560 gene ppk 3277 5313 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S51 protein_id gnl|my_center|LOCUS_00560 6307 5303 gene locus_tag LOCUS_00570 6307 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119948.1 protein_id gnl|my_center|LOCUS_00570 7576 6311 gene locus_tag LOCUS_00580 7576 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_00580 <8815 7655 gene locus_tag LOCUS_00590 <8815 7655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIS7:putative K(+)-stimulated pyrophosphate-energized sodium pump >Feature sequence0007 1343 51 gene locus_tag LOCUS_00600 1343 51 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_00600 2776 1340 gene locus_tag LOCUS_00610 2776 1340 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 protein_id gnl|my_center|LOCUS_00610 3097 3897 gene locus_tag LOCUS_00620 3097 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 4598 6292 gene locus_tag LOCUS_00630 4598 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 6707 7543 gene locus_tag LOCUS_00640 6707 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 >Feature sequence0008 326 955 gene locus_tag LOCUS_00650 326 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_00650 1010 2755 gene locus_tag LOCUS_00660 1010 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 2843 3667 gene locus_tag LOCUS_00670 gene thyA 2843 3667 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 protein_id gnl|my_center|LOCUS_00670 3676 4122 gene locus_tag LOCUS_00680 3676 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 4238 5401 gene locus_tag LOCUS_00690 4238 5401 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119788.1 protein_id gnl|my_center|LOCUS_00690 5420 6394 gene locus_tag LOCUS_00700 gene egtD 5420 6394 CDS product histidine N-alpha-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5M8 protein_id gnl|my_center|LOCUS_00700 6405 6926 gene locus_tag LOCUS_00710 6405 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 6942 7223 gene locus_tag LOCUS_00720 6942 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_00720 8297 7224 gene locus_tag LOCUS_00730 8297 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_00730 >Feature sequence0009 2492 1560 gene locus_tag LOCUS_00740 gene queG 2492 1560 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_00740 3518 2514 gene locus_tag LOCUS_00750 3518 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 4893 3871 gene locus_tag LOCUS_00760 gene ruvB 4893 3871 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_00760 5039 5548 gene locus_tag LOCUS_00770 5039 5548 CDS product thioredoxin peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_00770 7570 5744 gene locus_tag LOCUS_00780 gene ctaD 7570 5744 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_00780 <8225 7590 gene locus_tag LOCUS_00790 <8225 7590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962549.1:cytochrome c oxidase subunit II >Feature sequence0010 <1 1606 gene locus_tag LOCUS_00800 <1 1606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118436.1:DNA ligase-associated DEXH box helicase 1603 2247 gene locus_tag LOCUS_00810 1603 2247 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 protein_id gnl|my_center|LOCUS_00810 2286 3083 gene locus_tag LOCUS_00820 2286 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_00820 3083 4225 gene locus_tag LOCUS_00830 3083 4225 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_00830 5586 4234 gene locus_tag LOCUS_00840 5586 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082551.1 protein_id gnl|my_center|LOCUS_00840 >Feature sequence0011 <1 1340 gene locus_tag LOCUS_00850 <1 1340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963297.1:cytochrome c oxidase accessory protein CcoG 1617 2063 gene locus_tag LOCUS_00860 gene ccoH 1617 2063 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_00860 2066 2773 gene locus_tag LOCUS_00870 2066 2773 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_00870 4574 3219 gene locus_tag LOCUS_00880 gene hemN 4574 3219 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_00880 4874 4578 gene locus_tag LOCUS_00890 4874 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 5037 6287 gene locus_tag LOCUS_00900 gene nhaP 5037 6287 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_00900 6294 6956 gene locus_tag LOCUS_00910 6294 6956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962785.1 protein_id gnl|my_center|LOCUS_00910 >Feature sequence0012 <1 2885 gene locus_tag LOCUS_00920 <1 2885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256767.1:peptidase M23 2888 3316 gene locus_tag LOCUS_00930 2888 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143007.1 protein_id gnl|my_center|LOCUS_00930 4316 3321 gene locus_tag LOCUS_00940 4316 3321 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_00940 6092 4317 gene locus_tag LOCUS_00950 6092 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_00950 6448 6089 gene locus_tag LOCUS_00960 6448 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_00960 7367 6450 gene locus_tag LOCUS_00970 7367 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 >Feature sequence0013 142 390 gene locus_tag LOCUS_00980 142 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 470 661 gene locus_tag LOCUS_00990 470 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 750 1013 gene locus_tag LOCUS_01000 750 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 1134 1499 gene locus_tag LOCUS_01010 1134 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 1499 3169 gene locus_tag LOCUS_01020 1499 3169 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249504.1 protein_id gnl|my_center|LOCUS_01020 3169 3654 gene locus_tag LOCUS_01030 3169 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 3656 4318 gene locus_tag LOCUS_01040 3656 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 4291 4629 gene locus_tag LOCUS_01050 4291 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 4629 5060 gene locus_tag LOCUS_01060 4629 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 5088 5501 gene locus_tag LOCUS_01070 5088 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 5503 6663 gene locus_tag LOCUS_01080 5503 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714175.1 protein_id gnl|my_center|LOCUS_01080 6755 7273 gene locus_tag LOCUS_01090 6755 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 protein_id gnl|my_center|LOCUS_01090 >Feature sequence0014 <1 1643 gene locus_tag LOCUS_01100 <1 1643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089730.1:recombinase 2180 1647 gene locus_tag LOCUS_01110 2180 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 2846 2184 gene locus_tag LOCUS_01120 gene lolD 2846 2184 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_01120 5267 2898 gene locus_tag LOCUS_01130 5267 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 5478 6020 gene locus_tag LOCUS_01140 gene msrA 5478 6020 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_01140 6024 6623 gene locus_tag LOCUS_01150 gene folE 6024 6623 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEA8 protein_id gnl|my_center|LOCUS_01150 6676 6984 gene locus_tag LOCUS_01160 6676 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 >Feature sequence0015 1298 1822 gene locus_tag LOCUS_01170 1298 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 1819 2094 gene locus_tag LOCUS_01180 1819 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 2072 2365 gene locus_tag LOCUS_01190 2072 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 2340 3011 gene locus_tag LOCUS_01200 2340 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 3022 3549 gene locus_tag LOCUS_01210 3022 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 3533 3991 gene locus_tag LOCUS_01220 3533 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203472.1 protein_id gnl|my_center|LOCUS_01220 4476 3988 gene locus_tag LOCUS_01230 4476 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 5017 4742 gene locus_tag LOCUS_01240 5017 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 5153 5007 gene locus_tag LOCUS_01250 5153 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 <6850 5153 gene locus_tag LOCUS_01260 <6850 5153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002399687.1:DNA polymerase >Feature sequence0016 1359 379 gene locus_tag LOCUS_01270 gene pdhB 1359 379 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_01270 1710 3677 gene locus_tag LOCUS_01280 1710 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 3677 4477 gene locus_tag LOCUS_01290 3677 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 4573 5682 gene locus_tag LOCUS_01300 4573 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 5789 6565 gene locus_tag LOCUS_01310 5789 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 >Feature sequence0017 <1 629 gene locus_tag LOCUS_01320 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123135.1:membrane protein 830 1813 gene locus_tag LOCUS_01330 830 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_01330 2272 1835 gene locus_tag LOCUS_01340 2272 1835 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019905.1 protein_id gnl|my_center|LOCUS_01340 3112 2381 gene locus_tag LOCUS_01350 3112 2381 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_01350 3988 3185 gene locus_tag LOCUS_01360 3988 3185 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261101.1 protein_id gnl|my_center|LOCUS_01360 4875 3985 gene locus_tag LOCUS_01370 4875 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 6028 4913 gene locus_tag LOCUS_01380 gene pit 6028 4913 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CK32 protein_id gnl|my_center|LOCUS_01380 <6753 6106 gene locus_tag LOCUS_01390 <6753 6106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143344.1:methyltransferase type 11 >Feature sequence0018 1327 608 gene locus_tag LOCUS_01400 1327 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 4282 1355 gene locus_tag LOCUS_01410 4282 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 5198 4539 gene locus_tag LOCUS_01420 5198 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 <6706 5367 gene locus_tag LOCUS_01430 <6706 5367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109117.1:hybrid sensor histidine kinase/response regulator >Feature sequence0019 1005 4409 gene locus_tag LOCUS_01440 1005 4409 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_01440 4402 4818 gene locus_tag LOCUS_01450 gene ybeY 4402 4818 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_01450 >Feature sequence0020 570 1328 gene locus_tag LOCUS_01460 570 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 3254 1614 gene locus_tag LOCUS_01470 gene groL 3254 1614 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_01470 3603 3328 gene locus_tag LOCUS_01480 gene groS 3603 3328 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_01480 4129 3776 gene locus_tag LOCUS_01490 gene secG 4129 3776 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964085.1 protein_id gnl|my_center|LOCUS_01490 5070 4126 gene locus_tag LOCUS_01500 5070 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_01500 5533 5021 gene locus_tag LOCUS_01510 5533 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_01510 <6488 5565 gene locus_tag LOCUS_01520 <6488 5565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964082.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence0021 836 1675 gene locus_tag LOCUS_01530 836 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 1695 2828 gene locus_tag LOCUS_01540 1695 2828 CDS product glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919051.1 protein_id gnl|my_center|LOCUS_01540 3617 2832 gene locus_tag LOCUS_01550 3617 2832 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 protein_id gnl|my_center|LOCUS_01550 3767 4327 gene locus_tag LOCUS_01560 3767 4327 CDS product translation factor Sua5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_01560 4331 5749 gene locus_tag LOCUS_01570 gene cca 4331 5749 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_01570 >Feature sequence0022 866 1696 gene locus_tag LOCUS_01580 gene fjo14 866 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_01580 1724 2017 gene locus_tag LOCUS_01590 gene fjo15 1724 2017 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_01590 2063 2776 gene locus_tag LOCUS_01600 gene gldF 2063 2776 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_01600 2891 4525 gene locus_tag LOCUS_01610 gene gldG 2891 4525 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_01610 4634 5752 gene locus_tag LOCUS_01620 gene dnaN 4634 5752 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_01620 >Feature sequence0023 97 705 gene locus_tag LOCUS_01630 gene sodA 97 705 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_01630 3680 1782 gene locus_tag LOCUS_01640 gene purF 3680 1782 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_01640 4658 3735 gene locus_tag LOCUS_01650 4658 3735 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_01650 5467 4826 gene locus_tag LOCUS_01660 5467 4826 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 protein_id gnl|my_center|LOCUS_01660 6062 5460 gene locus_tag LOCUS_01670 gene purN 6062 5460 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 protein_id gnl|my_center|LOCUS_01670 >Feature sequence0024 377 120 gene locus_tag LOCUS_01680 377 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 1185 451 gene locus_tag LOCUS_01690 gene bplG 1185 451 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929610.1 protein_id gnl|my_center|LOCUS_01690 2035 1169 gene locus_tag LOCUS_01700 2035 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 3155 2037 gene locus_tag LOCUS_01710 3155 2037 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039039.1 protein_id gnl|my_center|LOCUS_01710 5086 3152 gene locus_tag LOCUS_01720 5086 3152 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_01720 5955 5086 gene locus_tag LOCUS_01730 5955 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence0025 754 2094 gene locus_tag LOCUS_01740 gene dgt 754 2094 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_01740 2234 4858 gene locus_tag LOCUS_01750 2234 4858 CDS product peptidase M36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962454.1 protein_id gnl|my_center|LOCUS_01750 <6196 4906 gene locus_tag LOCUS_01760 <6196 4906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWC0:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence0026 243 533 gene locus_tag LOCUS_01770 243 533 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764805.1 protein_id gnl|my_center|LOCUS_01770 719 588 gene locus_tag LOCUS_01780 719 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 1085 1882 gene locus_tag LOCUS_01790 1085 1882 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_01790 2607 1927 gene locus_tag LOCUS_01800 gene msrA 2607 1927 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3M7 protein_id gnl|my_center|LOCUS_01800 3501 2719 gene locus_tag LOCUS_01810 3501 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_01810 4620 3505 gene locus_tag LOCUS_01820 gene yqfO 4620 3505 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX9 protein_id gnl|my_center|LOCUS_01820 4725 5675 gene locus_tag LOCUS_01830 gene lpxK 4725 5675 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_01830 <6180 5672 gene locus_tag LOCUS_01840 <6180 5672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963589.1:histidine kinase >Feature sequence0027 187 1347 gene locus_tag LOCUS_01850 187 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 1392 1871 gene locus_tag LOCUS_01860 1392 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 2745 1873 gene locus_tag LOCUS_01870 2745 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 3946 2795 gene locus_tag LOCUS_01880 3946 2795 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_01880 4725 3943 gene locus_tag LOCUS_01890 4725 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 4995 5549 gene locus_tag LOCUS_01900 gene ruvC 4995 5549 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_01900 >Feature sequence0028 937 1980 gene locus_tag LOCUS_01910 937 1980 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_01910 2045 3271 gene locus_tag LOCUS_01920 2045 3271 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_01920 3298 4677 gene locus_tag LOCUS_01930 3298 4677 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_01930 4723 5424 gene locus_tag LOCUS_01940 4723 5424 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_01940 5424 5816 gene locus_tag LOCUS_01950 5424 5816 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404335.1 protein_id gnl|my_center|LOCUS_01950 >Feature sequence0029 171 1175 gene locus_tag LOCUS_01960 gene gpsA 171 1175 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_01960 1393 5232 gene locus_tag LOCUS_01970 1393 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 5530 5742 gene locus_tag LOCUS_01980 5530 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence0030 1015 149 gene locus_tag LOCUS_01990 gene rpoD 1015 149 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_01990 1396 2049 gene locus_tag LOCUS_02000 1396 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 2364 2053 gene locus_tag LOCUS_02010 2364 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 3029 2466 gene locus_tag LOCUS_02020 3029 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 3672 3097 gene locus_tag LOCUS_02030 3672 3097 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H133 protein_id gnl|my_center|LOCUS_02030 3796 4914 gene locus_tag LOCUS_02040 3796 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 4933 5181 gene locus_tag LOCUS_02050 4933 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 >Feature sequence0031 1206 589 gene locus_tag LOCUS_02060 gene hisIE 1206 589 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 protein_id gnl|my_center|LOCUS_02060 1982 1227 gene locus_tag LOCUS_02070 gene hisF 1982 1227 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_02070 2718 1972 gene locus_tag LOCUS_02080 gene hisA 2718 1972 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_02080 3296 2715 gene locus_tag LOCUS_02090 gene hisH 3296 2715 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY77 protein_id gnl|my_center|LOCUS_02090 4435 3296 gene locus_tag LOCUS_02100 gene hisB 4435 3296 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 protein_id gnl|my_center|LOCUS_02100 5484 4435 gene locus_tag LOCUS_02110 gene hisC 5484 4435 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY79 protein_id gnl|my_center|LOCUS_02110 >Feature sequence0032 735 235 gene locus_tag LOCUS_02120 735 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 2361 898 gene locus_tag LOCUS_02130 2361 898 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_02130 3503 2364 gene locus_tag LOCUS_02140 3503 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_02140 >Feature sequence0033 1144 209 gene locus_tag LOCUS_02150 1144 209 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_02150 1873 1205 gene locus_tag LOCUS_02160 1873 1205 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_02160 1970 2692 gene locus_tag LOCUS_02170 1970 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766240.1 protein_id gnl|my_center|LOCUS_02170 2699 2998 gene locus_tag LOCUS_02180 2699 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 4459 3110 gene locus_tag LOCUS_02190 4459 3110 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_02190 >Feature sequence0034 809 444 gene locus_tag LOCUS_02200 809 444 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_02200 1231 812 gene locus_tag LOCUS_02210 1231 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 1668 1237 gene locus_tag LOCUS_02220 1668 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 3075 1699 gene locus_tag LOCUS_02230 3075 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 3324 3824 gene locus_tag LOCUS_02240 3324 3824 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962389.1 protein_id gnl|my_center|LOCUS_02240 4601 3837 gene locus_tag LOCUS_02250 4601 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 5209 4655 gene locus_tag LOCUS_02260 5209 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 >Feature sequence0035 1266 1745 gene locus_tag LOCUS_02270 1266 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 2184 2840 gene locus_tag LOCUS_02280 2184 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 2901 3158 gene locus_tag LOCUS_02290 2901 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 3170 3625 gene locus_tag LOCUS_02300 3170 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 3719 4549 gene locus_tag LOCUS_02310 3719 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 4655 5281 gene locus_tag LOCUS_02320 4655 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938028.1 protein_id gnl|my_center|LOCUS_02320 >Feature sequence0036 953 87 gene locus_tag LOCUS_02330 953 87 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ30 protein_id gnl|my_center|LOCUS_02330 1933 950 gene locus_tag LOCUS_02340 1933 950 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_02340 3219 1933 gene locus_tag LOCUS_02350 3219 1933 CDS product UDP-glucose/GDP-mannose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 protein_id gnl|my_center|LOCUS_02350 3815 3222 gene locus_tag LOCUS_02360 3815 3222 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203508.1 protein_id gnl|my_center|LOCUS_02360 <5626 3859 gene locus_tag LOCUS_02370 <5626 3859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963430.1:sugar transporter >Feature sequence0037 775 1416 gene locus_tag LOCUS_02380 775 1416 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_02380 1500 2468 gene locus_tag LOCUS_02390 1500 2468 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_02390 4297 2480 gene locus_tag LOCUS_02400 4297 2480 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_02400 <5576 4366 gene locus_tag LOCUS_02410 <5576 4366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWE2:aspartokinase >Feature sequence0038 275 991 gene locus_tag LOCUS_02420 gene rprY 275 991 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_02420 1936 1028 gene locus_tag LOCUS_02430 gene miaA 1936 1028 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V8 protein_id gnl|my_center|LOCUS_02430 2736 1951 gene locus_tag LOCUS_02440 2736 1951 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_02440 4226 2847 gene locus_tag LOCUS_02450 4226 2847 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_02450 4915 4265 gene locus_tag LOCUS_02460 4915 4265 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_02460 5508 5041 gene locus_tag LOCUS_02470 5508 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 >Feature sequence0039 1755 781 gene locus_tag LOCUS_02480 gene ykcC 1755 781 CDS product putative glycosyltransferase YkcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34319 protein_id gnl|my_center|LOCUS_02480 2440 1757 gene locus_tag LOCUS_02490 gene ftsE 2440 1757 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_02490 3003 2533 gene locus_tag LOCUS_02500 3003 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 >Feature sequence0040 2371 3936 gene locus_tag LOCUS_02510 gene gldJ 2371 3936 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_02510 4006 5286 gene locus_tag LOCUS_02520 gene murF 4006 5286 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_02520 >Feature sequence0041 1326 1721 gene locus_tag LOCUS_02530 1326 1721 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_02530 1793 3394 gene locus_tag LOCUS_02540 gene pckA 1793 3394 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816Q7 protein_id gnl|my_center|LOCUS_02540 4939 3608 gene locus_tag LOCUS_02550 gene fucP 4939 3608 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_02550 >Feature sequence0042 <1 1991 gene locus_tag LOCUS_02560 <1 1991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107165.1:SusC/RagA family TonB-linked outer membrane protein 2009 3430 gene locus_tag LOCUS_02570 2009 3430 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404907.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence0043 533 1471 gene locus_tag LOCUS_02580 gene mvaK 533 1471 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_02580 1502 2416 gene locus_tag LOCUS_02590 1502 2416 CDS product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_02590 2466 3422 gene locus_tag LOCUS_02600 2466 3422 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727427.1 protein_id gnl|my_center|LOCUS_02600 3530 4405 gene locus_tag LOCUS_02610 3530 4405 CDS product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962486.1 protein_id gnl|my_center|LOCUS_02610 >Feature sequence0044 110 307 gene locus_tag LOCUS_02620 110 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963849.1 protein_id gnl|my_center|LOCUS_02620 1273 338 gene locus_tag LOCUS_02630 gene oxyR 1273 338 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_02630 1837 1403 gene locus_tag LOCUS_02640 1837 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 3298 1964 gene locus_tag LOCUS_02650 3298 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784758.1 protein_id gnl|my_center|LOCUS_02650 4364 3300 gene locus_tag LOCUS_02660 4364 3300 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_02660 >Feature sequence0045 <1 930 gene locus_tag LOCUS_02670 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2G8:ribonuclease R 952 1668 gene locus_tag LOCUS_02680 952 1668 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_02680 1796 1725 gene locus_tag LOCUS_t00010 1796 1725 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2246 1890 gene locus_tag LOCUS_02690 gene folB 2246 1890 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_02690 2375 4051 gene locus_tag LOCUS_02700 gene glnS 2375 4051 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_02700 4270 4647 gene locus_tag LOCUS_02710 4270 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 4649 5074 gene locus_tag LOCUS_02720 4649 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 5071 5322 gene locus_tag LOCUS_02730 5071 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 >Feature sequence0046 <1 859 gene locus_tag LOCUS_02740 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706687.1:polysaccharide biosynthesis protein 856 1734 gene locus_tag LOCUS_02750 856 1734 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122762.1 protein_id gnl|my_center|LOCUS_02750 1734 2651 gene locus_tag LOCUS_02760 1734 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 2651 3532 gene locus_tag LOCUS_02770 2651 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 3529 4707 gene locus_tag LOCUS_02780 3529 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 >Feature sequence0047 551 913 gene locus_tag LOCUS_02790 gene crcB 551 913 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J1 protein_id gnl|my_center|LOCUS_02790 1065 2291 gene locus_tag LOCUS_02800 1065 2291 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_02800 2393 3115 gene locus_tag LOCUS_02810 2393 3115 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_02810 3371 3102 gene locus_tag LOCUS_02820 3371 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 3825 3439 gene locus_tag LOCUS_02830 3825 3439 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 protein_id gnl|my_center|LOCUS_02830 4013 4408 gene locus_tag LOCUS_02840 4013 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 <5265 4397 gene locus_tag LOCUS_02850 <5265 4397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122885.1:alanine glycine permease >Feature sequence0048 681 43 gene locus_tag LOCUS_02860 681 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 1383 778 gene locus_tag LOCUS_02870 1383 778 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204186.1 protein_id gnl|my_center|LOCUS_02870 1681 1448 gene locus_tag LOCUS_02880 1681 1448 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_02880 3849 1843 gene locus_tag LOCUS_02890 gene uvrB 3849 1843 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY25 protein_id gnl|my_center|LOCUS_02890 <5255 3939 gene locus_tag LOCUS_02900 <5255 3939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963773.1:T9SS C-terminal target domain-containing protein >Feature sequence0049 1045 1410 gene locus_tag LOCUS_02910 1045 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 3648 1483 gene locus_tag LOCUS_02920 3648 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 <5214 3723 gene locus_tag LOCUS_02930 <5214 3723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2A9:glycine--tRNA ligase >Feature sequence0050 2067 2675 gene locus_tag LOCUS_02940 2067 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 4239 2677 gene locus_tag LOCUS_02950 4239 2677 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 protein_id gnl|my_center|LOCUS_02950 4966 4355 gene locus_tag LOCUS_02960 4966 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 >Feature sequence0051 2175 1516 gene locus_tag LOCUS_02970 2175 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 2936 2175 gene locus_tag LOCUS_02980 2936 2175 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ8 protein_id gnl|my_center|LOCUS_02980 4062 3019 gene locus_tag LOCUS_02990 4062 3019 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_02990 4672 4049 gene locus_tag LOCUS_03000 4672 4049 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962813.1 protein_id gnl|my_center|LOCUS_03000 >Feature sequence0052 427 1605 gene locus_tag LOCUS_03010 gene gcdH 427 1605 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_03010 1749 2645 gene locus_tag LOCUS_03020 1749 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 2979 2650 gene locus_tag LOCUS_03030 2979 2650 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_03030 4044 2992 gene locus_tag LOCUS_03040 4044 2992 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_03040 4296 4051 gene locus_tag LOCUS_03050 4296 4051 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_03050 <4981 4298 gene locus_tag LOCUS_03060 <4981 4298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H062:iron-sulfur cluster carrier protein >Feature sequence0053 677 1225 gene locus_tag LOCUS_03070 gene pfpI 677 1225 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090767.1 protein_id gnl|my_center|LOCUS_03070 1564 1274 gene locus_tag LOCUS_03080 1564 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 2715 1645 gene locus_tag LOCUS_03090 gene aroB 2715 1645 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_03090 2781 3953 gene locus_tag LOCUS_03100 gene putA 2781 3953 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence0054 1411 104 gene locus_tag LOCUS_03110 gene nqrF 1411 104 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_03110 2153 1413 gene locus_tag LOCUS_03120 gene nqrE 2153 1413 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L1 protein_id gnl|my_center|LOCUS_03120 2834 2187 gene locus_tag LOCUS_03130 gene nqrD 2834 2187 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_03130 3588 2839 gene locus_tag LOCUS_03140 gene nqrC 3588 2839 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 protein_id gnl|my_center|LOCUS_03140 4810 3593 gene locus_tag LOCUS_03150 gene nqrB 4810 3593 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US0 protein_id gnl|my_center|LOCUS_03150 >Feature sequence0055 602 1219 gene locus_tag LOCUS_03160 602 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 2566 1241 gene locus_tag LOCUS_03170 gene bfmBB 2566 1241 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_03170 3762 2641 gene locus_tag LOCUS_03180 3762 2641 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962750.1 protein_id gnl|my_center|LOCUS_03180 4386 3766 gene locus_tag LOCUS_03190 gene recR 4386 3766 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_03190 >Feature sequence0056 416 1399 gene locus_tag LOCUS_03200 416 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_03200 1505 2401 gene locus_tag LOCUS_03210 1505 2401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_03210 2404 3246 gene locus_tag LOCUS_03220 2404 3246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_03220 >Feature sequence0057 1391 174 gene locus_tag LOCUS_03230 1391 174 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405434.1 protein_id gnl|my_center|LOCUS_03230 1483 2559 gene locus_tag LOCUS_03240 1483 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 2568 4010 gene locus_tag LOCUS_03250 2568 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_03250 <4839 4014 gene locus_tag LOCUS_03260 <4839 4014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787651.1:carbon-nitrogen hydrolase >Feature sequence0058 1034 735 gene locus_tag LOCUS_03270 1034 735 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168851.1 protein_id gnl|my_center|LOCUS_03270 2161 1031 gene locus_tag LOCUS_03280 gene ansA 2161 1031 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 protein_id gnl|my_center|LOCUS_03280 2302 2805 gene locus_tag LOCUS_03290 2302 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 2875 3414 gene locus_tag LOCUS_03300 gene haaO 2875 3414 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_03300 >Feature sequence0059 305 1522 gene locus_tag LOCUS_03310 305 1522 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_03310 1858 2421 gene locus_tag LOCUS_03320 1858 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 <4751 2942 gene locus_tag LOCUS_03330 <4751 2942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963589.1:histidine kinase >Feature sequence0060 1321 2211 gene locus_tag LOCUS_03340 1321 2211 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_03340 2302 3339 gene locus_tag LOCUS_03350 gene hemH 2302 3339 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_03350 >Feature sequence0061 189 713 gene locus_tag LOCUS_03360 189 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 776 1084 gene locus_tag LOCUS_03370 776 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 1113 2078 gene locus_tag LOCUS_03380 1113 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 2162 3235 gene locus_tag LOCUS_03390 2162 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 3293 3910 gene locus_tag LOCUS_03400 3293 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence0062 1217 1014 gene locus_tag LOCUS_03410 1217 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 1800 1207 gene locus_tag LOCUS_03420 1800 1207 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 protein_id gnl|my_center|LOCUS_03420 3200 1803 gene locus_tag LOCUS_03430 3200 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 4431 3193 gene locus_tag LOCUS_03440 4431 3193 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_03440 >Feature sequence0063 1186 1614 gene locus_tag LOCUS_03450 1186 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 1690 2040 gene locus_tag LOCUS_03460 1690 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 3377 2088 gene locus_tag LOCUS_03470 gene hemL 3377 2088 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW4 protein_id gnl|my_center|LOCUS_03470 4225 3383 gene locus_tag LOCUS_03480 4225 3383 CDS product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 protein_id gnl|my_center|LOCUS_03480 >Feature sequence0064 470 1006 gene locus_tag LOCUS_03490 470 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 1017 1514 gene locus_tag LOCUS_03500 1017 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963236.1 protein_id gnl|my_center|LOCUS_03500 2167 1511 gene locus_tag LOCUS_03510 2167 1511 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_03510 2575 2231 gene locus_tag LOCUS_03520 2575 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 2949 2632 gene locus_tag LOCUS_03530 2949 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 4204 2951 gene locus_tag LOCUS_03540 gene pyrC2 4204 2951 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_03540 4551 4201 gene locus_tag LOCUS_03550 4551 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence0065 <1 538 gene locus_tag LOCUS_03560 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962311.1:BatA protein 540 1580 gene locus_tag LOCUS_03570 gene batB 540 1580 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_03570 1582 2457 gene locus_tag LOCUS_03580 gene batC 1582 2457 CDS product BatC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962308.1 protein_id gnl|my_center|LOCUS_03580 2546 4240 gene locus_tag LOCUS_03590 gene batD 2546 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_03590 >Feature sequence0066 603 1493 gene locus_tag LOCUS_03600 603 1493 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_03600 1477 3177 gene locus_tag LOCUS_03610 1477 3177 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_03610 >Feature sequence0067 3519 3959 gene locus_tag LOCUS_03620 3519 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 3969 4445 gene locus_tag LOCUS_03630 3969 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 >Feature sequence0068 1757 447 gene locus_tag LOCUS_03640 1757 447 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_03640 1904 2566 gene locus_tag LOCUS_03650 1904 2566 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_03650 2671 2898 gene locus_tag LOCUS_03660 gene feoA 2671 2898 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_03660 >Feature sequence0069 <1 1437 gene locus_tag LOCUS_03670 <1 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964195.1:outer membrane protein assembly factor BamA 1476 2333 gene locus_tag LOCUS_03680 gene skp 1476 2333 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964196.1 protein_id gnl|my_center|LOCUS_03680 2376 2885 gene locus_tag LOCUS_03690 2376 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2987 3778 gene locus_tag LOCUS_03700 gene murI 2987 3778 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D7 protein_id gnl|my_center|LOCUS_03700 4510 3779 gene locus_tag LOCUS_03710 4510 3779 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_03710 >Feature sequence0070 179 439 gene locus_tag LOCUS_03720 179 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 551 1753 gene locus_tag LOCUS_03730 551 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 1844 3040 gene locus_tag LOCUS_03740 1844 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 >Feature sequence0071 <1 1206 gene locus_tag LOCUS_03750 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYW2:lysine--tRNA ligase 1538 3574 gene locus_tag LOCUS_03760 1538 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence0072 3 275 gene locus_tag LOCUS_03770 3 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 708 289 gene locus_tag LOCUS_03780 708 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 3304 803 gene locus_tag LOCUS_03790 3304 803 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_03790 3908 3513 gene locus_tag LOCUS_03800 3908 3513 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_03800 <4489 3975 gene locus_tag LOCUS_03810 <4489 3975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962696.1:ABC transporter >Feature sequence0073 819 310 gene locus_tag LOCUS_03820 819 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 1241 1002 gene locus_tag LOCUS_03830 1241 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 protein_id gnl|my_center|LOCUS_03830 1696 1238 gene locus_tag LOCUS_03840 1696 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 1852 3822 gene locus_tag LOCUS_03850 1852 3822 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_03850 >Feature sequence0074 1117 584 gene locus_tag LOCUS_03860 1117 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 1328 2344 gene locus_tag LOCUS_03870 1328 2344 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140328.1 protein_id gnl|my_center|LOCUS_03870 3506 3045 gene locus_tag LOCUS_03880 3506 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence0075 3068 2001 gene locus_tag LOCUS_03890 3068 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence0076 1416 772 gene locus_tag LOCUS_03900 gene aat 1416 772 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H233 protein_id gnl|my_center|LOCUS_03900 2841 1465 gene locus_tag LOCUS_03910 gene atoE 2841 1465 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_03910 3254 2880 gene locus_tag LOCUS_03920 3254 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_03920 4015 3278 gene locus_tag LOCUS_03930 4015 3278 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257343.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence0077 1914 517 gene locus_tag LOCUS_03940 1914 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 2485 1886 gene locus_tag LOCUS_03950 2485 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 2957 2469 gene locus_tag LOCUS_03960 2957 2469 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_03960 3159 3707 gene locus_tag LOCUS_03970 3159 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 4187 3756 gene locus_tag LOCUS_03980 4187 3756 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974779.1 protein_id gnl|my_center|LOCUS_03980 >Feature sequence0078 185 1072 gene locus_tag LOCUS_03990 185 1072 CDS product AttM/AiiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729411.1 protein_id gnl|my_center|LOCUS_03990 1074 1448 gene locus_tag LOCUS_04000 1074 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 1454 2209 gene locus_tag LOCUS_04010 gene sufC 1454 2209 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_04010 2276 3592 gene locus_tag LOCUS_04020 gene sufD 2276 3592 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence0079 1560 307 gene locus_tag LOCUS_04030 gene metK 1560 307 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_04030 1978 2400 gene locus_tag LOCUS_04040 1978 2400 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403972.1 protein_id gnl|my_center|LOCUS_04040 2416 2832 gene locus_tag LOCUS_04050 2416 2832 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388926.1 protein_id gnl|my_center|LOCUS_04050 2871 3821 gene locus_tag LOCUS_04060 2871 3821 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence0080 <1 582 gene locus_tag LOCUS_04070 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963581.1:ABC transporter substrate-binding protein 582 1613 gene locus_tag LOCUS_04080 582 1613 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_04080 1613 2407 gene locus_tag LOCUS_04090 1613 2407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 protein_id gnl|my_center|LOCUS_04090 2440 3765 gene locus_tag LOCUS_04100 gene rmuC 2440 3765 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_04100 3752 4126 gene locus_tag LOCUS_04110 3752 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 >Feature sequence0081 89 397 gene locus_tag LOCUS_04120 89 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 369 890 gene locus_tag LOCUS_04130 369 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 1419 853 gene locus_tag LOCUS_04140 1419 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225286.1 protein_id gnl|my_center|LOCUS_04140 1725 1459 gene locus_tag LOCUS_04150 1725 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 2090 1713 gene locus_tag LOCUS_04160 2090 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 2638 2168 gene locus_tag LOCUS_04170 2638 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 2840 2628 gene locus_tag LOCUS_04180 2840 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 3220 2837 gene locus_tag LOCUS_04190 3220 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3380 3222 gene locus_tag LOCUS_04200 3380 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 4045 3362 gene locus_tag LOCUS_04210 4045 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 >Feature sequence0082 611 180 gene locus_tag LOCUS_04220 611 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071321.1 protein_id gnl|my_center|LOCUS_04220 761 1372 gene locus_tag LOCUS_04230 761 1372 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_04230 1508 2176 gene locus_tag LOCUS_04240 1508 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 2173 2907 gene locus_tag LOCUS_04250 2173 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3291 2884 gene locus_tag LOCUS_04260 3291 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence0083 235 1683 gene locus_tag LOCUS_04270 gene gapA2 235 1683 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX7 protein_id gnl|my_center|LOCUS_04270 1810 2268 gene locus_tag LOCUS_04280 1810 2268 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223856.1 protein_id gnl|my_center|LOCUS_04280 2306 2800 gene locus_tag LOCUS_04290 2306 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 2803 3480 gene locus_tag LOCUS_04300 gene trmD 2803 3480 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_04300 >Feature sequence0084 309 863 gene locus_tag LOCUS_04310 309 863 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_04310 1045 875 gene locus_tag LOCUS_04320 1045 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 1659 1135 gene locus_tag LOCUS_04330 gene yfiT 1659 1135 CDS product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 protein_id gnl|my_center|LOCUS_04330 2679 1747 gene locus_tag LOCUS_04340 gene ppiC 2679 1747 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_04340 3369 4055 gene locus_tag LOCUS_04350 3369 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence0085 767 1426 gene locus_tag LOCUS_04360 767 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 1427 1735 gene locus_tag LOCUS_04370 1427 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_04370 1725 2561 gene locus_tag LOCUS_04380 gene rsmA 1725 2561 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_04380 2539 3888 gene locus_tag LOCUS_04390 gene mgtE 2539 3888 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_04390 3885 4277 gene locus_tag LOCUS_04400 3885 4277 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence0086 >Feature sequence0087 151 414 gene locus_tag LOCUS_04410 151 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 465 884 gene locus_tag LOCUS_04420 465 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 909 1931 gene locus_tag LOCUS_04430 909 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 1928 2095 gene locus_tag LOCUS_04440 1928 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 2095 2358 gene locus_tag LOCUS_04450 2095 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 2382 3176 gene locus_tag LOCUS_04460 2382 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 3176 3394 gene locus_tag LOCUS_04470 3176 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 <4273 3490 gene locus_tag LOCUS_04480 <4273 3490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775527.1:integrase >Feature sequence0088 2761 1991 gene locus_tag LOCUS_04490 2761 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_04490 2780 3934 gene locus_tag LOCUS_04500 2780 3934 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962567.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence0089 <1 1608 gene locus_tag LOCUS_04510 <1 1608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_638169.2:endoproteinase ArgC 1725 2765 gene locus_tag LOCUS_04520 gene rlmN 1725 2765 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_04520 3630 2815 gene locus_tag LOCUS_04530 3630 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 3728 3883 gene locus_tag LOCUS_04540 3728 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence0090 <1 1060 gene locus_tag LOCUS_04550 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963277.1:antibiotic ABC transporter ATP-binding protein 1539 2090 gene locus_tag LOCUS_04560 1539 2090 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_04560 2114 2614 gene locus_tag LOCUS_04570 2114 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 2616 3059 gene locus_tag LOCUS_04580 2616 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_04580 4067 3132 gene locus_tag LOCUS_04590 4067 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_04590 >Feature sequence0091 3 860 gene locus_tag LOCUS_04600 gene gcvT 3 860 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_04600 863 1777 gene locus_tag LOCUS_04610 gene glsA 863 1777 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEA1 protein_id gnl|my_center|LOCUS_04610 1804 2664 gene locus_tag LOCUS_04620 1804 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 2710 2991 gene locus_tag LOCUS_04630 2710 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 3041 3763 gene locus_tag LOCUS_04640 3041 3763 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_04640 >Feature sequence0092 <1 649 gene locus_tag LOCUS_04650 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX96:replicative DNA helicase 777 1961 gene locus_tag LOCUS_04660 777 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_04660 2119 1958 gene locus_tag LOCUS_04670 2119 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 3047 2121 gene locus_tag LOCUS_04680 3047 2121 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682158.1 protein_id gnl|my_center|LOCUS_04680 3550 3044 gene locus_tag LOCUS_04690 3550 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 >Feature sequence0093 717 55 gene locus_tag LOCUS_04700 717 55 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_04700 1460 717 gene locus_tag LOCUS_04710 gene plsC 1460 717 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_04710 1940 1530 gene locus_tag LOCUS_04720 gene yqiW 1940 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_04720 2158 2895 gene locus_tag LOCUS_04730 2158 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 3027 3683 gene locus_tag LOCUS_04740 gene sirR 3027 3683 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence0094 3112 1748 gene locus_tag LOCUS_04750 3112 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence0095 <1 928 gene locus_tag LOCUS_04760 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYD1:ATP-dependent DNA helicase RecG 2147 921 gene locus_tag LOCUS_04770 2147 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 >Feature sequence0096 939 205 gene locus_tag LOCUS_04780 939 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_04780 2063 936 gene locus_tag LOCUS_04790 2063 936 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020736.1 protein_id gnl|my_center|LOCUS_04790 2858 2151 gene locus_tag LOCUS_04800 gene yiaD 2858 2151 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963625.1 protein_id gnl|my_center|LOCUS_04800 3337 2858 gene locus_tag LOCUS_04810 3337 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 <4176 3654 gene locus_tag LOCUS_04820 <4176 3654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963173.1:dehydrogenase >Feature sequence0097 1234 437 gene locus_tag LOCUS_04830 1234 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 1774 1241 gene locus_tag LOCUS_04840 1774 1241 CDS product RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027940.1 protein_id gnl|my_center|LOCUS_04840 >Feature sequence0098 603 1493 gene locus_tag LOCUS_04850 603 1493 CDS product protein of unknown function precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362027.1 protein_id gnl|my_center|LOCUS_04850 2760 1549 gene locus_tag LOCUS_04860 gene hflX 2760 1549 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 protein_id gnl|my_center|LOCUS_04860 >Feature sequence0099 2450 537 gene locus_tag LOCUS_04870 2450 537 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_04870 3426 2467 gene locus_tag LOCUS_04880 3426 2467 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_04880 <4155 3483 gene locus_tag LOCUS_04890 <4155 3483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin >Feature sequence0100 1881 1378 gene locus_tag LOCUS_04900 1881 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964227.1 protein_id gnl|my_center|LOCUS_04900 2653 1934 gene locus_tag LOCUS_04910 2653 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 3455 2694 gene locus_tag LOCUS_04920 3455 2694 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 protein_id gnl|my_center|LOCUS_04920 3573 4142 gene locus_tag LOCUS_04930 3573 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence0101 1445 1083 gene locus_tag LOCUS_04940 1445 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 2219 1503 gene locus_tag LOCUS_04950 2219 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 3080 2415 gene locus_tag LOCUS_04960 3080 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 <4139 3082 gene locus_tag LOCUS_04970 <4139 3082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D3HAT3:sensor histidine kinase >Feature sequence0102 109 480 gene locus_tag LOCUS_04980 109 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 591 2825 gene locus_tag LOCUS_04990 591 2825 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_04990 2938 3246 gene locus_tag LOCUS_05000 2938 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence0103 258 1670 gene locus_tag LOCUS_05010 gene trmA 258 1670 CDS product tRNA (uracil-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_05010 1690 2178 gene locus_tag LOCUS_05020 1690 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 2204 2836 gene locus_tag LOCUS_05030 2204 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_05030 4028 2871 gene locus_tag LOCUS_05040 4028 2871 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence0104 1572 307 gene locus_tag LOCUS_05050 1572 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 3145 1754 gene locus_tag LOCUS_05060 gene fumC 3145 1754 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_05060 3314 3484 gene locus_tag LOCUS_05070 3314 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963717.1 protein_id gnl|my_center|LOCUS_05070 <4075 3550 gene locus_tag LOCUS_05080 <4075 3550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963716.1:TonB-dependent receptor >Feature sequence0105 2513 612 gene locus_tag LOCUS_05090 2513 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 3820 2510 gene locus_tag LOCUS_05100 3820 2510 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_05100 >Feature sequence0106 <1 762 gene locus_tag LOCUS_05110 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2D7:ATP synthase subunit alpha 843 1715 gene locus_tag LOCUS_05120 gene atpG 843 1715 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_05120 1815 2375 gene locus_tag LOCUS_05130 1815 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 2430 3890 gene locus_tag LOCUS_05140 2430 3890 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence0107 <1 621 gene locus_tag LOCUS_05150 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003530156.1:fatty acid hydroxylase 680 1051 gene locus_tag LOCUS_05160 680 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 1487 1041 gene locus_tag LOCUS_05170 gene elaA 1487 1041 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_05170 2408 1497 gene locus_tag LOCUS_05180 gene czcD 2408 1497 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964573.1 protein_id gnl|my_center|LOCUS_05180 2850 2419 gene locus_tag LOCUS_05190 gene rpiB 2850 2419 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_05190 3620 3381 gene locus_tag LOCUS_05200 3620 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence0108 331 1209 gene locus_tag LOCUS_05210 gene folD 331 1209 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 protein_id gnl|my_center|LOCUS_05210 1665 1228 gene locus_tag LOCUS_05220 1665 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 2213 1728 gene locus_tag LOCUS_05230 2213 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 3202 2216 gene locus_tag LOCUS_05240 3202 2216 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202490.1 protein_id gnl|my_center|LOCUS_05240 3668 3240 gene locus_tag LOCUS_05250 3668 3240 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence0109 902 1426 gene locus_tag LOCUS_05260 902 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 1436 1975 gene locus_tag LOCUS_05270 1436 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2033 2230 gene locus_tag LOCUS_05280 2033 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 2242 2613 gene locus_tag LOCUS_05290 2242 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence0110 698 3817 gene locus_tag LOCUS_05300 gene hsdR-1 698 3817 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_05300 3817 3939 gene locus_tag LOCUS_05310 3817 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 >Feature sequence0111 887 384 gene locus_tag LOCUS_05320 887 384 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833668.1 protein_id gnl|my_center|LOCUS_05320 1861 1001 gene locus_tag LOCUS_05330 1861 1001 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_05330 2959 1967 gene locus_tag LOCUS_05340 2959 1967 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence0112 3567 1186 gene locus_tag LOCUS_05350 3567 1186 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_05350 >Feature sequence0113 >Feature sequence0114 340 1503 gene locus_tag LOCUS_05360 gene purT 340 1503 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP9 protein_id gnl|my_center|LOCUS_05360 3019 1514 gene locus_tag LOCUS_05370 3019 1514 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_05370 <3965 3019 gene locus_tag LOCUS_05380 <3965 3019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785058.1:Trk system potassium transport protein TrkA >Feature sequence0115 <1 1192 gene locus_tag LOCUS_05390 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963727.1:DUF490 domain-containing protein 1574 1194 gene locus_tag LOCUS_05400 gene yjgF 1574 1194 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_05400 <3963 1593 gene locus_tag LOCUS_05410 <3963 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962910.1:organic solvent tolerance protein OstA >Feature sequence0116 1307 195 gene locus_tag LOCUS_05420 1307 195 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963379.1 protein_id gnl|my_center|LOCUS_05420 2302 1304 gene locus_tag LOCUS_05430 2302 1304 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963382.1 protein_id gnl|my_center|LOCUS_05430 3846 2308 gene locus_tag LOCUS_05440 3846 2308 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963383.1 protein_id gnl|my_center|LOCUS_05440 >Feature sequence0117 853 1701 gene locus_tag LOCUS_05450 853 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_05450 3145 1730 gene locus_tag LOCUS_05460 3145 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 >Feature sequence0118 927 1949 gene locus_tag LOCUS_05470 gene fjo19 927 1949 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_05470 2017 2493 gene locus_tag LOCUS_05480 gene gldI 2017 2493 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T4 protein_id gnl|my_center|LOCUS_05480 2501 3604 gene locus_tag LOCUS_05490 gene ppiA 2501 3604 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963995.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence0119 3165 631 gene locus_tag LOCUS_05500 gene alaS 3165 631 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 protein_id gnl|my_center|LOCUS_05500 3119 3352 gene locus_tag LOCUS_05510 3119 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 >Feature sequence0120 275 958 gene locus_tag LOCUS_05520 275 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05520 1451 1047 gene locus_tag LOCUS_05530 gene yuxK 1451 1047 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_05530 3607 1448 gene locus_tag LOCUS_05540 3607 1448 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG0 protein_id gnl|my_center|LOCUS_05540 >Feature sequence0121 1085 6 gene locus_tag LOCUS_05550 gene manC 1085 6 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_05550 1686 1075 gene locus_tag LOCUS_05560 1686 1075 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_05560 2390 1689 gene locus_tag LOCUS_05570 2390 1689 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_05570 <3838 2459 gene locus_tag LOCUS_05580 <3838 2459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZE4:dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex >Feature sequence0122 1664 2131 gene locus_tag LOCUS_05590 1664 2131 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263864.1 protein_id gnl|my_center|LOCUS_05590 2376 2197 gene locus_tag LOCUS_05600 2376 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 2764 2393 gene locus_tag LOCUS_05610 2764 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 3274 2885 gene locus_tag LOCUS_05620 3274 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 3599 3294 gene locus_tag LOCUS_05630 3599 3294 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence0123 3 1262 gene locus_tag LOCUS_05640 gene bfmBB 3 1262 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_05640 1297 2364 gene locus_tag LOCUS_05650 gene ilvK 1297 2364 CDS product branched-chain-amino-acid aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39576 protein_id gnl|my_center|LOCUS_05650 >Feature sequence0124 <1 2582 gene locus_tag LOCUS_05660 <1 2582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962810.1:DNA topoisomerase IV subunit A 2595 3032 gene locus_tag LOCUS_05670 gene mscL 2595 3032 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLX9 protein_id gnl|my_center|LOCUS_05670 >Feature sequence0125 2766 697 gene locus_tag LOCUS_05680 2766 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 3047 2769 gene locus_tag LOCUS_05690 3047 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 3358 3008 gene locus_tag LOCUS_05700 3358 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 3644 3330 gene locus_tag LOCUS_05710 3644 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 >Feature sequence0126 207 2219 gene locus_tag LOCUS_05720 gene hutU 207 2219 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_05720 2225 2761 gene locus_tag LOCUS_05730 2225 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_05730 <3782 3205 gene locus_tag LOCUS_05740 <3782 3205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963173.1:dehydrogenase >Feature sequence0127 2488 2634 gene locus_tag LOCUS_05750 2488 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 2634 2867 gene locus_tag LOCUS_05760 2634 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 2984 3202 gene locus_tag LOCUS_05770 2984 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 3189 3620 gene locus_tag LOCUS_05780 3189 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence0128 188 616 gene locus_tag LOCUS_05790 gene phnB 188 616 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_05790 898 1569 gene locus_tag LOCUS_05800 898 1569 CDS product DUF4919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107330.1 protein_id gnl|my_center|LOCUS_05800 1562 3088 gene locus_tag LOCUS_05810 1562 3088 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038609.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence0129 62 1138 gene locus_tag LOCUS_05820 62 1138 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777415.1 protein_id gnl|my_center|LOCUS_05820 1492 1785 gene locus_tag LOCUS_05830 1492 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 1922 2647 gene locus_tag LOCUS_05840 1922 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 >Feature sequence0130 <1 1566 gene locus_tag LOCUS_05850 <1 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963149.1:peptidase M1 >Feature sequence0131 46 351 gene locus_tag LOCUS_05860 46 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 353 1063 gene locus_tag LOCUS_05870 353 1063 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_05870 1305 1490 gene locus_tag LOCUS_05880 1305 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 1541 2185 gene locus_tag LOCUS_05890 1541 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_05890 2191 2529 gene locus_tag LOCUS_05900 2191 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 2529 3032 gene locus_tag LOCUS_05910 2529 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence0132 1364 711 gene locus_tag LOCUS_05920 1364 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 2492 1377 gene locus_tag LOCUS_05930 gene lpxB 2492 1377 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_05930 2784 2494 gene locus_tag LOCUS_05940 2784 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 3560 2781 gene locus_tag LOCUS_05950 gene surE 3560 2781 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_05950 >Feature sequence0133 1827 397 gene locus_tag LOCUS_05960 1827 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 2812 1919 gene locus_tag LOCUS_05970 2812 1919 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065968.1 protein_id gnl|my_center|LOCUS_05970 3540 2815 gene locus_tag LOCUS_05980 3540 2815 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence0134 321 1700 gene locus_tag LOCUS_05990 321 1700 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_05990 1728 2891 gene locus_tag LOCUS_06000 1728 2891 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence0135 35 703 gene locus_tag LOCUS_06010 35 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 787 1401 gene locus_tag LOCUS_06020 gene lspA 787 1401 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_06020 2534 1398 gene locus_tag LOCUS_06030 2534 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 3299 3006 gene locus_tag LOCUS_06040 3299 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 3634 3350 gene locus_tag LOCUS_06050 3634 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 >Feature sequence0136 1495 392 gene locus_tag LOCUS_06060 1495 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3680 1545 gene locus_tag LOCUS_06070 3680 1545 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_06070 >Feature sequence0137 <1 1817 gene locus_tag LOCUS_06080 <1 1817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203283.1:dihydrofolate reductase 2750 1938 gene locus_tag LOCUS_06090 2750 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 3126 2725 gene locus_tag LOCUS_06100 3126 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 <3700 3191 gene locus_tag LOCUS_06110 <3700 3191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CN75:oxygen regulatory protein NreC >Feature sequence0138 <1 798 gene locus_tag LOCUS_06120 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964554.1:gliding motility protein 804 1277 gene locus_tag LOCUS_06130 804 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_06130 1312 1563 gene locus_tag LOCUS_06140 1312 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 1556 1951 gene locus_tag LOCUS_06150 1556 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 2021 3130 gene locus_tag LOCUS_06160 gene atpB 2021 3130 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_06160 3154 3393 gene locus_tag LOCUS_06170 3154 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 >Feature sequence0139 >Feature sequence0140 709 3120 gene locus_tag LOCUS_06180 709 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence0141 1367 96 gene locus_tag LOCUS_06190 1367 96 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_06190 2604 1360 gene locus_tag LOCUS_06200 2604 1360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_06200 3319 2597 gene locus_tag LOCUS_06210 3319 2597 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence0142 1 186 gene locus_tag LOCUS_06220 1 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 270 461 gene locus_tag LOCUS_06230 270 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 1399 515 gene locus_tag LOCUS_06240 gene fabD 1399 515 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_06240 2025 1525 gene locus_tag LOCUS_06250 2025 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 2945 2100 gene locus_tag LOCUS_06260 2945 2100 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287963.1 protein_id gnl|my_center|LOCUS_06260 3441 2956 gene locus_tag LOCUS_06270 gene dfrA 3441 2956 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_06270 >Feature sequence0143 718 2640 gene locus_tag LOCUS_06280 718 2640 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_06280 >Feature sequence0144 1378 1527 gene locus_tag LOCUS_06290 1378 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 2219 1659 gene locus_tag LOCUS_06300 2219 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 3286 2246 gene locus_tag LOCUS_06310 3286 2246 CDS product adenylate/guanylate cyclase domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085648.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence0145 784 41 gene locus_tag LOCUS_06320 gene dnrN 784 41 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_06320 1251 817 gene locus_tag LOCUS_06330 1251 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 1428 1931 gene locus_tag LOCUS_06340 1428 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 1942 2517 gene locus_tag LOCUS_06350 1942 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 >Feature sequence0146 <1 901 gene locus_tag LOCUS_06360 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962627.1:ribonucleoside-diphosphate reductase 1027 3447 gene locus_tag LOCUS_06370 gene nrdA 1027 3447 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_06370 >Feature sequence0147 161 1186 gene locus_tag LOCUS_06380 161 1186 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_06380 1183 2775 gene locus_tag LOCUS_06390 gene lig2 1183 2775 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_06390 >Feature sequence0148 332 1930 gene locus_tag LOCUS_06400 332 1930 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_06400 2125 1931 gene locus_tag LOCUS_06410 2125 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 2716 2135 gene locus_tag LOCUS_06420 2716 2135 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_06420 2839 3405 gene locus_tag LOCUS_06430 2839 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence0149 1079 45 gene locus_tag LOCUS_06440 1079 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 1763 1227 gene locus_tag LOCUS_06450 1763 1227 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_06450 <3587 1778 gene locus_tag LOCUS_06460 <3587 1778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEB0:3-deoxy-alpha-D-manno-octulosonate 8-oxidase >Feature sequence0150 2730 1876 gene locus_tag LOCUS_06470 2730 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence0151 737 2482 gene locus_tag LOCUS_06480 737 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence0152 122 865 gene locus_tag LOCUS_06490 122 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 855 2753 gene locus_tag LOCUS_06500 855 2753 CDS product DNA primase/helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107640.1 protein_id gnl|my_center|LOCUS_06500 2761 2988 gene locus_tag LOCUS_06510 2761 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2992 3423 gene locus_tag LOCUS_06520 2992 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence0153 1434 145 gene locus_tag LOCUS_06530 1434 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_06530 1643 2092 gene locus_tag LOCUS_06540 1643 2092 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_06540 2947 2165 gene locus_tag LOCUS_06550 gene rluF 2947 2165 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4I3 protein_id gnl|my_center|LOCUS_06550 >Feature sequence0154 >Feature sequence0155 733 1578 gene locus_tag LOCUS_06560 gene tktA 733 1578 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_06560 1597 2550 gene locus_tag LOCUS_06570 gene tktC 1597 2550 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence0156 <3558 1417 gene locus_tag LOCUS_06580 <3558 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011922226.1:DEAD/DEAH box helicase >Feature sequence0157 1574 669 gene locus_tag LOCUS_06590 1574 669 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_06590 3247 1595 gene locus_tag LOCUS_06600 gene recN 3247 1595 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_06600 >Feature sequence0158 1503 28 gene locus_tag LOCUS_06610 gene proS 1503 28 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_06610 1668 2609 gene locus_tag LOCUS_06620 1668 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence0159 565 987 gene locus_tag LOCUS_06630 565 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962798.1 protein_id gnl|my_center|LOCUS_06630 984 1286 gene locus_tag LOCUS_06640 984 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence0160 <1 635 gene locus_tag LOCUS_06650 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962702.1:iron ABC transporter 818 636 gene locus_tag LOCUS_06660 818 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 1607 939 gene locus_tag LOCUS_06670 1607 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_06670 2630 1734 gene locus_tag LOCUS_06680 2630 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence0161 2663 3115 gene locus_tag LOCUS_06690 2663 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence0162 2810 1101 gene locus_tag LOCUS_06700 gene ggt 2810 1101 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_06700 3391 2807 gene locus_tag LOCUS_06710 3391 2807 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence0163 9 1340 gene locus_tag LOCUS_06720 9 1340 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_06720 1437 1730 gene locus_tag LOCUS_06730 1437 1730 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438991.1 protein_id gnl|my_center|LOCUS_06730 1743 2057 gene locus_tag LOCUS_06740 1743 2057 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963761.1 protein_id gnl|my_center|LOCUS_06740 2406 2738 gene locus_tag LOCUS_06750 2406 2738 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963761.1 protein_id gnl|my_center|LOCUS_06750 >Feature sequence0164 282 422 gene locus_tag LOCUS_06760 282 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 655 879 gene locus_tag LOCUS_06770 655 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 936 2135 gene locus_tag LOCUS_06780 gene ald 936 2135 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_06780 2138 2515 gene locus_tag LOCUS_06790 2138 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 <3413 2512 gene locus_tag LOCUS_06800 <3413 2512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836500.1:AraC family transcriptional regulator >Feature sequence0165 618 908 gene locus_tag LOCUS_06810 618 908 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_06810 1010 1744 gene locus_tag LOCUS_06820 1010 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06820 1829 2356 gene locus_tag LOCUS_06830 1829 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06830 2442 2792 gene locus_tag LOCUS_06840 2442 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074110.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence0166 1662 685 gene locus_tag LOCUS_06850 1662 685 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_06850 2587 1652 gene locus_tag LOCUS_06860 2587 1652 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_06860 <3369 2577 gene locus_tag LOCUS_06870 <3369 2577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0A2:arginine decarboxylase >Feature sequence0167 1833 322 gene locus_tag LOCUS_06880 gene hutH1 1833 322 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW5 protein_id gnl|my_center|LOCUS_06880 <3366 1916 gene locus_tag LOCUS_06890 <3366 1916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89ZJ4:bifunctional NAD(P)H-hydrate repair enzyme >Feature sequence0168 1990 1241 gene locus_tag LOCUS_06900 1990 1241 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_06900 3196 2018 gene locus_tag LOCUS_06910 3196 2018 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence0169 2 808 gene locus_tag LOCUS_06920 gene holA 2 808 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_06920 1527 805 gene locus_tag LOCUS_06930 1527 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1875 1561 gene locus_tag LOCUS_06940 1875 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 2093 2995 gene locus_tag LOCUS_06950 gene menA 2093 2995 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW2 protein_id gnl|my_center|LOCUS_06950 >Feature sequence0170 670 326 gene locus_tag LOCUS_06960 670 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 1123 728 gene locus_tag LOCUS_06970 1123 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951052.1 protein_id gnl|my_center|LOCUS_06970 1742 1116 gene locus_tag LOCUS_06980 1742 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 1906 1730 gene locus_tag LOCUS_06990 1906 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2094 1903 gene locus_tag LOCUS_07000 2094 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2264 2082 gene locus_tag LOCUS_07010 2264 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2396 2590 gene locus_tag LOCUS_07020 2396 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 2784 3041 gene locus_tag LOCUS_07030 2784 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence0171 295 1008 gene locus_tag LOCUS_07040 295 1008 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_07040 <3348 1005 gene locus_tag LOCUS_07050 <3348 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0P5:primosomal protein N' >Feature sequence0172 <1 1928 gene locus_tag LOCUS_07060 <1 1928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963971.1:RelA/SpoT family protein 1952 2407 gene locus_tag LOCUS_07070 gene fur 1952 2407 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence0173 161 1129 gene locus_tag LOCUS_07080 161 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1126 2127 gene locus_tag LOCUS_07090 1126 2127 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_07090 2130 3290 gene locus_tag LOCUS_07100 2130 3290 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545909.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence0174 <1 1769 gene locus_tag LOCUS_07110 <1 1769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889007.1:bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase 1808 2560 gene locus_tag LOCUS_07120 1808 2560 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_07120 2578 3174 gene locus_tag LOCUS_07130 gene paaY 2578 3174 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77181 protein_id gnl|my_center|LOCUS_07130 >Feature sequence0175 >Feature sequence0176 250 711 gene locus_tag LOCUS_07140 250 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 1229 2110 gene locus_tag LOCUS_07150 1229 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 2080 2331 gene locus_tag LOCUS_07160 2080 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 2328 2516 gene locus_tag LOCUS_07170 2328 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 >Feature sequence0177 3 641 gene locus_tag LOCUS_07180 3 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 644 1423 gene locus_tag LOCUS_07190 644 1423 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_07190 1428 1886 gene locus_tag LOCUS_07200 1428 1886 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 protein_id gnl|my_center|LOCUS_07200 1879 3153 gene locus_tag LOCUS_07210 1879 3153 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence0178 409 1326 gene locus_tag LOCUS_07220 gene ltd 409 1326 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_07220 2038 1334 gene locus_tag LOCUS_07230 2038 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 2228 2154 gene locus_tag LOCUS_t00020 2228 2154 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3314 2427 gene locus_tag LOCUS_07240 3314 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 >Feature sequence0179 383 1345 gene locus_tag LOCUS_07250 gene trxB1 383 1345 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_07250 1889 1404 gene locus_tag LOCUS_07260 1889 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 2704 1982 gene locus_tag LOCUS_07270 2704 1982 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962837.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence0180 667 371 gene locus_tag LOCUS_07280 667 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 1713 730 gene locus_tag LOCUS_07290 gene ccoP 1713 730 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_07290 1898 1710 gene locus_tag LOCUS_07300 gene ccoQ 1898 1710 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963295.1 protein_id gnl|my_center|LOCUS_07300 <3259 1901 gene locus_tag LOCUS_07310 <3259 1901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963294.1:bifunctional cbb3-type cytochrome C oxidase subunit I/II >Feature sequence0181 1420 353 gene locus_tag LOCUS_07320 gene fbaA 1420 353 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_07320 <3258 1465 gene locus_tag LOCUS_07330 <3258 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962495.1:membrane protein >Feature sequence0182 2159 1614 gene locus_tag LOCUS_07340 2159 1614 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479525.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence0183 74 1288 gene locus_tag LOCUS_07350 74 1288 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 protein_id gnl|my_center|LOCUS_07350 1355 2227 gene locus_tag LOCUS_07360 gene lipA 1355 2227 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_07360 >Feature sequence0184 3 701 gene locus_tag LOCUS_07370 3 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 698 2161 gene locus_tag LOCUS_07380 gene murE 698 2161 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_07380 >Feature sequence0185 2947 158 gene locus_tag LOCUS_07390 gene sucA 2947 158 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence0186 <1 518 gene locus_tag LOCUS_07400 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964107.1:transcriptional regulator 1360 515 gene locus_tag LOCUS_07410 1360 515 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_07410 1804 1418 gene locus_tag LOCUS_07420 1804 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_07420 >Feature sequence0187 2419 1934 gene locus_tag LOCUS_07430 gene purE 2419 1934 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_07430 <3196 2439 gene locus_tag LOCUS_07440 <3196 2439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZC2:N5-carboxyaminoimidazole ribonucleotide synthase >Feature sequence0188 1869 1270 gene locus_tag LOCUS_07450 gene pdxH 1869 1270 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 protein_id gnl|my_center|LOCUS_07450 2816 1977 gene locus_tag LOCUS_07460 gene uspA 2816 1977 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence0189 1139 567 gene locus_tag LOCUS_07470 gene clpP 1139 567 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI38 protein_id gnl|my_center|LOCUS_07470 1470 1132 gene locus_tag LOCUS_07480 1470 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 1938 1516 gene locus_tag LOCUS_07490 1938 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2789 1971 gene locus_tag LOCUS_07500 2789 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence0190 2457 1969 gene locus_tag LOCUS_07510 gene gldH 2457 1969 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence0191 1393 719 gene locus_tag LOCUS_07520 gene clpP 1393 719 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_07520 2801 1479 gene locus_tag LOCUS_07530 gene tig 2801 1479 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence0192 <1 526 gene locus_tag LOCUS_07540 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964035.1:NADH dehydrogenase 898 536 gene locus_tag LOCUS_07550 898 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 2088 976 gene locus_tag LOCUS_07560 2088 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2688 2092 gene locus_tag LOCUS_07570 2688 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291518.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence0193 566 1468 gene locus_tag LOCUS_07580 566 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 1472 2197 gene locus_tag LOCUS_07590 gene lipB 1472 2197 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_07590 2812 2174 gene locus_tag LOCUS_07600 2812 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence0194 741 1178 gene locus_tag LOCUS_07610 741 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence0195 820 59 gene locus_tag LOCUS_07620 820 59 CDS product DNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790362.1 protein_id gnl|my_center|LOCUS_07620 2106 817 gene locus_tag LOCUS_07630 2106 817 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_07630 2214 2984 gene locus_tag LOCUS_07640 2214 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence0196 <1 2551 gene locus_tag LOCUS_07650 <1 2551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962906.1:ATP-dependent Clp protease ClpC 2735 3061 gene locus_tag LOCUS_07660 2735 3061 CDS product dksA/traR C4-type zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence0197 >Feature sequence0198 268 1923 gene locus_tag LOCUS_07670 268 1923 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence0199 <1 1924 gene locus_tag LOCUS_07680 <1 1924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962399.1:patatin >Feature sequence0200 1 321 gene locus_tag LOCUS_07690 1 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 438 2327 gene locus_tag LOCUS_07700 gene yidC 438 2327 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U2 protein_id gnl|my_center|LOCUS_07700 2430 3125 gene locus_tag LOCUS_07710 2430 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964005.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence0201 278 6 gene locus_tag LOCUS_07720 278 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 466 284 gene locus_tag LOCUS_07730 466 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 891 469 gene locus_tag LOCUS_07740 891 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 1321 884 gene locus_tag LOCUS_07750 1321 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 1817 1338 gene locus_tag LOCUS_07760 1817 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2679 1834 gene locus_tag LOCUS_07770 2679 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 >Feature sequence0202 3 1298 gene locus_tag LOCUS_07780 3 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 1298 2959 gene locus_tag LOCUS_07790 1298 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence0203 <1 822 gene locus_tag LOCUS_07800 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2F2:phosphoribosylamine--glycine ligase 1071 814 gene locus_tag LOCUS_07810 1071 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 1255 2013 gene locus_tag LOCUS_07820 1255 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964559.1 protein_id gnl|my_center|LOCUS_07820 2160 2765 gene locus_tag LOCUS_07830 2160 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence0204 220 591 gene locus_tag LOCUS_07840 220 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962882.1 protein_id gnl|my_center|LOCUS_07840 591 1445 gene locus_tag LOCUS_07850 591 1445 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 protein_id gnl|my_center|LOCUS_07850 1560 2228 gene locus_tag LOCUS_07860 1560 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 <3107 2301 gene locus_tag LOCUS_07870 <3107 2301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005483312.1:hybrid sensor histidine kinase/response regulator >Feature sequence0205 527 102 gene locus_tag LOCUS_07880 527 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 896 549 gene locus_tag LOCUS_07890 896 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 942 1448 gene locus_tag LOCUS_07900 942 1448 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964325.1 protein_id gnl|my_center|LOCUS_07900 1458 2798 gene locus_tag LOCUS_07910 1458 2798 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029304.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence0206 <1 831 gene locus_tag LOCUS_07920 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964202.1:thioredoxin 837 1685 gene locus_tag LOCUS_07930 gene mscS3 837 1685 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963360.1 protein_id gnl|my_center|LOCUS_07930 1708 2421 gene locus_tag LOCUS_07940 1708 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence0207 >Feature sequence0208 317 1774 gene locus_tag LOCUS_07950 317 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 <3091 1840 gene locus_tag LOCUS_07960 <3091 1840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963348.1:serine protease >Feature sequence0209 242 523 gene locus_tag LOCUS_07970 242 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 513 845 gene locus_tag LOCUS_07980 513 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 848 1138 gene locus_tag LOCUS_07990 848 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1141 1290 gene locus_tag LOCUS_08000 1141 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 1283 1780 gene locus_tag LOCUS_08010 1283 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 1761 2081 gene locus_tag LOCUS_08020 1761 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 2447 2653 gene locus_tag LOCUS_08030 2447 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence0210 1091 564 gene locus_tag LOCUS_08040 gene ppa 1091 564 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH9 protein_id gnl|my_center|LOCUS_08040 2629 1223 gene locus_tag LOCUS_08050 2629 1223 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250240.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence0211 >Feature sequence0212 >Feature sequence0213 1386 31 gene locus_tag LOCUS_08060 1386 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 2108 1620 gene locus_tag LOCUS_08070 2108 1620 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728N4 protein_id gnl|my_center|LOCUS_08070 2952 2179 gene locus_tag LOCUS_08080 2952 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence0214 434 1669 gene locus_tag LOCUS_08090 434 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 1662 2054 gene locus_tag LOCUS_08100 1662 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 2362 2559 gene locus_tag LOCUS_08110 2362 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 2552 2821 gene locus_tag LOCUS_08120 2552 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence0215 2966 1275 gene locus_tag LOCUS_08130 2966 1275 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964344.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence0216 1677 1006 gene locus_tag LOCUS_08140 1677 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_08140 2193 1684 gene locus_tag LOCUS_08150 2193 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence0217 569 2887 gene locus_tag LOCUS_08160 gene uvrD 569 2887 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_08160 >Feature sequence0218 <1 542 gene locus_tag LOCUS_08170 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962677.1:anthranilate synthase component I 545 1114 gene locus_tag LOCUS_08180 gene pabA 545 1114 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_08180 1132 2133 gene locus_tag LOCUS_08190 gene trpD 1132 2133 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_08190 2130 2915 gene locus_tag LOCUS_08200 gene trpC 2130 2915 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_08200 >Feature sequence0219 97 975 gene locus_tag LOCUS_08210 gene ftsX 97 975 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_08210 1108 1368 gene locus_tag LOCUS_08220 gene fjo13 1108 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_08220 1372 2163 gene locus_tag LOCUS_08230 gene uppP 1372 2163 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_08230 2163 2852 gene locus_tag LOCUS_08240 gene truB 2163 2852 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_08240 >Feature sequence0220 961 1929 gene locus_tag LOCUS_08250 961 1929 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_08250 2762 1926 gene locus_tag LOCUS_08260 2762 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964150.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence0221 482 919 gene locus_tag LOCUS_08270 482 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 977 2188 gene locus_tag LOCUS_08280 gene catF 977 2188 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206899.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence0222 889 98 gene locus_tag LOCUS_08290 889 98 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_08290 1326 892 gene locus_tag LOCUS_08300 1326 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_08300 2648 1326 gene locus_tag LOCUS_08310 2648 1326 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence0223 211 735 gene locus_tag LOCUS_08320 211 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 1483 713 gene locus_tag LOCUS_08330 1483 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence0224 229 1314 gene locus_tag LOCUS_08340 229 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1330 2061 gene locus_tag LOCUS_08350 1330 2061 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence0225 442 807 gene locus_tag LOCUS_08360 442 807 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2S8 protein_id gnl|my_center|LOCUS_08360 794 1648 gene locus_tag LOCUS_08370 794 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680721.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence0226 2429 57 gene locus_tag LOCUS_08380 gene ftsK 2429 57 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_08380 2980 2534 gene locus_tag LOCUS_08390 2980 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence0227 1641 502 gene locus_tag LOCUS_08400 1641 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2390 1641 gene locus_tag LOCUS_08410 2390 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence0228 997 2547 gene locus_tag LOCUS_08420 gene porX 997 2547 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence0229 <1 609 gene locus_tag LOCUS_08430 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW44:3-oxoacyl-[acyl-carrier-protein] synthase 2 619 1362 gene locus_tag LOCUS_08440 gene rnc 619 1362 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 protein_id gnl|my_center|LOCUS_08440 1472 1963 gene locus_tag LOCUS_08450 1472 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962379.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence0230 1222 1013 gene locus_tag LOCUS_08460 1222 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 <2950 1285 gene locus_tag LOCUS_08470 <2950 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404986.1:amino acid transporter >Feature sequence0231 723 202 gene locus_tag LOCUS_08480 723 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 928 716 gene locus_tag LOCUS_08490 928 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1077 925 gene locus_tag LOCUS_08500 1077 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1471 1079 gene locus_tag LOCUS_08510 1471 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 1827 1468 gene locus_tag LOCUS_08520 1827 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286547.1 protein_id gnl|my_center|LOCUS_08520 2173 1868 gene locus_tag LOCUS_08530 2173 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 2680 2525 gene locus_tag LOCUS_08540 2680 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence0232 2170 1352 gene locus_tag LOCUS_08550 2170 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 <2929 2348 gene locus_tag LOCUS_08560 <2929 2348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963836.1:acyl-CoA dehydrogenase >Feature sequence0233 632 258 gene locus_tag LOCUS_08570 632 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 898 632 gene locus_tag LOCUS_08580 898 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 1725 877 gene locus_tag LOCUS_08590 1725 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2157 1756 gene locus_tag LOCUS_08600 2157 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence0234 1371 2444 gene locus_tag LOCUS_08610 1371 2444 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903891.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence0235 358 1944 gene locus_tag LOCUS_08620 358 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1959 2765 gene locus_tag LOCUS_08630 1959 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence0236 <1 672 gene locus_tag LOCUS_08640 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962530.1:two-component sensor histidine kinase 1707 637 gene locus_tag LOCUS_08650 1707 637 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_08650 1792 2472 gene locus_tag LOCUS_08660 gene trmB 1792 2472 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_08660 >Feature sequence0237 1227 865 gene locus_tag LOCUS_08670 1227 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 1714 1352 gene locus_tag LOCUS_08680 1714 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 1898 1767 gene locus_tag LOCUS_08690 1898 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 <2899 1949 gene locus_tag LOCUS_08700 <2899 1949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764018.1:membrane protein >Feature sequence0238 1323 601 gene locus_tag LOCUS_08710 1323 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 2046 1555 gene locus_tag LOCUS_08720 2046 1555 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence0239 365 562 gene locus_tag LOCUS_08730 365 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 763 1074 gene locus_tag LOCUS_08740 763 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1223 1456 gene locus_tag LOCUS_08750 1223 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1453 1755 gene locus_tag LOCUS_08760 1453 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1770 1937 gene locus_tag LOCUS_08770 1770 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2160 1978 gene locus_tag LOCUS_08780 2160 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2602 2847 gene locus_tag LOCUS_08790 2602 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence0240 <1 872 gene locus_tag LOCUS_08800 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963376.1:sugar transferase 2072 876 gene locus_tag LOCUS_08810 2072 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405075.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence0241 1332 619 gene locus_tag LOCUS_08820 1332 619 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_08820 2517 1381 gene locus_tag LOCUS_08830 2517 1381 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268812.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence0242 1146 385 gene locus_tag LOCUS_08840 1146 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1219 2361 gene locus_tag LOCUS_08850 1219 2361 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_08850 >Feature sequence0243 1073 2215 gene locus_tag LOCUS_08860 1073 2215 CDS product copper-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550379.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence0244 >Feature sequence0245 <1 729 gene locus_tag LOCUS_08870 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404720.1:universal stress protein 1745 756 gene locus_tag LOCUS_08880 gene ldhA 1745 756 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973390.1 protein_id gnl|my_center|LOCUS_08880 2386 1748 gene locus_tag LOCUS_08890 2386 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence0246 703 906 gene locus_tag LOCUS_08900 703 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence0247 1262 162 gene locus_tag LOCUS_08910 1262 162 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_08910 1391 2020 gene locus_tag LOCUS_08920 gene rsmG 1391 2020 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_08920 2576 2010 gene locus_tag LOCUS_08930 2576 2010 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532010.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence0248 <1 1901 gene locus_tag LOCUS_08940 <1 1901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963860.1:antirepressor 2641 2126 gene locus_tag LOCUS_08950 gene apt 2641 2126 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1A4 protein_id gnl|my_center|LOCUS_08950 >Feature sequence0249 >Feature sequence0250 2 604 gene locus_tag LOCUS_08960 2 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 2271 601 gene locus_tag LOCUS_08970 gene gatA 2271 601 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759455.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence0251 <1 1049 gene locus_tag LOCUS_08980 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861436.1:peptidyl-arginine deiminase 1190 1546 gene locus_tag LOCUS_08990 1190 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2138 1557 gene locus_tag LOCUS_09000 gene tag 2138 1557 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence0252 <2798 1171 gene locus_tag LOCUS_09010 <2798 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXH5:phosphoribosylformylglycinamidine synthase >Feature sequence0253 2796 2401 gene locus_tag LOCUS_09020 2796 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence0254 1 444 gene locus_tag LOCUS_09030 1 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 509 1477 gene locus_tag LOCUS_09040 509 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence0255 <1 822 gene locus_tag LOCUS_09050 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963618.1:TonB-dependent receptor 2144 1137 gene locus_tag LOCUS_09060 gene fabH2 2144 1137 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_09060 2295 2777 gene locus_tag LOCUS_09070 2295 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence0256 505 864 gene locus_tag LOCUS_09080 505 864 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_09080 2168 873 gene locus_tag LOCUS_09090 2168 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2554 2324 gene locus_tag LOCUS_09100 2554 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence0257 1741 734 gene locus_tag LOCUS_09110 1741 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 <2783 1848 gene locus_tag LOCUS_09120 <2783 1848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000752843.1:portal protein >Feature sequence0258 1338 673 gene locus_tag LOCUS_09130 gene sdhC 1338 673 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence0259 2128 95 gene locus_tag LOCUS_09140 2128 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_09140 <2764 2194 gene locus_tag LOCUS_09150 <2764 2194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963112.1:beta-ketoacyl-ACP reductase >Feature sequence0260 1212 799 gene locus_tag LOCUS_09160 1212 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_09160 1864 1274 gene locus_tag LOCUS_09170 gene def 1864 1274 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_09170 2281 1871 gene locus_tag LOCUS_09180 2281 1871 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_09180 >Feature sequence0261 >Feature sequence0262 848 159 gene locus_tag LOCUS_09190 848 159 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_09190 <2739 905 gene locus_tag LOCUS_09200 <2739 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H244:leucine--tRNA ligase >Feature sequence0263 126 992 gene locus_tag LOCUS_09210 126 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 992 1414 gene locus_tag LOCUS_09220 992 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 2294 1767 gene locus_tag LOCUS_09230 2294 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence0264 240 2330 gene locus_tag LOCUS_09240 240 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence0265 250 669 gene locus_tag LOCUS_09250 250 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 792 1160 gene locus_tag LOCUS_09260 792 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1162 1971 gene locus_tag LOCUS_09270 1162 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 2145 2546 gene locus_tag LOCUS_09280 2145 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence0266 1042 311 gene locus_tag LOCUS_09290 1042 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2271 1093 gene locus_tag LOCUS_09300 gene purM 2271 1093 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_09300 >Feature sequence0267 1026 295 gene locus_tag LOCUS_09310 gene birA 1026 295 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_09310 1112 1483 gene locus_tag LOCUS_09320 gene rsfS 1112 1483 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_09320 >Feature sequence0268 243 10 gene locus_tag LOCUS_09330 243 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 965 246 gene locus_tag LOCUS_09340 965 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1324 1043 gene locus_tag LOCUS_09350 1324 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1638 1336 gene locus_tag LOCUS_09360 1638 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence0269 <1 1630 gene locus_tag LOCUS_09370 <1 1630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268937.1:aldehyde oxidase >Feature sequence0270 436 188 gene locus_tag LOCUS_09380 436 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence0271 990 1616 gene locus_tag LOCUS_09390 990 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1662 1943 gene locus_tag LOCUS_09400 1662 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence0272 <1 570 gene locus_tag LOCUS_09410 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H228:monofunctional biosynthetic peptidoglycan transglycosylase 567 1025 gene locus_tag LOCUS_09420 567 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_09420 1499 1026 gene locus_tag LOCUS_09430 1499 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 2035 1496 gene locus_tag LOCUS_09440 2035 1496 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119942.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence0273 >Feature sequence0274 2001 613 gene locus_tag LOCUS_09450 2001 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 <2685 2094 gene locus_tag LOCUS_09460 <2685 2094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964328.1:TonB-dependent receptor >Feature sequence0275 780 259 gene locus_tag LOCUS_09470 gene aroK 780 259 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 protein_id gnl|my_center|LOCUS_09470 900 973 gene locus_tag LOCUS_t00030 900 973 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1008 1091 gene locus_tag LOCUS_t00040 1008 1091 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1512 1201 gene locus_tag LOCUS_09480 1512 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1805 1593 gene locus_tag LOCUS_09490 1805 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2077 1802 gene locus_tag LOCUS_09500 2077 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence0276 >Feature sequence0277 202 1323 gene locus_tag LOCUS_09510 202 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence0278 1116 2465 gene locus_tag LOCUS_09520 1116 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence0279 2011 1469 gene locus_tag LOCUS_09530 2011 1469 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_09530 <2663 2132 gene locus_tag LOCUS_09540 <2663 2132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1S7:protein RecA >Feature sequence0280 89 1564 gene locus_tag LOCUS_09550 89 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_09550 2009 1554 gene locus_tag LOCUS_09560 2009 1554 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence0281 >Feature sequence0282 592 368 gene locus_tag LOCUS_09570 592 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 733 1272 gene locus_tag LOCUS_09580 733 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2282 1269 gene locus_tag LOCUS_09590 gene murB 2282 1269 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_09590 >Feature sequence0283 317 174 gene locus_tag LOCUS_09600 317 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1329 811 gene locus_tag LOCUS_09610 1329 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1934 1500 gene locus_tag LOCUS_09620 1934 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2413 2183 gene locus_tag LOCUS_09630 2413 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence0284 1421 147 gene locus_tag LOCUS_09640 1421 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence0285 1189 737 gene locus_tag LOCUS_09650 gene dtd 1189 737 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 protein_id gnl|my_center|LOCUS_09650 2136 1186 gene locus_tag LOCUS_09660 gene rsgA 2136 1186 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 protein_id gnl|my_center|LOCUS_09660 2629 2216 gene locus_tag LOCUS_09670 2629 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence0286 608 72 gene locus_tag LOCUS_09680 608 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 821 1681 gene locus_tag LOCUS_09690 821 1681 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_09690 1684 2481 gene locus_tag LOCUS_09700 1684 2481 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence0287 <1 927 gene locus_tag LOCUS_09710 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964014.1:oxidoreductase 939 1826 gene locus_tag LOCUS_09720 939 1826 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence0288 1769 1350 gene locus_tag LOCUS_09730 1769 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1998 1744 gene locus_tag LOCUS_09740 1998 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 <2628 2032 gene locus_tag LOCUS_09750 <2628 2032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001196946.1:coat protein >Feature sequence0289 1100 642 gene locus_tag LOCUS_09760 1100 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence0290 237 1694 gene locus_tag LOCUS_09770 237 1694 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_09770 1711 2517 gene locus_tag LOCUS_09780 gene crt 1711 2517 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence0291 <2621 1655 gene locus_tag LOCUS_09790 <2621 1655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX63:protein translocase subunit SecA >Feature sequence0292 >Feature sequence0293 1055 624 gene locus_tag LOCUS_09800 1055 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1350 1153 gene locus_tag LOCUS_09810 1350 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1644 1495 gene locus_tag LOCUS_09820 1644 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1933 1721 gene locus_tag LOCUS_09830 1933 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2091 1930 gene locus_tag LOCUS_09840 2091 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2462 2088 gene locus_tag LOCUS_09850 2462 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101104.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence0294 <1 513 gene locus_tag LOCUS_09860 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976335.1:phenylacetate-CoA oxygenase subunit PaaA 571 858 gene locus_tag LOCUS_09870 gene paaB 571 858 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902768.1 protein_id gnl|my_center|LOCUS_09870 874 1626 gene locus_tag LOCUS_09880 874 1626 CDS product phenylacetate-CoA oxygenase subunit PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705612.1 protein_id gnl|my_center|LOCUS_09880 1741 2241 gene locus_tag LOCUS_09890 gene paaD 1741 2241 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence0295 >Feature sequence0296 465 34 gene locus_tag LOCUS_09900 465 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 608 1786 gene locus_tag LOCUS_09910 gene bioF 608 1786 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_09910 1812 2444 gene locus_tag LOCUS_09920 gene bioD 1812 2444 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_09920 >Feature sequence0297 314 652 gene locus_tag LOCUS_09930 gene csaA 314 652 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_09930 1779 649 gene locus_tag LOCUS_09940 1779 649 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 protein_id gnl|my_center|LOCUS_09940 1793 1942 gene locus_tag LOCUS_09950 1793 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence0298 249 995 gene locus_tag LOCUS_09960 249 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1010 1726 gene locus_tag LOCUS_09970 1010 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1723 1860 gene locus_tag LOCUS_09980 1723 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1897 2436 gene locus_tag LOCUS_09990 1897 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence0299 129 1790 gene locus_tag LOCUS_10000 129 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence0300 588 1148 gene locus_tag LOCUS_10010 588 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1135 1506 gene locus_tag LOCUS_10020 1135 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1544 2083 gene locus_tag LOCUS_10030 1544 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166765.1 protein_id gnl|my_center|LOCUS_10030 2428 2150 gene locus_tag LOCUS_10040 2428 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence0301 1347 580 gene locus_tag LOCUS_10050 1347 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2508 1402 gene locus_tag LOCUS_10060 gene dinB2 2508 1402 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_10060 >Feature sequence0302 <1 863 gene locus_tag LOCUS_10070 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963153.1:aminopeptidase 863 1777 gene locus_tag LOCUS_10080 863 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 2298 1774 gene locus_tag LOCUS_10090 2298 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence0303 <2583 761 gene locus_tag LOCUS_10100 <2583 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963986.1:TonB-dependent receptor >Feature sequence0304 296 1222 gene locus_tag LOCUS_10110 296 1222 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_10110 1815 1219 gene locus_tag LOCUS_10120 gene ddpX 1815 1219 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H017 protein_id gnl|my_center|LOCUS_10120 >Feature sequence0305 468 1496 gene locus_tag LOCUS_10130 gene ribD 468 1496 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_10130 1493 2365 gene locus_tag LOCUS_10140 1493 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44170 protein_id gnl|my_center|LOCUS_10140 >Feature sequence0306 434 1555 gene locus_tag LOCUS_10150 gene pepC 434 1555 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_10150 1586 2032 gene locus_tag LOCUS_10160 1586 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2573 2061 gene locus_tag LOCUS_10170 2573 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence0307 195 473 gene locus_tag LOCUS_10180 gene rpmE 195 473 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_10180 586 1761 gene locus_tag LOCUS_10190 586 1761 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence0308 1378 656 gene locus_tag LOCUS_10200 1378 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1954 1379 gene locus_tag LOCUS_10210 1954 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence0309 34 888 gene locus_tag LOCUS_10220 34 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 919 1965 gene locus_tag LOCUS_10230 919 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531602.1 protein_id gnl|my_center|LOCUS_10230 2053 2388 gene locus_tag LOCUS_10240 2053 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 >Feature sequence0310 2 712 gene locus_tag LOCUS_10250 2 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 717 1133 gene locus_tag LOCUS_10260 717 1133 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence0311 83 490 gene locus_tag LOCUS_10270 gene ygcM 83 490 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_10270 483 1460 gene locus_tag LOCUS_10280 gene manA 483 1460 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 protein_id gnl|my_center|LOCUS_10280 1495 1761 gene locus_tag LOCUS_10290 1495 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963895.1 protein_id gnl|my_center|LOCUS_10290 2404 1766 gene locus_tag LOCUS_10300 2404 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence0312 <1 1337 gene locus_tag LOCUS_10310 <1 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759576.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence0313 1546 1238 gene locus_tag LOCUS_10320 1546 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 2151 1627 gene locus_tag LOCUS_10330 2151 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence0314 >Feature sequence0315 >Feature sequence0316 785 117 gene locus_tag LOCUS_10340 785 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_10340 1000 2553 gene locus_tag LOCUS_10350 gene htpG 1000 2553 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_10350 >Feature sequence0317 >Feature sequence0318 >Feature sequence0319 >Feature sequence0320 831 1163 gene locus_tag LOCUS_10360 831 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1258 2157 gene locus_tag LOCUS_10370 1258 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence0321 537 1541 gene locus_tag LOCUS_10380 537 1541 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_10380 1638 2504 gene locus_tag LOCUS_10390 1638 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence0322 535 59 gene locus_tag LOCUS_10400 535 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2391 643 gene locus_tag LOCUS_10410 2391 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence0323 1115 150 gene locus_tag LOCUS_10420 gene kdsD 1115 150 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence0324 331 723 gene locus_tag LOCUS_10430 gene ytxJ 331 723 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_10430 1840 752 gene locus_tag LOCUS_10440 1840 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963930.1 protein_id gnl|my_center|LOCUS_10440 <2523 1968 gene locus_tag LOCUS_10450 <2523 1968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962840.1:fumarylacetoacetase >Feature sequence0325 >Feature sequence0326 1 885 gene locus_tag LOCUS_10460 1 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 954 1568 gene locus_tag LOCUS_10470 954 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 protein_id gnl|my_center|LOCUS_10470 1894 1589 gene locus_tag LOCUS_10480 1894 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 <2506 1920 gene locus_tag LOCUS_10490 <2506 1920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964058.1:phenylalanine 4-monooxygenase >Feature sequence0327 528 698 gene locus_tag LOCUS_10500 528 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 685 960 gene locus_tag LOCUS_10510 685 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 957 1364 gene locus_tag LOCUS_10520 957 1364 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262479.1 protein_id gnl|my_center|LOCUS_10520 1357 1566 gene locus_tag LOCUS_10530 1357 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1478 1735 gene locus_tag LOCUS_10540 1478 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1807 2499 gene locus_tag LOCUS_10550 1807 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence0328 <1 2207 gene locus_tag LOCUS_10560 <1 2207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109087.1:collagen-binding protein >Feature sequence0329 569 249 gene locus_tag LOCUS_10570 569 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 protein_id gnl|my_center|LOCUS_10570 1197 832 gene locus_tag LOCUS_10580 1197 832 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY02 protein_id gnl|my_center|LOCUS_10580 >Feature sequence0330 1 756 gene locus_tag LOCUS_10590 1 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 756 1367 gene locus_tag LOCUS_10600 756 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964358.1 protein_id gnl|my_center|LOCUS_10600 1360 1617 gene locus_tag LOCUS_10610 1360 1617 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence0331 633 2456 gene locus_tag LOCUS_10620 633 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973596.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence0332 113 601 gene locus_tag LOCUS_10630 113 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 601 1032 gene locus_tag LOCUS_10640 601 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1051 1329 gene locus_tag LOCUS_10650 1051 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1333 1929 gene locus_tag LOCUS_10660 1333 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1929 2321 gene locus_tag LOCUS_10670 1929 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence0333 535 1608 gene locus_tag LOCUS_10680 535 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence0334 >Feature sequence0335 167 1159 gene locus_tag LOCUS_10690 gene troA 167 1159 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_10690 1159 1896 gene locus_tag LOCUS_10700 1159 1896 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_10700 >Feature sequence0336 >Feature sequence0337 1246 170 gene locus_tag LOCUS_10710 1246 170 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247147.1 protein_id gnl|my_center|LOCUS_10710 2397 1312 gene locus_tag LOCUS_10720 2397 1312 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence0338 <1 2109 gene locus_tag LOCUS_10730 <1 2109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071225.1:acriflavin resistance protein >Feature sequence0339 112 1002 gene locus_tag LOCUS_10740 112 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1005 2432 gene locus_tag LOCUS_10750 1005 2432 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence0340 1325 1086 gene locus_tag LOCUS_10760 1325 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1996 1367 gene locus_tag LOCUS_10770 1996 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2436 1996 gene locus_tag LOCUS_10780 2436 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence0341 >Feature sequence0342 2362 1025 gene locus_tag LOCUS_10790 2362 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence0343 361 1131 gene locus_tag LOCUS_10800 gene mreC 361 1131 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 protein_id gnl|my_center|LOCUS_10800 1121 1627 gene locus_tag LOCUS_10810 gene mreD 1121 1627 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence0344 515 1192 gene locus_tag LOCUS_10820 515 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 protein_id gnl|my_center|LOCUS_10820 1196 2434 gene locus_tag LOCUS_10830 1196 2434 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence0345 553 1806 gene locus_tag LOCUS_10840 553 1806 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence0346 1369 545 gene locus_tag LOCUS_10850 1369 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1626 1366 gene locus_tag LOCUS_10860 1626 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence0347 2 793 gene locus_tag LOCUS_10870 2 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence0348 676 233 gene locus_tag LOCUS_10880 676 233 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974893.1 protein_id gnl|my_center|LOCUS_10880 1422 928 gene locus_tag LOCUS_10890 1422 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 <2433 1499 gene locus_tag LOCUS_10900 <2433 1499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876948.1:diaminopimelate decarboxylase >Feature sequence0349 >Feature sequence0350 >Feature sequence0351 1851 508 gene locus_tag LOCUS_10910 gene gdhA 1851 508 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_10910 >Feature sequence0352 913 2055 gene locus_tag LOCUS_10920 gene wbsE 913 2055 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence0353 >Feature sequence0354 2266 272 gene locus_tag LOCUS_10930 gene ligA 2266 272 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 protein_id gnl|my_center|LOCUS_10930 >Feature sequence0355 1593 238 gene locus_tag LOCUS_10940 1593 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2120 1596 gene locus_tag LOCUS_10950 2120 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence0356 971 390 gene locus_tag LOCUS_10960 971 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2244 979 gene locus_tag LOCUS_10970 gene cysN 2244 979 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_10970 >Feature sequence0357 637 275 gene locus_tag LOCUS_10980 637 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1101 715 gene locus_tag LOCUS_10990 1101 715 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_10990 2059 1103 gene locus_tag LOCUS_11000 2059 1103 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence0358 <1 817 gene locus_tag LOCUS_11010 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002485353.1:pyridoxal-dependent decarboxylase 846 1976 gene locus_tag LOCUS_11020 846 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1978 2364 gene locus_tag LOCUS_11030 gene apaG 1978 2364 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence0359 710 1435 gene locus_tag LOCUS_11040 710 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence0360 >Feature sequence0361 2 472 gene locus_tag LOCUS_11050 2 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 527 940 gene locus_tag LOCUS_11060 527 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence0362 466 1398 gene locus_tag LOCUS_11070 466 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1420 1839 gene locus_tag LOCUS_11080 1420 1839 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB16 protein_id gnl|my_center|LOCUS_11080 1849 2220 gene locus_tag LOCUS_11090 1849 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence0363 >Feature sequence0364 255 1031 gene locus_tag LOCUS_11100 gene gumL 255 1031 CDS product GumL protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037585.1 protein_id gnl|my_center|LOCUS_11100 1093 2310 gene locus_tag LOCUS_11110 gene rfbB 1093 2310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence0365 <1 572 gene locus_tag LOCUS_11120 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1A5:putative GTP-binding protein EngB 912 547 gene locus_tag LOCUS_11130 912 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1247 912 gene locus_tag LOCUS_11140 gene gldC 1247 912 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_11140 2236 1247 gene locus_tag LOCUS_11150 gene gldB 2236 1247 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence0366 1278 499 gene locus_tag LOCUS_11160 1278 499 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203148.1 protein_id gnl|my_center|LOCUS_11160 1760 1275 gene locus_tag LOCUS_11170 1760 1275 CDS product ankyrin repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963598.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence0367 >Feature sequence0368 122 976 gene locus_tag LOCUS_11180 122 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 <2352 1041 gene locus_tag LOCUS_11190 <2352 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203545.1:cell envelope biogenesis protein TonB >Feature sequence0369 2047 776 gene locus_tag LOCUS_11200 gene serS 2047 776 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence0370 190 53 gene locus_tag LOCUS_11210 190 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1119 433 gene locus_tag LOCUS_11220 1119 433 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_11220 1965 1192 gene locus_tag LOCUS_11230 1965 1192 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence0371 395 213 gene locus_tag LOCUS_11240 395 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 646 422 gene locus_tag LOCUS_11250 646 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 770 1423 gene locus_tag LOCUS_11260 770 1423 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107439.1 protein_id gnl|my_center|LOCUS_11260 <2342 1400 gene locus_tag LOCUS_11270 <2342 1400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962573.1:3-deoxy-D-manno-octulosonic acid transferase >Feature sequence0372 279 1634 gene locus_tag LOCUS_11280 gene wcaJ 279 1634 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_11280 <2340 1631 gene locus_tag LOCUS_11290 <2340 1631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107354.1:glycosyltransferase WbuB >Feature sequence0373 <2327 953 gene locus_tag LOCUS_11300 <2327 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404972.1:methylmalonyl-CoA carboxyltransferase >Feature sequence0374 <1 623 gene locus_tag LOCUS_11310 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:signal transduction histidine kinase note possible pseudo, internal stop codon 639 1973 gene locus_tag LOCUS_11320 639 1973 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence0375 <2321 440 gene locus_tag LOCUS_11330 <2321 440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963589.1:histidine kinase >Feature sequence0376 501 698 gene locus_tag LOCUS_11340 501 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 720 959 gene locus_tag LOCUS_11350 720 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_11350 1046 1984 gene locus_tag LOCUS_11360 1046 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence0377 527 979 gene locus_tag LOCUS_11370 527 979 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence0378 557 129 gene locus_tag LOCUS_11380 557 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 923 558 gene locus_tag LOCUS_11390 923 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1141 1395 gene locus_tag LOCUS_11400 1141 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence0379 375 58 gene locus_tag LOCUS_11410 375 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 662 372 gene locus_tag LOCUS_11420 662 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 838 659 gene locus_tag LOCUS_11430 838 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1341 835 gene locus_tag LOCUS_11440 1341 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1630 1325 gene locus_tag LOCUS_11450 1630 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2014 1733 gene locus_tag LOCUS_11460 2014 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2139 2011 gene locus_tag LOCUS_11470 2139 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence0380 765 1082 gene locus_tag LOCUS_11480 765 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence0381 952 239 gene locus_tag LOCUS_11490 gene pdxJ 952 239 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 protein_id gnl|my_center|LOCUS_11490 1039 1695 gene locus_tag LOCUS_11500 1039 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence0382 314 84 gene locus_tag LOCUS_11510 314 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1537 1944 gene locus_tag LOCUS_11520 1537 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence0383 <1 677 gene locus_tag LOCUS_11530 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FUJ2:copper homeostasis protein CutC 1181 681 gene locus_tag LOCUS_11540 1181 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1683 1204 gene locus_tag LOCUS_11550 1683 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784138.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence0384 2018 1020 gene locus_tag LOCUS_11560 2018 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11560 >Feature sequence0385 532 29 gene locus_tag LOCUS_11570 532 29 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545769.1 protein_id gnl|my_center|LOCUS_11570 1647 532 gene locus_tag LOCUS_11580 1647 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 2220 1648 gene locus_tag LOCUS_11590 2220 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence0386 86 520 gene locus_tag LOCUS_11600 86 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 <2288 517 gene locus_tag LOCUS_11610 <2288 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964459.1:TonB-dependent receptor >Feature sequence0387 1171 809 gene locus_tag LOCUS_11620 1171 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence0388 311 1264 gene locus_tag LOCUS_11630 gene accA 311 1264 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_11630 >Feature sequence0389 >Feature sequence0390 1762 884 gene locus_tag LOCUS_11640 gene hisG 1762 884 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY81 protein_id gnl|my_center|LOCUS_11640 >Feature sequence0391 >Feature sequence0392 911 228 gene locus_tag LOCUS_11650 911 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1156 959 gene locus_tag LOCUS_11660 1156 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence0393 85 774 gene locus_tag LOCUS_11670 85 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 908 2044 gene locus_tag LOCUS_11680 908 2044 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963394.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence0394 1859 492 gene locus_tag LOCUS_11690 1859 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence0395 1909 983 gene locus_tag LOCUS_11700 gene natA 1909 983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence0396 >Feature sequence0397 878 120 gene locus_tag LOCUS_11710 878 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1561 884 gene locus_tag LOCUS_11720 1561 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2204 1578 gene locus_tag LOCUS_11730 2204 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766952.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence0398 >Feature sequence0399 719 90 gene locus_tag LOCUS_11740 719 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence0400 139 396 gene locus_tag LOCUS_11750 139 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 393 563 gene locus_tag LOCUS_11760 393 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 606 1019 gene locus_tag LOCUS_11770 606 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1019 1276 gene locus_tag LOCUS_11780 1019 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1273 1839 gene locus_tag LOCUS_11790 1273 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1836 2006 gene locus_tag LOCUS_11800 1836 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 2003 2209 gene locus_tag LOCUS_11810 2003 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence0401 677 276 gene locus_tag LOCUS_11820 677 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1342 677 gene locus_tag LOCUS_11830 1342 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2111 1479 gene locus_tag LOCUS_11840 2111 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence0402 <2226 1283 gene locus_tag LOCUS_11850 <2226 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963607.1:TonB-dependent receptor >Feature sequence0403 201 1715 gene locus_tag LOCUS_11860 gene gpmI 201 1715 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_11860 1759 2160 gene locus_tag LOCUS_11870 1759 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761508.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence0404 >Feature sequence0405 652 449 gene locus_tag LOCUS_11880 652 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 721 1242 gene locus_tag LOCUS_11890 721 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1787 1245 gene locus_tag LOCUS_11900 1787 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence0406 509 1138 gene locus_tag LOCUS_11910 509 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 protein_id gnl|my_center|LOCUS_11910 <2210 1122 gene locus_tag LOCUS_11920 <2210 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963288.1:endonuclease >Feature sequence0407 1559 480 gene locus_tag LOCUS_11930 1559 480 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_11930 <2210 1564 gene locus_tag LOCUS_11940 <2210 1564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX92:queuine tRNA-ribosyltransferase >Feature sequence0408 >Feature sequence0409 693 232 gene locus_tag LOCUS_11950 693 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1064 699 gene locus_tag LOCUS_11960 1064 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1339 1088 gene locus_tag LOCUS_11970 1339 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1674 1339 gene locus_tag LOCUS_11980 1674 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1849 1664 gene locus_tag LOCUS_11990 1849 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence0410 1537 1040 gene locus_tag LOCUS_12000 1537 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1841 1560 gene locus_tag LOCUS_12010 1841 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence0411 <2206 141 gene locus_tag LOCUS_12020 <2206 141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964346.1:glycerol acyltransferase >Feature sequence0412 1771 344 gene locus_tag LOCUS_12030 1771 344 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence0413 >Feature sequence0414 767 324 gene locus_tag LOCUS_12040 767 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 905 1603 gene locus_tag LOCUS_12050 gene radC 905 1603 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence0415 20 283 gene locus_tag LOCUS_12060 20 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 928 659 gene locus_tag LOCUS_12070 928 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1658 933 gene locus_tag LOCUS_12080 1658 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2092 1892 gene locus_tag LOCUS_12090 2092 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence0416 964 509 gene locus_tag LOCUS_12100 964 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12100 <2202 1263 gene locus_tag LOCUS_12110 <2202 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070433.1:bifunctional TolB-family protein/amidohydrolase >Feature sequence0417 <1 1401 gene locus_tag LOCUS_12120 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZD2:glycine dehydrogenase (aminomethyl-transferring) >Feature sequence0418 611 1141 gene locus_tag LOCUS_12130 611 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1301 1708 gene locus_tag LOCUS_12140 1301 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence0419 >Feature sequence0420 745 1302 gene locus_tag LOCUS_12150 745 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1303 1503 gene locus_tag LOCUS_12160 1303 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1505 2026 gene locus_tag LOCUS_12170 1505 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence0421 1801 1055 gene locus_tag LOCUS_12180 1801 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence0422 429 172 gene locus_tag LOCUS_12190 429 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1346 429 gene locus_tag LOCUS_12200 1346 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1699 1343 gene locus_tag LOCUS_12210 1699 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1913 1692 gene locus_tag LOCUS_12220 1913 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 2081 1920 gene locus_tag LOCUS_12230 2081 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence0423 1164 739 gene locus_tag LOCUS_12240 1164 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2125 1253 gene locus_tag LOCUS_12250 gene rimK 2125 1253 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JS5 protein_id gnl|my_center|LOCUS_12250 >Feature sequence0424 1870 1640 gene locus_tag LOCUS_12260 1870 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence0425 >Feature sequence0426 484 1350 gene locus_tag LOCUS_12270 gene mvaB 484 1350 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence0427 >Feature sequence0428 >Feature sequence0429 800 606 gene locus_tag LOCUS_12280 800 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1406 807 gene locus_tag LOCUS_12290 1406 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 <2170 1506 gene locus_tag LOCUS_12300 <2170 1506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404227.1:aconitate hydratase >Feature sequence0430 <1 1091 gene locus_tag LOCUS_12310 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962362.1:NAD metabolism ATPase/kinase 1091 1495 gene locus_tag LOCUS_12320 1091 1495 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence0431 >Feature sequence0432 559 825 gene locus_tag LOCUS_12330 559 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 818 1909 gene locus_tag LOCUS_12340 818 1909 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_12340 2124 2050 gene locus_tag LOCUS_t00050 2124 2050 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0433 <1 623 gene locus_tag LOCUS_12350 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1B0:DNA primase 1257 625 gene locus_tag LOCUS_12360 1257 625 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964170.1 protein_id gnl|my_center|LOCUS_12360 <2155 1419 gene locus_tag LOCUS_12370 <2155 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1A8:NH(3)-dependent NAD(+) synthetase >Feature sequence0434 <1 1451 gene locus_tag LOCUS_12380 <1 1451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963773.1:T9SS C-terminal target domain-containing protein >Feature sequence0435 849 1616 gene locus_tag LOCUS_12390 849 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_12390 2152 1631 gene locus_tag LOCUS_12400 2152 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence0436 <1 1169 gene locus_tag LOCUS_12410 <1 1169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WNT5:error-prone DNA polymerase >Feature sequence0437 1933 962 gene locus_tag LOCUS_12420 1933 962 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence0438 795 508 gene locus_tag LOCUS_12430 795 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1155 958 gene locus_tag LOCUS_12440 1155 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1704 1165 gene locus_tag LOCUS_12450 1704 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1865 2050 gene locus_tag LOCUS_12460 1865 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence0439 184 1080 gene locus_tag LOCUS_12470 gene mscS 184 1080 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_12470 1225 2067 gene locus_tag LOCUS_12480 1225 2067 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence0440 <2132 853 gene locus_tag LOCUS_12490 <2132 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963906.1:membrane protein >Feature sequence0441 1333 1181 gene locus_tag LOCUS_12500 1333 1181 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_12500 1556 1374 gene locus_tag LOCUS_12510 gene rpmG 1556 1374 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_12510 1824 1585 gene locus_tag LOCUS_12520 gene rpmB 1824 1585 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_12520 >Feature sequence0442 >Feature sequence0443 738 433 gene locus_tag LOCUS_12530 738 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1774 815 gene locus_tag LOCUS_12540 1774 815 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962707.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence0444 316 119 gene locus_tag LOCUS_12550 316 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 991 389 gene locus_tag LOCUS_12560 991 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1478 996 gene locus_tag LOCUS_12570 1478 996 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_12570 1727 1948 gene locus_tag LOCUS_12580 1727 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence0445 >Feature sequence0446 1158 610 gene locus_tag LOCUS_12590 gene rmlC 1158 610 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_12590 2015 1158 gene locus_tag LOCUS_12600 gene rmlA 2015 1158 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95778 protein_id gnl|my_center|LOCUS_12600 >Feature sequence0447 371 913 gene locus_tag LOCUS_12610 371 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 981 1721 gene locus_tag LOCUS_12620 981 1721 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence0448 >Feature sequence0449 996 634 gene locus_tag LOCUS_12630 996 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2102 1164 gene locus_tag LOCUS_12640 2102 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence0450 810 340 gene locus_tag LOCUS_12650 810 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1962 1051 gene locus_tag LOCUS_12660 1962 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence0451 151 957 gene locus_tag LOCUS_12670 151 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_12670 981 1796 gene locus_tag LOCUS_12680 gene murQ 981 1796 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_12680 1789 2013 gene locus_tag LOCUS_12690 1789 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence0452 >Feature sequence0453 >Feature sequence0454 299 1177 gene locus_tag LOCUS_12700 gene dapA 299 1177 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_12700 >Feature sequence0455 533 255 gene locus_tag LOCUS_12710 533 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12710 1154 540 gene locus_tag LOCUS_12720 1154 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12720 >Feature sequence0456 581 850 gene locus_tag LOCUS_12730 581 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 854 1009 gene locus_tag LOCUS_12740 854 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1011 1229 gene locus_tag LOCUS_12750 1011 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence0457 447 776 gene locus_tag LOCUS_12760 447 776 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_12760 789 1388 gene locus_tag LOCUS_12770 789 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_12770 1392 1829 gene locus_tag LOCUS_12780 1392 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence0458 1818 637 gene locus_tag LOCUS_12790 1818 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence0459 >Feature sequence0460 >Feature sequence0461 <1 584 gene locus_tag LOCUS_12800 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964417.1:adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA 1010 573 gene locus_tag LOCUS_12810 1010 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence0462 624 1937 gene locus_tag LOCUS_12820 gene capK 624 1937 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964561.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence0463 1431 421 gene locus_tag LOCUS_12830 gene fbp 1431 421 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWD9 protein_id gnl|my_center|LOCUS_12830 1430 1996 gene locus_tag LOCUS_12840 1430 1996 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence0464 230 1156 gene locus_tag LOCUS_12850 230 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1203 1877 gene locus_tag LOCUS_12860 1203 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence0465 1568 615 gene locus_tag LOCUS_12870 1568 615 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence0466 611 18 gene locus_tag LOCUS_12880 611 18 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083338.1 protein_id gnl|my_center|LOCUS_12880 1325 723 gene locus_tag LOCUS_12890 1325 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence0467 1228 737 gene locus_tag LOCUS_12900 1228 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence0468 >Feature sequence0469 956 615 gene locus_tag LOCUS_12910 956 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1081 953 gene locus_tag LOCUS_12920 1081 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1521 1150 gene locus_tag LOCUS_12930 1521 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1843 1574 gene locus_tag LOCUS_12940 1843 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence0470 104 313 gene locus_tag LOCUS_12950 104 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 633 845 gene locus_tag LOCUS_12960 633 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 925 1302 gene locus_tag LOCUS_12970 925 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1522 1397 gene locus_tag LOCUS_12980 1522 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1657 1854 gene locus_tag LOCUS_12990 1657 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence0471 >Feature sequence0472 583 275 gene locus_tag LOCUS_13000 583 275 CDS product ethyl tert-butyl ether degradation protein EthD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727587.1 protein_id gnl|my_center|LOCUS_13000 1737 598 gene locus_tag LOCUS_13010 1737 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence0473 >Feature sequence0474 371 132 gene locus_tag LOCUS_13020 371 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 504 322 gene locus_tag LOCUS_13030 504 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 <2034 644 gene locus_tag LOCUS_13040 <2034 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005489009.1:carboxylate--amine ligase >Feature sequence0475 2 811 gene locus_tag LOCUS_13050 gene thiL 2 811 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_13050 1060 815 gene locus_tag LOCUS_13060 1060 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1460 1128 gene locus_tag LOCUS_13070 1460 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1919 1548 gene locus_tag LOCUS_13080 1919 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13080 >Feature sequence0476 862 1854 gene locus_tag LOCUS_13090 862 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence0477 549 1028 gene locus_tag LOCUS_13100 549 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence0478 <2027 1362 gene locus_tag LOCUS_13110 <2027 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962284.1:histidine kinase >Feature sequence0479 433 1296 gene locus_tag LOCUS_13120 433 1296 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202112.1 protein_id gnl|my_center|LOCUS_13120 1774 1301 gene locus_tag LOCUS_13130 1774 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence0480 >Feature sequence0481 <2017 400 gene locus_tag LOCUS_13140 <2017 400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009292032.1:alpha-1 2-mannosidase >Feature sequence0482 1741 383 gene locus_tag LOCUS_13150 1741 383 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence0483 425 784 gene locus_tag LOCUS_13160 425 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1201 821 gene locus_tag LOCUS_13170 1201 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1687 1379 gene locus_tag LOCUS_13180 1687 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence0484 <1 1077 gene locus_tag LOCUS_13190 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXB2:tRNA modification GTPase MnmE 1186 1608 gene locus_tag LOCUS_13200 1186 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence0485 176 1945 gene locus_tag LOCUS_13210 176 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence0486 >Feature sequence0487 <1 581 gene locus_tag LOCUS_13220 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWI8:guanylate kinase 578 1168 gene locus_tag LOCUS_13230 gene nadD 578 1168 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_13230 >Feature sequence0488 340 266 gene locus_tag LOCUS_t00060 340 266 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 824 549 gene locus_tag LOCUS_13240 gene clpS 824 549 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_13240 1682 855 gene locus_tag LOCUS_13250 gene prmA 1682 855 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence0489 1732 317 gene locus_tag LOCUS_13260 gene surA 1732 317 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence0490 442 1083 gene locus_tag LOCUS_13270 442 1083 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963343.1 protein_id gnl|my_center|LOCUS_13270 1228 1872 gene locus_tag LOCUS_13280 1228 1872 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963343.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence0491 >Feature sequence0492 >Feature sequence0493 1145 159 gene locus_tag LOCUS_13290 1145 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_13290 1401 1718 gene locus_tag LOCUS_13300 1401 1718 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence0494 1869 988 gene locus_tag LOCUS_13310 gene ykuF 1869 988 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence0495 273 560 gene locus_tag LOCUS_13320 273 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 561 1142 gene locus_tag LOCUS_13330 561 1142 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence0496 803 81 gene locus_tag LOCUS_13340 803 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1375 1055 gene locus_tag LOCUS_13350 1375 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence0497 <1 1295 gene locus_tag LOCUS_13360 <1 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963532.1:O-acyltransferase >Feature sequence0498 <1 841 gene locus_tag LOCUS_13370 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583291.1:glycosyl transferase family 1 >Feature sequence0499 >Feature sequence0500 <1 992 gene locus_tag LOCUS_13380 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962575.1:UDP-glucose 4-epimerase >Feature sequence0501 1446 526 gene locus_tag LOCUS_13390 1446 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122391.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence0502 631 1332 gene locus_tag LOCUS_13400 631 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1360 1797 gene locus_tag LOCUS_13410 1360 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence0503 852 286 gene locus_tag LOCUS_13420 gene efp 852 286 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_13420 1665 880 gene locus_tag LOCUS_13430 gene lpxA 1665 880 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_13430 >Feature sequence0504 <1 630 gene locus_tag LOCUS_13440 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962545.1:molybdopterin oxidoreductase 633 1169 gene locus_tag LOCUS_13450 gene actD 633 1169 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_13450 1171 1857 gene locus_tag LOCUS_13460 gene actE 1171 1857 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence0505 >Feature sequence0506 218 1681 gene locus_tag LOCUS_13470 gene rpoN 218 1681 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence0507 1161 1088 gene locus_tag LOCUS_t00070 1161 1088 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0508 >Feature sequence0509 1591 560 gene locus_tag LOCUS_13480 gene yceA 1591 560 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL9 protein_id gnl|my_center|LOCUS_13480 >Feature sequence0510 1 1614 gene locus_tag LOCUS_13490 1 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence0511 439 1803 gene locus_tag LOCUS_13500 gene gcdH 439 1803 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228249.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence0512 758 405 gene locus_tag LOCUS_13510 gene rplS 758 405 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_13510 >Feature sequence0513 1085 141 gene locus_tag LOCUS_13520 1085 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1291 1082 gene locus_tag LOCUS_13530 1291 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1511 1365 gene locus_tag LOCUS_13540 1511 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence0514 1439 780 gene locus_tag LOCUS_13550 1439 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence0515 <1 1102 gene locus_tag LOCUS_13560 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY30:succinate--CoA ligase [ADP-forming] subunit beta 1261 1590 gene locus_tag LOCUS_13570 1261 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence0516 <1923 975 gene locus_tag LOCUS_13580 <1923 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVN4:coproporphyrinogen oxidase >Feature sequence0517 1377 784 gene locus_tag LOCUS_13590 gene cysC 1377 784 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88X60 protein_id gnl|my_center|LOCUS_13590 1835 1377 gene locus_tag LOCUS_13600 1835 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence0518 1 264 gene locus_tag LOCUS_13610 1 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 337 678 gene locus_tag LOCUS_13620 337 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1062 1265 gene locus_tag LOCUS_13630 1062 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1322 1774 gene locus_tag LOCUS_13640 1322 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence0519 >Feature sequence0520 >Feature sequence0521 >Feature sequence0522 221 1696 gene locus_tag LOCUS_13650 221 1696 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence0523 <1915 90 gene locus_tag LOCUS_13660 <1915 90 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 >Feature sequence0524 <1914 1043 gene locus_tag LOCUS_13670 <1914 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176703.1:lytic transglycosylase >Feature sequence0525 1239 550 gene locus_tag LOCUS_13680 1239 550 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence0526 >Feature sequence0527 414 253 gene locus_tag LOCUS_13690 414 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 649 419 gene locus_tag LOCUS_13700 649 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1472 750 gene locus_tag LOCUS_13710 1472 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1773 1582 gene locus_tag LOCUS_13720 1773 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence0528 1054 296 gene locus_tag LOCUS_13730 1054 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 protein_id gnl|my_center|LOCUS_13730 1838 1095 gene locus_tag LOCUS_13740 1838 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence0529 >Feature sequence0530 57 368 gene locus_tag LOCUS_13750 57 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence0531 <1902 1090 gene locus_tag LOCUS_13760 <1902 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962708.1:glutamine synthetase >Feature sequence0532 1309 131 gene locus_tag LOCUS_13770 1309 131 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201908.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence0533 >Feature sequence0534 8 499 gene locus_tag LOCUS_13780 8 499 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_13780 <1900 527 gene locus_tag LOCUS_13790 <1900 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964423.1:competence protein ComEC >Feature sequence0535 568 1086 gene locus_tag LOCUS_13800 568 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence0536 446 51 gene locus_tag LOCUS_13810 446 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_13810 1479 460 gene locus_tag LOCUS_13820 gene pheS 1479 460 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_13820 >Feature sequence0537 304 693 gene locus_tag LOCUS_13830 304 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1075 1440 gene locus_tag LOCUS_13840 1075 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 1463 1597 gene locus_tag LOCUS_13850 1463 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence0538 >Feature sequence0539 >Feature sequence0540 741 82 gene locus_tag LOCUS_13860 gene trmH 741 82 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_13860 814 1491 gene locus_tag LOCUS_13870 gene npdA 814 1491 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 protein_id gnl|my_center|LOCUS_13870 >Feature sequence0541 >Feature sequence0542 3 224 gene locus_tag LOCUS_13880 3 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence0543 1848 1063 gene locus_tag LOCUS_13890 1848 1063 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence0544 612 178 gene locus_tag LOCUS_13900 612 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1437 631 gene locus_tag LOCUS_13910 1437 631 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence0545 207 575 gene locus_tag LOCUS_13920 207 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 639 1430 gene locus_tag LOCUS_13930 639 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1432 1758 gene locus_tag LOCUS_13940 1432 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence0546 1149 295 gene locus_tag LOCUS_13950 gene ctaB 1149 295 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_13950 >Feature sequence0547 855 547 gene locus_tag LOCUS_13960 855 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1117 884 gene locus_tag LOCUS_13970 1117 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence0548 1046 141 gene locus_tag LOCUS_13980 1046 141 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224885.1 protein_id gnl|my_center|LOCUS_13980 1820 1050 gene locus_tag LOCUS_13990 1820 1050 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence0549 333 136 gene locus_tag LOCUS_14000 333 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 756 337 gene locus_tag LOCUS_14010 756 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1112 753 gene locus_tag LOCUS_14020 1112 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1443 1114 gene locus_tag LOCUS_14030 1443 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence0550 1155 232 gene locus_tag LOCUS_14040 gene rpoD 1155 232 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VAU1 protein_id gnl|my_center|LOCUS_14040 1524 1156 gene locus_tag LOCUS_14050 1524 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence0551 446 1159 gene locus_tag LOCUS_14060 446 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1184 1774 gene locus_tag LOCUS_14070 1184 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence0552 403 966 gene locus_tag LOCUS_14080 403 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963570.1 protein_id gnl|my_center|LOCUS_14080 <1866 1033 gene locus_tag LOCUS_14090 <1866 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0J8:adenylosuccinate lyase >Feature sequence0553 <1 1270 gene locus_tag LOCUS_14100 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYW8:chromosomal replication initiator protein DnaA 1310 1762 gene locus_tag LOCUS_14110 1310 1762 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence0554 287 1156 gene locus_tag LOCUS_14120 gene udp 287 1156 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence0555 >Feature sequence0556 207 389 gene locus_tag LOCUS_14130 207 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 382 531 gene locus_tag LOCUS_14140 382 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 494 754 gene locus_tag LOCUS_14150 494 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 747 872 gene locus_tag LOCUS_14160 747 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 872 1063 gene locus_tag LOCUS_14170 872 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1063 1287 gene locus_tag LOCUS_14180 1063 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1284 1505 gene locus_tag LOCUS_14190 1284 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1498 1821 gene locus_tag LOCUS_14200 1498 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence0557 >Feature sequence0558 <1 1857 gene locus_tag LOCUS_14210 <1 1857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963765.1:TonB-dependent receptor >Feature sequence0559 528 692 gene locus_tag LOCUS_14220 528 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 819 1073 gene locus_tag LOCUS_14230 819 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1057 1254 gene locus_tag LOCUS_14240 1057 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1251 1511 gene locus_tag LOCUS_14250 1251 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence0560 >Feature sequence0561 949 518 gene locus_tag LOCUS_14260 949 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1284 943 gene locus_tag LOCUS_14270 1284 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1554 1309 gene locus_tag LOCUS_14280 1554 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence0562 236 721 gene locus_tag LOCUS_14290 236 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence0563 1452 670 gene locus_tag LOCUS_14300 gene trp1400B 1452 670 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815813.1 protein_id gnl|my_center|LOCUS_14300 1742 1476 gene locus_tag LOCUS_14310 1742 1476 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948267.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence0564 438 1361 gene locus_tag LOCUS_14320 438 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence0565 <1 595 gene locus_tag LOCUS_14330 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWZ1:tryptophan synthase beta chain 723 1484 gene locus_tag LOCUS_14340 gene trpA 723 1484 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_14340 1568 1696 gene locus_tag LOCUS_14350 1568 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence0566 337 888 gene locus_tag LOCUS_14360 337 888 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_14360 893 1138 gene locus_tag LOCUS_14370 893 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence0567 >Feature sequence0568 130 540 gene locus_tag LOCUS_14380 130 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_14380 1091 615 gene locus_tag LOCUS_14390 1091 615 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_14390 >Feature sequence0569 <1842 919 gene locus_tag LOCUS_14400 <1842 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097864.1:UDP-N-acetylglucosamine 4,6-dehydratase (inverting) >Feature sequence0570 1683 658 gene locus_tag LOCUS_14410 1683 658 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence0571 331 1617 gene locus_tag LOCUS_14420 331 1617 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434922.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence0572 268 89 gene locus_tag LOCUS_14430 268 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 390 265 gene locus_tag LOCUS_14440 390 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 843 547 gene locus_tag LOCUS_14450 843 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 1037 837 gene locus_tag LOCUS_14460 1037 837 CDS product DUF3310 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111491.1 protein_id gnl|my_center|LOCUS_14460 1257 1030 gene locus_tag LOCUS_14470 1257 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1644 1312 gene locus_tag LOCUS_14480 1644 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence0573 <1 714 gene locus_tag LOCUS_14490 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0T6:GMP synthase [glutamine-hydrolyzing] >Feature sequence0574 >Feature sequence0575 145 1740 gene locus_tag LOCUS_14500 145 1740 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112390.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence0576 448 17 gene locus_tag LOCUS_14510 448 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 802 449 gene locus_tag LOCUS_14520 802 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence0577 1762 8 gene locus_tag LOCUS_14530 gene sglT 1762 8 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence0578 405 1340 gene locus_tag LOCUS_14540 405 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence0579 950 708 gene locus_tag LOCUS_14550 950 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1276 950 gene locus_tag LOCUS_14560 1276 950 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence0580 1262 207 gene locus_tag LOCUS_14570 gene queA 1262 207 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_14570 1623 1339 gene locus_tag LOCUS_14580 1623 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14580 >Feature sequence0581 <1 802 gene locus_tag LOCUS_14590 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H289:dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex 1729 1097 gene locus_tag LOCUS_14600 1729 1097 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence0582 1064 258 gene locus_tag LOCUS_14610 1064 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1334 1125 gene locus_tag LOCUS_14620 1334 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1826 1751 gene locus_tag LOCUS_t00080 1826 1751 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0583 >Feature sequence0584 368 114 gene locus_tag LOCUS_14630 368 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 751 554 gene locus_tag LOCUS_14640 751 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 915 748 gene locus_tag LOCUS_14650 915 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1219 899 gene locus_tag LOCUS_14660 1219 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1377 1216 gene locus_tag LOCUS_14670 1377 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence0585 62 241 gene locus_tag LOCUS_14680 62 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 586 1164 gene locus_tag LOCUS_14690 586 1164 CDS product protein ninG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211735.1 protein_id gnl|my_center|LOCUS_14690 1161 1574 gene locus_tag LOCUS_14700 1161 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1577 1744 gene locus_tag LOCUS_14710 1577 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence0586 631 80 gene locus_tag LOCUS_14720 631 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1446 631 gene locus_tag LOCUS_14730 1446 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence0587 >Feature sequence0588 306 1085 gene locus_tag LOCUS_14740 306 1085 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 protein_id gnl|my_center|LOCUS_14740 1721 1113 gene locus_tag LOCUS_14750 1721 1113 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence0589 614 327 gene locus_tag LOCUS_14760 614 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 852 598 gene locus_tag LOCUS_14770 852 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence0590 <1819 733 gene locus_tag LOCUS_14780 <1819 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963276.1:phosphoglucomutase >Feature sequence0591 1652 1011 gene locus_tag LOCUS_14790 1652 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence0592 597 316 gene locus_tag LOCUS_14800 597 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 941 597 gene locus_tag LOCUS_14810 941 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1222 938 gene locus_tag LOCUS_14820 1222 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence0593 336 1088 gene locus_tag LOCUS_14830 336 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1197 1529 gene locus_tag LOCUS_14840 1197 1529 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 protein_id gnl|my_center|LOCUS_14840 >Feature sequence0594 >Feature sequence0595 <1 505 gene locus_tag LOCUS_14850 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34812:putative NADP-dependent oxidoreductase YfmJ 595 1233 gene locus_tag LOCUS_14860 gene yhfK 595 1233 CDS product putative sugar epimerase YhfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07609 protein_id gnl|my_center|LOCUS_14860 >Feature sequence0596 >Feature sequence0597 500 949 gene locus_tag LOCUS_14870 500 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 952 1377 gene locus_tag LOCUS_14880 gene sufE 952 1377 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_14880 1382 1708 gene locus_tag LOCUS_14890 1382 1708 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence0598 <1 1142 gene locus_tag LOCUS_14900 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963032.1:single-stranded-DNA-specific exonuclease RecJ <1809 1105 gene locus_tag LOCUS_14910 <1809 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964460.1:UDP-2,3-diacylglucosamine hydrolase >Feature sequence0599 <1 579 gene locus_tag LOCUS_14920 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1C2:ATP-dependent Clp protease ATP-binding subunit ClpX 856 671 gene locus_tag LOCUS_14930 856 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence0600 >Feature sequence0601 >Feature sequence0602 46 591 gene locus_tag LOCUS_14940 46 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1275 646 gene locus_tag LOCUS_14950 gene queE 1275 646 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_14950 >Feature sequence0603 >Feature sequence0604 >Feature sequence0605 305 1381 gene locus_tag LOCUS_14960 gene prfA 305 1381 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_14960 >Feature sequence0606 1572 334 gene locus_tag LOCUS_14970 1572 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence0607 <1 639 gene locus_tag LOCUS_14980 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWY1:o-succinylbenzoate synthase 691 1644 gene locus_tag LOCUS_14990 gene yyaK 691 1644 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence0608 2 448 gene locus_tag LOCUS_15000 2 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 557 1717 gene locus_tag LOCUS_15010 557 1717 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence0609 <1 918 gene locus_tag LOCUS_15020 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZ68:citrate synthase >Feature sequence0610 1238 507 gene locus_tag LOCUS_15030 1238 507 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831296.1 protein_id gnl|my_center|LOCUS_15030 <1786 1235 gene locus_tag LOCUS_15040 <1786 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P45347:UPF0271 protein >Feature sequence0611 100 630 gene locus_tag LOCUS_15050 100 630 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence0612 >Feature sequence0613 >Feature sequence0614 1185 490 gene locus_tag LOCUS_15060 gene cmk 1185 490 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 protein_id gnl|my_center|LOCUS_15060 <1780 1185 gene locus_tag LOCUS_15070 <1780 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963823.1:penicillin-binding protein >Feature sequence0615 333 19 gene locus_tag LOCUS_15080 333 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 985 326 gene locus_tag LOCUS_15090 985 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1577 1047 gene locus_tag LOCUS_15100 1577 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence0616 1495 773 gene locus_tag LOCUS_15110 1495 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence0617 838 659 gene locus_tag LOCUS_15120 838 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963197.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence0618 >Feature sequence0619 >Feature sequence0620 >Feature sequence0621 >Feature sequence0622 203 598 gene locus_tag LOCUS_15130 gene rbfA 203 598 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 protein_id gnl|my_center|LOCUS_15130 >Feature sequence0623 >Feature sequence0624 >Feature sequence0625 180 1250 gene locus_tag LOCUS_15140 180 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence0626 1598 1044 gene locus_tag LOCUS_15150 gene grpE 1598 1044 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_15150 >Feature sequence0627 79 258 gene locus_tag LOCUS_15160 79 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 275 451 gene locus_tag LOCUS_15170 275 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 703 906 gene locus_tag LOCUS_15180 703 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1464 1688 gene locus_tag LOCUS_15190 1464 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence0628 501 1427 gene locus_tag LOCUS_15200 501 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence0629 418 1716 gene locus_tag LOCUS_15210 418 1716 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence0630 622 954 gene locus_tag LOCUS_15220 622 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1466 1197 gene locus_tag LOCUS_15230 1466 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence0631 >Feature sequence0632 >Feature sequence0633 >Feature sequence0634 <1 852 gene locus_tag LOCUS_15240 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272562.1:radical SAM/Cys-rich domain protein 1008 1379 gene locus_tag LOCUS_15250 1008 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence0635 1367 105 gene locus_tag LOCUS_15260 1367 105 CDS product dehydrogenase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964378.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence0636 778 1707 gene locus_tag LOCUS_15270 778 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence0637 1405 599 gene locus_tag LOCUS_15280 1405 599 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence0638 498 701 gene locus_tag LOCUS_15290 498 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 688 1464 gene locus_tag LOCUS_15300 688 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence0639 >Feature sequence0640 173 544 gene locus_tag LOCUS_15310 173 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 630 788 gene locus_tag LOCUS_15320 630 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 785 1240 gene locus_tag LOCUS_15330 785 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1233 1430 gene locus_tag LOCUS_15340 1233 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence0641 366 680 gene locus_tag LOCUS_15350 366 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 718 1224 gene locus_tag LOCUS_15360 718 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1296 1523 gene locus_tag LOCUS_15370 1296 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence0642 >Feature sequence0643 <1731 635 gene locus_tag LOCUS_15380 <1731 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530233.1:VWA domain-containing protein >Feature sequence0644 984 76 gene locus_tag LOCUS_15390 984 76 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767289.1 protein_id gnl|my_center|LOCUS_15390 1549 1040 gene locus_tag LOCUS_15400 1549 1040 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence0645 182 511 gene locus_tag LOCUS_15410 gene sufA 182 511 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence0646 769 146 gene locus_tag LOCUS_15420 769 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1563 772 gene locus_tag LOCUS_15430 1563 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence0647 >Feature sequence0648 >Feature sequence0649 <1 1082 gene locus_tag LOCUS_15440 <1 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066164.1:catalase-peroxidase 1717 1139 gene locus_tag LOCUS_15450 1717 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence0650 260 1249 gene locus_tag LOCUS_15460 260 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1291 1674 gene locus_tag LOCUS_15470 1291 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence0651 289 852 gene locus_tag LOCUS_15480 289 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 854 1216 gene locus_tag LOCUS_15490 854 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1637 1712 gene locus_tag LOCUS_t00090 1637 1712 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0652 >Feature sequence0653 >Feature sequence0654 >Feature sequence0655 353 1540 gene locus_tag LOCUS_15500 gene argD 353 1540 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence0656 >Feature sequence0657 863 225 gene locus_tag LOCUS_15510 863 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1461 1024 gene locus_tag LOCUS_15520 1461 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence0658 1023 1252 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tggttttgaggccggttatt >Feature sequence0659 456 1586 gene locus_tag LOCUS_15530 gene yghO 456 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence0660 532 1680 gene locus_tag LOCUS_15540 532 1680 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence0661 <1699 920 gene locus_tag LOCUS_15550 <1699 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681381.1:type I restriction-modification system subunit M >Feature sequence0662 <1699 511 gene locus_tag LOCUS_15560 <1699 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962856.1:RNA methyltransferase >Feature sequence0663 <1698 583 gene locus_tag LOCUS_15570 <1698 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812939.1:DNA recombination/repair protein RecA >Feature sequence0664 1500 391 gene locus_tag LOCUS_15580 1500 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence0665 <1 1144 gene locus_tag LOCUS_15590 <1 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HEL7:pyruvate carboxylase >Feature sequence0666 <1 605 gene locus_tag LOCUS_15600 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975810.1:S-adenosylmethionine-binding protein 664 882 gene locus_tag LOCUS_15610 664 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 879 1043 gene locus_tag LOCUS_15620 879 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1283 1627 gene locus_tag LOCUS_15630 1283 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence0667 <1 664 gene locus_tag LOCUS_15640 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964536.1:nucleotidyltransferase >Feature sequence0668 >Feature sequence0669 77 1690 gene locus_tag LOCUS_15650 77 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence0670 15 1571 gene locus_tag LOCUS_15660 15 1571 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence0671 87 1046 gene locus_tag LOCUS_15670 87 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1106 1402 gene locus_tag LOCUS_15680 1106 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence0672 >Feature sequence0673 <1 745 gene locus_tag LOCUS_15690 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789838.1:dolichol-phosphate mannosyltransferase 742 1377 gene locus_tag LOCUS_15700 742 1377 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802698.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence0674 631 1050 gene locus_tag LOCUS_15710 631 1050 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence0675 >Feature sequence0676 426 61 gene locus_tag LOCUS_15720 426 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602867.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence0677 1378 338 gene locus_tag LOCUS_15730 1378 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence0678 1471 119 gene locus_tag LOCUS_15740 1471 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence0679 409 849 gene locus_tag LOCUS_15750 409 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1089 823 gene locus_tag LOCUS_15760 1089 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1424 1089 gene locus_tag LOCUS_15770 1424 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence0680 987 1619 gene locus_tag LOCUS_15780 987 1619 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105616.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence0681 1254 595 gene locus_tag LOCUS_15790 1254 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence0682 <1 872 gene locus_tag LOCUS_15800 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein >Feature sequence0683 >Feature sequence0684 >Feature sequence0685 >Feature sequence0686 >Feature sequence0687 >Feature sequence0688 192 1199 gene locus_tag LOCUS_15810 192 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence0689 >Feature sequence0690 <1660 661 gene locus_tag LOCUS_15820 <1660 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962827.1:Fis family transcriptional regulator >Feature sequence0691 >Feature sequence0692 <1656 929 gene locus_tag LOCUS_15830 <1656 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962242.1:cell envelope biogenesis protein OmpA >Feature sequence0693 139 486 gene locus_tag LOCUS_15840 139 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 639 1127 gene locus_tag LOCUS_15850 639 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence0694 242 628 gene locus_tag LOCUS_15860 242 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 696 851 gene locus_tag LOCUS_15870 696 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 861 1058 gene locus_tag LOCUS_15880 861 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1120 1368 gene locus_tag LOCUS_15890 1120 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence0695 <1653 836 gene locus_tag LOCUS_15900 <1653 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963566.1:MerR family transcriptional regulator >Feature sequence0696 >Feature sequence0697 1265 330 gene locus_tag LOCUS_15910 1265 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence0698 <1 982 gene locus_tag LOCUS_15920 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYM2:UvrABC system protein A >Feature sequence0699 1513 41 gene locus_tag LOCUS_15930 1513 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence0700 >Feature sequence0701 1110 1565 gene locus_tag LOCUS_15940 1110 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence0702 >Feature sequence0703 2 1318 gene locus_tag LOCUS_15950 gene murD 2 1318 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_15950 >Feature sequence0704 2 634 gene locus_tag LOCUS_15960 2 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1135 803 gene locus_tag LOCUS_15970 1135 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence0705 >Feature sequence0706 1025 81 gene locus_tag LOCUS_15980 1025 81 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815393.1 protein_id gnl|my_center|LOCUS_15980 1420 1022 gene locus_tag LOCUS_15990 1420 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence0707 583 47 gene locus_tag LOCUS_16000 583 47 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918364.1 protein_id gnl|my_center|LOCUS_16000 730 915 gene locus_tag LOCUS_16010 730 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1095 973 gene locus_tag LOCUS_16020 1095 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence0708 1186 893 gene locus_tag LOCUS_16030 1186 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence0709 >Feature sequence0710 188 658 gene locus_tag LOCUS_16040 gene mraZ 188 658 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_16040 636 1541 gene locus_tag LOCUS_16050 gene rsmH 636 1541 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 protein_id gnl|my_center|LOCUS_16050 >Feature sequence0711 >Feature sequence0712 >Feature sequence0713 642 109 gene locus_tag LOCUS_16060 642 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1189 632 gene locus_tag LOCUS_16070 1189 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence0714 >Feature sequence0715 >Feature sequence0716 >Feature sequence0717 <1 1401 gene locus_tag LOCUS_16080 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963010.1:phosphoglucosamine mutase >Feature sequence0718 334 50 gene locus_tag LOCUS_16090 334 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence0719 614 1162 gene locus_tag LOCUS_16100 gene sirH 614 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070826.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence0720 846 634 gene locus_tag LOCUS_16110 846 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1045 848 gene locus_tag LOCUS_16120 1045 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence0721 122 328 gene locus_tag LOCUS_16130 122 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 455 697 gene locus_tag LOCUS_16140 455 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 712 999 gene locus_tag LOCUS_16150 712 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence0722 470 294 gene locus_tag LOCUS_16160 470 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 822 481 gene locus_tag LOCUS_16170 822 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1067 825 gene locus_tag LOCUS_16180 1067 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1550 1080 gene locus_tag LOCUS_16190 1550 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence0723 >Feature sequence0724 501 1562 gene locus_tag LOCUS_16200 gene pdxA 501 1562 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_16200 >Feature sequence0725 148 879 gene locus_tag LOCUS_16210 148 879 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence0726 66 662 gene locus_tag LOCUS_16220 66 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence0727 >Feature sequence0728 >Feature sequence0729 232 157 gene locus_tag LOCUS_t00100 232 157 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 495 420 gene locus_tag LOCUS_t00110 495 420 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <1604 561 gene locus_tag LOCUS_16230 <1604 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962704.1:tetrahydrofolate synthase >Feature sequence0730 924 1418 gene locus_tag LOCUS_16240 924 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence0731 81 212 gene locus_tag LOCUS_16250 81 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 311 997 gene locus_tag LOCUS_16260 311 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1011 1475 gene locus_tag LOCUS_16270 1011 1475 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965831.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence0732 151 444 gene locus_tag LOCUS_16280 151 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 435 803 gene locus_tag LOCUS_16290 435 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 764 1042 gene locus_tag LOCUS_16300 764 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1054 1428 gene locus_tag LOCUS_16310 1054 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence0733 742 407 gene locus_tag LOCUS_16320 742 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963901.1 protein_id gnl|my_center|LOCUS_16320 <1601 732 gene locus_tag LOCUS_16330 <1601 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0I8:aspartate carbamoyltransferase >Feature sequence0734 519 196 gene locus_tag LOCUS_16340 519 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence0735 606 1184 gene locus_tag LOCUS_16350 606 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence0736 >Feature sequence0737 >Feature sequence0738 >Feature sequence0739 142 963 gene locus_tag LOCUS_16360 gene uspA 142 963 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_16360 1038 1565 gene locus_tag LOCUS_16370 1038 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence0740 572 1027 gene locus_tag LOCUS_16380 572 1027 CDS product GAF domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_16380 <1591 1044 gene locus_tag LOCUS_16390 <1591 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964503.1:ABC transporter permease >Feature sequence0741 230 865 gene locus_tag LOCUS_16400 230 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1586 1089 gene locus_tag LOCUS_16410 1586 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence0742 481 1362 gene locus_tag LOCUS_16420 481 1362 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962727.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence0743 873 295 gene locus_tag LOCUS_16430 873 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_16430 <1585 961 gene locus_tag LOCUS_16440 <1585 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW35:transcription-repair-coupling factor >Feature sequence0744 555 25 gene locus_tag LOCUS_16450 gene yozB 555 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_16450 1246 533 gene locus_tag LOCUS_16460 gene ypmQ 1246 533 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence0745 208 396 gene locus_tag LOCUS_16470 208 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 393 1223 gene locus_tag LOCUS_16480 393 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1220 1432 gene locus_tag LOCUS_16490 1220 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence0746 >Feature sequence0747 >Feature sequence0748 1442 402 gene locus_tag LOCUS_16500 1442 402 CDS product carbamoyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963414.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence0749 472 1251 gene locus_tag LOCUS_16510 472 1251 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence0750 >Feature sequence0751 821 186 gene locus_tag LOCUS_16520 821 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1226 825 gene locus_tag LOCUS_16530 1226 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence0752 <1568 534 gene locus_tag LOCUS_16540 <1568 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404499.1:glutamate:proton symporter >Feature sequence0753 >Feature sequence0754 110 367 gene locus_tag LOCUS_16550 110 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 397 771 gene locus_tag LOCUS_16560 397 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1503 871 gene locus_tag LOCUS_16570 1503 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence0755 <1565 535 gene locus_tag LOCUS_16580 <1565 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963911.1:8-amino-7-oxononanoate synthase >Feature sequence0756 >Feature sequence0757 275 1303 gene locus_tag LOCUS_16590 275 1303 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence0758 1560 1117 gene locus_tag LOCUS_16600 1560 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence0759 1492 497 gene locus_tag LOCUS_16610 1492 497 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence0760 978 1229 gene locus_tag LOCUS_16620 978 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence0761 381 818 gene locus_tag LOCUS_16630 381 818 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964360.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence0762 573 52 gene locus_tag LOCUS_16640 573 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 946 548 gene locus_tag LOCUS_16650 946 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence0763 >Feature sequence0764 <1 547 gene locus_tag LOCUS_16660 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946141.1:zinc metalloprotease >Feature sequence0765 97 306 gene locus_tag LOCUS_16670 97 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 367 726 gene locus_tag LOCUS_16680 367 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 723 1241 gene locus_tag LOCUS_16690 723 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1242 1454 gene locus_tag LOCUS_16700 1242 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence0766 >Feature sequence0767 <1 564 gene locus_tag LOCUS_16710 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108655.1:hybrid sensor histidine kinase/response regulator 663 947 gene locus_tag LOCUS_16720 663 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence0768 502 993 gene locus_tag LOCUS_16730 502 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence0769 >Feature sequence0770 >Feature sequence0771 >Feature sequence0772 >Feature sequence0773 928 401 gene locus_tag LOCUS_16740 928 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 974 1225 gene locus_tag LOCUS_16750 974 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence0774 >Feature sequence0775 22 489 gene locus_tag LOCUS_16760 gene rimP 22 489 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV6 protein_id gnl|my_center|LOCUS_16760 >Feature sequence0776 <1 749 gene locus_tag LOCUS_16770 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964215.1:RND transporter 753 1409 gene locus_tag LOCUS_16780 753 1409 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence0777 >Feature sequence0778 3 146 gene locus_tag LOCUS_16790 3 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 118 1425 gene locus_tag LOCUS_16800 gene gdhA 118 1425 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96110 protein_id gnl|my_center|LOCUS_16800 >Feature sequence0779 1363 263 gene locus_tag LOCUS_16810 1363 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence0780 1105 1458 gene locus_tag LOCUS_16820 1105 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence0781 >Feature sequence0782 >Feature sequence0783 352 741 gene locus_tag LOCUS_16830 352 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence0784 942 430 gene locus_tag LOCUS_16840 942 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1148 963 gene locus_tag LOCUS_16850 1148 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1375 1145 gene locus_tag LOCUS_16860 1375 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence0785 1476 397 gene locus_tag LOCUS_16870 gene recF 1476 397 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_16870 >Feature sequence0786 <1 530 gene locus_tag LOCUS_16880 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY12:3-methyl-2-oxobutanoate hydroxymethyltransferase 606 1274 gene locus_tag LOCUS_16890 606 1274 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence0787 >Feature sequence0788 218 397 gene locus_tag LOCUS_16900 218 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 394 546 gene locus_tag LOCUS_16910 394 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 546 806 gene locus_tag LOCUS_16920 546 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 888 1028 gene locus_tag LOCUS_16930 888 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1051 1176 gene locus_tag LOCUS_16940 1051 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1178 1336 gene locus_tag LOCUS_16950 1178 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence0789 <1 957 gene locus_tag LOCUS_16960 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962285.1:membrane protein >Feature sequence0790 528 397 gene locus_tag LOCUS_16970 528 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 662 525 gene locus_tag LOCUS_16980 662 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 923 762 gene locus_tag LOCUS_16990 923 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1303 947 gene locus_tag LOCUS_17000 1303 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence0791 <1 992 gene locus_tag LOCUS_17010 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964508.1:penicillin-binding protein 2 >Feature sequence0792 <1 647 gene locus_tag LOCUS_17020 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202132.1:TonB-dependent receptor 1521 679 gene locus_tag LOCUS_17030 1521 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence0793 >Feature sequence0794 >Feature sequence0795 <1 597 gene locus_tag LOCUS_17040 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H103:GTPase Der >Feature sequence0796 >Feature sequence0797 <1517 131 gene locus_tag LOCUS_17050 <1517 131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963873.1:peptidase S8 >Feature sequence0798 >Feature sequence0799 >Feature sequence0800 >Feature sequence0801 >Feature sequence0802 285 94 gene locus_tag LOCUS_17060 285 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 633 286 gene locus_tag LOCUS_17070 633 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 811 626 gene locus_tag LOCUS_17080 811 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 986 795 gene locus_tag LOCUS_17090 986 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1299 997 gene locus_tag LOCUS_17100 1299 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence0803 956 408 gene locus_tag LOCUS_17110 956 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence0804 134 805 gene locus_tag LOCUS_17120 134 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 <1505 802 gene locus_tag LOCUS_17130 <1505 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2H7:glutamate--tRNA ligase >Feature sequence0805 >Feature sequence0806 1305 694 gene locus_tag LOCUS_17140 1305 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence0807 >Feature sequence0808 >Feature sequence0809 199 1485 gene locus_tag LOCUS_17150 gene eno 199 1485 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_17150 >Feature sequence0810 255 815 gene locus_tag LOCUS_17160 255 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 942 1211 gene locus_tag LOCUS_17170 942 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence0811 1285 416 gene locus_tag LOCUS_17180 1285 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence0812 >Feature sequence0813 604 1344 gene locus_tag LOCUS_17190 604 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence0814 >Feature sequence0815 856 296 gene locus_tag LOCUS_17200 856 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 <1496 936 gene locus_tag LOCUS_17210 <1496 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963302.1:aconitate hydratase >Feature sequence0816 <1496 711 gene locus_tag LOCUS_17220 <1496 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963410.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence0817 1301 363 gene locus_tag LOCUS_17230 1301 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence0818 355 101 gene locus_tag LOCUS_17240 355 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 651 917 gene locus_tag LOCUS_17250 651 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 953 1120 gene locus_tag LOCUS_17260 953 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence0819 658 975 gene locus_tag LOCUS_17270 658 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence0820 >Feature sequence0821 <1 1047 gene locus_tag LOCUS_17280 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962802.1:acyl-CoA reductase >Feature sequence0822 >Feature sequence0823 >Feature sequence0824 <1 849 gene locus_tag LOCUS_17290 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815367.1:thiol:disulfide interchange protein 1486 851 gene locus_tag LOCUS_17300 1486 851 CDS product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883307.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence0825 766 8 gene locus_tag LOCUS_17310 gene lgtF 766 8 CDS product beta 1,4 glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224973.1 protein_id gnl|my_center|LOCUS_17310 <1486 774 gene locus_tag LOCUS_17320 <1486 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074271.1:CDP-glycerol--glycerophosphate glycerophosphotransferase >Feature sequence0826 58 1368 gene locus_tag LOCUS_17330 gene murA 58 1368 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 protein_id gnl|my_center|LOCUS_17330 >Feature sequence0827 1076 138 gene locus_tag LOCUS_17340 1076 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1483 1088 gene locus_tag LOCUS_17350 1483 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence0828 1371 1180 gene locus_tag LOCUS_17360 1371 1180 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence0829 >Feature sequence0830 175 627 gene locus_tag LOCUS_17370 175 627 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence0831 933 571 gene locus_tag LOCUS_17380 933 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074087.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence0832 <1478 646 gene locus_tag LOCUS_17390 <1478 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964324.1:penicillin-binding protein 1C >Feature sequence0833 90 962 gene locus_tag LOCUS_17400 90 962 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence0834 >Feature sequence0835 188 475 gene locus_tag LOCUS_17410 188 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence0836 942 1253 gene locus_tag LOCUS_17420 942 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence0837 >Feature sequence0838 <1 526 gene locus_tag LOCUS_17430 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H222:3-hydroxy-3-methylglutaryl coenzyme A reductase 523 1443 gene locus_tag LOCUS_17440 523 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence0839 826 476 gene locus_tag LOCUS_17450 826 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1129 908 gene locus_tag LOCUS_17460 1129 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence0840 161 496 gene locus_tag LOCUS_17470 161 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 612 878 gene locus_tag LOCUS_17480 612 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 972 1412 gene locus_tag LOCUS_17490 972 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence0841 <1 714 gene locus_tag LOCUS_17500 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962644.1:peptidase M28 >Feature sequence0842 1211 231 gene locus_tag LOCUS_17510 1211 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence0843 1440 244 gene locus_tag LOCUS_17520 1440 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence0844 >Feature sequence0845 >Feature sequence0846 866 726 gene locus_tag LOCUS_17530 866 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1104 949 gene locus_tag LOCUS_17540 1104 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence0847 663 97 gene locus_tag LOCUS_17550 663 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 <1462 666 gene locus_tag LOCUS_17560 <1462 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008657265.1:transporter >Feature sequence0848 <1462 196 gene locus_tag LOCUS_17570 <1462 196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962330.1:Xaa-Pro aminopeptidase >Feature sequence0849 99 1424 gene locus_tag LOCUS_17580 99 1424 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362019.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence0850 <1461 609 gene locus_tag LOCUS_17590 <1461 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963739.1:thiol:disulfide interchange protein DsbD >Feature sequence0851 1459 296 gene locus_tag LOCUS_17600 1459 296 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence0852 168 950 gene locus_tag LOCUS_17610 168 950 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202009.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence0853 791 114 gene locus_tag LOCUS_17620 791 114 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence0854 >Feature sequence0855 345 557 gene locus_tag LOCUS_17630 345 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 580 891 gene locus_tag LOCUS_17640 580 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence0856 632 832 gene locus_tag LOCUS_17650 632 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1026 1220 gene locus_tag LOCUS_17660 1026 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence0857 47 1234 gene locus_tag LOCUS_17670 gene mnmA 47 1234 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_17670 >Feature sequence0858 140 835 gene locus_tag LOCUS_17680 140 835 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence0859 1044 1343 gene locus_tag LOCUS_17690 1044 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence0860 1382 192 gene locus_tag LOCUS_17700 1382 192 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence0861 748 527 gene locus_tag LOCUS_17710 748 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1109 864 gene locus_tag LOCUS_17720 1109 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence0862 <1 1318 gene locus_tag LOCUS_17730 <1 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963545.1:xenobiotic ABC transporter ATP-binding protein >Feature sequence0863 >Feature sequence0864 898 614 gene locus_tag LOCUS_17740 898 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1143 907 gene locus_tag LOCUS_17750 1143 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1370 1188 gene locus_tag LOCUS_17760 1370 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence0865 96 776 gene locus_tag LOCUS_17770 96 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 780 1439 gene locus_tag LOCUS_17780 780 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence0866 <1 1136 gene locus_tag LOCUS_17790 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583646.1:lipoprotein >Feature sequence0867 >Feature sequence0868 340 837 gene locus_tag LOCUS_17800 340 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence0869 >Feature sequence0870 835 314 gene locus_tag LOCUS_17810 835 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 1217 939 gene locus_tag LOCUS_17820 1217 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence0871 >Feature sequence0872 >Feature sequence0873 149 991 gene locus_tag LOCUS_17830 149 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence0874 <1436 235 gene locus_tag LOCUS_17840 <1436 235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MY0:DNA topoisomerase 1 >Feature sequence0875 <1 963 gene locus_tag LOCUS_17850 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871027.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) >Feature sequence0876 >Feature sequence0877 >Feature sequence0878 >Feature sequence0879 201 485 gene locus_tag LOCUS_17860 201 485 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103251.1 protein_id gnl|my_center|LOCUS_17860 452 1399 gene locus_tag LOCUS_17870 452 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence0880 37 603 gene locus_tag LOCUS_17880 gene yceI 37 603 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence0881 >Feature sequence0882 1277 66 gene locus_tag LOCUS_17890 1277 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence0883 >Feature sequence0884 1415 504 gene locus_tag LOCUS_17900 1415 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence0885 >Feature sequence0886 <1429 719 gene locus_tag LOCUS_17910 <1429 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1P7:kynureninase >Feature sequence0887 >Feature sequence0888 1 420 gene locus_tag LOCUS_17920 1 420 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB16 protein_id gnl|my_center|LOCUS_17920 429 626 gene locus_tag LOCUS_17930 429 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 661 942 gene locus_tag LOCUS_17940 661 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096305.1 protein_id gnl|my_center|LOCUS_17940 929 1276 gene locus_tag LOCUS_17950 929 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence0889 >Feature sequence0890 >Feature sequence0891 64 261 gene locus_tag LOCUS_17960 64 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 258 587 gene locus_tag LOCUS_17970 258 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 593 859 gene locus_tag LOCUS_17980 593 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 863 1012 gene locus_tag LOCUS_17990 863 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence0892 >Feature sequence0893 269 433 gene locus_tag LOCUS_18000 269 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1088 444 gene locus_tag LOCUS_18010 1088 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence0894 >Feature sequence0895 >Feature sequence0896 963 769 gene locus_tag LOCUS_18020 963 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 1280 960 gene locus_tag LOCUS_18030 1280 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence0897 >Feature sequence0898 >Feature sequence0899 173 343 gene locus_tag LOCUS_18040 173 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 343 510 gene locus_tag LOCUS_18050 343 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1262 507 gene locus_tag LOCUS_18060 1262 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence0900 1385 429 gene locus_tag LOCUS_18070 gene ytcB 1385 429 CDS product putative UDP-glucose epimerase YtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34886 protein_id gnl|my_center|LOCUS_18070 >Feature sequence0901 >Feature sequence0902 <1 983 gene locus_tag LOCUS_18080 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958071.1:succinate-semialdehyde dehydrogenase >Feature sequence0903 778 419 gene locus_tag LOCUS_18090 gene dgkA 778 419 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963705.1 protein_id gnl|my_center|LOCUS_18090 1278 778 gene locus_tag LOCUS_18100 gene tpx 1278 778 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXZ5 protein_id gnl|my_center|LOCUS_18100 >Feature sequence0904 >Feature sequence0905 <1406 94 gene locus_tag LOCUS_18110 <1406 94 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964323.1:membrane protein >Feature sequence0906 >Feature sequence0907 273 133 gene locus_tag LOCUS_18120 273 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 611 270 gene locus_tag LOCUS_18130 611 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 867 613 gene locus_tag LOCUS_18140 867 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 1153 908 gene locus_tag LOCUS_18150 1153 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence0908 <1 704 gene locus_tag LOCUS_18160 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202542.1:beta-mannosidase >Feature sequence0909 >Feature sequence0910 >Feature sequence0911 <1 971 gene locus_tag LOCUS_18170 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZF6:ribosomal protein S12 methylthiotransferase RimO >Feature sequence0912 375 563 gene locus_tag LOCUS_18180 375 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 560 748 gene locus_tag LOCUS_18190 560 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 887 1255 gene locus_tag LOCUS_18200 887 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence0913 178 555 gene locus_tag LOCUS_18210 178 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1220 579 gene locus_tag LOCUS_18220 gene pcm 1220 579 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence0914 413 183 gene locus_tag LOCUS_18230 413 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 646 497 gene locus_tag LOCUS_18240 646 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 831 643 gene locus_tag LOCUS_18250 831 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 991 833 gene locus_tag LOCUS_18260 991 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1189 1004 gene locus_tag LOCUS_18270 1189 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence0915 >Feature sequence0916 >Feature sequence0917 >Feature sequence0918 <1 981 gene locus_tag LOCUS_18280 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962192.1:DNA polymerase III subunit delta' >Feature sequence0919 <1385 868 gene locus_tag LOCUS_18290 <1385 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964187.1:alpha/beta hydrolase >Feature sequence0920 <1384 707 gene locus_tag LOCUS_18300 <1384 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0K9:UPF0721 transmembrane protein >Feature sequence0921 >Feature sequence0922 58 315 gene locus_tag LOCUS_18310 58 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 817 368 gene locus_tag LOCUS_18320 gene tadA 817 368 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_18320 >Feature sequence0923 >Feature sequence0924 >Feature sequence0925 >Feature sequence0926 >Feature sequence0927 >Feature sequence0928 626 213 gene locus_tag LOCUS_18330 626 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963120.1 protein_id gnl|my_center|LOCUS_18330 <1377 626 gene locus_tag LOCUS_18340 <1377 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963121.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase >Feature sequence0929 >Feature sequence0930 >Feature sequence0931 1111 209 gene locus_tag LOCUS_18350 1111 209 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence0932 422 213 gene locus_tag LOCUS_18360 422 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 630 388 gene locus_tag LOCUS_18370 630 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 883 1140 gene locus_tag LOCUS_18380 883 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence0933 3 1199 gene locus_tag LOCUS_18390 3 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence0934 1213 680 gene locus_tag LOCUS_18400 1213 680 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence0935 831 403 gene locus_tag LOCUS_18410 831 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence0936 >Feature sequence0937 >Feature sequence0938 79 765 gene locus_tag LOCUS_18420 79 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 762 929 gene locus_tag LOCUS_18430 762 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence0939 >Feature sequence0940 2 319 gene locus_tag LOCUS_18440 2 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964162.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence0941 >Feature sequence0942 238 801 gene locus_tag LOCUS_18450 238 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 899 1336 gene locus_tag LOCUS_18460 899 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence0943 >Feature sequence0944 782 63 gene locus_tag LOCUS_18470 782 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence0945 757 584 gene locus_tag LOCUS_18480 757 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1359 736 gene locus_tag LOCUS_18490 1359 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence0946 >Feature sequence0947 169 852 gene locus_tag LOCUS_18500 169 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence0948 <1 834 gene locus_tag LOCUS_18510 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H195:UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase >Feature sequence0949 142 420 gene locus_tag LOCUS_18520 142 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 449 643 gene locus_tag LOCUS_18530 449 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 827 1270 gene locus_tag LOCUS_18540 827 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence0950 >Feature sequence0951 249 452 gene locus_tag LOCUS_18550 249 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 479 838 gene locus_tag LOCUS_18560 479 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence0952 >Feature sequence0953 >Feature sequence0954 >Feature sequence0955 1117 350 gene locus_tag LOCUS_18570 1117 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence0956 >Feature sequence0957 >Feature sequence0958 >Feature sequence0959 >Feature sequence0960 >Feature sequence0961 >Feature sequence0962 <1350 292 gene locus_tag LOCUS_18580 <1350 292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962777.1:T9SS C-terminal target domain-containing protein >Feature sequence0963 652 1149 gene locus_tag LOCUS_18590 652 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence0964 41 565 gene locus_tag LOCUS_18600 41 565 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119942.1 protein_id gnl|my_center|LOCUS_18600 567 830 gene locus_tag LOCUS_18610 567 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496395.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence0965 >Feature sequence0966 275 27 gene locus_tag LOCUS_18620 275 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 567 337 gene locus_tag LOCUS_18630 567 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 760 545 gene locus_tag LOCUS_18640 760 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1020 757 gene locus_tag LOCUS_18650 1020 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1250 1020 gene locus_tag LOCUS_18660 1250 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence0967 27 515 gene locus_tag LOCUS_18670 27 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_18670 625 840 gene locus_tag LOCUS_18680 625 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence0968 598 1143 gene locus_tag LOCUS_18690 598 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence0969 246 1268 gene locus_tag LOCUS_18700 246 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 >Feature sequence0970 <1 1335 gene locus_tag LOCUS_18710 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404969.1:peptidase M14 >Feature sequence0971 1041 1289 gene locus_tag LOCUS_18720 1041 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence0972 >Feature sequence0973 >Feature sequence0974 798 172 gene locus_tag LOCUS_18730 798 172 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence0975 381 560 gene locus_tag LOCUS_18740 381 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence0976 157 795 gene locus_tag LOCUS_18750 157 795 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902568.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence0977 439 281 gene locus_tag LOCUS_18760 439 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1250 441 gene locus_tag LOCUS_18770 1250 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence0978 <1 562 gene locus_tag LOCUS_18780 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964122.1:ABC transporter permease >Feature sequence0979 936 628 gene locus_tag LOCUS_18790 936 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence0980 >Feature sequence0981 121 597 gene locus_tag LOCUS_18800 gene rplQ 121 597 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ72 protein_id gnl|my_center|LOCUS_18800 >Feature sequence0982 >Feature sequence0983 816 244 gene locus_tag LOCUS_18810 816 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1019 819 gene locus_tag LOCUS_18820 1019 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence0984 860 711 gene locus_tag LOCUS_18830 860 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence0985 >Feature sequence0986 400 624 gene locus_tag LOCUS_18840 400 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 621 968 gene locus_tag LOCUS_18850 621 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 965 1168 gene locus_tag LOCUS_18860 965 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence0987 25 225 gene locus_tag LOCUS_18870 25 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 191 412 gene locus_tag LOCUS_18880 191 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 681 409 gene locus_tag LOCUS_18890 681 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 1027 644 gene locus_tag LOCUS_18900 1027 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence0988 48 494 gene locus_tag LOCUS_18910 48 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 497 763 gene locus_tag LOCUS_18920 497 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 760 1086 gene locus_tag LOCUS_18930 760 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence0989 >Feature sequence0990 1220 63 gene locus_tag LOCUS_18940 gene porR 1220 63 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence0991 >Feature sequence0992 790 89 gene locus_tag LOCUS_18950 790 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence0993 635 510 gene locus_tag LOCUS_18960 635 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 1129 719 gene locus_tag LOCUS_18970 1129 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence0994 314 610 gene locus_tag LOCUS_18980 314 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence0995 >Feature sequence0996 482 291 gene locus_tag LOCUS_18990 482 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 1030 479 gene locus_tag LOCUS_19000 1030 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence0997 >Feature sequence0998 381 124 gene locus_tag LOCUS_19010 381 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence0999 741 268 gene locus_tag LOCUS_19020 gene rlmH 741 268 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_19020 >Feature sequence1000 851 261 gene locus_tag LOCUS_19030 851 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 1191 973 gene locus_tag LOCUS_19040 1191 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence1001 >Feature sequence1002 96 335 gene locus_tag LOCUS_19050 96 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence1003 202 687 gene locus_tag LOCUS_19060 202 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 994 665 gene locus_tag LOCUS_19070 994 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence1004 181 996 gene locus_tag LOCUS_19080 gene yeeZ 181 996 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962265.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence1005 221 415 gene locus_tag LOCUS_19090 221 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 739 1086 gene locus_tag LOCUS_19100 739 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence1006 >Feature sequence1007 1055 105 gene locus_tag LOCUS_19110 1055 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence1008 <1 795 gene locus_tag LOCUS_19120 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963605.1:iron-regulated protein A precursor >Feature sequence1009 >Feature sequence1010 >Feature sequence1011 <1 848 gene locus_tag LOCUS_19130 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969977.1:aspartate aminotransferase family protein >Feature sequence1012 305 724 gene locus_tag LOCUS_19140 305 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 717 1115 gene locus_tag LOCUS_19150 717 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence1013 909 391 gene locus_tag LOCUS_19160 909 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 >Feature sequence1014 >Feature sequence1015 2 238 gene locus_tag LOCUS_19170 2 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence1016 >Feature sequence1017 143 493 gene locus_tag LOCUS_19180 143 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence1018 >Feature sequence1019 <1 693 gene locus_tag LOCUS_19190 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877378.1:cryptochrome/photolyase family protein >Feature sequence1020 >Feature sequence1021 655 993 gene locus_tag LOCUS_19200 655 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence1022 >Feature sequence1023 507 358 gene locus_tag LOCUS_19210 507 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 803 603 gene locus_tag LOCUS_19220 803 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence1024 >Feature sequence1025 85 930 gene locus_tag LOCUS_19230 gene panC 85 930 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 protein_id gnl|my_center|LOCUS_19230 >Feature sequence1026 >Feature sequence1027 >Feature sequence1028 <1286 624 gene locus_tag LOCUS_19240 <1286 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962326.1:ribose-phosphate pyrophosphokinase >Feature sequence1029 407 111 gene locus_tag LOCUS_19250 407 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 776 462 gene locus_tag LOCUS_19260 776 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1012 776 gene locus_tag LOCUS_19270 1012 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence1030 >Feature sequence1031 >Feature sequence1032 204 563 gene locus_tag LOCUS_19280 204 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 912 568 gene locus_tag LOCUS_19290 912 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 >Feature sequence1033 <1 531 gene locus_tag LOCUS_19300 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962300.1:T9SS C-terminal target domain-containing protein >Feature sequence1034 1019 387 gene locus_tag LOCUS_19310 1019 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence1035 <1278 597 gene locus_tag LOCUS_19320 <1278 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963431.1:sugar transporter >Feature sequence1036 >Feature sequence1037 >Feature sequence1038 669 217 gene locus_tag LOCUS_19330 669 217 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314059.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence1039 >Feature sequence1040 555 1184 gene locus_tag LOCUS_19340 555 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence1041 >Feature sequence1042 159 404 gene locus_tag LOCUS_19350 159 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 <1272 419 gene locus_tag LOCUS_19360 <1272 419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963187.1:ABC-F family ATPase >Feature sequence1043 <1272 364 gene locus_tag LOCUS_19370 <1272 364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038867.1:N-acyl-L-amino acid amidohydrolase >Feature sequence1044 522 106 gene locus_tag LOCUS_19380 522 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 740 522 gene locus_tag LOCUS_19390 740 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence1045 664 14 gene locus_tag LOCUS_19400 664 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence1046 >Feature sequence1047 >Feature sequence1048 >Feature sequence1049 883 296 gene locus_tag LOCUS_19410 883 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1007 801 gene locus_tag LOCUS_19420 1007 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence1050 131 352 gene locus_tag LOCUS_19430 131 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence1051 62 712 gene locus_tag LOCUS_19440 gene pdxH 62 712 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 protein_id gnl|my_center|LOCUS_19440 716 1204 gene locus_tag LOCUS_19450 gene sixA 716 1204 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence1052 >Feature sequence1053 <1260 746 gene locus_tag LOCUS_19460 <1260 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933671.1:mechanosensitive ion channel protein MscS >Feature sequence1054 <1 1005 gene locus_tag LOCUS_19470 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003440276.1:sodium:alanine symporter 1226 1002 gene locus_tag LOCUS_19480 1226 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 >Feature sequence1055 >Feature sequence1056 <1 867 gene locus_tag LOCUS_19490 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403087.1:nitrous-oxide reductase >Feature sequence1057 <1256 33 gene locus_tag LOCUS_19500 <1256 33 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67943:60 kDa chaperonin >Feature sequence1058 473 1009 gene locus_tag LOCUS_19510 473 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence1059 >Feature sequence1060 84 731 gene locus_tag LOCUS_19520 84 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 786 1094 gene locus_tag LOCUS_19530 786 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence1061 367 1134 gene locus_tag LOCUS_19540 367 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence1062 1186 518 gene locus_tag LOCUS_19550 1186 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence1063 >Feature sequence1064 340 104 gene locus_tag LOCUS_19560 340 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 702 415 gene locus_tag LOCUS_19570 702 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 851 699 gene locus_tag LOCUS_19580 851 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence1065 <1 754 gene locus_tag LOCUS_19590 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY90:polyphosphate kinase >Feature sequence1066 >Feature sequence1067 >Feature sequence1068 >Feature sequence1069 216 383 gene locus_tag LOCUS_19600 216 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 411 671 gene locus_tag LOCUS_19610 411 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 725 1234 gene locus_tag LOCUS_19620 725 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence1070 >Feature sequence1071 498 884 gene locus_tag LOCUS_19630 498 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_19630 1241 906 gene locus_tag LOCUS_19640 1241 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence1072 >Feature sequence1073 304 546 gene locus_tag LOCUS_19650 304 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 1002 706 gene locus_tag LOCUS_19660 1002 706 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence1074 393 917 gene locus_tag LOCUS_19670 gene rimM 393 917 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_19670 >Feature sequence1075 780 49 gene locus_tag LOCUS_19680 780 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence1076 666 331 gene locus_tag LOCUS_19690 666 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 1017 667 gene locus_tag LOCUS_19700 1017 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence1077 >Feature sequence1078 >Feature sequence1079 714 475 gene locus_tag LOCUS_19710 714 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 1236 724 gene locus_tag LOCUS_19720 1236 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence1080 >Feature sequence1081 >Feature sequence1082 >Feature sequence1083 >Feature sequence1084 545 45 gene locus_tag LOCUS_19730 545 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 990 778 gene locus_tag LOCUS_19740 990 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence1085 925 260 gene locus_tag LOCUS_19750 925 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1204 1034 gene locus_tag LOCUS_19760 1204 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence1086 >Feature sequence1087 >Feature sequence1088 309 515 gene locus_tag LOCUS_19770 309 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 672 1106 gene locus_tag LOCUS_19780 672 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence1089 <1229 566 gene locus_tag LOCUS_19790 <1229 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXX2:cytokinin riboside 5'-monophosphate phosphoribohydrolase >Feature sequence1090 >Feature sequence1091 <1 979 gene locus_tag LOCUS_19800 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O05949:DNA polymerase I >Feature sequence1092 289 131 gene locus_tag LOCUS_19810 289 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 648 286 gene locus_tag LOCUS_19820 648 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 839 660 gene locus_tag LOCUS_19830 839 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence1093 >Feature sequence1094 310 170 gene locus_tag LOCUS_19840 310 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 560 324 gene locus_tag LOCUS_19850 560 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 732 517 gene locus_tag LOCUS_19860 732 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1174 761 gene locus_tag LOCUS_19870 1174 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence1095 >Feature sequence1096 867 172 gene locus_tag LOCUS_19880 867 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence1097 >Feature sequence1098 >Feature sequence1099 >Feature sequence1100 >Feature sequence1101 >Feature sequence1102 >Feature sequence1103 >Feature sequence1104 747 142 gene locus_tag LOCUS_19890 747 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence1105 903 139 gene locus_tag LOCUS_19900 903 139 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence1106 >Feature sequence1107 >Feature sequence1108 49 231 gene locus_tag LOCUS_19910 49 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 235 516 gene locus_tag LOCUS_19920 235 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 628 882 gene locus_tag LOCUS_19930 628 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 879 1187 gene locus_tag LOCUS_19940 879 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence1109 455 997 gene locus_tag LOCUS_19950 455 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence1110 1203 430 gene locus_tag LOCUS_19960 1203 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence1111 <1 720 gene locus_tag LOCUS_19970 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964509.1:rod shape-determining protein RodA >Feature sequence1112 >Feature sequence1113 >Feature sequence1114 1026 571 gene locus_tag LOCUS_19980 1026 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence1115 129 431 gene locus_tag LOCUS_19990 129 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 433 654 gene locus_tag LOCUS_20000 433 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 656 880 gene locus_tag LOCUS_20010 656 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 902 1102 gene locus_tag LOCUS_20020 902 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence1116 267 554 gene locus_tag LOCUS_20030 267 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 558 923 gene locus_tag LOCUS_20040 558 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence1117 374 78 gene locus_tag LOCUS_20050 374 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence1118 772 71 gene locus_tag LOCUS_20060 gene atoD 772 71 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence1119 >Feature sequence1120 451 188 gene locus_tag LOCUS_20070 451 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 959 687 gene locus_tag LOCUS_20080 959 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence1121 917 717 gene locus_tag LOCUS_20090 917 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence1122 1051 143 gene locus_tag LOCUS_20100 gene hemC 1051 143 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP0 protein_id gnl|my_center|LOCUS_20100 >Feature sequence1123 1006 119 gene locus_tag LOCUS_20110 1006 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence1124 698 78 gene locus_tag LOCUS_20120 698 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence1125 >Feature sequence1126 >Feature sequence1127 >Feature sequence1128 <1 741 gene locus_tag LOCUS_20130 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010714183.1:DEAD/DEAH box helicase >Feature sequence1129 >Feature sequence1130 >Feature sequence1131 >Feature sequence1132 >Feature sequence1133 448 867 gene locus_tag LOCUS_20140 448 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence1134 328 95 gene locus_tag LOCUS_20150 328 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 915 406 gene locus_tag LOCUS_20160 915 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence1135 1132 446 gene locus_tag LOCUS_20170 1132 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence1136 >Feature sequence1137 >Feature sequence1138 27 188 gene locus_tag LOCUS_20180 27 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 185 607 gene locus_tag LOCUS_20190 185 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 675 830 gene locus_tag LOCUS_20200 675 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 823 1062 gene locus_tag LOCUS_20210 823 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence1139 571 173 gene locus_tag LOCUS_20220 571 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 962 762 gene locus_tag LOCUS_20230 962 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1126 959 gene locus_tag LOCUS_20240 1126 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence1140 >Feature sequence1141 >Feature sequence1142 >Feature sequence1143 <1 672 gene locus_tag LOCUS_20250 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:membrane protein >Feature sequence1144 <1 1159 gene locus_tag LOCUS_20260 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011011095.1:DNA helicase >Feature sequence1145 859 155 gene locus_tag LOCUS_20270 859 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 >Feature sequence1146 <1180 348 gene locus_tag LOCUS_20280 <1180 348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZE5:pyruvate dehydrogenase E1 component subunit alpha >Feature sequence1147 217 498 gene locus_tag LOCUS_20290 217 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 519 851 gene locus_tag LOCUS_20300 519 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 838 1131 gene locus_tag LOCUS_20310 838 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence1148 796 332 gene locus_tag LOCUS_20320 796 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence1149 >Feature sequence1150 >Feature sequence1151 >Feature sequence1152 149 658 gene locus_tag LOCUS_20330 149 658 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence1153 >Feature sequence1154 >Feature sequence1155 >Feature sequence1156 167 565 gene locus_tag LOCUS_20340 167 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 553 975 gene locus_tag LOCUS_20350 553 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence1157 <1173 632 gene locus_tag LOCUS_20360 <1173 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458883.1:zinc ABC transporter permease >Feature sequence1158 1111 218 gene locus_tag LOCUS_20370 1111 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence1159 >Feature sequence1160 560 1018 gene locus_tag LOCUS_20380 560 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence1161 132 959 gene locus_tag LOCUS_20390 132 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20390 >Feature sequence1162 <1 897 gene locus_tag LOCUS_20400 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037381.1:glutaryl-7-ACA acylase >Feature sequence1163 406 732 gene locus_tag LOCUS_20410 406 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence1164 >Feature sequence1165 >Feature sequence1166 >Feature sequence1167 >Feature sequence1168 534 289 gene locus_tag LOCUS_20420 534 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 627 1157 gene locus_tag LOCUS_20430 627 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence1169 >Feature sequence1170 441 127 gene locus_tag LOCUS_20440 441 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 637 458 gene locus_tag LOCUS_20450 637 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 843 634 gene locus_tag LOCUS_20460 843 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 1141 854 gene locus_tag LOCUS_20470 1141 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence1171 >Feature sequence1172 >Feature sequence1173 >Feature sequence1174 562 972 gene locus_tag LOCUS_20480 562 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence1175 >Feature sequence1176 1117 398 gene locus_tag LOCUS_20490 gene recO 1117 398 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 protein_id gnl|my_center|LOCUS_20490 >Feature sequence1177 >Feature sequence1178 183 596 gene locus_tag LOCUS_20500 183 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 729 989 gene locus_tag LOCUS_20510 729 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence1179 82 372 gene locus_tag LOCUS_20520 82 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 365 583 gene locus_tag LOCUS_20530 365 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 719 1141 gene locus_tag LOCUS_20540 719 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence1180 1010 420 gene locus_tag LOCUS_20550 1010 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence1181 >Feature sequence1182 21 980 gene locus_tag LOCUS_20560 21 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence1183 1152 775 gene locus_tag LOCUS_20570 1152 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence1184 <1153 118 gene locus_tag LOCUS_20580 <1153 118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963722.1:magnesium chelatase >Feature sequence1185 >Feature sequence1186 >Feature sequence1187 >Feature sequence1188 >Feature sequence1189 >Feature sequence1190 >Feature sequence1191 <1148 264 gene locus_tag LOCUS_20590 <1148 264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964222.1:malic enzyme >Feature sequence1192 >Feature sequence1193 >Feature sequence1194 344 742 gene locus_tag LOCUS_20600 344 742 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence1195 >Feature sequence1196 >Feature sequence1197 727 308 gene locus_tag LOCUS_20610 727 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence1198 >Feature sequence1199 65 883 gene locus_tag LOCUS_20620 65 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence1200 <1 620 gene locus_tag LOCUS_20630 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946961.1:recombinase >Feature sequence1201 >Feature sequence1202 324 1004 gene locus_tag LOCUS_20640 324 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence1203 >Feature sequence1204 537 932 gene locus_tag LOCUS_20650 537 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence1205 <1 628 gene locus_tag LOCUS_20660 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964214.1:transporter >Feature sequence1206 >Feature sequence1207 >Feature sequence1208 >Feature sequence1209 >Feature sequence1210 1136 429 gene locus_tag LOCUS_20670 1136 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence1211 >Feature sequence1212 >Feature sequence1213 164 313 gene locus_tag LOCUS_20680 164 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 <1135 379 gene locus_tag LOCUS_20690 <1135 379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962898.1:ornithine--oxo-acid transaminase >Feature sequence1214 107 988 gene locus_tag LOCUS_20700 107 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963809.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence1215 827 528 gene locus_tag LOCUS_20710 827 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence1216 651 316 gene locus_tag LOCUS_20720 651 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 802 596 gene locus_tag LOCUS_20730 802 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1008 802 gene locus_tag LOCUS_20740 1008 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence1217 157 705 gene locus_tag LOCUS_20750 157 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence1218 989 285 gene locus_tag LOCUS_20760 989 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 >Feature sequence1219 115 696 gene locus_tag LOCUS_20770 gene miaE 115 696 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence1220 >Feature sequence1221 314 898 gene locus_tag LOCUS_20780 314 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence1222 <1128 296 gene locus_tag LOCUS_20790 <1128 296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963409.1:polysaccharide biosynthesis protein CapD >Feature sequence1223 >Feature sequence1224 >Feature sequence1225 434 886 gene locus_tag LOCUS_20800 434 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 >Feature sequence1226 683 468 gene locus_tag LOCUS_20810 683 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 621 839 gene locus_tag LOCUS_20820 621 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence1227 >Feature sequence1228 1 867 gene locus_tag LOCUS_20830 1 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence1229 752 162 gene locus_tag LOCUS_20840 752 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence1230 771 944 gene locus_tag LOCUS_20850 771 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence1231 >Feature sequence1232 >Feature sequence1233 419 778 gene locus_tag LOCUS_20860 419 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence1234 >Feature sequence1235 727 1026 gene locus_tag LOCUS_20870 727 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence1236 <1 894 gene locus_tag LOCUS_20880 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964301.1:ATPase >Feature sequence1237 >Feature sequence1238 <1122 462 gene locus_tag LOCUS_20890 <1122 462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWG7:demethylmenaquinone methyltransferase >Feature sequence1239 >Feature sequence1240 >Feature sequence1241 >Feature sequence1242 >Feature sequence1243 >Feature sequence1244 784 47 gene locus_tag LOCUS_20900 784 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence1245 >Feature sequence1246 >Feature sequence1247 >Feature sequence1248 625 98 gene locus_tag LOCUS_20910 625 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 977 612 gene locus_tag LOCUS_20920 977 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence1249 232 684 gene locus_tag LOCUS_20930 232 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 677 1090 gene locus_tag LOCUS_20940 677 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence1250 355 528 gene locus_tag LOCUS_20950 355 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence1251 1020 403 gene locus_tag LOCUS_20960 1020 403 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence1252 >Feature sequence1253 374 1033 gene locus_tag LOCUS_20970 374 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence1254 140 319 gene locus_tag LOCUS_20980 140 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence1255 144 10 gene locus_tag LOCUS_20990 144 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 322 116 gene locus_tag LOCUS_21000 322 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 592 371 gene locus_tag LOCUS_21010 592 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 800 594 gene locus_tag LOCUS_21020 800 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence1256 >Feature sequence1257 >Feature sequence1258 66 233 gene locus_tag LOCUS_21030 66 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 237 386 gene locus_tag LOCUS_21040 237 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 386 619 gene locus_tag LOCUS_21050 386 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 616 849 gene locus_tag LOCUS_21060 616 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence1259 133 744 gene locus_tag LOCUS_21070 133 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 783 953 gene locus_tag LOCUS_21080 783 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence1260 >Feature sequence1261 75 704 gene locus_tag LOCUS_21090 75 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence1262 >Feature sequence1263 >Feature sequence1264 95 472 gene locus_tag LOCUS_21100 95 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 483 674 gene locus_tag LOCUS_21110 483 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence1265 >Feature sequence1266 746 39 gene locus_tag LOCUS_21120 746 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_21120 >Feature sequence1267 >Feature sequence1268 864 118 gene locus_tag LOCUS_21130 864 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence1269 >Feature sequence1270 280 975 gene locus_tag LOCUS_21140 280 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 >Feature sequence1271 83 823 gene locus_tag LOCUS_21150 83 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence1272 >Feature sequence1273 >Feature sequence1274 1021 71 gene locus_tag LOCUS_21160 1021 71 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence1275 >Feature sequence1276 >Feature sequence1277 >Feature sequence1278 >Feature sequence1279 >Feature sequence1280 >Feature sequence1281 >Feature sequence1282 288 548 gene locus_tag LOCUS_21170 288 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 655 1026 gene locus_tag LOCUS_21180 655 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence1283 >Feature sequence1284 >Feature sequence1285 520 771 gene locus_tag LOCUS_21190 520 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence1286 566 207 gene locus_tag LOCUS_21200 566 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence1287 <1094 29 gene locus_tag LOCUS_21210 <1094 29 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203697.1:tyrosine recombinase >Feature sequence1288 <1 948 gene locus_tag LOCUS_21220 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887835.1:phosphatase >Feature sequence1289 >Feature sequence1290 >Feature sequence1291 3 212 gene locus_tag LOCUS_21230 3 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence1292 >Feature sequence1293 835 17 gene locus_tag LOCUS_21240 835 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence1294 >Feature sequence1295 341 592 gene locus_tag LOCUS_21250 341 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 672 1082 gene locus_tag LOCUS_21260 672 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence1296 541 26 gene locus_tag LOCUS_21270 541 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 957 526 gene locus_tag LOCUS_21280 957 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence1297 >Feature sequence1298 3 479 gene locus_tag LOCUS_21290 3 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 464 856 gene locus_tag LOCUS_21300 464 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence1299 >Feature sequence1300 >Feature sequence1301 >Feature sequence1302 >Feature sequence1303 3 632 gene locus_tag LOCUS_21310 3 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence1304 1077 556 gene locus_tag LOCUS_21320 1077 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence1305 >Feature sequence1306 >Feature sequence1307 >Feature sequence1308 >Feature sequence1309 150 398 gene locus_tag LOCUS_21330 150 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence1310 894 451 gene locus_tag LOCUS_21340 894 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence1311 >Feature sequence1312 34 429 gene locus_tag LOCUS_21350 34 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 426 638 gene locus_tag LOCUS_21360 426 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence1313 265 128 gene locus_tag LOCUS_21370 265 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 392 243 gene locus_tag LOCUS_21380 392 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 620 429 gene locus_tag LOCUS_21390 620 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 1024 620 gene locus_tag LOCUS_21400 1024 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence1314 208 699 gene locus_tag LOCUS_21410 gene gldD 208 699 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence1315 >Feature sequence1316 <1077 100 gene locus_tag LOCUS_21420 <1077 100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H092:valine--tRNA ligase >Feature sequence1317 >Feature sequence1318 <1 739 gene locus_tag LOCUS_21430 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207243.1:AraC family transcriptional regulator >Feature sequence1319 >Feature sequence1320 >Feature sequence1321 801 406 gene locus_tag LOCUS_21440 801 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 1020 847 gene locus_tag LOCUS_21450 1020 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence1322 >Feature sequence1323 754 296 gene locus_tag LOCUS_21460 754 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 929 744 gene locus_tag LOCUS_21470 929 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence1324 >Feature sequence1325 >Feature sequence1326 >Feature sequence1327 >Feature sequence1328 >Feature sequence1329 482 120 gene locus_tag LOCUS_21480 482 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence1330 >Feature sequence1331 104 856 gene locus_tag LOCUS_21490 104 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence1332 851 411 gene locus_tag LOCUS_21500 851 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1036 848 gene locus_tag LOCUS_21510 1036 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence1333 305 637 gene locus_tag LOCUS_21520 305 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence1334 379 245 gene locus_tag LOCUS_21530 379 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence1335 >Feature sequence1336 >Feature sequence1337 >Feature sequence1338 332 640 gene locus_tag LOCUS_21540 332 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 618 1001 gene locus_tag LOCUS_21550 618 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence1339 126 269 gene locus_tag LOCUS_21560 126 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 327 758 gene locus_tag LOCUS_21570 327 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence1340 >Feature sequence1341 >Feature sequence1342 405 716 gene locus_tag LOCUS_21580 405 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 789 980 gene locus_tag LOCUS_21590 789 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence1343 <1 1034 gene locus_tag LOCUS_21600 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964489.1:copper transporter >Feature sequence1344 591 313 gene locus_tag LOCUS_21610 591 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence1345 >Feature sequence1346 199 44 gene locus_tag LOCUS_21620 199 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 685 506 gene locus_tag LOCUS_21630 685 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence1347 >Feature sequence1348 1 162 gene locus_tag LOCUS_21640 1 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 162 410 gene locus_tag LOCUS_21650 162 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 403 579 gene locus_tag LOCUS_21660 403 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence1349 682 35 gene locus_tag LOCUS_21670 682 35 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence1350 >Feature sequence1351 793 440 gene locus_tag LOCUS_21680 793 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence1352 594 220 gene locus_tag LOCUS_21690 594 220 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence1353 628 158 gene locus_tag LOCUS_21700 628 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence1354 510 43 gene locus_tag LOCUS_21710 gene smpB 510 43 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 protein_id gnl|my_center|LOCUS_21710 >Feature sequence1355 <1 845 gene locus_tag LOCUS_21720 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A666:phosphate transporter >Feature sequence1356 >Feature sequence1357 >Feature sequence1358 >Feature sequence1359 <1 1018 gene locus_tag LOCUS_21730 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186419.1:glycosyl transferase >Feature sequence1360 459 115 gene locus_tag LOCUS_21740 459 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence1361 >Feature sequence1362 16 312 gene locus_tag LOCUS_21750 16 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 312 638 gene locus_tag LOCUS_21760 312 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 638 1021 gene locus_tag LOCUS_21770 638 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence1363 >Feature sequence1364 >Feature sequence1365 <1050 449 gene locus_tag LOCUS_21780 <1050 449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962384.1:coproporphyrinogen III oxidase >Feature sequence1366 321 446 gene locus_tag LOCUS_21790 321 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 453 815 gene locus_tag LOCUS_21800 453 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence1367 >Feature sequence1368 >Feature sequence1369 >Feature sequence1370 >Feature sequence1371 >Feature sequence1372 >Feature sequence1373 157 990 gene locus_tag LOCUS_21810 157 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence1374 >Feature sequence1375 173 490 gene locus_tag LOCUS_21820 173 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 462 812 gene locus_tag LOCUS_21830 462 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence1376 253 855 gene locus_tag LOCUS_21840 253 855 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence1377 >Feature sequence1378 >Feature sequence1379 >Feature sequence1380 496 708 gene locus_tag LOCUS_21850 496 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence1381 <1043 405 gene locus_tag LOCUS_21860 <1043 405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813290.1:phenylacetic acid degradation protein >Feature sequence1382 >Feature sequence1383 601 966 gene locus_tag LOCUS_21870 601 966 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence1384 >Feature sequence1385 >Feature sequence1386 299 781 gene locus_tag LOCUS_21880 299 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence1387 >Feature sequence1388 594 364 gene locus_tag LOCUS_21890 594 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence1389 >Feature sequence1390 <1 713 gene locus_tag LOCUS_21900 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962469.1:membrane protein >Feature sequence1391 >Feature sequence1392 >Feature sequence1393 903 658 gene locus_tag LOCUS_21910 903 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence1394 >Feature sequence1395 >Feature sequence1396 371 673 gene locus_tag LOCUS_21920 371 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 >Feature sequence1397 >Feature sequence1398 799 230 gene locus_tag LOCUS_21930 799 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence1399 816 214 gene locus_tag LOCUS_21940 816 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence1400 464 880 gene locus_tag LOCUS_21950 464 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence1401 530 811 gene locus_tag LOCUS_21960 530 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence1402 >Feature sequence1403 <1031 300 gene locus_tag LOCUS_21970 <1031 300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY93:succinate--CoA ligase [ADP-forming] subunit alpha >Feature sequence1404 523 182 gene locus_tag LOCUS_21980 523 182 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_21980 1008 520 gene locus_tag LOCUS_21990 1008 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence1405 <1030 431 gene locus_tag LOCUS_22000 <1030 431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405453.1:glutaminyl-tRNA synthetase >Feature sequence1406 43 279 gene locus_tag LOCUS_22010 43 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 225 431 gene locus_tag LOCUS_22020 225 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 400 807 gene locus_tag LOCUS_22030 400 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence1407 242 592 gene locus_tag LOCUS_22040 242 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 685 843 gene locus_tag LOCUS_22050 685 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence1408 448 269 gene locus_tag LOCUS_22060 448 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 709 494 gene locus_tag LOCUS_22070 709 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence1409 >Feature sequence1410 >Feature sequence1411 >Feature sequence1412 >Feature sequence1413 >Feature sequence1414 >Feature sequence1415 446 327 gene locus_tag LOCUS_22080 446 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 862 449 gene locus_tag LOCUS_22090 862 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence1416 >Feature sequence1417 196 867 gene locus_tag LOCUS_22100 gene rsmI 196 867 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 protein_id gnl|my_center|LOCUS_22100 >Feature sequence1418 >Feature sequence1419 >Feature sequence1420 674 228 gene locus_tag LOCUS_22110 674 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 >Feature sequence1421 >Feature sequence1422 819 517 gene locus_tag LOCUS_22120 819 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence1423 383 135 gene locus_tag LOCUS_22130 383 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 <1022 451 gene locus_tag LOCUS_22140 <1022 451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072867.1:phage capsid protein >Feature sequence1424 783 256 gene locus_tag LOCUS_22150 783 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 >Feature sequence1425 <1 987 gene locus_tag LOCUS_22160 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:nuclease >Feature sequence1426 >Feature sequence1427 <1022 477 gene locus_tag LOCUS_22170 <1022 477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0C9:dihydrolipoyl dehydrogenase >Feature sequence1428 509 727 gene locus_tag LOCUS_22180 509 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 889 764 gene locus_tag LOCUS_22190 889 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 >Feature sequence1429 >Feature sequence1430 564 800 gene locus_tag LOCUS_22200 564 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence1431 >Feature sequence1432 <1 646 gene locus_tag LOCUS_22210 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW73:peptidyl-tRNA hydrolase >Feature sequence1433 >Feature sequence1434 1017 823 gene locus_tag LOCUS_22220 1017 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence1435 >Feature sequence1436 >Feature sequence1437 >Feature sequence1438 >Feature sequence1439 572 123 gene locus_tag LOCUS_22230 572 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence1440 182 979 gene locus_tag LOCUS_22240 182 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence1441 264 818 gene locus_tag LOCUS_22250 264 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence1442 839 54 gene locus_tag LOCUS_22260 839 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence1443 >Feature sequence1444 >Feature sequence1445 >Feature sequence1446 >Feature sequence1447 324 506 gene locus_tag LOCUS_22270 324 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence1448 621 43 gene locus_tag LOCUS_22280 621 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence1449 >Feature sequence1450 >Feature sequence1451 >Feature sequence1452 >Feature sequence1453 1008 718 gene locus_tag LOCUS_22290 1008 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence1454 >Feature sequence1455 >Feature sequence1456 >Feature sequence1457 261 755 gene locus_tag LOCUS_22300 261 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence1458 >Feature sequence1459 >Feature sequence1460 >Feature sequence1461 >Feature sequence1462 446 309 gene locus_tag LOCUS_22310 446 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence1463 <1006 49 gene locus_tag LOCUS_22320 <1006 49 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964584.1:protease >Feature sequence1464 584 156 gene locus_tag LOCUS_22330 584 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence1465 606 433 gene locus_tag LOCUS_22340 606 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence1466 >Feature sequence1467 >Feature sequence1468 >Feature sequence1469 307 119 gene locus_tag LOCUS_22350 307 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 509 291 gene locus_tag LOCUS_22360 509 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 725 513 gene locus_tag LOCUS_22370 725 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence1470 807 259 gene locus_tag LOCUS_22380 807 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence1471 288 527 gene locus_tag LOCUS_22390 288 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence1472 >Feature sequence1473 130 831 gene locus_tag LOCUS_22400 130 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400