>Feature sequence01 116 1855 gene locus_tag LOCUS_00010 gene batD 116 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_00010 1852 2625 gene locus_tag LOCUS_00020 gene batE 1852 2625 CDS product BatE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_00020 2847 2635 gene locus_tag LOCUS_00030 2847 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2805 3035 gene locus_tag LOCUS_00040 2805 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3145 3774 gene locus_tag LOCUS_00050 gene cynT 3145 3774 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_00050 3847 5445 gene locus_tag LOCUS_00060 3847 5445 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 protein_id gnl|my_center|LOCUS_00060 6163 5618 gene locus_tag LOCUS_00070 6163 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6315 6671 gene locus_tag LOCUS_00080 6315 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_00080 6703 7398 gene locus_tag LOCUS_00090 6703 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7501 8517 gene locus_tag LOCUS_00100 gene pheS 7501 8517 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_00100 8718 9113 gene locus_tag LOCUS_00110 8718 9113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_00110 10103 9114 gene locus_tag LOCUS_00120 gene gpsA 10103 9114 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_00120 10384 11304 gene locus_tag LOCUS_00130 10384 11304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11489 11983 gene locus_tag LOCUS_00140 gene ygaU 11489 11983 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120434.1 protein_id gnl|my_center|LOCUS_00140 12207 12803 gene locus_tag LOCUS_00150 12207 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 13383 12805 gene locus_tag LOCUS_00160 gene nadD 13383 12805 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_00160 13961 13386 gene locus_tag LOCUS_00170 gene gmk 13961 13386 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_00170 14823 13963 gene locus_tag LOCUS_00180 14823 13963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_00180 14996 16090 gene locus_tag LOCUS_00190 14996 16090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 16173 16589 gene locus_tag LOCUS_00200 16173 16589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 17451 16648 gene locus_tag LOCUS_00210 17451 16648 CDS product endo-1,3-1,4-beta glucanase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_00210 18200 17454 gene locus_tag LOCUS_00220 18200 17454 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_00220 19265 18210 gene locus_tag LOCUS_00230 19265 18210 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_00230 20474 19323 gene locus_tag LOCUS_00240 20474 19323 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973788.1 protein_id gnl|my_center|LOCUS_00240 21708 20476 gene locus_tag LOCUS_00250 21708 20476 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097908.1 protein_id gnl|my_center|LOCUS_00250 22694 21717 gene locus_tag LOCUS_00260 22694 21717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 22862 24571 gene locus_tag LOCUS_00270 22862 24571 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_00270 24574 25212 gene locus_tag LOCUS_00280 24574 25212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 25212 26138 gene locus_tag LOCUS_00290 25212 26138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 26609 26142 gene locus_tag LOCUS_00300 26609 26142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 28258 26660 gene locus_tag LOCUS_00310 gene treA 28258 26660 CDS product periplasmic trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHG0 protein_id gnl|my_center|LOCUS_00310 28864 28346 gene locus_tag LOCUS_00320 28864 28346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 29986 29018 gene locus_tag LOCUS_00330 29986 29018 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_00330 31008 29986 gene locus_tag LOCUS_00340 31008 29986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530707.1 protein_id gnl|my_center|LOCUS_00340 31126 31602 gene locus_tag LOCUS_00350 31126 31602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 32489 31599 gene locus_tag LOCUS_00360 32489 31599 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_00360 32803 32498 gene locus_tag LOCUS_00370 32803 32498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 33053 33529 gene locus_tag LOCUS_00380 33053 33529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_00380 34274 33513 gene locus_tag LOCUS_00390 34274 33513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 34329 35525 gene locus_tag LOCUS_00400 34329 35525 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_00400 36345 35536 gene locus_tag LOCUS_00410 36345 35536 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962446.1 protein_id gnl|my_center|LOCUS_00410 36554 37897 gene locus_tag LOCUS_00420 gene gdhA 36554 37897 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_00420 38053 40275 gene locus_tag LOCUS_00430 38053 40275 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_00430 40275 40991 gene locus_tag LOCUS_00440 gene recO 40275 40991 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 protein_id gnl|my_center|LOCUS_00440 41001 43406 gene locus_tag LOCUS_00450 41001 43406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_00450 43418 43798 gene locus_tag LOCUS_00460 43418 43798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 43866 44354 gene locus_tag LOCUS_00470 43866 44354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 46910 44364 gene locus_tag LOCUS_00480 46910 44364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 47262 48440 gene locus_tag LOCUS_00490 47262 48440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 48529 51939 gene locus_tag LOCUS_00500 gene ileS 48529 51939 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_00500 51947 52330 gene locus_tag LOCUS_00510 gene dksA 51947 52330 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_00510 52398 53030 gene locus_tag LOCUS_00520 52398 53030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 53064 53669 gene locus_tag LOCUS_00530 gene lspA 53064 53669 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_00530 54815 53676 gene locus_tag LOCUS_00540 54815 53676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 55432 54872 gene locus_tag LOCUS_00550 gene ygfA 55432 54872 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_00550 56408 55425 gene locus_tag LOCUS_00560 56408 55425 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_00560 57284 56412 gene locus_tag LOCUS_00570 gene rimK 57284 56412 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_00570 57706 57281 gene locus_tag LOCUS_00580 57706 57281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 57899 59695 gene locus_tag LOCUS_00590 gene uvrC 57899 59695 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_00590 59692 61956 gene locus_tag LOCUS_00600 59692 61956 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_00600 62035 63195 gene locus_tag LOCUS_00610 gene hmgA 62035 63195 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_00610 63314 64474 gene locus_tag LOCUS_00620 gene hppD 63314 64474 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_00620 64717 65493 gene locus_tag LOCUS_00630 64717 65493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_00630 65493 66446 gene locus_tag LOCUS_00640 65493 66446 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_00640 66478 67719 gene locus_tag LOCUS_00650 66478 67719 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_00650 67721 69364 gene locus_tag LOCUS_00660 gene pgi 67721 69364 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ0 protein_id gnl|my_center|LOCUS_00660 69533 72124 gene locus_tag LOCUS_00670 69533 72124 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_00670 72136 73839 gene locus_tag LOCUS_00680 72136 73839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 73927 75582 gene locus_tag LOCUS_00690 73927 75582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 75707 76147 gene locus_tag LOCUS_00700 75707 76147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_00700 77544 76231 gene locus_tag LOCUS_00710 gene pepP 77544 76231 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_00710 77644 80559 gene locus_tag LOCUS_00720 77644 80559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 80567 80956 gene locus_tag LOCUS_00730 80567 80956 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_00730 81218 81874 gene locus_tag LOCUS_00740 gene sdhC 81218 81874 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_00740 81878 83881 gene locus_tag LOCUS_00750 gene sdhA 81878 83881 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_00750 83904 84650 gene locus_tag LOCUS_00760 gene sdhB 83904 84650 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_00760 86101 84740 gene locus_tag LOCUS_00770 gene radA 86101 84740 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_00770 87237 86101 gene locus_tag LOCUS_00780 87237 86101 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962284.1 protein_id gnl|my_center|LOCUS_00780 88295 87327 gene locus_tag LOCUS_00790 88295 87327 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_00790 88648 88298 gene locus_tag LOCUS_00800 gene panD 88648 88298 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 protein_id gnl|my_center|LOCUS_00800 89515 88667 gene locus_tag LOCUS_00810 gene panC 89515 88667 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 protein_id gnl|my_center|LOCUS_00810 89716 90432 gene locus_tag LOCUS_00820 89716 90432 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_00820 90456 92057 gene locus_tag LOCUS_00830 90456 92057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962289.1 protein_id gnl|my_center|LOCUS_00830 92064 93914 gene locus_tag LOCUS_00840 gene glmS 92064 93914 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_00840 94132 95640 gene locus_tag LOCUS_00850 gene atpD 94132 95640 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_00850 95715 95993 gene locus_tag LOCUS_00860 95715 95993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 96184 96612 gene locus_tag LOCUS_00870 96184 96612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 98388 96616 gene locus_tag LOCUS_00880 98388 96616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_00880 98644 98438 gene locus_tag LOCUS_00890 98644 98438 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894739.1 protein_id gnl|my_center|LOCUS_00890 99180 98647 gene locus_tag LOCUS_00900 99180 98647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 99698 99183 gene locus_tag LOCUS_00910 99698 99183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 99914 101089 gene locus_tag LOCUS_00920 gene bioF 99914 101089 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_00920 101128 101544 gene locus_tag LOCUS_00930 101128 101544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 101537 102157 gene locus_tag LOCUS_00940 gene bioD 101537 102157 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_00940 102187 103452 gene locus_tag LOCUS_00950 gene bioA 102187 103452 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_00950 103849 104574 gene locus_tag LOCUS_00960 103849 104574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 104582 107320 gene locus_tag LOCUS_00970 104582 107320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 107752 107321 gene locus_tag LOCUS_00980 107752 107321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 107887 109125 gene locus_tag LOCUS_00990 107887 109125 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964416.1 protein_id gnl|my_center|LOCUS_00990 109149 111347 gene locus_tag LOCUS_01000 109149 111347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108861.1 protein_id gnl|my_center|LOCUS_01000 111413 112498 gene locus_tag LOCUS_01010 gene bioB 111413 112498 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_01010 112517 113383 gene locus_tag LOCUS_01020 112517 113383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203923.1 protein_id gnl|my_center|LOCUS_01020 113859 113380 gene locus_tag LOCUS_01030 gene recX 113859 113380 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_01030 115554 114019 gene locus_tag LOCUS_01040 gene cafA 115554 114019 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_01040 116147 115851 gene locus_tag LOCUS_01050 gene hupA 116147 115851 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_01050 116276 117361 gene locus_tag LOCUS_01060 gene mutY 116276 117361 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_01060 117466 117924 gene locus_tag LOCUS_01070 gene ssb 117466 117924 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H058 protein_id gnl|my_center|LOCUS_01070 117952 119280 gene locus_tag LOCUS_01080 117952 119280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 119299 119865 gene locus_tag LOCUS_01090 gene gldD 119299 119865 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_01090 120078 120818 gene locus_tag LOCUS_01100 gene fjo11 120078 120818 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_01100 122920 120851 gene locus_tag LOCUS_01110 122920 120851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01110 124294 122975 gene locus_tag LOCUS_01120 124294 122975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 124503 124970 gene locus_tag LOCUS_01130 124503 124970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 125072 125557 gene locus_tag LOCUS_01140 125072 125557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 125583 125846 gene locus_tag LOCUS_01150 gene rpmA 125583 125846 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P8 protein_id gnl|my_center|LOCUS_01150 126030 127604 gene locus_tag LOCUS_01160 126030 127604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 127768 130596 gene locus_tag LOCUS_01170 127768 130596 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_01170 130598 131620 gene locus_tag LOCUS_01180 gene phy 130598 131620 CDS product 3-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42094 protein_id gnl|my_center|LOCUS_01180 131996 131697 gene locus_tag LOCUS_01190 131996 131697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 132209 132958 gene locus_tag LOCUS_01200 132209 132958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 134338 133022 gene locus_tag LOCUS_01210 gene ahcY 134338 133022 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_01210 134396 135028 gene locus_tag LOCUS_01220 gene sfp 134396 135028 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_01220 135025 135750 gene locus_tag LOCUS_01230 gene pcrB 135025 135750 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_01230 135752 136384 gene locus_tag LOCUS_01240 gene pnuC 135752 136384 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_01240 136390 136905 gene locus_tag LOCUS_01250 136390 136905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01250 136902 138446 gene locus_tag LOCUS_01260 136902 138446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01260 138446 138847 gene locus_tag LOCUS_01270 138446 138847 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_01270 139092 139418 gene locus_tag LOCUS_01280 139092 139418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 139701 141017 gene locus_tag LOCUS_01290 139701 141017 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_01290 143403 141007 gene locus_tag LOCUS_01300 143403 141007 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108984.1 protein_id gnl|my_center|LOCUS_01300 143685 145901 gene locus_tag LOCUS_01310 143685 145901 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_01310 146360 145953 gene locus_tag LOCUS_01320 146360 145953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 146575 147051 gene locus_tag LOCUS_01330 gene greA 146575 147051 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_01330 147056 147445 gene locus_tag LOCUS_01340 147056 147445 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_01340 147795 147442 gene locus_tag LOCUS_01350 147795 147442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 148415 147828 gene locus_tag LOCUS_01360 148415 147828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540486.1 protein_id gnl|my_center|LOCUS_01360 149569 148412 gene locus_tag LOCUS_01370 gene porY 149569 148412 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_01370 149776 150672 gene locus_tag LOCUS_01380 149776 150672 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_01380 150691 151068 gene locus_tag LOCUS_01390 150691 151068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_01390 151506 151967 gene locus_tag LOCUS_01400 151506 151967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 152534 151950 gene locus_tag LOCUS_01410 gene tag 152534 151950 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_01410 152628 153266 gene locus_tag LOCUS_01420 152628 153266 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_01420 153978 153244 gene locus_tag LOCUS_01430 153978 153244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 154753 154040 gene locus_tag LOCUS_01440 gene truB 154753 154040 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_01440 155573 154776 gene locus_tag LOCUS_01450 gene uppP 155573 154776 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_01450 155859 155584 gene locus_tag LOCUS_01460 gene fjo13 155859 155584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_01460 156785 155907 gene locus_tag LOCUS_01470 gene ftsX 156785 155907 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_01470 156926 157882 gene locus_tag LOCUS_01480 156926 157882 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJS5 protein_id gnl|my_center|LOCUS_01480 158072 161092 gene locus_tag LOCUS_01490 gene leuS 158072 161092 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H244 protein_id gnl|my_center|LOCUS_01490 161306 162001 gene locus_tag LOCUS_01500 161306 162001 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_01500 162086 162271 gene locus_tag LOCUS_01510 162086 162271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 162259 162558 gene locus_tag LOCUS_01520 162259 162558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 163920 162613 gene locus_tag LOCUS_01530 gene tyrS 163920 162613 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 protein_id gnl|my_center|LOCUS_01530 164097 165134 gene locus_tag LOCUS_01540 164097 165134 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_01540 165599 165114 gene locus_tag LOCUS_01550 165599 165114 CDS product lipoprotein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962340.1 protein_id gnl|my_center|LOCUS_01550 166936 165596 gene locus_tag LOCUS_01560 gene pyrC1 166936 165596 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_01560 167669 166938 gene locus_tag LOCUS_01570 167669 166938 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_01570 167778 168437 gene locus_tag LOCUS_01580 167778 168437 CDS product DUF4271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962358.1 protein_id gnl|my_center|LOCUS_01580 168474 169226 gene locus_tag LOCUS_01590 168474 169226 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_01590 170906 169296 gene locus_tag LOCUS_01600 gene pckA 170906 169296 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816Q7 protein_id gnl|my_center|LOCUS_01600 171364 170978 gene locus_tag LOCUS_01610 171364 170978 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_01610 171427 172791 gene locus_tag LOCUS_01620 171427 172791 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_01620 172881 173351 gene locus_tag LOCUS_01630 172881 173351 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_01630 173359 174321 gene locus_tag LOCUS_01640 173359 174321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679309.1 protein_id gnl|my_center|LOCUS_01640 175424 174447 gene locus_tag LOCUS_01650 175424 174447 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_01650 175585 176268 gene locus_tag LOCUS_01660 gene phoP 175585 176268 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_01660 176268 177353 gene locus_tag LOCUS_01670 gene phoR 176268 177353 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_01670 178679 179353 gene locus_tag LOCUS_01680 gene trmB 178679 179353 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_01680 179435 179992 gene locus_tag LOCUS_01690 179435 179992 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962540.1 protein_id gnl|my_center|LOCUS_01690 179979 180338 gene locus_tag LOCUS_01700 gene ogt2 179979 180338 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_01700 180474 181610 gene locus_tag LOCUS_01710 gene mrp 180474 181610 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 protein_id gnl|my_center|LOCUS_01710 181614 181859 gene locus_tag LOCUS_01720 181614 181859 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_01720 182108 182989 gene locus_tag LOCUS_01730 182108 182989 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_01730 183073 183393 gene locus_tag LOCUS_01740 183073 183393 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_01740 184328 183600 gene locus_tag LOCUS_01750 184328 183600 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_01750 185231 184335 gene locus_tag LOCUS_01760 185231 184335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 186095 185319 gene locus_tag LOCUS_01770 186095 185319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_01770 187354 186176 gene locus_tag LOCUS_01780 gene gcdH 187354 186176 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_01780 188162 187494 gene locus_tag LOCUS_01790 188162 187494 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI6 protein_id gnl|my_center|LOCUS_01790 188492 188223 gene locus_tag LOCUS_01800 188492 188223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 189062 188538 gene locus_tag LOCUS_01810 gene rimM 189062 188538 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_01810 189616 189074 gene locus_tag LOCUS_01820 gene rpsP 189616 189074 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI4 protein_id gnl|my_center|LOCUS_01820 189831 190634 gene locus_tag LOCUS_01830 189831 190634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 192181 190631 gene locus_tag LOCUS_01840 192181 190631 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073265.1 protein_id gnl|my_center|LOCUS_01840 192487 192185 gene locus_tag LOCUS_01850 192487 192185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 193495 192776 gene locus_tag LOCUS_01860 193495 192776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 195931 193505 gene locus_tag LOCUS_01870 195931 193505 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_01870 196266 197180 gene locus_tag LOCUS_01880 196266 197180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 197275 198063 gene locus_tag LOCUS_01890 197275 198063 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 protein_id gnl|my_center|LOCUS_01890 200484 198112 gene locus_tag LOCUS_01900 200484 198112 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404072.1 protein_id gnl|my_center|LOCUS_01900 200695 201306 gene locus_tag LOCUS_01910 200695 201306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 202280 201513 gene locus_tag LOCUS_01920 202280 201513 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_01920 204076 202433 gene locus_tag LOCUS_01930 204076 202433 CDS product N-acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109363.1 protein_id gnl|my_center|LOCUS_01930 204986 204081 gene locus_tag LOCUS_01940 204986 204081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 207274 204998 gene locus_tag LOCUS_01950 207274 204998 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_01950 208079 207303 gene locus_tag LOCUS_01960 208079 207303 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_01960 209340 208081 gene locus_tag LOCUS_01970 209340 208081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 protein_id gnl|my_center|LOCUS_01970 210778 209474 gene locus_tag LOCUS_01980 210778 209474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 protein_id gnl|my_center|LOCUS_01980 212284 210863 gene locus_tag LOCUS_01990 212284 210863 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_01990 215407 212297 gene locus_tag LOCUS_02000 215407 212297 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_02000 218381 215634 gene locus_tag LOCUS_02010 218381 215634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_02010 219687 218560 gene locus_tag LOCUS_02020 219687 218560 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969697.1 protein_id gnl|my_center|LOCUS_02020 220166 220885 gene locus_tag LOCUS_02030 220166 220885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 222105 220882 gene locus_tag LOCUS_02040 222105 220882 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_02040 223411 222098 gene locus_tag LOCUS_02050 223411 222098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 223658 224512 gene locus_tag LOCUS_02060 223658 224512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 224505 225488 gene locus_tag LOCUS_02070 224505 225488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203251.1 protein_id gnl|my_center|LOCUS_02070 225590 225922 gene locus_tag LOCUS_02080 225590 225922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 225941 226954 gene locus_tag LOCUS_02090 225941 226954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 226954 227685 gene locus_tag LOCUS_02100 226954 227685 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_02100 228337 227687 gene locus_tag LOCUS_02110 228337 227687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 229198 228437 gene locus_tag LOCUS_02120 229198 228437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 229978 229292 gene locus_tag LOCUS_02130 229978 229292 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_02130 231153 229975 gene locus_tag LOCUS_02140 231153 229975 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769569.1 protein_id gnl|my_center|LOCUS_02140 231314 232138 gene locus_tag LOCUS_02150 gene glpQ 231314 232138 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_02150 232141 232506 gene locus_tag LOCUS_02160 232141 232506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 232568 233002 gene locus_tag LOCUS_02170 232568 233002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 233149 235362 gene locus_tag LOCUS_02180 gene nicT 233149 235362 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_02180 235950 235534 gene locus_tag LOCUS_02190 235950 235534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 236010 236843 gene locus_tag LOCUS_02200 236010 236843 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_02200 236954 237835 gene locus_tag LOCUS_02210 236954 237835 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122415.1 protein_id gnl|my_center|LOCUS_02210 238245 239438 gene locus_tag LOCUS_02220 238245 239438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_02220 240355 239972 gene locus_tag LOCUS_02230 240355 239972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817730.1 protein_id gnl|my_center|LOCUS_02230 241127 240333 gene locus_tag LOCUS_02240 241127 240333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766739.1 protein_id gnl|my_center|LOCUS_02240 241906 243258 gene locus_tag LOCUS_02250 241906 243258 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 protein_id gnl|my_center|LOCUS_02250 244368 245954 gene locus_tag LOCUS_02260 244368 245954 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227184.1 protein_id gnl|my_center|LOCUS_02260 246386 247777 gene locus_tag LOCUS_02270 246386 247777 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119342.1 protein_id gnl|my_center|LOCUS_02270 248604 249179 gene locus_tag LOCUS_02280 248604 249179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 249357 249560 gene locus_tag LOCUS_02290 249357 249560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 249561 250766 gene locus_tag LOCUS_02300 249561 250766 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YH8 protein_id gnl|my_center|LOCUS_02300 250766 253138 gene locus_tag LOCUS_02310 250766 253138 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816115.1 protein_id gnl|my_center|LOCUS_02310 253135 254040 gene locus_tag LOCUS_02320 253135 254040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 255793 254558 gene locus_tag LOCUS_02330 255793 254558 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957917.1 protein_id gnl|my_center|LOCUS_02330 256795 256076 gene locus_tag LOCUS_02340 gene msrA 256795 256076 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJL3 protein_id gnl|my_center|LOCUS_02340 258111 257620 gene locus_tag LOCUS_02350 258111 257620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 259580 258435 gene locus_tag LOCUS_02360 259580 258435 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N14 protein_id gnl|my_center|LOCUS_02360 260679 259612 gene locus_tag LOCUS_02370 260679 259612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730860.1 protein_id gnl|my_center|LOCUS_02370 261737 260706 gene locus_tag LOCUS_02380 261737 260706 CDS product glycosyl hydrolase family 43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784057.1 protein_id gnl|my_center|LOCUS_02380 262012 262296 gene locus_tag LOCUS_02390 262012 262296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 262401 263765 gene locus_tag LOCUS_02400 gene hemN 262401 263765 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_02400 265037 264330 gene locus_tag LOCUS_02410 265037 264330 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_02410 265487 265041 gene locus_tag LOCUS_02420 gene ccoH 265487 265041 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_02420 265675 265529 gene locus_tag LOCUS_02430 265675 265529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 267105 265684 gene locus_tag LOCUS_02440 gene ccoG 267105 265684 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_02440 268092 267109 gene locus_tag LOCUS_02450 gene ccoP 268092 267109 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_02450 270484 268280 gene locus_tag LOCUS_02460 gene ccoN/ccoO 270484 268280 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_02460 270705 270487 gene locus_tag LOCUS_02470 gene ccoS 270705 270487 CDS product cytochrome oxidase maturation protein Cbb3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963292.1 protein_id gnl|my_center|LOCUS_02470 273198 270766 gene locus_tag LOCUS_02480 gene ccoI 273198 270766 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_02480 273302 274003 gene locus_tag LOCUS_02490 273302 274003 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_02490 275079 274000 gene locus_tag LOCUS_02500 275079 274000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 275714 278746 gene locus_tag LOCUS_02510 gene susC 275714 278746 CDS product TonB-dependent receptor SusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G1 protein_id gnl|my_center|LOCUS_02510 278767 280575 gene locus_tag LOCUS_02520 278767 280575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 280646 281770 gene locus_tag LOCUS_02530 280646 281770 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_02530 281775 283532 gene locus_tag LOCUS_02540 281775 283532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 285433 283592 gene locus_tag LOCUS_02550 285433 283592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 285797 288202 gene locus_tag LOCUS_02560 285797 288202 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 protein_id gnl|my_center|LOCUS_02560 288222 289580 gene locus_tag LOCUS_02570 288222 289580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 291116 289776 gene locus_tag LOCUS_02580 291116 289776 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_02580 292452 291106 gene locus_tag LOCUS_02590 292452 291106 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794226.1 protein_id gnl|my_center|LOCUS_02590 292658 293911 gene locus_tag LOCUS_02600 292658 293911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_02600 293967 294671 gene locus_tag LOCUS_02610 293967 294671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_02610 294868 297177 gene locus_tag LOCUS_02620 294868 297177 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_02620 297206 299677 gene locus_tag LOCUS_02630 297206 299677 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_02630 299700 302126 gene locus_tag LOCUS_02640 299700 302126 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_02640 302152 304572 gene locus_tag LOCUS_02650 302152 304572 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800665.1 protein_id gnl|my_center|LOCUS_02650 304603 305271 gene locus_tag LOCUS_02660 304603 305271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768705.1 protein_id gnl|my_center|LOCUS_02660 305357 306778 gene locus_tag LOCUS_02670 305357 306778 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_02670 306852 307751 gene locus_tag LOCUS_02680 306852 307751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811178.1 protein_id gnl|my_center|LOCUS_02680 307839 309773 gene locus_tag LOCUS_02690 307839 309773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 309786 310451 gene locus_tag LOCUS_02700 309786 310451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 310974 312770 gene locus_tag LOCUS_02710 310974 312770 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310162.1 protein_id gnl|my_center|LOCUS_02710 313036 313872 gene locus_tag LOCUS_02720 313036 313872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962948.1 protein_id gnl|my_center|LOCUS_02720 314242 315057 gene locus_tag LOCUS_02730 314242 315057 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990036.1 protein_id gnl|my_center|LOCUS_02730 315133 315627 gene locus_tag LOCUS_02740 315133 315627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 316221 316415 gene locus_tag LOCUS_02750 316221 316415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 317165 317509 gene locus_tag LOCUS_02760 317165 317509 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_02760 317588 317968 gene locus_tag LOCUS_02770 317588 317968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 317981 318178 gene locus_tag LOCUS_02780 317981 318178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 318609 318989 gene locus_tag LOCUS_02790 318609 318989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 319000 320031 gene locus_tag LOCUS_02800 319000 320031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 320037 321617 gene locus_tag LOCUS_02810 320037 321617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 321739 323766 gene locus_tag LOCUS_02820 321739 323766 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545530.1 protein_id gnl|my_center|LOCUS_02820 323763 326336 gene locus_tag LOCUS_02830 323763 326336 CDS product type III restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545345.1 protein_id gnl|my_center|LOCUS_02830 326349 327194 gene locus_tag LOCUS_02840 326349 327194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 327255 329000 gene locus_tag LOCUS_02850 327255 329000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853121.1 protein_id gnl|my_center|LOCUS_02850 329037 330407 gene locus_tag LOCUS_02860 329037 330407 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022107.1 protein_id gnl|my_center|LOCUS_02860 330787 330416 gene locus_tag LOCUS_02870 330787 330416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 331627 330794 gene locus_tag LOCUS_02880 331627 330794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 >Feature sequence02 1597 845 gene locus_tag LOCUS_02890 gene sufC 1597 845 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_02890 3097 1652 gene locus_tag LOCUS_02900 gene sufB 3097 1652 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_02900 3472 3143 gene locus_tag LOCUS_02910 gene sufA 3472 3143 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_02910 3737 4792 gene locus_tag LOCUS_02920 gene thiL 3737 4792 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_02920 5044 4799 gene locus_tag LOCUS_02930 5044 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 6009 5242 gene locus_tag LOCUS_02940 6009 5242 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_02940 6200 6006 gene locus_tag LOCUS_02950 6200 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 6121 7338 gene locus_tag LOCUS_02960 6121 7338 CDS product branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459557.1 protein_id gnl|my_center|LOCUS_02960 7338 7490 gene locus_tag LOCUS_02970 7338 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 7526 8128 gene locus_tag LOCUS_02980 7526 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 8264 8596 gene locus_tag LOCUS_02990 8264 8596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962738.1 protein_id gnl|my_center|LOCUS_02990 8722 9111 gene locus_tag LOCUS_03000 8722 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 9118 9486 gene locus_tag LOCUS_03010 9118 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 9623 10429 gene locus_tag LOCUS_03020 9623 10429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962739.1 protein_id gnl|my_center|LOCUS_03020 10500 11534 gene locus_tag LOCUS_03030 10500 11534 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_03030 11590 12531 gene locus_tag LOCUS_03040 11590 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_03040 13212 12604 gene locus_tag LOCUS_03050 gene sodA 13212 12604 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54375 protein_id gnl|my_center|LOCUS_03050 13298 13930 gene locus_tag LOCUS_03060 13298 13930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040262.1 protein_id gnl|my_center|LOCUS_03060 16180 14063 gene locus_tag LOCUS_03070 16180 14063 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108749.1 protein_id gnl|my_center|LOCUS_03070 18041 16191 gene locus_tag LOCUS_03080 gene susA 18041 16191 CDS product neopullulanase SusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G0 protein_id gnl|my_center|LOCUS_03080 19568 18126 gene locus_tag LOCUS_03090 19568 18126 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250835.1 protein_id gnl|my_center|LOCUS_03090 20753 19611 gene locus_tag LOCUS_03100 20753 19611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 22398 20770 gene locus_tag LOCUS_03110 22398 20770 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403138.1 protein_id gnl|my_center|LOCUS_03110 25282 22403 gene locus_tag LOCUS_03120 25282 22403 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_03120 27331 25655 gene locus_tag LOCUS_03130 27331 25655 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108757.1 protein_id gnl|my_center|LOCUS_03130 27617 28831 gene locus_tag LOCUS_03140 27617 28831 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_03140 30795 28837 gene locus_tag LOCUS_03150 30795 28837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 31756 30779 gene locus_tag LOCUS_03160 31756 30779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 34248 31753 gene locus_tag LOCUS_03170 34248 31753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 34386 35723 gene locus_tag LOCUS_03180 34386 35723 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y26 protein_id gnl|my_center|LOCUS_03180 37001 35796 gene locus_tag LOCUS_03190 37001 35796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 38136 37081 gene locus_tag LOCUS_03200 38136 37081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 39699 38149 gene locus_tag LOCUS_03210 39699 38149 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_03210 42895 39713 gene locus_tag LOCUS_03220 42895 39713 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_03220 44161 43178 gene locus_tag LOCUS_03230 44161 43178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 45030 44158 gene locus_tag LOCUS_03240 45030 44158 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_03240 45236 46375 gene locus_tag LOCUS_03250 45236 46375 CDS product mannan endo-1,4-beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_03250 46376 48214 gene locus_tag LOCUS_03260 46376 48214 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_03260 48218 49420 gene locus_tag LOCUS_03270 48218 49420 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y28 protein_id gnl|my_center|LOCUS_03270 49413 50606 gene locus_tag LOCUS_03280 49413 50606 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y26 protein_id gnl|my_center|LOCUS_03280 50611 51852 gene locus_tag LOCUS_03290 50611 51852 CDS product mannan endo-1,4-beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796113.1 protein_id gnl|my_center|LOCUS_03290 51896 52717 gene locus_tag LOCUS_03300 51896 52717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03300 53227 54909 gene locus_tag LOCUS_03310 53227 54909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03310 54931 55449 gene locus_tag LOCUS_03320 54931 55449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03320 56829 55450 gene locus_tag LOCUS_03330 56829 55450 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122409.1 protein_id gnl|my_center|LOCUS_03330 57943 56843 gene locus_tag LOCUS_03340 57943 56843 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766053.1 protein_id gnl|my_center|LOCUS_03340 60485 58092 gene locus_tag LOCUS_03350 60485 58092 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_03350 61749 60556 gene locus_tag LOCUS_03360 gene galA 61749 60556 CDS product arabinogalactan endo-beta-1,4-galactanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB67 protein_id gnl|my_center|LOCUS_03360 62987 61830 gene locus_tag LOCUS_03370 62987 61830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 64611 63004 gene locus_tag LOCUS_03380 64611 63004 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_03380 67589 64617 gene locus_tag LOCUS_03390 67589 64617 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_03390 71747 67842 gene locus_tag LOCUS_03400 71747 67842 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_03400 72052 74661 gene locus_tag LOCUS_03410 72052 74661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 75533 75057 gene locus_tag LOCUS_03420 75533 75057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 75773 75603 gene locus_tag LOCUS_03430 75773 75603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 76439 75957 gene locus_tag LOCUS_03440 76439 75957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03440 76917 76618 gene locus_tag LOCUS_03450 76917 76618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 77875 77495 gene locus_tag LOCUS_03460 77875 77495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 78306 77968 gene locus_tag LOCUS_03470 78306 77968 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_03470 78492 78325 gene locus_tag LOCUS_03480 78492 78325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 78886 79125 gene locus_tag LOCUS_03490 78886 79125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 79783 79703 gene locus_tag LOCUS_t00010 79783 79703 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 79918 80859 gene locus_tag LOCUS_03500 gene prsA 79918 80859 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_03500 80886 81512 gene locus_tag LOCUS_03510 gene rplY 80886 81512 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 protein_id gnl|my_center|LOCUS_03510 81724 82344 gene locus_tag LOCUS_03520 gene pth 81724 82344 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_03520 82346 83281 gene locus_tag LOCUS_03530 gene ribF 82346 83281 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_03530 83274 84632 gene locus_tag LOCUS_03540 83274 84632 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_03540 84725 85993 gene locus_tag LOCUS_03550 gene serS 84725 85993 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_03550 86204 87988 gene locus_tag LOCUS_03560 86204 87988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_03560 88118 88444 gene locus_tag LOCUS_03570 88118 88444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_03570 88478 89335 gene locus_tag LOCUS_03580 gene rsmA 88478 89335 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_03580 89557 90909 gene locus_tag LOCUS_03590 gene mgtE 89557 90909 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_03590 90979 91386 gene locus_tag LOCUS_03600 90979 91386 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_03600 91407 92342 gene locus_tag LOCUS_03610 91407 92342 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_03610 92429 93031 gene locus_tag LOCUS_03620 92429 93031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 93038 93439 gene locus_tag LOCUS_03630 93038 93439 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_03630 93458 93949 gene locus_tag LOCUS_03640 93458 93949 CDS product phosphinothricin N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990112.1 protein_id gnl|my_center|LOCUS_03640 95771 93936 gene locus_tag LOCUS_03650 95771 93936 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_03650 97158 95905 gene locus_tag LOCUS_03660 gene lysC 97158 95905 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_03660 97656 97168 gene locus_tag LOCUS_03670 97656 97168 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_03670 98197 97769 gene locus_tag LOCUS_03680 98197 97769 CDS product fructose 1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962635.1 protein_id gnl|my_center|LOCUS_03680 98779 99564 gene locus_tag LOCUS_03690 98779 99564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 99561 101171 gene locus_tag LOCUS_03700 gene lig2 99561 101171 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_03700 101168 103636 gene locus_tag LOCUS_03710 101168 103636 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104887.1 protein_id gnl|my_center|LOCUS_03710 103776 104183 gene locus_tag LOCUS_03720 103776 104183 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948145.1 protein_id gnl|my_center|LOCUS_03720 104289 104924 gene locus_tag LOCUS_03730 104289 104924 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_03730 105031 105828 gene locus_tag LOCUS_03740 105031 105828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_03740 107170 105818 gene locus_tag LOCUS_03750 107170 105818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082551.1 protein_id gnl|my_center|LOCUS_03750 107323 110706 gene locus_tag LOCUS_03760 gene mfd 107323 110706 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_03760 111140 110784 gene locus_tag LOCUS_03770 111140 110784 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_03770 112049 111144 gene locus_tag LOCUS_03780 112049 111144 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_03780 112683 112057 gene locus_tag LOCUS_03790 112683 112057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 112787 114868 gene locus_tag LOCUS_03800 gene metG 112787 114868 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_03800 114944 117079 gene locus_tag LOCUS_03810 114944 117079 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964572.1 protein_id gnl|my_center|LOCUS_03810 117072 117974 gene locus_tag LOCUS_03820 117072 117974 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404794.1 protein_id gnl|my_center|LOCUS_03820 118093 118632 gene locus_tag LOCUS_03830 118093 118632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 118768 119025 gene locus_tag LOCUS_03840 118768 119025 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_03840 119050 120822 gene locus_tag LOCUS_03850 119050 120822 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_03850 120948 122858 gene locus_tag LOCUS_03860 gene acsA 120948 122858 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_03860 123261 122929 gene locus_tag LOCUS_03870 123261 122929 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_03870 123498 124877 gene locus_tag LOCUS_03880 123498 124877 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021945.1 protein_id gnl|my_center|LOCUS_03880 125285 126559 gene locus_tag LOCUS_03890 125285 126559 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402917.1 protein_id gnl|my_center|LOCUS_03890 126564 128357 gene locus_tag LOCUS_03900 126564 128357 CDS product ribonucleoside-diphosphate reductase, alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229097.1 protein_id gnl|my_center|LOCUS_03900 128485 129009 gene locus_tag LOCUS_03910 128485 129009 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 protein_id gnl|my_center|LOCUS_03910 129029 129376 gene locus_tag LOCUS_03920 129029 129376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_03920 129839 129378 gene locus_tag LOCUS_03930 129839 129378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 129979 132285 gene locus_tag LOCUS_03940 129979 132285 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228011.1 protein_id gnl|my_center|LOCUS_03940 132311 133111 gene locus_tag LOCUS_03950 gene yeeZ 132311 133111 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962265.1 protein_id gnl|my_center|LOCUS_03950 134553 133228 gene locus_tag LOCUS_03960 134553 133228 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 protein_id gnl|my_center|LOCUS_03960 134654 135295 gene locus_tag LOCUS_03970 134654 135295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 137415 135349 gene locus_tag LOCUS_03980 gene pepO 137415 135349 CDS product endothelin-converting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962266.1 protein_id gnl|my_center|LOCUS_03980 137943 137443 gene locus_tag LOCUS_03990 137943 137443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_03990 138551 137949 gene locus_tag LOCUS_04000 138551 137949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 138983 138630 gene locus_tag LOCUS_04010 138983 138630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 139854 139255 gene locus_tag LOCUS_04020 139854 139255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 139967 140371 gene locus_tag LOCUS_04030 139967 140371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 140687 143782 gene locus_tag LOCUS_04040 140687 143782 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_04040 143796 145259 gene locus_tag LOCUS_04050 143796 145259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_04050 145803 145444 gene locus_tag LOCUS_04060 145803 145444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962526.1 protein_id gnl|my_center|LOCUS_04060 146079 148322 gene locus_tag LOCUS_04070 146079 148322 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A666 protein_id gnl|my_center|LOCUS_04070 149736 148384 gene locus_tag LOCUS_04080 149736 148384 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_04080 150489 149812 gene locus_tag LOCUS_04090 150489 149812 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_04090 151259 150486 gene locus_tag LOCUS_04100 gene plsC 151259 150486 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_04100 151411 151773 gene locus_tag LOCUS_04110 151411 151773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 152466 151774 gene locus_tag LOCUS_04120 gene yjbF 152466 151774 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131406.1 protein_id gnl|my_center|LOCUS_04120 152668 152471 gene locus_tag LOCUS_04130 152668 152471 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_04130 153054 152665 gene locus_tag LOCUS_04140 153054 152665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 153269 154342 gene locus_tag LOCUS_04150 gene glxK 153269 154342 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209537.1 protein_id gnl|my_center|LOCUS_04150 154345 155682 gene locus_tag LOCUS_04160 154345 155682 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052704.1 protein_id gnl|my_center|LOCUS_04160 155833 155759 gene locus_tag LOCUS_t00020 155833 155759 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 157346 156012 gene locus_tag LOCUS_04170 157346 156012 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_04170 157615 158295 gene locus_tag LOCUS_04180 157615 158295 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_04180 158373 158714 gene locus_tag LOCUS_04190 158373 158714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 158707 160809 gene locus_tag LOCUS_04200 gene feoB 158707 160809 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_04200 161388 160957 gene locus_tag LOCUS_04210 161388 160957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 162257 161436 gene locus_tag LOCUS_04220 162257 161436 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_04220 164149 162269 gene locus_tag LOCUS_04230 gene mntH 164149 162269 CDS product divalent metal cation transporter MntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVS3 protein_id gnl|my_center|LOCUS_04230 164818 164168 gene locus_tag LOCUS_04240 gene sirR 164818 164168 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_04240 164908 167262 gene locus_tag LOCUS_04250 164908 167262 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_04250 167263 167763 gene locus_tag LOCUS_04260 167263 167763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 167806 168954 gene locus_tag LOCUS_04270 gene crtY 167806 168954 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_04270 169021 169950 gene locus_tag LOCUS_04280 169021 169950 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_04280 170041 170832 gene locus_tag LOCUS_04290 170041 170832 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_04290 172243 170888 gene locus_tag LOCUS_04300 172243 170888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 173492 172347 gene locus_tag LOCUS_04310 173492 172347 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_04310 177834 173503 gene locus_tag LOCUS_04320 177834 173503 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_04320 178299 177931 gene locus_tag LOCUS_04330 178299 177931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 182445 178438 gene locus_tag LOCUS_04340 182445 178438 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963617.1 protein_id gnl|my_center|LOCUS_04340 183486 182737 gene locus_tag LOCUS_04350 183486 182737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 183898 184308 gene locus_tag LOCUS_04360 gene yqiW 183898 184308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_04360 184522 186312 gene locus_tag LOCUS_04370 184522 186312 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 protein_id gnl|my_center|LOCUS_04370 186486 186758 gene locus_tag LOCUS_04380 186486 186758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 186847 187038 gene locus_tag LOCUS_04390 186847 187038 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_04390 187291 188067 gene locus_tag LOCUS_04400 187291 188067 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022231.1 protein_id gnl|my_center|LOCUS_04400 189664 188048 gene locus_tag LOCUS_04410 189664 188048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_04410 190312 189752 gene locus_tag LOCUS_04420 190312 189752 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_04420 190483 191364 gene locus_tag LOCUS_04430 190483 191364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962608.1 protein_id gnl|my_center|LOCUS_04430 191519 193054 gene locus_tag LOCUS_04440 gene glyS 191519 193054 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2A9 protein_id gnl|my_center|LOCUS_04440 193204 196218 gene locus_tag LOCUS_04450 193204 196218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 199650 196231 gene locus_tag LOCUS_04460 199650 196231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_04460 199771 200538 gene locus_tag LOCUS_04470 gene xth 199771 200538 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_04470 200619 201578 gene locus_tag LOCUS_04480 200619 201578 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_04480 201791 202264 gene locus_tag LOCUS_04490 201791 202264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 202364 203398 gene locus_tag LOCUS_04500 202364 203398 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930118.1 protein_id gnl|my_center|LOCUS_04500 204166 203468 gene locus_tag LOCUS_04510 204166 203468 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H8 protein_id gnl|my_center|LOCUS_04510 204489 204199 gene locus_tag LOCUS_04520 204489 204199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 205412 204489 gene locus_tag LOCUS_04530 205412 204489 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107998.1 protein_id gnl|my_center|LOCUS_04530 206255 205563 gene locus_tag LOCUS_04540 206255 205563 CDS product divalent heavy-metal cations transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775812.1 protein_id gnl|my_center|LOCUS_04540 206985 206260 gene locus_tag LOCUS_04550 gene mip 206985 206260 CDS product outer membrane protein MIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXE0 protein_id gnl|my_center|LOCUS_04550 208435 207071 gene locus_tag LOCUS_04560 gene gcdH 208435 207071 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228249.1 protein_id gnl|my_center|LOCUS_04560 209647 208505 gene locus_tag LOCUS_04570 209647 208505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 210764 209688 gene locus_tag LOCUS_04580 210764 209688 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958153.1 protein_id gnl|my_center|LOCUS_04580 210901 211608 gene locus_tag LOCUS_04590 210901 211608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 211605 211910 gene locus_tag LOCUS_04600 211605 211910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 211907 212518 gene locus_tag LOCUS_04610 211907 212518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 213303 212521 gene locus_tag LOCUS_04620 gene crt 213303 212521 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_04620 214797 213334 gene locus_tag LOCUS_04630 214797 213334 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_04630 215375 214827 gene locus_tag LOCUS_04640 215375 214827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_04640 218531 215469 gene locus_tag LOCUS_04650 218531 215469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 220091 218733 gene locus_tag LOCUS_04660 220091 218733 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_04660 221230 220190 gene locus_tag LOCUS_04670 gene hemH 221230 220190 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_04670 222059 221331 gene locus_tag LOCUS_04680 222059 221331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 222949 222062 gene locus_tag LOCUS_04690 222949 222062 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_04690 223141 224406 gene locus_tag LOCUS_04700 gene hemA 223141 224406 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 protein_id gnl|my_center|LOCUS_04700 224410 225327 gene locus_tag LOCUS_04710 gene hemC 224410 225327 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP0 protein_id gnl|my_center|LOCUS_04710 225377 226429 gene locus_tag LOCUS_04720 225377 226429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 226463 227494 gene locus_tag LOCUS_04730 gene hemE 226463 227494 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 protein_id gnl|my_center|LOCUS_04730 227491 227979 gene locus_tag LOCUS_04740 227491 227979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 227979 228722 gene locus_tag LOCUS_04750 227979 228722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 228715 229245 gene locus_tag LOCUS_04760 228715 229245 CDS product ribosomal-protein-amino-adic N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962220.1 protein_id gnl|my_center|LOCUS_04760 229249 230151 gene locus_tag LOCUS_04770 gene hemF 229249 230151 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_04770 230173 231468 gene locus_tag LOCUS_04780 230173 231468 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727955.1 protein_id gnl|my_center|LOCUS_04780 231468 232679 gene locus_tag LOCUS_04790 231468 232679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 234995 232704 gene locus_tag LOCUS_04800 234995 232704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406189.1 protein_id gnl|my_center|LOCUS_04800 235391 236380 gene locus_tag LOCUS_04810 gene hemB 235391 236380 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN2 protein_id gnl|my_center|LOCUS_04810 236384 236893 gene locus_tag LOCUS_04820 236384 236893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 236997 238103 gene locus_tag LOCUS_04830 236997 238103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_04830 238171 238644 gene locus_tag LOCUS_04840 gene ogt1 238171 238644 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN0 protein_id gnl|my_center|LOCUS_04840 238699 239412 gene locus_tag LOCUS_04850 238699 239412 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_04850 239443 241134 gene locus_tag LOCUS_04860 gene gsiA 239443 241134 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_04860 242251 241595 gene locus_tag LOCUS_04870 gene atoA 242251 241595 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_04870 242891 242253 gene locus_tag LOCUS_04880 242891 242253 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186345.1 protein_id gnl|my_center|LOCUS_04880 243631 242933 gene locus_tag LOCUS_04890 gene atoD 243631 242933 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_04890 246086 243750 gene locus_tag LOCUS_04900 gene mrcA 246086 243750 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_04900 246573 246073 gene locus_tag LOCUS_04910 gene gldH 246573 246073 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_04910 247738 246566 gene locus_tag LOCUS_04920 gene fjo17 247738 246566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_04920 248056 249132 gene locus_tag LOCUS_04930 248056 249132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 250238 249201 gene locus_tag LOCUS_04940 gene yceA 250238 249201 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL9 protein_id gnl|my_center|LOCUS_04940 250839 251876 gene locus_tag LOCUS_04950 gene recA 250839 251876 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_04950 251950 252363 gene locus_tag LOCUS_04960 251950 252363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 252394 252942 gene locus_tag LOCUS_04970 252394 252942 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_04970 252939 254384 gene locus_tag LOCUS_04980 252939 254384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 255255 254509 gene locus_tag LOCUS_04990 255255 254509 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_04990 255376 256344 gene locus_tag LOCUS_05000 gene trpS 255376 256344 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_05000 257441 256341 gene locus_tag LOCUS_05010 gene smf 257441 256341 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_05010 257537 258466 gene locus_tag LOCUS_05020 257537 258466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 protein_id gnl|my_center|LOCUS_05020 258568 259077 gene locus_tag LOCUS_05030 258568 259077 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_05030 260557 259136 gene locus_tag LOCUS_05040 260557 259136 CDS product glutamate carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860725.1 protein_id gnl|my_center|LOCUS_05040 261957 260707 gene locus_tag LOCUS_05050 261957 260707 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_05050 262724 261957 gene locus_tag LOCUS_05060 262724 261957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 protein_id gnl|my_center|LOCUS_05060 264072 262726 gene locus_tag LOCUS_05070 264072 262726 CDS product cytochrome c biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964529.1 protein_id gnl|my_center|LOCUS_05070 265074 264082 gene locus_tag LOCUS_05080 265074 264082 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_05080 265634 265200 gene locus_tag LOCUS_05090 gene dut 265634 265200 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_05090 267091 265658 gene locus_tag LOCUS_05100 267091 265658 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_05100 267596 267159 gene locus_tag LOCUS_05110 267596 267159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 268609 267734 gene locus_tag LOCUS_05120 gene atpG 268609 267734 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_05120 270219 268639 gene locus_tag LOCUS_05130 gene atpA 270219 268639 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_05130 270809 270270 gene locus_tag LOCUS_05140 gene atpH 270809 270270 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_05140 271325 270825 gene locus_tag LOCUS_05150 gene atpF 271325 270825 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_05150 271590 271402 gene locus_tag LOCUS_05160 271590 271402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 272744 271608 gene locus_tag LOCUS_05170 gene atpB 272744 271608 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence03 400 209 gene locus_tag LOCUS_05180 400 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 989 381 gene locus_tag LOCUS_05190 989 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390793.1 protein_id gnl|my_center|LOCUS_05190 1709 993 gene locus_tag LOCUS_05200 1709 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390792.1 protein_id gnl|my_center|LOCUS_05200 5298 1936 gene locus_tag LOCUS_05210 gene secA 5298 1936 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_05210 5757 5536 gene locus_tag LOCUS_05220 5757 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_05220 6480 5908 gene locus_tag LOCUS_05230 6480 5908 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_05230 6719 6525 gene locus_tag LOCUS_05240 6719 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 7786 6752 gene locus_tag LOCUS_05250 7786 6752 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_05250 8396 7773 gene locus_tag LOCUS_05260 8396 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 8649 9623 gene locus_tag LOCUS_05270 gene ddl 8649 9623 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD5 protein_id gnl|my_center|LOCUS_05270 9676 10128 gene locus_tag LOCUS_05280 gene coaD 9676 10128 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_05280 10152 10940 gene locus_tag LOCUS_05290 10152 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 11002 11748 gene locus_tag LOCUS_05300 11002 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 13847 11769 gene locus_tag LOCUS_05310 13847 11769 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_05310 15326 14055 gene locus_tag LOCUS_05320 15326 14055 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_05320 15668 17212 gene locus_tag LOCUS_05330 15668 17212 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_05330 17416 17288 gene locus_tag LOCUS_05340 17416 17288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 18265 17501 gene locus_tag LOCUS_05350 gene trpA 18265 17501 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_05350 18785 18492 gene locus_tag LOCUS_05360 18785 18492 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090833.1 protein_id gnl|my_center|LOCUS_05360 20033 18849 gene locus_tag LOCUS_05370 gene trpB 20033 18849 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_05370 20712 20074 gene locus_tag LOCUS_05380 gene trpF 20712 20074 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_05380 21782 21000 gene locus_tag LOCUS_05390 gene trpC 21782 21000 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_05390 22779 21784 gene locus_tag LOCUS_05400 gene trpD 22779 21784 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_05400 22824 22927 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agatttccgtcttcacggaa 23513 22941 gene locus_tag LOCUS_05410 gene pabA 23513 22941 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_05410 24912 23515 gene locus_tag LOCUS_05420 gene trpE 24912 23515 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_05420 26043 25474 gene locus_tag LOCUS_05430 26043 25474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 26724 26092 gene locus_tag LOCUS_05440 26724 26092 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_05440 27175 26717 gene locus_tag LOCUS_05450 27175 26717 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_05450 27363 27914 gene locus_tag LOCUS_05460 27363 27914 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016011.1 protein_id gnl|my_center|LOCUS_05460 27928 28548 gene locus_tag LOCUS_05470 27928 28548 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408503.1 protein_id gnl|my_center|LOCUS_05470 28690 29010 gene locus_tag LOCUS_05480 28690 29010 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_05480 29354 30799 gene locus_tag LOCUS_05490 29354 30799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 31088 31567 gene locus_tag LOCUS_05500 31088 31567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 31693 33069 gene locus_tag LOCUS_05510 31693 33069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403008.1 protein_id gnl|my_center|LOCUS_05510 33206 34621 gene locus_tag LOCUS_05520 gene ugd 33206 34621 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_05520 34756 35517 gene locus_tag LOCUS_05530 gene rfbA 34756 35517 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C714 protein_id gnl|my_center|LOCUS_05530 35514 36089 gene locus_tag LOCUS_05540 gene rfbC 35514 36089 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_05540 36086 36958 gene locus_tag LOCUS_05550 gene rmlD 36086 36958 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_05550 36955 37968 gene locus_tag LOCUS_05560 gene rfbB 36955 37968 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WK99 protein_id gnl|my_center|LOCUS_05560 38021 39133 gene locus_tag LOCUS_05570 gene gmd 38021 39133 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56872 protein_id gnl|my_center|LOCUS_05570 39151 40233 gene locus_tag LOCUS_05580 39151 40233 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797323.1 protein_id gnl|my_center|LOCUS_05580 40252 41382 gene locus_tag LOCUS_05590 gene fcl 40252 41382 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8E2 protein_id gnl|my_center|LOCUS_05590 41383 43167 gene locus_tag LOCUS_05600 gene yfbS 41383 43167 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261126.1 protein_id gnl|my_center|LOCUS_05600 43171 43770 gene locus_tag LOCUS_05610 gene cysC 43171 43770 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MT8 protein_id gnl|my_center|LOCUS_05610 43767 44672 gene locus_tag LOCUS_05620 gene cysD 43767 44672 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_05620 44691 45953 gene locus_tag LOCUS_05630 gene cysN 44691 45953 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_05630 46075 46869 gene locus_tag LOCUS_05640 46075 46869 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107256.1 protein_id gnl|my_center|LOCUS_05640 46873 47799 gene locus_tag LOCUS_05650 46873 47799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 47820 49088 gene locus_tag LOCUS_05660 47820 49088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 49089 49652 gene locus_tag LOCUS_05670 49089 49652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 49682 50629 gene locus_tag LOCUS_05680 49682 50629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 50647 51294 gene locus_tag LOCUS_05690 50647 51294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 51319 52440 gene locus_tag LOCUS_05700 51319 52440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 52444 53034 gene locus_tag LOCUS_05710 52444 53034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945848.1 protein_id gnl|my_center|LOCUS_05710 53034 54056 gene locus_tag LOCUS_05720 53034 54056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 54066 55061 gene locus_tag LOCUS_05730 54066 55061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 55058 56299 gene locus_tag LOCUS_05740 55058 56299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 56311 57612 gene locus_tag LOCUS_05750 56311 57612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 57621 58580 gene locus_tag LOCUS_05760 gene gmd 57621 58580 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51366 protein_id gnl|my_center|LOCUS_05760 58567 59586 gene locus_tag LOCUS_05770 58567 59586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 59579 60751 gene locus_tag LOCUS_05780 gene bme6 59579 60751 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 protein_id gnl|my_center|LOCUS_05780 60754 61332 gene locus_tag LOCUS_05790 gene bme4 60754 61332 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974186.1 protein_id gnl|my_center|LOCUS_05790 61325 62140 gene locus_tag LOCUS_05800 61325 62140 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946557.1 protein_id gnl|my_center|LOCUS_05800 62137 63075 gene locus_tag LOCUS_05810 62137 63075 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_05810 63082 63843 gene locus_tag LOCUS_05820 gene wbyL 63082 63843 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331386.1 protein_id gnl|my_center|LOCUS_05820 63987 63853 gene locus_tag LOCUS_05830 63987 63853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 63977 65224 gene locus_tag LOCUS_05840 gene wcaJ 63977 65224 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_05840 65251 66066 gene locus_tag LOCUS_05850 65251 66066 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_05850 66073 68436 gene locus_tag LOCUS_05860 66073 68436 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_05860 68831 69925 gene locus_tag LOCUS_05870 gene manC 68831 69925 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_05870 71386 72144 gene locus_tag LOCUS_05880 71386 72144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963660.1 protein_id gnl|my_center|LOCUS_05880 72146 72616 gene locus_tag LOCUS_05890 72146 72616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964411.1 protein_id gnl|my_center|LOCUS_05890 72546 72788 gene locus_tag LOCUS_05900 72546 72788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963662.1 protein_id gnl|my_center|LOCUS_05900 72778 72984 gene locus_tag LOCUS_05910 72778 72984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 73674 73868 gene locus_tag LOCUS_05920 73674 73868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 75135 73876 gene locus_tag LOCUS_05930 gene umuC 75135 73876 CDS product SOS mutagenesis and repair protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_05930 75559 75137 gene locus_tag LOCUS_05940 75559 75137 CDS product SOS-response transcriptional regulator UmuD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202621.1 protein_id gnl|my_center|LOCUS_05940 75726 75902 gene locus_tag LOCUS_05950 75726 75902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 75920 76648 gene locus_tag LOCUS_05960 75920 76648 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_05960 76782 77210 gene locus_tag LOCUS_05970 76782 77210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 77221 77454 gene locus_tag LOCUS_05980 77221 77454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 77801 77451 gene locus_tag LOCUS_05990 77801 77451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 78738 81728 gene locus_tag LOCUS_06000 78738 81728 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404908.1 protein_id gnl|my_center|LOCUS_06000 81808 83136 gene locus_tag LOCUS_06010 81808 83136 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_06010 83136 85727 gene locus_tag LOCUS_06020 83136 85727 CDS product acylaminoacyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405424.1 protein_id gnl|my_center|LOCUS_06020 86037 85765 gene locus_tag LOCUS_06030 86037 85765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 87619 86114 gene locus_tag LOCUS_06040 87619 86114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 88615 87701 gene locus_tag LOCUS_06050 88615 87701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 89018 88629 gene locus_tag LOCUS_06060 89018 88629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 89249 91654 gene locus_tag LOCUS_06070 89249 91654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 91749 92579 gene locus_tag LOCUS_06080 91749 92579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963653.1 protein_id gnl|my_center|LOCUS_06080 94238 92862 gene locus_tag LOCUS_06090 94238 92862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108853.1 protein_id gnl|my_center|LOCUS_06090 95365 94379 gene locus_tag LOCUS_06100 95365 94379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767682.1 protein_id gnl|my_center|LOCUS_06100 97432 95375 gene locus_tag LOCUS_06110 97432 95375 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767681.1 protein_id gnl|my_center|LOCUS_06110 100844 97443 gene locus_tag LOCUS_06120 100844 97443 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767673.1 protein_id gnl|my_center|LOCUS_06120 102166 101000 gene locus_tag LOCUS_06130 102166 101000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 102303 102878 gene locus_tag LOCUS_06140 102303 102878 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_06140 104124 102946 gene locus_tag LOCUS_06150 104124 102946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 105753 104266 gene locus_tag LOCUS_06160 105753 104266 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769373.1 protein_id gnl|my_center|LOCUS_06160 108880 105764 gene locus_tag LOCUS_06170 108880 105764 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_06170 109140 111872 gene locus_tag LOCUS_06180 109140 111872 CDS product glycosyl hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_06180 111898 113022 gene locus_tag LOCUS_06190 111898 113022 CDS product glycosyl hydrolase family 88 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109151.1 protein_id gnl|my_center|LOCUS_06190 113033 115999 gene locus_tag LOCUS_06200 113033 115999 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109155.1 protein_id gnl|my_center|LOCUS_06200 115986 116930 gene locus_tag LOCUS_06210 115986 116930 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122640.1 protein_id gnl|my_center|LOCUS_06210 117069 118019 gene locus_tag LOCUS_06220 117069 118019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 120353 118203 gene locus_tag LOCUS_06230 120353 118203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 124005 120358 gene locus_tag LOCUS_06240 124005 120358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 125804 124011 gene locus_tag LOCUS_06250 gene yesW 125804 124011 CDS product rhamnogalacturonan endolyase YesW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31526 protein_id gnl|my_center|LOCUS_06250 128406 125893 gene locus_tag LOCUS_06260 128406 125893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767247.1 protein_id gnl|my_center|LOCUS_06260 129880 128393 gene locus_tag LOCUS_06270 129880 128393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 131542 130115 gene locus_tag LOCUS_06280 131542 130115 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118019.1 protein_id gnl|my_center|LOCUS_06280 132696 131545 gene locus_tag LOCUS_06290 gene lldD 132696 131545 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 protein_id gnl|my_center|LOCUS_06290 134075 132702 gene locus_tag LOCUS_06300 134075 132702 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968718.1 protein_id gnl|my_center|LOCUS_06300 135373 134093 gene locus_tag LOCUS_06310 135373 134093 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973080.1 protein_id gnl|my_center|LOCUS_06310 137564 135468 gene locus_tag LOCUS_06320 137564 135468 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973081.1 protein_id gnl|my_center|LOCUS_06320 137714 138760 gene locus_tag LOCUS_06330 137714 138760 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766583.1 protein_id gnl|my_center|LOCUS_06330 138867 140150 gene locus_tag LOCUS_06340 138867 140150 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_06340 140169 143030 gene locus_tag LOCUS_06350 140169 143030 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A065 protein_id gnl|my_center|LOCUS_06350 143039 144550 gene locus_tag LOCUS_06360 143039 144550 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109150.1 protein_id gnl|my_center|LOCUS_06360 148568 144600 gene locus_tag LOCUS_06370 148568 144600 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_06370 148820 150628 gene locus_tag LOCUS_06380 148820 150628 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784059.1 protein_id gnl|my_center|LOCUS_06380 150744 152450 gene locus_tag LOCUS_06390 150744 152450 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767669.1 protein_id gnl|my_center|LOCUS_06390 152469 153299 gene locus_tag LOCUS_06400 152469 153299 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760470.1 protein_id gnl|my_center|LOCUS_06400 153522 154841 gene locus_tag LOCUS_06410 gene fucP 153522 154841 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44776 protein_id gnl|my_center|LOCUS_06410 154888 156936 gene locus_tag LOCUS_06420 154888 156936 CDS product alpha-1,2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108864.1 protein_id gnl|my_center|LOCUS_06420 157051 158427 gene locus_tag LOCUS_06430 157051 158427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_06430 158429 159766 gene locus_tag LOCUS_06440 158429 159766 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_06440 159773 160960 gene locus_tag LOCUS_06450 159773 160960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 161746 161033 gene locus_tag LOCUS_06460 161746 161033 CDS product transcriptional initiation protein Tat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405240.1 protein_id gnl|my_center|LOCUS_06460 163468 161750 gene locus_tag LOCUS_06470 163468 161750 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_06470 163729 165126 gene locus_tag LOCUS_06480 163729 165126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201944.1 protein_id gnl|my_center|LOCUS_06480 165194 167323 gene locus_tag LOCUS_06490 165194 167323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108651.1 protein_id gnl|my_center|LOCUS_06490 167338 168147 gene locus_tag LOCUS_06500 167338 168147 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_06500 168303 169430 gene locus_tag LOCUS_06510 168303 169430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 170153 169500 gene locus_tag LOCUS_06520 170153 169500 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_06520 172512 170197 gene locus_tag LOCUS_06530 172512 170197 CDS product sugar hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_06530 174824 172533 gene locus_tag LOCUS_06540 174824 172533 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762490.1 protein_id gnl|my_center|LOCUS_06540 177037 174866 gene locus_tag LOCUS_06550 177037 174866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784055.1 protein_id gnl|my_center|LOCUS_06550 178035 177064 gene locus_tag LOCUS_06560 178035 177064 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795630.1 protein_id gnl|my_center|LOCUS_06560 179686 178238 gene locus_tag LOCUS_06570 179686 178238 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_06570 181971 179698 gene locus_tag LOCUS_06580 181971 179698 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764319.1 protein_id gnl|my_center|LOCUS_06580 182875 182186 gene locus_tag LOCUS_06590 182875 182186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 184783 182894 gene locus_tag LOCUS_06600 184783 182894 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_06600 187884 184786 gene locus_tag LOCUS_06610 187884 184786 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291394.1 protein_id gnl|my_center|LOCUS_06610 191101 188597 gene locus_tag LOCUS_06620 191101 188597 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201943.1 protein_id gnl|my_center|LOCUS_06620 193086 191260 gene locus_tag LOCUS_06630 193086 191260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 193761 193099 gene locus_tag LOCUS_06640 193761 193099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 195625 193823 gene locus_tag LOCUS_06650 195625 193823 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109040.1 protein_id gnl|my_center|LOCUS_06650 198856 195680 gene locus_tag LOCUS_06660 198856 195680 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108857.1 protein_id gnl|my_center|LOCUS_06660 200392 199361 gene locus_tag LOCUS_06670 gene ccpA 200392 199361 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356351.1 protein_id gnl|my_center|LOCUS_06670 200745 201743 gene locus_tag LOCUS_06680 200745 201743 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103265.1 protein_id gnl|my_center|LOCUS_06680 203170 201746 gene locus_tag LOCUS_06690 203170 201746 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_06690 206929 203333 gene locus_tag LOCUS_06700 206929 203333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 207239 208024 gene locus_tag LOCUS_06710 207239 208024 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_06710 208331 208819 gene locus_tag LOCUS_06720 208331 208819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 208830 210101 gene locus_tag LOCUS_06730 208830 210101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 210163 210750 gene locus_tag LOCUS_06740 210163 210750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 211682 210819 gene locus_tag LOCUS_06750 211682 210819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 212208 211828 gene locus_tag LOCUS_06760 212208 211828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 212492 213367 gene locus_tag LOCUS_06770 212492 213367 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490863.1 protein_id gnl|my_center|LOCUS_06770 213465 214682 gene locus_tag LOCUS_06780 213465 214682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 215524 214679 gene locus_tag LOCUS_06790 215524 214679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 215724 216308 gene locus_tag LOCUS_06800 215724 216308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 216348 216974 gene locus_tag LOCUS_06810 216348 216974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 217814 217035 gene locus_tag LOCUS_06820 217814 217035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_06820 219596 218415 gene locus_tag LOCUS_06830 219596 218415 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962682.1 protein_id gnl|my_center|LOCUS_06830 220182 220973 gene locus_tag LOCUS_06840 220182 220973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 220970 222811 gene locus_tag LOCUS_06850 220970 222811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 223368 225005 gene locus_tag LOCUS_06860 223368 225005 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403855.1 protein_id gnl|my_center|LOCUS_06860 225008 227611 gene locus_tag LOCUS_06870 225008 227611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 227615 228892 gene locus_tag LOCUS_06880 227615 228892 CDS product type I restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691244.1 protein_id gnl|my_center|LOCUS_06880 228999 232001 gene locus_tag LOCUS_06890 228999 232001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403859.1 protein_id gnl|my_center|LOCUS_06890 232016 233206 gene locus_tag LOCUS_06900 232016 233206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 233206 233775 gene locus_tag LOCUS_06910 233206 233775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 233823 234740 gene locus_tag LOCUS_06920 233823 234740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 234823 235386 gene locus_tag LOCUS_06930 234823 235386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 236590 236372 gene locus_tag LOCUS_06940 236590 236372 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109410.1 protein_id gnl|my_center|LOCUS_06940 236753 238462 gene locus_tag LOCUS_06950 236753 238462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 240418 241362 gene locus_tag LOCUS_06960 240418 241362 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767372.1 protein_id gnl|my_center|LOCUS_06960 241398 242057 gene locus_tag LOCUS_06970 241398 242057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 242296 242054 gene locus_tag LOCUS_06980 242296 242054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 242892 242416 gene locus_tag LOCUS_06990 242892 242416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 243540 243235 gene locus_tag LOCUS_07000 243540 243235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 244341 244577 gene locus_tag LOCUS_07010 244341 244577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 245190 244789 gene locus_tag LOCUS_07020 245190 244789 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_07020 248321 245187 gene locus_tag LOCUS_07030 248321 245187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 249055 248741 gene locus_tag LOCUS_07040 249055 248741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 249876 249052 gene locus_tag LOCUS_07050 249876 249052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 250232 249873 gene locus_tag LOCUS_07060 250232 249873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 251113 250259 gene locus_tag LOCUS_07070 gene traP 251113 250259 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361991.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence04 <1 513 gene locus_tag LOCUS_07080 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073616.1:phosphoesterase 520 1131 gene locus_tag LOCUS_07090 520 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 1749 1312 gene locus_tag LOCUS_07100 1749 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 1973 2341 gene locus_tag LOCUS_07110 1973 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2472 3287 gene locus_tag LOCUS_07120 2472 3287 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727421.1 protein_id gnl|my_center|LOCUS_07120 3331 4227 gene locus_tag LOCUS_07130 3331 4227 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_07130 4253 4900 gene locus_tag LOCUS_07140 4253 4900 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 protein_id gnl|my_center|LOCUS_07140 5049 5720 gene locus_tag LOCUS_07150 5049 5720 CDS product N-acyl homoserine lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216585.1 protein_id gnl|my_center|LOCUS_07150 5814 6470 gene locus_tag LOCUS_07160 5814 6470 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580891.1 protein_id gnl|my_center|LOCUS_07160 6541 7578 gene locus_tag LOCUS_07170 6541 7578 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810847.1 protein_id gnl|my_center|LOCUS_07170 7729 8358 gene locus_tag LOCUS_07180 7729 8358 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_07180 8541 9206 gene locus_tag LOCUS_07190 8541 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 10715 9786 gene locus_tag LOCUS_07200 10715 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 11882 11037 gene locus_tag LOCUS_07210 11882 11037 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_07210 13559 12666 gene locus_tag LOCUS_07220 13559 12666 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_07220 13717 14700 gene locus_tag LOCUS_07230 13717 14700 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 protein_id gnl|my_center|LOCUS_07230 14722 15177 gene locus_tag LOCUS_07240 14722 15177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 15189 15644 gene locus_tag LOCUS_07250 15189 15644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 15652 16257 gene locus_tag LOCUS_07260 15652 16257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 16318 17415 gene locus_tag LOCUS_07270 16318 17415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 17420 18262 gene locus_tag LOCUS_07280 17420 18262 CDS product 2,5-diketo-D-gluconic acid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_07280 18357 18821 gene locus_tag LOCUS_07290 18357 18821 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917912.1 protein_id gnl|my_center|LOCUS_07290 18839 19483 gene locus_tag LOCUS_07300 18839 19483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_07300 19503 19931 gene locus_tag LOCUS_07310 19503 19931 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764895.1 protein_id gnl|my_center|LOCUS_07310 21132 20119 gene locus_tag LOCUS_07320 gene pucA 21132 20119 CDS product putative xanthine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32147 protein_id gnl|my_center|LOCUS_07320 23420 21183 gene locus_tag LOCUS_07330 23420 21183 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_07330 24148 24063 gene locus_tag LOCUS_t00030 24148 24063 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24963 24301 gene locus_tag LOCUS_07340 24963 24301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_07340 25150 25779 gene locus_tag LOCUS_07350 25150 25779 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_07350 26121 25774 gene locus_tag LOCUS_07360 26121 25774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 27336 26191 gene locus_tag LOCUS_07370 gene ribBA 27336 26191 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_07370 28964 27423 gene locus_tag LOCUS_07380 28964 27423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963702.1 protein_id gnl|my_center|LOCUS_07380 29705 29040 gene locus_tag LOCUS_07390 gene lolA 29705 29040 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_07390 32076 29698 gene locus_tag LOCUS_07400 gene ftsK 32076 29698 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_07400 32601 32230 gene locus_tag LOCUS_07410 gene dgkA 32601 32230 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963705.1 protein_id gnl|my_center|LOCUS_07410 33105 32605 gene locus_tag LOCUS_07420 gene tpx 33105 32605 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZY8 protein_id gnl|my_center|LOCUS_07420 33615 33367 gene locus_tag LOCUS_07430 33615 33367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_07430 33910 33596 gene locus_tag LOCUS_07440 33910 33596 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_07440 34606 33968 gene locus_tag LOCUS_07450 34606 33968 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963839.1 protein_id gnl|my_center|LOCUS_07450 36336 34855 gene locus_tag LOCUS_07460 36336 34855 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_07460 36820 38367 gene locus_tag LOCUS_07470 36820 38367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 38456 39862 gene locus_tag LOCUS_07480 gene lpdA1 38456 39862 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_07480 39976 40950 gene locus_tag LOCUS_07490 39976 40950 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813997.1 protein_id gnl|my_center|LOCUS_07490 40969 42228 gene locus_tag LOCUS_07500 40969 42228 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704776.1 protein_id gnl|my_center|LOCUS_07500 42383 46012 gene locus_tag LOCUS_07510 42383 46012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 46043 46774 gene locus_tag LOCUS_07520 46043 46774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 46774 47133 gene locus_tag LOCUS_07530 46774 47133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 47206 48303 gene locus_tag LOCUS_07540 47206 48303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 48319 49782 gene locus_tag LOCUS_07550 48319 49782 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403033.1 protein_id gnl|my_center|LOCUS_07550 49793 51046 gene locus_tag LOCUS_07560 49793 51046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 51049 52209 gene locus_tag LOCUS_07570 51049 52209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 54264 52216 gene locus_tag LOCUS_07580 54264 52216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 54454 54819 gene locus_tag LOCUS_07590 54454 54819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 54872 55288 gene locus_tag LOCUS_07600 54872 55288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 55413 59162 gene locus_tag LOCUS_07610 55413 59162 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_07610 59152 60396 gene locus_tag LOCUS_07620 59152 60396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 60400 61014 gene locus_tag LOCUS_07630 60400 61014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 61025 62245 gene locus_tag LOCUS_07640 61025 62245 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_07640 62335 63069 gene locus_tag LOCUS_07650 62335 63069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 63073 63774 gene locus_tag LOCUS_07660 63073 63774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 63809 65521 gene locus_tag LOCUS_07670 63809 65521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 65730 66812 gene locus_tag LOCUS_07680 gene fabH1 65730 66812 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_07680 67024 70647 gene locus_tag LOCUS_07690 67024 70647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 70649 72859 gene locus_tag LOCUS_07700 70649 72859 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_07700 72865 73281 gene locus_tag LOCUS_07710 72865 73281 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876084.1 protein_id gnl|my_center|LOCUS_07710 73284 73880 gene locus_tag LOCUS_07720 73284 73880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 73828 74385 gene locus_tag LOCUS_07730 73828 74385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 75574 74390 gene locus_tag LOCUS_07740 75574 74390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 protein_id gnl|my_center|LOCUS_07740 76667 75567 gene locus_tag LOCUS_07750 76667 75567 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_07750 77178 76657 gene locus_tag LOCUS_07760 77178 76657 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404532.1 protein_id gnl|my_center|LOCUS_07760 77815 77168 gene locus_tag LOCUS_07770 77815 77168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_07770 77958 78344 gene locus_tag LOCUS_07780 77958 78344 CDS product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632398.1 protein_id gnl|my_center|LOCUS_07780 79569 78352 gene locus_tag LOCUS_07790 79569 78352 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_07790 79754 80410 gene locus_tag LOCUS_07800 79754 80410 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_07800 80507 81697 gene locus_tag LOCUS_07810 gene sucC 80507 81697 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_07810 82024 82386 gene locus_tag LOCUS_07820 82024 82386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 82574 83017 gene locus_tag LOCUS_07830 82574 83017 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295281.1 protein_id gnl|my_center|LOCUS_07830 83994 83098 gene locus_tag LOCUS_07840 gene xerD 83994 83098 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_07840 84104 84703 gene locus_tag LOCUS_07850 84104 84703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402867.1 protein_id gnl|my_center|LOCUS_07850 85101 85703 gene locus_tag LOCUS_07860 85101 85703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_07860 85877 86500 gene locus_tag LOCUS_07870 85877 86500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_07870 86563 87132 gene locus_tag LOCUS_07880 86563 87132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 87175 87600 gene locus_tag LOCUS_07890 gene aroQ 87175 87600 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_07890 87605 88141 gene locus_tag LOCUS_07900 87605 88141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 88154 88879 gene locus_tag LOCUS_07910 88154 88879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_07910 90410 88998 gene locus_tag LOCUS_07920 gene lpdA2 90410 88998 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_07920 90971 90462 gene locus_tag LOCUS_07930 90971 90462 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894086.1 protein_id gnl|my_center|LOCUS_07930 91559 91047 gene locus_tag LOCUS_07940 91559 91047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 92104 91691 gene locus_tag LOCUS_07950 gene mrsB2 92104 91691 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963829.1 protein_id gnl|my_center|LOCUS_07950 92717 92238 gene locus_tag LOCUS_07960 92717 92238 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088596.1 protein_id gnl|my_center|LOCUS_07960 92894 94828 gene locus_tag LOCUS_07970 gene glgE 92894 94828 CDS product alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAR6 protein_id gnl|my_center|LOCUS_07970 94867 96504 gene locus_tag LOCUS_07980 94867 96504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 96497 98416 gene locus_tag LOCUS_07990 gene glgB 96497 98416 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHB1 protein_id gnl|my_center|LOCUS_07990 98526 100919 gene locus_tag LOCUS_08000 98526 100919 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_08000 101011 101823 gene locus_tag LOCUS_08010 101011 101823 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_08010 101905 103239 gene locus_tag LOCUS_08020 101905 103239 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_08020 104025 103297 gene locus_tag LOCUS_08030 104025 103297 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_08030 105147 104044 gene locus_tag LOCUS_08040 105147 104044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 105679 105128 gene locus_tag LOCUS_08050 105679 105128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 106242 105685 gene locus_tag LOCUS_08060 106242 105685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 106470 108920 gene locus_tag LOCUS_08070 gene lon 106470 108920 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_08070 109035 110054 gene locus_tag LOCUS_08080 gene porQ 109035 110054 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_08080 110054 110785 gene locus_tag LOCUS_08090 gene cmk 110054 110785 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 protein_id gnl|my_center|LOCUS_08090 110810 111979 gene locus_tag LOCUS_08100 110810 111979 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766719.1 protein_id gnl|my_center|LOCUS_08100 112150 113580 gene locus_tag LOCUS_08110 112150 113580 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958071.1 protein_id gnl|my_center|LOCUS_08110 114673 113831 gene locus_tag LOCUS_08120 114673 113831 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_08120 114865 116748 gene locus_tag LOCUS_08130 gene rpsA 114865 116748 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963900.1 protein_id gnl|my_center|LOCUS_08130 117021 118199 gene locus_tag LOCUS_08140 117021 118199 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_08140 119782 118196 gene locus_tag LOCUS_08150 119782 118196 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962666.1 protein_id gnl|my_center|LOCUS_08150 120871 119789 gene locus_tag LOCUS_08160 120871 119789 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962667.1 protein_id gnl|my_center|LOCUS_08160 122211 120883 gene locus_tag LOCUS_08170 122211 120883 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962668.1 protein_id gnl|my_center|LOCUS_08170 122824 122201 gene locus_tag LOCUS_08180 122824 122201 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962669.1 protein_id gnl|my_center|LOCUS_08180 124597 122960 gene locus_tag LOCUS_08190 124597 122960 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_08190 124780 126117 gene locus_tag LOCUS_08200 124780 126117 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_08200 126466 126167 gene locus_tag LOCUS_08210 126466 126167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 126733 127365 gene locus_tag LOCUS_08220 126733 127365 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_08220 127403 128353 gene locus_tag LOCUS_08230 127403 128353 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_08230 129131 128430 gene locus_tag LOCUS_08240 129131 128430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 129850 129293 gene locus_tag LOCUS_08250 129850 129293 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 protein_id gnl|my_center|LOCUS_08250 130323 133175 gene locus_tag LOCUS_08260 gene carB 130323 133175 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_08260 133303 133896 gene locus_tag LOCUS_08270 133303 133896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 134495 133950 gene locus_tag LOCUS_08280 134495 133950 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_08280 134887 134519 gene locus_tag LOCUS_08290 134887 134519 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_08290 136247 134919 gene locus_tag LOCUS_08300 gene rmuC 136247 134919 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_08300 137077 136289 gene locus_tag LOCUS_08310 137077 136289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 protein_id gnl|my_center|LOCUS_08310 138109 137081 gene locus_tag LOCUS_08320 138109 137081 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_08320 139163 138102 gene locus_tag LOCUS_08330 139163 138102 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_08330 139643 141481 gene locus_tag LOCUS_08340 139643 141481 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963575.1 protein_id gnl|my_center|LOCUS_08340 141492 142550 gene locus_tag LOCUS_08350 141492 142550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963574.1 protein_id gnl|my_center|LOCUS_08350 143403 142624 gene locus_tag LOCUS_08360 143403 142624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 144077 143412 gene locus_tag LOCUS_08370 144077 143412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 145610 144153 gene locus_tag LOCUS_08380 145610 144153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 145746 146255 gene locus_tag LOCUS_08390 145746 146255 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_08390 146242 146679 gene locus_tag LOCUS_08400 146242 146679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963572.1 protein_id gnl|my_center|LOCUS_08400 146696 147220 gene locus_tag LOCUS_08410 146696 147220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 147221 147757 gene locus_tag LOCUS_08420 147221 147757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 147894 149987 gene locus_tag LOCUS_08430 gene pta 147894 149987 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726S7 protein_id gnl|my_center|LOCUS_08430 150002 151186 gene locus_tag LOCUS_08440 gene ackA 150002 151186 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYB1 protein_id gnl|my_center|LOCUS_08440 152705 151362 gene locus_tag LOCUS_08450 gene purB 152705 151362 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_08450 153373 152831 gene locus_tag LOCUS_08460 153373 152831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963491.1 protein_id gnl|my_center|LOCUS_08460 153426 153899 gene locus_tag LOCUS_08470 153426 153899 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_08470 154548 153868 gene locus_tag LOCUS_08480 gene npdA 154548 153868 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 protein_id gnl|my_center|LOCUS_08480 154683 157013 gene locus_tag LOCUS_08490 154683 157013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 157079 157726 gene locus_tag LOCUS_08500 gene trmH 157079 157726 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_08500 157729 157971 gene locus_tag LOCUS_08510 157729 157971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 158030 158398 gene locus_tag LOCUS_08520 158030 158398 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 protein_id gnl|my_center|LOCUS_08520 159207 158410 gene locus_tag LOCUS_08530 159207 158410 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 protein_id gnl|my_center|LOCUS_08530 161104 159284 gene locus_tag LOCUS_08540 161104 159284 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_08540 161859 161287 gene locus_tag LOCUS_08550 161859 161287 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_08550 161989 162678 gene locus_tag LOCUS_08560 161989 162678 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_08560 164908 162752 gene locus_tag LOCUS_08570 164908 162752 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_08570 165380 164919 gene locus_tag LOCUS_08580 165380 164919 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_08580 165530 166111 gene locus_tag LOCUS_08590 165530 166111 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362242.1 protein_id gnl|my_center|LOCUS_08590 166151 166828 gene locus_tag LOCUS_08600 gene rpiA 166151 166828 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9T4 protein_id gnl|my_center|LOCUS_08600 167786 166899 gene locus_tag LOCUS_08610 167786 166899 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287475.1 protein_id gnl|my_center|LOCUS_08610 167758 167913 gene locus_tag LOCUS_08620 167758 167913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 167920 168285 gene locus_tag LOCUS_08630 167920 168285 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_08630 168733 168338 gene locus_tag LOCUS_08640 168733 168338 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722478.1 protein_id gnl|my_center|LOCUS_08640 170155 168737 gene locus_tag LOCUS_08650 170155 168737 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_08650 173984 170316 gene locus_tag LOCUS_08660 173984 170316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 174109 174372 gene locus_tag LOCUS_08670 174109 174372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 174382 175722 gene locus_tag LOCUS_08680 174382 175722 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_08680 175823 176137 gene locus_tag LOCUS_08690 175823 176137 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963761.1 protein_id gnl|my_center|LOCUS_08690 176153 176488 gene locus_tag LOCUS_08700 176153 176488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 176530 177288 gene locus_tag LOCUS_08710 176530 177288 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_08710 178647 177319 gene locus_tag LOCUS_08720 178647 177319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_08720 179920 178706 gene locus_tag LOCUS_08730 179920 178706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 181107 180301 gene locus_tag LOCUS_08740 181107 180301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 181638 181108 gene locus_tag LOCUS_08750 181638 181108 CDS product RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027940.1 protein_id gnl|my_center|LOCUS_08750 182322 181735 gene locus_tag LOCUS_08760 182322 181735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 183302 182412 gene locus_tag LOCUS_08770 183302 182412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107505.1 protein_id gnl|my_center|LOCUS_08770 183368 184348 gene locus_tag LOCUS_08780 183368 184348 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_08780 187565 184404 gene locus_tag LOCUS_08790 187565 184404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_08790 187796 188395 gene locus_tag LOCUS_08800 187796 188395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 188572 189693 gene locus_tag LOCUS_08810 188572 189693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_08810 189723 191186 gene locus_tag LOCUS_08820 189723 191186 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_08820 193131 191260 gene locus_tag LOCUS_08830 193131 191260 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_08830 194033 193149 gene locus_tag LOCUS_08840 gene porP 194033 193149 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_08840 <197663 194107 gene locus_tag LOCUS_08850 <197663 194107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin >Feature sequence05 1 534 gene locus_tag LOCUS_08860 1 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 531 845 gene locus_tag LOCUS_08870 531 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1126 1593 gene locus_tag LOCUS_08880 1126 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1899 2120 gene locus_tag LOCUS_08890 1899 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2117 2452 gene locus_tag LOCUS_08900 2117 2452 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_08900 2442 3395 gene locus_tag LOCUS_08910 2442 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_08910 4169 7450 gene locus_tag LOCUS_08920 4169 7450 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039975.1 protein_id gnl|my_center|LOCUS_08920 7462 9201 gene locus_tag LOCUS_08930 7462 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_08930 9201 10058 gene locus_tag LOCUS_08940 9201 10058 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_08940 10071 10910 gene locus_tag LOCUS_08950 10071 10910 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119732.1 protein_id gnl|my_center|LOCUS_08950 12587 11490 gene locus_tag LOCUS_08960 12587 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 13285 12590 gene locus_tag LOCUS_08970 13285 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 13840 14148 gene locus_tag LOCUS_08980 13840 14148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 14463 15074 gene locus_tag LOCUS_08990 14463 15074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 15223 15807 gene locus_tag LOCUS_09000 15223 15807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 16645 16854 gene locus_tag LOCUS_09010 16645 16854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 16820 17266 gene locus_tag LOCUS_09020 16820 17266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 18183 18338 gene locus_tag LOCUS_09030 18183 18338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 18550 20937 gene locus_tag LOCUS_09040 gene hsdR 18550 20937 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819015.1 protein_id gnl|my_center|LOCUS_09040 20937 22367 gene locus_tag LOCUS_09050 20937 22367 CDS product restriction endonuclease EcoEI subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387312.1 protein_id gnl|my_center|LOCUS_09050 22368 24173 gene locus_tag LOCUS_09060 22368 24173 CDS product type I restriction endonuclease EcoAI subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110084.1 protein_id gnl|my_center|LOCUS_09060 24193 26223 gene locus_tag LOCUS_09070 24193 26223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 26220 27353 gene locus_tag LOCUS_09080 26220 27353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 27424 28779 gene locus_tag LOCUS_09090 27424 28779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 28785 30743 gene locus_tag LOCUS_09100 28785 30743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502257.1 protein_id gnl|my_center|LOCUS_09100 30733 31458 gene locus_tag LOCUS_09110 30733 31458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 32169 31927 gene locus_tag LOCUS_09120 32169 31927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 32656 32261 gene locus_tag LOCUS_09130 32656 32261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 32996 32793 gene locus_tag LOCUS_09140 32996 32793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 33407 34522 gene locus_tag LOCUS_09150 33407 34522 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_09150 35729 34527 gene locus_tag LOCUS_09160 35729 34527 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203295.1 protein_id gnl|my_center|LOCUS_09160 36065 36397 gene locus_tag LOCUS_09170 36065 36397 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_09170 36446 36913 gene locus_tag LOCUS_09180 36446 36913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_09180 36929 37558 gene locus_tag LOCUS_09190 gene arsC 36929 37558 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_09190 37882 39024 gene locus_tag LOCUS_09200 37882 39024 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_09200 39089 42280 gene locus_tag LOCUS_09210 39089 42280 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932956.1 protein_id gnl|my_center|LOCUS_09210 42348 43820 gene locus_tag LOCUS_09220 42348 43820 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932955.1 protein_id gnl|my_center|LOCUS_09220 44595 43894 gene locus_tag LOCUS_09230 44595 43894 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_09230 44720 46210 gene locus_tag LOCUS_09240 44720 46210 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_09240 46213 47523 gene locus_tag LOCUS_09250 gene xylA 46213 47523 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U20 protein_id gnl|my_center|LOCUS_09250 47690 48070 gene locus_tag LOCUS_09260 47690 48070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962885.1 protein_id gnl|my_center|LOCUS_09260 48227 48445 gene locus_tag LOCUS_09270 48227 48445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 48719 49174 gene locus_tag LOCUS_09280 48719 49174 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229404.1 protein_id gnl|my_center|LOCUS_09280 50086 49196 gene locus_tag LOCUS_09290 50086 49196 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 protein_id gnl|my_center|LOCUS_09290 52650 50086 gene locus_tag LOCUS_09300 52650 50086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105233.1 protein_id gnl|my_center|LOCUS_09300 56025 52669 gene locus_tag LOCUS_09310 56025 52669 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266501.1 protein_id gnl|my_center|LOCUS_09310 57274 56255 gene locus_tag LOCUS_09320 gene ltaE 57274 56255 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_09320 58109 57300 gene locus_tag LOCUS_09330 58109 57300 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_09330 59170 58103 gene locus_tag LOCUS_09340 59170 58103 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888722.1 protein_id gnl|my_center|LOCUS_09340 59817 59146 gene locus_tag LOCUS_09350 59817 59146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 60965 59844 gene locus_tag LOCUS_09360 60965 59844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 61773 61069 gene locus_tag LOCUS_09370 gene yiaD 61773 61069 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963625.1 protein_id gnl|my_center|LOCUS_09370 62340 61858 gene locus_tag LOCUS_09380 62340 61858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963626.1 protein_id gnl|my_center|LOCUS_09380 64675 62666 gene locus_tag LOCUS_09390 gene bfmBA 64675 62666 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_09390 64801 65778 gene locus_tag LOCUS_09400 64801 65778 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_09400 65783 66115 gene locus_tag LOCUS_09410 65783 66115 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963176.1 protein_id gnl|my_center|LOCUS_09410 66131 67066 gene locus_tag LOCUS_09420 66131 67066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 67067 67939 gene locus_tag LOCUS_09430 gene udp 67067 67939 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_09430 68010 70061 gene locus_tag LOCUS_09440 gene ppk 68010 70061 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM32 protein_id gnl|my_center|LOCUS_09440 70065 70886 gene locus_tag LOCUS_09450 70065 70886 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_09450 71896 71231 gene locus_tag LOCUS_09460 gene ung2 71896 71231 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_09460 72054 74225 gene locus_tag LOCUS_09470 72054 74225 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG0 protein_id gnl|my_center|LOCUS_09470 74225 74623 gene locus_tag LOCUS_09480 gene yuxK 74225 74623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_09480 74698 76617 gene locus_tag LOCUS_09490 74698 76617 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_09490 76621 77286 gene locus_tag LOCUS_09500 gene chd1 76621 77286 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119974.1 protein_id gnl|my_center|LOCUS_09500 78390 77266 gene locus_tag LOCUS_09510 78390 77266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 79966 78515 gene locus_tag LOCUS_09520 gene gltP 79966 78515 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_09520 81300 80236 gene locus_tag LOCUS_09530 gene aroC 81300 80236 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_09530 81460 82284 gene locus_tag LOCUS_09540 81460 82284 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_09540 82965 82285 gene locus_tag LOCUS_09550 82965 82285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 85298 82977 gene locus_tag LOCUS_09560 gene uvrD 85298 82977 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_09560 85573 86757 gene locus_tag LOCUS_09570 85573 86757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 86978 87523 gene locus_tag LOCUS_09580 86978 87523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 87533 88816 gene locus_tag LOCUS_09590 gene amaA 87533 88816 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_09590 88864 90294 gene locus_tag LOCUS_09600 88864 90294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 90390 92009 gene locus_tag LOCUS_09610 gene gltB2 90390 92009 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_09610 92012 92536 gene locus_tag LOCUS_09620 92012 92536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_09620 92529 93056 gene locus_tag LOCUS_09630 92529 93056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 93089 94546 gene locus_tag LOCUS_09640 93089 94546 CDS product K+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_09640 94613 95017 gene locus_tag LOCUS_09650 94613 95017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 95947 95024 gene locus_tag LOCUS_09660 95947 95024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 98016 95947 gene locus_tag LOCUS_09670 98016 95947 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963153.1 protein_id gnl|my_center|LOCUS_09670 98129 100231 gene locus_tag LOCUS_09680 gene recG 98129 100231 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_09680 100380 102806 gene locus_tag LOCUS_09690 gene pheT 100380 102806 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_09690 102876 103598 gene locus_tag LOCUS_09700 102876 103598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 103595 104113 gene locus_tag LOCUS_09710 103595 104113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 105817 104192 gene locus_tag LOCUS_09720 105817 104192 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_09720 106000 107418 gene locus_tag LOCUS_09730 106000 107418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963192.1 protein_id gnl|my_center|LOCUS_09730 108223 107567 gene locus_tag LOCUS_09740 gene tal 108223 107567 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_09740 109148 108345 gene locus_tag LOCUS_09750 109148 108345 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_09750 109382 110440 gene locus_tag LOCUS_09760 109382 110440 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_09760 110505 111998 gene locus_tag LOCUS_09770 110505 111998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_09770 112002 114503 gene locus_tag LOCUS_09780 112002 114503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 114510 114830 gene locus_tag LOCUS_09790 114510 114830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 115139 116422 gene locus_tag LOCUS_09800 115139 116422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 121728 116455 gene locus_tag LOCUS_09810 121728 116455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 121905 122612 gene locus_tag LOCUS_09820 121905 122612 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931708.1 protein_id gnl|my_center|LOCUS_09820 122717 123763 gene locus_tag LOCUS_09830 122717 123763 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_09830 123860 124468 gene locus_tag LOCUS_09840 gene argA 123860 124468 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037388.1 protein_id gnl|my_center|LOCUS_09840 124465 125010 gene locus_tag LOCUS_09850 124465 125010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_09850 125038 125790 gene locus_tag LOCUS_09860 125038 125790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966202.1 protein_id gnl|my_center|LOCUS_09860 125916 125842 gene locus_tag LOCUS_t00040 125916 125842 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 126720 126004 gene locus_tag LOCUS_09870 126720 126004 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_09870 127952 126777 gene locus_tag LOCUS_09880 gene mccB 127952 126777 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05394 protein_id gnl|my_center|LOCUS_09880 128085 128546 gene locus_tag LOCUS_09890 128085 128546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 128619 129422 gene locus_tag LOCUS_09900 128619 129422 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_09900 129636 130685 gene locus_tag LOCUS_09910 gene pgl 129636 130685 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34499 protein_id gnl|my_center|LOCUS_09910 132358 130724 gene locus_tag LOCUS_09920 132358 130724 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_09920 134207 132459 gene locus_tag LOCUS_09930 134207 132459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_09930 137305 134282 gene locus_tag LOCUS_09940 137305 134282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_09940 137536 138219 gene locus_tag LOCUS_09950 gene ftsE 137536 138219 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_09950 138235 139122 gene locus_tag LOCUS_09960 138235 139122 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_09960 139115 140044 gene locus_tag LOCUS_09970 139115 140044 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_09970 140423 140034 gene locus_tag LOCUS_09980 140423 140034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963968.1 protein_id gnl|my_center|LOCUS_09980 141429 140416 gene locus_tag LOCUS_09990 141429 140416 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963969.1 protein_id gnl|my_center|LOCUS_09990 141554 142750 gene locus_tag LOCUS_10000 gene wbsE 141554 142750 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 protein_id gnl|my_center|LOCUS_10000 144967 143675 gene locus_tag LOCUS_10010 gene wzxE 144967 143675 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963976.1 protein_id gnl|my_center|LOCUS_10010 146060 144960 gene locus_tag LOCUS_10020 146060 144960 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963975.1 protein_id gnl|my_center|LOCUS_10020 147058 146057 gene locus_tag LOCUS_10030 147058 146057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_10030 148957 147161 gene locus_tag LOCUS_10040 gene typA 148957 147161 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_10040 149239 150054 gene locus_tag LOCUS_10050 gene kdsA 149239 150054 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY4 protein_id gnl|my_center|LOCUS_10050 150263 152155 gene locus_tag LOCUS_10060 150263 152155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 152577 152227 gene locus_tag LOCUS_10070 152577 152227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 152721 153857 gene locus_tag LOCUS_10080 152721 153857 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_10080 153872 155482 gene locus_tag LOCUS_10090 153872 155482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 155485 156342 gene locus_tag LOCUS_10100 155485 156342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 156445 157083 gene locus_tag LOCUS_10110 156445 157083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107677.1 protein_id gnl|my_center|LOCUS_10110 157117 157416 gene locus_tag LOCUS_10120 157117 157416 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_10120 157409 157939 gene locus_tag LOCUS_10130 157409 157939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 157970 158785 gene locus_tag LOCUS_10140 157970 158785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 158794 159468 gene locus_tag LOCUS_10150 158794 159468 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680079.1 protein_id gnl|my_center|LOCUS_10150 159472 159855 gene locus_tag LOCUS_10160 159472 159855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 161048 159834 gene locus_tag LOCUS_10170 161048 159834 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_10170 161198 162025 gene locus_tag LOCUS_10180 161198 162025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 162137 162536 gene locus_tag LOCUS_tm00010 162137 162536 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 162896 164032 gene locus_tag LOCUS_10190 162896 164032 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_10190 164331 164612 gene locus_tag LOCUS_10200 164331 164612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence06 160 88 gene locus_tag LOCUS_t00050 160 88 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 277 205 gene locus_tag LOCUS_t00060 277 205 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1826 354 gene locus_tag LOCUS_10210 gene proS 1826 354 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_10210 1957 3108 gene locus_tag LOCUS_10220 1957 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 3148 4644 gene locus_tag LOCUS_10230 3148 4644 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_10230 4812 5498 gene locus_tag LOCUS_10240 gene folE2 4812 5498 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_10240 5569 7056 gene locus_tag LOCUS_10250 gene cysS 5569 7056 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_10250 7379 8314 gene locus_tag LOCUS_10260 gene lgt 7379 8314 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX82 protein_id gnl|my_center|LOCUS_10260 8321 8803 gene locus_tag LOCUS_10270 8321 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404141.1 protein_id gnl|my_center|LOCUS_10270 8803 9720 gene locus_tag LOCUS_10280 gene glsA 8803 9720 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEA1 protein_id gnl|my_center|LOCUS_10280 12805 9794 gene locus_tag LOCUS_10290 gene secDF 12805 9794 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 protein_id gnl|my_center|LOCUS_10290 13401 15956 gene locus_tag LOCUS_10300 13401 15956 CDS product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203460.1 protein_id gnl|my_center|LOCUS_10300 16952 16026 gene locus_tag LOCUS_10310 gene mdh 16952 16026 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX11 protein_id gnl|my_center|LOCUS_10310 18201 17197 gene locus_tag LOCUS_10320 18201 17197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 20257 18317 gene locus_tag LOCUS_10330 gene gyrB 20257 18317 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX10 protein_id gnl|my_center|LOCUS_10330 22314 20632 gene locus_tag LOCUS_10340 gene asnB 22314 20632 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_10340 22626 22459 gene locus_tag LOCUS_10350 22626 22459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 22571 23125 gene locus_tag LOCUS_10360 22571 23125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 23812 23180 gene locus_tag LOCUS_10370 gene queE 23812 23180 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_10370 23988 25511 gene locus_tag LOCUS_10380 23988 25511 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_10380 25540 26085 gene locus_tag LOCUS_10390 25540 26085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 26096 26464 gene locus_tag LOCUS_10400 26096 26464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 26603 26806 gene locus_tag LOCUS_10410 26603 26806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 26854 27696 gene locus_tag LOCUS_10420 26854 27696 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_10420 27721 28515 gene locus_tag LOCUS_10430 27721 28515 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_10430 28650 28895 gene locus_tag LOCUS_10440 28650 28895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_10440 28921 29340 gene locus_tag LOCUS_10450 28921 29340 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_10450 29340 30398 gene locus_tag LOCUS_10460 29340 30398 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202490.1 protein_id gnl|my_center|LOCUS_10460 30729 30571 gene locus_tag LOCUS_10470 30729 30571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 30930 31670 gene locus_tag LOCUS_10480 30930 31670 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_10480 32625 31738 gene locus_tag LOCUS_10490 gene folD 32625 31738 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 protein_id gnl|my_center|LOCUS_10490 33024 32659 gene locus_tag LOCUS_10500 33024 32659 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957424.1 protein_id gnl|my_center|LOCUS_10500 34451 33123 gene locus_tag LOCUS_10510 gene ffh 34451 33123 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 protein_id gnl|my_center|LOCUS_10510 35753 34689 gene locus_tag LOCUS_10520 35753 34689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 35893 36417 gene locus_tag LOCUS_10530 35893 36417 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992764.1 protein_id gnl|my_center|LOCUS_10530 36476 37384 gene locus_tag LOCUS_10540 36476 37384 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107892.1 protein_id gnl|my_center|LOCUS_10540 37404 39893 gene locus_tag LOCUS_10550 37404 39893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 41669 39894 gene locus_tag LOCUS_10560 gene argS 41669 39894 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 protein_id gnl|my_center|LOCUS_10560 41783 42214 gene locus_tag LOCUS_10570 41783 42214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 42414 42211 gene locus_tag LOCUS_10580 42414 42211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 42508 43962 gene locus_tag LOCUS_10590 42508 43962 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_10590 44229 45464 gene locus_tag LOCUS_10600 44229 45464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 46396 45461 gene locus_tag LOCUS_10610 46396 45461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_10610 47344 46430 gene locus_tag LOCUS_10620 47344 46430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_10620 48721 47435 gene locus_tag LOCUS_10630 gene gltA 48721 47435 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_10630 50518 49229 gene locus_tag LOCUS_10640 gene eno 50518 49229 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_10640 50568 50747 gene locus_tag LOCUS_10650 50568 50747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 51842 50730 gene locus_tag LOCUS_10660 gene carA 51842 50730 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_10660 52598 51897 gene locus_tag LOCUS_10670 52598 51897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 53165 52689 gene locus_tag LOCUS_10680 gene rplQ 53165 52689 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ72 protein_id gnl|my_center|LOCUS_10680 54184 53231 gene locus_tag LOCUS_10690 gene rpoA 54184 53231 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_10690 54855 54250 gene locus_tag LOCUS_10700 gene rpsD 54855 54250 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ74 protein_id gnl|my_center|LOCUS_10700 55364 54942 gene locus_tag LOCUS_10710 gene rpsK 55364 54942 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 protein_id gnl|my_center|LOCUS_10710 55748 55374 gene locus_tag LOCUS_10720 gene rpsM 55748 55374 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ76 protein_id gnl|my_center|LOCUS_10720 56090 55875 gene locus_tag LOCUS_10730 gene infA 56090 55875 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ78 protein_id gnl|my_center|LOCUS_10730 57427 56090 gene locus_tag LOCUS_10740 gene secY 57427 56090 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ79 protein_id gnl|my_center|LOCUS_10740 57890 57438 gene locus_tag LOCUS_10750 gene rplO 57890 57438 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ80 protein_id gnl|my_center|LOCUS_10750 58082 57903 gene locus_tag LOCUS_10760 gene rpmD 58082 57903 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ81 protein_id gnl|my_center|LOCUS_10760 58618 58094 gene locus_tag LOCUS_10770 gene rpsE 58618 58094 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ82 protein_id gnl|my_center|LOCUS_10770 58978 58625 gene locus_tag LOCUS_10780 gene rplR 58978 58625 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7J0 protein_id gnl|my_center|LOCUS_10780 59532 58990 gene locus_tag LOCUS_10790 gene rplF 59532 58990 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 protein_id gnl|my_center|LOCUS_10790 59951 59553 gene locus_tag LOCUS_10800 gene rpsH 59951 59553 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_10800 60295 60026 gene locus_tag LOCUS_10810 gene rpsN 60295 60026 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_10810 60849 60298 gene locus_tag LOCUS_10820 gene rplE 60849 60298 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_10820 61163 60852 gene locus_tag LOCUS_10830 gene rplX 61163 60852 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ88 protein_id gnl|my_center|LOCUS_10830 61544 61176 gene locus_tag LOCUS_10840 gene rplN 61544 61176 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_10840 61816 61547 gene locus_tag LOCUS_10850 gene rpsQ 61816 61547 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_10850 62007 61816 gene locus_tag LOCUS_10860 gene rpmC 62007 61816 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ91 protein_id gnl|my_center|LOCUS_10860 62441 62019 gene locus_tag LOCUS_10870 gene rplP 62441 62019 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ92 protein_id gnl|my_center|LOCUS_10870 63177 62461 gene locus_tag LOCUS_10880 gene rpsC 63177 62461 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_10880 63591 63181 gene locus_tag LOCUS_10890 gene rplV 63591 63181 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 protein_id gnl|my_center|LOCUS_10890 63878 63600 gene locus_tag LOCUS_10900 gene rpsS 63878 63600 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ95 protein_id gnl|my_center|LOCUS_10900 64709 63885 gene locus_tag LOCUS_10910 gene rplB 64709 63885 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ96 protein_id gnl|my_center|LOCUS_10910 65009 64719 gene locus_tag LOCUS_10920 gene rplW 65009 64719 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ97 protein_id gnl|my_center|LOCUS_10920 65643 65014 gene locus_tag LOCUS_10930 gene rplD 65643 65014 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_10930 66254 65643 gene locus_tag LOCUS_10940 gene rplC 66254 65643 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ99 protein_id gnl|my_center|LOCUS_10940 66716 66411 gene locus_tag LOCUS_10950 gene rpsJ 66716 66411 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_10950 68860 66728 gene locus_tag LOCUS_10960 gene fusA 68860 66728 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 protein_id gnl|my_center|LOCUS_10960 69342 68866 gene locus_tag LOCUS_10970 gene rpsG 69342 68866 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_10970 69740 69366 gene locus_tag LOCUS_10980 gene rpsL 69740 69366 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 protein_id gnl|my_center|LOCUS_10980 69909 71600 gene locus_tag LOCUS_10990 69909 71600 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963474.1 protein_id gnl|my_center|LOCUS_10990 71852 75145 gene locus_tag LOCUS_11000 71852 75145 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_11000 75149 77002 gene locus_tag LOCUS_11010 75149 77002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 77016 77927 gene locus_tag LOCUS_11020 77016 77927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 78362 81562 gene locus_tag LOCUS_11030 78362 81562 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_11030 81570 83159 gene locus_tag LOCUS_11040 81570 83159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_11040 83249 83983 gene locus_tag LOCUS_11050 83249 83983 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_11050 84453 83980 gene locus_tag LOCUS_11060 84453 83980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 84852 86129 gene locus_tag LOCUS_11070 84852 86129 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_11070 87093 86212 gene locus_tag LOCUS_11080 87093 86212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 87840 87148 gene locus_tag LOCUS_11090 87840 87148 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_11090 89065 87833 gene locus_tag LOCUS_11100 89065 87833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 89964 89266 gene locus_tag LOCUS_11110 gene radC 89964 89266 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_11110 90223 90849 gene locus_tag LOCUS_11120 gene paiB 90223 90849 CDS product protease synthase and sporulation protein PAI 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21341 protein_id gnl|my_center|LOCUS_11120 92198 90846 gene locus_tag LOCUS_11130 92198 90846 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_11130 93235 92276 gene locus_tag LOCUS_11140 93235 92276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 93830 93306 gene locus_tag LOCUS_11150 93830 93306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_11150 94913 93900 gene locus_tag LOCUS_11160 gene obg 94913 93900 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB7 protein_id gnl|my_center|LOCUS_11160 95346 94954 gene locus_tag LOCUS_11170 95346 94954 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_11170 96495 95389 gene locus_tag LOCUS_11180 96495 95389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 96738 97895 gene locus_tag LOCUS_11190 gene purK 96738 97895 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_11190 97958 98437 gene locus_tag LOCUS_11200 gene purE 97958 98437 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_11200 98644 100674 gene locus_tag LOCUS_11210 gene dcp1 98644 100674 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_11210 101935 100709 gene locus_tag LOCUS_11220 101935 100709 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_11220 102016 102522 gene locus_tag LOCUS_11230 102016 102522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 102626 103054 gene locus_tag LOCUS_11240 102626 103054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 105902 103110 gene locus_tag LOCUS_11250 gene gcvP 105902 103110 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_11250 106086 106901 gene locus_tag LOCUS_11260 106086 106901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362021.1 protein_id gnl|my_center|LOCUS_11260 107132 106869 gene locus_tag LOCUS_11270 107132 106869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 107720 107136 gene locus_tag LOCUS_11280 gene sigX 107720 107136 CDS product ECF RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35165 protein_id gnl|my_center|LOCUS_11280 107850 108371 gene locus_tag LOCUS_11290 107850 108371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 108368 109216 gene locus_tag LOCUS_11300 108368 109216 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963505.1 protein_id gnl|my_center|LOCUS_11300 110827 109208 gene locus_tag LOCUS_11310 gene pafA 110827 109208 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_11310 110967 111704 gene locus_tag LOCUS_11320 110967 111704 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_11320 111704 112477 gene locus_tag LOCUS_11330 111704 112477 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_11330 113904 112471 gene locus_tag LOCUS_11340 113904 112471 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_11340 115005 113911 gene locus_tag LOCUS_11350 gene manC 115005 113911 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_11350 115611 115015 gene locus_tag LOCUS_11360 115611 115015 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_11360 116301 115615 gene locus_tag LOCUS_11370 116301 115615 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_11370 117346 116294 gene locus_tag LOCUS_11380 117346 116294 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_11380 119107 117419 gene locus_tag LOCUS_11390 gene pdhC 119107 117419 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_11390 120112 119111 gene locus_tag LOCUS_11400 gene pdhA 120112 119111 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_11400 120737 120255 gene locus_tag LOCUS_11410 gene cdd 120737 120255 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_11410 121913 120744 gene locus_tag LOCUS_11420 gene porV 121913 120744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_11420 125831 121950 gene locus_tag LOCUS_11430 gene porU 125831 121950 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_11430 126094 127743 gene locus_tag LOCUS_11440 gene gldJ 126094 127743 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_11440 127813 129105 gene locus_tag LOCUS_11450 gene murF 127813 129105 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_11450 129412 129337 gene locus_tag LOCUS_t00070 129412 129337 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 129603 130538 gene locus_tag LOCUS_11460 129603 130538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 130875 132209 gene locus_tag LOCUS_11470 130875 132209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 133743 132259 gene locus_tag LOCUS_11480 133743 132259 CDS product selenocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_11480 136629 133930 gene locus_tag LOCUS_11490 136629 133930 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_11490 138703 136733 gene locus_tag LOCUS_11500 gene dsbD 138703 136733 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_11500 140120 138966 gene locus_tag LOCUS_11510 140120 138966 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_11510 141516 140134 gene locus_tag LOCUS_11520 141516 140134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 144766 141527 gene locus_tag LOCUS_11530 144766 141527 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_11530 146030 144900 gene locus_tag LOCUS_11540 146030 144900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 146312 146890 gene locus_tag LOCUS_11550 146312 146890 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801526.1 protein_id gnl|my_center|LOCUS_11550 147067 146849 gene locus_tag LOCUS_11560 147067 146849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 147309 146995 gene locus_tag LOCUS_11570 147309 146995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence07 173 1465 gene locus_tag LOCUS_11580 gene fahA 173 1465 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_11580 1717 2319 gene locus_tag LOCUS_11590 1717 2319 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_11590 2297 3301 gene locus_tag LOCUS_11600 2297 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4471 3464 gene locus_tag LOCUS_11610 gene fabH2 4471 3464 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_11610 4787 7237 gene locus_tag LOCUS_11620 4787 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_11620 7295 7990 gene locus_tag LOCUS_11630 7295 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 8166 9143 gene locus_tag LOCUS_11640 8166 9143 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963293.1 protein_id gnl|my_center|LOCUS_11640 9961 9224 gene locus_tag LOCUS_11650 9961 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202384.1 protein_id gnl|my_center|LOCUS_11650 10725 11090 gene locus_tag LOCUS_11660 10725 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 11191 11775 gene locus_tag LOCUS_11670 11191 11775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 12113 13189 gene locus_tag LOCUS_11680 12113 13189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933037.1 protein_id gnl|my_center|LOCUS_11680 13264 14373 gene locus_tag LOCUS_11690 13264 14373 CDS product cysteine proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117742.1 protein_id gnl|my_center|LOCUS_11690 14477 15520 gene locus_tag LOCUS_11700 14477 15520 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_11700 16827 17870 gene locus_tag LOCUS_11710 gene abnA 16827 17870 CDS product extracellular endo-alpha-(1->5)-L-arabinanase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94522 protein_id gnl|my_center|LOCUS_11710 17895 18632 gene locus_tag LOCUS_11720 17895 18632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 18666 20345 gene locus_tag LOCUS_11730 18666 20345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 20353 21213 gene locus_tag LOCUS_11740 20353 21213 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659480.1 protein_id gnl|my_center|LOCUS_11740 21314 22630 gene locus_tag LOCUS_11750 21314 22630 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_11750 22834 23319 gene locus_tag LOCUS_11760 22834 23319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 23499 26198 gene locus_tag LOCUS_11770 23499 26198 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405361.1 protein_id gnl|my_center|LOCUS_11770 26232 29474 gene locus_tag LOCUS_11780 26232 29474 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_11780 29566 30171 gene locus_tag LOCUS_11790 29566 30171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_11790 30182 31321 gene locus_tag LOCUS_11800 30182 31321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 33665 31326 gene locus_tag LOCUS_11810 33665 31326 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709186.1 protein_id gnl|my_center|LOCUS_11810 35548 33908 gene locus_tag LOCUS_11820 35548 33908 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_11820 38278 35582 gene locus_tag LOCUS_11830 38278 35582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 40630 38291 gene locus_tag LOCUS_11840 40630 38291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 41066 41911 gene locus_tag LOCUS_11850 41066 41911 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_11850 42600 41908 gene locus_tag LOCUS_11860 42600 41908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 44409 42688 gene locus_tag LOCUS_11870 44409 42688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 45011 44412 gene locus_tag LOCUS_11880 45011 44412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 45486 44995 gene locus_tag LOCUS_11890 gene sigE 45486 44995 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGI0 protein_id gnl|my_center|LOCUS_11890 46136 45711 gene locus_tag LOCUS_11900 46136 45711 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359781.1 protein_id gnl|my_center|LOCUS_11900 46352 47401 gene locus_tag LOCUS_11910 gene argK 46352 47401 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962733.1 protein_id gnl|my_center|LOCUS_11910 47661 47398 gene locus_tag LOCUS_11920 47661 47398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 48633 47689 gene locus_tag LOCUS_11930 gene ytcB 48633 47689 CDS product putative UDP-glucose epimerase YtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34886 protein_id gnl|my_center|LOCUS_11930 49207 48635 gene locus_tag LOCUS_11940 49207 48635 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_11940 49438 49208 gene locus_tag LOCUS_11950 49438 49208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_11950 49721 51166 gene locus_tag LOCUS_11960 49721 51166 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202708.1 protein_id gnl|my_center|LOCUS_11960 51502 51137 gene locus_tag LOCUS_11970 51502 51137 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_11970 51987 54353 gene locus_tag LOCUS_11980 51987 54353 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_11980 54941 54549 gene locus_tag LOCUS_11990 gene ytxJ 54941 54549 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_11990 55179 57782 gene locus_tag LOCUS_12000 gene clpB 55179 57782 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0F9 protein_id gnl|my_center|LOCUS_12000 58017 59789 gene locus_tag LOCUS_12010 58017 59789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 59923 61011 gene locus_tag LOCUS_12020 59923 61011 CDS product DUF4935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269085.1 protein_id gnl|my_center|LOCUS_12020 61047 61313 gene locus_tag LOCUS_12030 61047 61313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 61579 61833 gene locus_tag LOCUS_12040 61579 61833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 62343 62867 gene locus_tag LOCUS_12050 62343 62867 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_12050 63003 63239 gene locus_tag LOCUS_12060 63003 63239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 63236 63499 gene locus_tag LOCUS_12070 63236 63499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 63591 63800 gene locus_tag LOCUS_12080 63591 63800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 64348 63905 gene locus_tag LOCUS_12090 gene phnB 64348 63905 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_12090 64513 65574 gene locus_tag LOCUS_12100 64513 65574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 65732 66268 gene locus_tag LOCUS_12110 65732 66268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 66315 67133 gene locus_tag LOCUS_12120 gene yneD 66315 67133 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 protein_id gnl|my_center|LOCUS_12120 67256 68473 gene locus_tag LOCUS_12130 gene sbcD 67256 68473 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA98 protein_id gnl|my_center|LOCUS_12130 68477 71503 gene locus_tag LOCUS_12140 gene sbcC 68477 71503 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSI6 protein_id gnl|my_center|LOCUS_12140 71609 72001 gene locus_tag LOCUS_12150 71609 72001 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963098.1 protein_id gnl|my_center|LOCUS_12150 72657 72079 gene locus_tag LOCUS_12160 72657 72079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 72963 74357 gene locus_tag LOCUS_12170 72963 74357 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_12170 74363 76615 gene locus_tag LOCUS_12180 gene dpp4 74363 76615 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118275.1 protein_id gnl|my_center|LOCUS_12180 77197 76691 gene locus_tag LOCUS_12190 77197 76691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 77668 77303 gene locus_tag LOCUS_12200 77668 77303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 79564 77744 gene locus_tag LOCUS_12210 79564 77744 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 protein_id gnl|my_center|LOCUS_12210 81209 79641 gene locus_tag LOCUS_12220 81209 79641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962728.1 protein_id gnl|my_center|LOCUS_12220 81905 81456 gene locus_tag LOCUS_12230 81905 81456 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_12230 81996 82652 gene locus_tag LOCUS_12240 gene nth 81996 82652 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_12240 82688 82981 gene locus_tag LOCUS_12250 82688 82981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 83007 83645 gene locus_tag LOCUS_12260 83007 83645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 84483 83899 gene locus_tag LOCUS_12270 84483 83899 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_12270 84715 87498 gene locus_tag LOCUS_12280 gene uvrA1 84715 87498 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_12280 87724 88275 gene locus_tag LOCUS_12290 87724 88275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 88414 89829 gene locus_tag LOCUS_12300 gene mnmE 88414 89829 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_12300 90065 90622 gene locus_tag LOCUS_12310 90065 90622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 90683 91840 gene locus_tag LOCUS_12320 90683 91840 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361999.1 protein_id gnl|my_center|LOCUS_12320 91869 93257 gene locus_tag LOCUS_12330 91869 93257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 93361 93690 gene locus_tag LOCUS_12340 93361 93690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 93690 93986 gene locus_tag LOCUS_12350 93690 93986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 93983 95590 gene locus_tag LOCUS_12360 93983 95590 CDS product primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962558.1 protein_id gnl|my_center|LOCUS_12360 95592 97070 gene locus_tag LOCUS_12370 95592 97070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 97275 97087 gene locus_tag LOCUS_12380 97275 97087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 97305 97898 gene locus_tag LOCUS_12390 97305 97898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 98436 97900 gene locus_tag LOCUS_12400 98436 97900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 98615 100420 gene locus_tag LOCUS_12410 98615 100420 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_12410 101804 102676 gene locus_tag LOCUS_12420 101804 102676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 102760 103281 gene locus_tag LOCUS_12430 102760 103281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 103284 104198 gene locus_tag LOCUS_12440 103284 104198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 104318 106519 gene locus_tag LOCUS_12450 104318 106519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108745.1 protein_id gnl|my_center|LOCUS_12450 106733 107362 gene locus_tag LOCUS_12460 106733 107362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 107412 107750 gene locus_tag LOCUS_12470 107412 107750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 107912 109102 gene locus_tag LOCUS_12480 107912 109102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090572.1 protein_id gnl|my_center|LOCUS_12480 111208 109223 gene locus_tag LOCUS_12490 111208 109223 CDS product cadmium/zinc/cobalt-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_12490 111669 111250 gene locus_tag LOCUS_12500 111669 111250 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202354.1 protein_id gnl|my_center|LOCUS_12500 112041 111700 gene locus_tag LOCUS_12510 gene yddC 112041 111700 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905289.1 protein_id gnl|my_center|LOCUS_12510 112149 112781 gene locus_tag LOCUS_12520 112149 112781 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 protein_id gnl|my_center|LOCUS_12520 113154 112852 gene locus_tag LOCUS_12530 113154 112852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 115061 113316 gene locus_tag LOCUS_12540 115061 113316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 117171 115048 gene locus_tag LOCUS_12550 117171 115048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence08 1190 648 gene locus_tag LOCUS_12560 1190 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 protein_id gnl|my_center|LOCUS_12560 1317 3218 gene locus_tag LOCUS_12570 1317 3218 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962777.1 protein_id gnl|my_center|LOCUS_12570 3222 3497 gene locus_tag LOCUS_12580 3222 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962900.1 protein_id gnl|my_center|LOCUS_12580 3500 3826 gene locus_tag LOCUS_12590 3500 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 3971 5257 gene locus_tag LOCUS_12600 gene mscS2 3971 5257 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_12600 5311 6390 gene locus_tag LOCUS_12610 5311 6390 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_12610 6395 7312 gene locus_tag LOCUS_12620 6395 7312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 8683 7337 gene locus_tag LOCUS_12630 8683 7337 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704293.1 protein_id gnl|my_center|LOCUS_12630 9172 8687 gene locus_tag LOCUS_12640 9172 8687 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FD9 protein_id gnl|my_center|LOCUS_12640 10062 9169 gene locus_tag LOCUS_12650 10062 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 10284 11027 gene locus_tag LOCUS_12660 10284 11027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 11188 11406 gene locus_tag LOCUS_12670 11188 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 12044 11403 gene locus_tag LOCUS_12680 gene pcm 12044 11403 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_12680 12236 13195 gene locus_tag LOCUS_12690 12236 13195 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_12690 13263 13982 gene locus_tag LOCUS_12700 gene gldF 13263 13982 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_12700 13984 15660 gene locus_tag LOCUS_12710 gene gldG 13984 15660 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_12710 15798 16916 gene locus_tag LOCUS_12720 gene dnaN 15798 16916 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_12720 17087 17683 gene locus_tag LOCUS_12730 17087 17683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 17674 19098 gene locus_tag LOCUS_12740 17674 19098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 19581 19144 gene locus_tag LOCUS_12750 19581 19144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 21164 19698 gene locus_tag LOCUS_12760 gene gltD 21164 19698 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_12760 25681 21173 gene locus_tag LOCUS_12770 gene gltA 25681 21173 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_12770 26153 27262 gene locus_tag LOCUS_12780 26153 27262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 27282 27620 gene locus_tag LOCUS_12790 27282 27620 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_12790 27640 28932 gene locus_tag LOCUS_12800 27640 28932 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAC1 protein_id gnl|my_center|LOCUS_12800 29348 29004 gene locus_tag LOCUS_12810 29348 29004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074087.1 protein_id gnl|my_center|LOCUS_12810 29514 30818 gene locus_tag LOCUS_12820 29514 30818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 32335 30866 gene locus_tag LOCUS_12830 32335 30866 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250770.1 protein_id gnl|my_center|LOCUS_12830 33615 32344 gene locus_tag LOCUS_12840 33615 32344 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_12840 36110 33663 gene locus_tag LOCUS_12850 36110 33663 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_12850 36431 36141 gene locus_tag LOCUS_12860 36431 36141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 36578 37468 gene locus_tag LOCUS_12870 36578 37468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963908.1 protein_id gnl|my_center|LOCUS_12870 37508 38626 gene locus_tag LOCUS_12880 gene yghO 37508 38626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_12880 39345 38668 gene locus_tag LOCUS_12890 39345 38668 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963019.1 protein_id gnl|my_center|LOCUS_12890 40039 39389 gene locus_tag LOCUS_12900 40039 39389 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 protein_id gnl|my_center|LOCUS_12900 40278 41051 gene locus_tag LOCUS_12910 40278 41051 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_12910 42499 41111 gene locus_tag LOCUS_12920 42499 41111 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_12920 42651 43277 gene locus_tag LOCUS_12930 42651 43277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 43332 43934 gene locus_tag LOCUS_12940 43332 43934 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_12940 43947 45701 gene locus_tag LOCUS_12950 gene ggt 43947 45701 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_12950 45832 46425 gene locus_tag LOCUS_12960 45832 46425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 46422 47159 gene locus_tag LOCUS_12970 46422 47159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 49740 47191 gene locus_tag LOCUS_12980 49740 47191 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_12980 50423 49740 gene locus_tag LOCUS_12990 50423 49740 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_12990 50506 51234 gene locus_tag LOCUS_13000 gene tesA 50506 51234 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576212.1 protein_id gnl|my_center|LOCUS_13000 51438 52757 gene locus_tag LOCUS_13010 51438 52757 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_13010 53091 53690 gene locus_tag LOCUS_13020 53091 53690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291519.1 protein_id gnl|my_center|LOCUS_13020 53693 54118 gene locus_tag LOCUS_13030 53693 54118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 54245 55075 gene locus_tag LOCUS_13040 54245 55075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 56434 55139 gene locus_tag LOCUS_13050 gene ndh 56434 55139 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_13050 56559 57053 gene locus_tag LOCUS_13060 56559 57053 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_13060 57060 57701 gene locus_tag LOCUS_13070 57060 57701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964037.1 protein_id gnl|my_center|LOCUS_13070 57860 60766 gene locus_tag LOCUS_13080 57860 60766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 60826 62118 gene locus_tag LOCUS_13090 60826 62118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 62213 62578 gene locus_tag LOCUS_13100 62213 62578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_13100 63221 62583 gene locus_tag LOCUS_13110 63221 62583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 65890 63455 gene locus_tag LOCUS_13120 65890 63455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 66703 65990 gene locus_tag LOCUS_13130 66703 65990 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_13130 67028 66711 gene locus_tag LOCUS_13140 67028 66711 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963165.1 protein_id gnl|my_center|LOCUS_13140 68085 67015 gene locus_tag LOCUS_13150 68085 67015 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963164.1 protein_id gnl|my_center|LOCUS_13150 69219 68086 gene locus_tag LOCUS_13160 69219 68086 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963163.1 protein_id gnl|my_center|LOCUS_13160 71584 69209 gene locus_tag LOCUS_13170 71584 69209 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963162.1 protein_id gnl|my_center|LOCUS_13170 72122 71556 gene locus_tag LOCUS_13180 gene hnoX 72122 71556 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262973.1 protein_id gnl|my_center|LOCUS_13180 72538 72122 gene locus_tag LOCUS_13190 72538 72122 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_13190 74054 72684 gene locus_tag LOCUS_13200 74054 72684 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_13200 75081 74128 gene locus_tag LOCUS_13210 gene purC 75081 74128 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_13210 76049 75096 gene locus_tag LOCUS_13220 gene phoH 76049 75096 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_13220 76159 76989 gene locus_tag LOCUS_13230 gene fjo14 76159 76989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_13230 76998 77294 gene locus_tag LOCUS_13240 gene fjo15 76998 77294 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_13240 77387 78274 gene locus_tag LOCUS_13250 77387 78274 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_13250 78278 78748 gene locus_tag LOCUS_13260 78278 78748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 78786 80018 gene locus_tag LOCUS_13270 78786 80018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964016.1 protein_id gnl|my_center|LOCUS_13270 80152 80814 gene locus_tag LOCUS_13280 80152 80814 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_13280 80859 82235 gene locus_tag LOCUS_13290 80859 82235 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_13290 82239 82604 gene locus_tag LOCUS_13300 82239 82604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 82601 83446 gene locus_tag LOCUS_13310 82601 83446 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_13310 83439 84347 gene locus_tag LOCUS_13320 gene miaA 83439 84347 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V8 protein_id gnl|my_center|LOCUS_13320 85087 84368 gene locus_tag LOCUS_13330 gene rprY 85087 84368 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_13330 86664 85093 gene locus_tag LOCUS_13340 gene rprX 86664 85093 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_13340 87323 86730 gene locus_tag LOCUS_13350 gene coaE 87323 86730 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_13350 88264 87320 gene locus_tag LOCUS_13360 88264 87320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 89286 88288 gene locus_tag LOCUS_13370 89286 88288 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_13370 90266 89442 gene locus_tag LOCUS_13380 90266 89442 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_13380 91957 90305 gene locus_tag LOCUS_13390 gene recN 91957 90305 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_13390 93106 92222 gene locus_tag LOCUS_13400 93106 92222 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_13400 94310 93099 gene locus_tag LOCUS_13410 gene coaBC 94310 93099 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_13410 94636 94313 gene locus_tag LOCUS_13420 94636 94313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_13420 95462 94656 gene locus_tag LOCUS_13430 gene bamD 95462 94656 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_13430 96380 95499 gene locus_tag LOCUS_13440 gene dapA 96380 95499 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_13440 96900 96382 gene locus_tag LOCUS_13450 96900 96382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 96967 97716 gene locus_tag LOCUS_13460 96967 97716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 protein_id gnl|my_center|LOCUS_13460 97719 98627 gene locus_tag LOCUS_13470 97719 98627 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_13470 99346 98624 gene locus_tag LOCUS_13480 99346 98624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 100148 99459 gene locus_tag LOCUS_13490 100148 99459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 102330 100339 gene locus_tag LOCUS_13500 gene ligA 102330 100339 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 protein_id gnl|my_center|LOCUS_13500 102964 102374 gene locus_tag LOCUS_13510 102964 102374 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXS5 protein_id gnl|my_center|LOCUS_13510 103806 102961 gene locus_tag LOCUS_13520 gene prmC 103806 102961 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_13520 104289 103807 gene locus_tag LOCUS_13530 gene yjgM 104289 103807 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_13530 104346 105377 gene locus_tag LOCUS_13540 gene ribD 104346 105377 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_13540 105370 105984 gene locus_tag LOCUS_13550 105370 105984 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_13550 105981 106856 gene locus_tag LOCUS_13560 105981 106856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689009.1 protein_id gnl|my_center|LOCUS_13560 106856 107470 gene locus_tag LOCUS_13570 106856 107470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_13570 107869 107471 gene locus_tag LOCUS_13580 107869 107471 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence09 78 326 gene locus_tag LOCUS_13590 gene rpsT 78 326 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM9 protein_id gnl|my_center|LOCUS_13590 2251 488 gene locus_tag LOCUS_13600 gene rho 2251 488 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_13600 2458 2868 gene locus_tag LOCUS_13610 2458 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_13610 3434 2943 gene locus_tag LOCUS_13620 3434 2943 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_13620 3485 4276 gene locus_tag LOCUS_13630 gene truA 3485 4276 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_13630 4266 6035 gene locus_tag LOCUS_13640 4266 6035 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_13640 6880 6032 gene locus_tag LOCUS_13650 6880 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 7669 6887 gene locus_tag LOCUS_13660 7669 6887 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108919.1 protein_id gnl|my_center|LOCUS_13660 7902 8261 gene locus_tag LOCUS_13670 7902 8261 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_13670 8263 10437 gene locus_tag LOCUS_13680 8263 10437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 10982 11134 gene locus_tag LOCUS_13690 10982 11134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 11643 11131 gene locus_tag LOCUS_13700 11643 11131 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_13700 11800 12192 gene locus_tag LOCUS_13710 11800 12192 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_13710 14207 12243 gene locus_tag LOCUS_13720 14207 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 15346 14381 gene locus_tag LOCUS_13730 15346 14381 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119030.1 protein_id gnl|my_center|LOCUS_13730 16246 15593 gene locus_tag LOCUS_13740 16246 15593 CDS product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGB4 protein_id gnl|my_center|LOCUS_13740 17066 16233 gene locus_tag LOCUS_13750 17066 16233 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202801.1 protein_id gnl|my_center|LOCUS_13750 17735 17070 gene locus_tag LOCUS_13760 gene thiE 17735 17070 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0Q4 protein_id gnl|my_center|LOCUS_13760 18530 17736 gene locus_tag LOCUS_13770 gene thiM 18530 17736 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JW7 protein_id gnl|my_center|LOCUS_13770 19189 18722 gene locus_tag LOCUS_13780 19189 18722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 19304 21202 gene locus_tag LOCUS_13790 19304 21202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 23622 21199 gene locus_tag LOCUS_13800 23622 21199 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_13800 23919 23692 gene locus_tag LOCUS_13810 23919 23692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 25574 24072 gene locus_tag LOCUS_13820 25574 24072 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583888.1 protein_id gnl|my_center|LOCUS_13820 25880 25605 gene locus_tag LOCUS_13830 25880 25605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 26002 26874 gene locus_tag LOCUS_13840 26002 26874 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_13840 27013 27522 gene locus_tag LOCUS_13850 27013 27522 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930808.1 protein_id gnl|my_center|LOCUS_13850 27529 28737 gene locus_tag LOCUS_13860 27529 28737 CDS product arabinose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279096.1 protein_id gnl|my_center|LOCUS_13860 28758 29153 gene locus_tag LOCUS_13870 28758 29153 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530542.1 protein_id gnl|my_center|LOCUS_13870 29220 29807 gene locus_tag LOCUS_13880 29220 29807 CDS product nodulation protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_13880 29812 30177 gene locus_tag LOCUS_13890 29812 30177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967288.1 protein_id gnl|my_center|LOCUS_13890 30214 30570 gene locus_tag LOCUS_13900 30214 30570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 30602 30835 gene locus_tag LOCUS_13910 gene pptA 30602 30835 CDS product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHR3 protein_id gnl|my_center|LOCUS_13910 30871 31722 gene locus_tag LOCUS_13920 30871 31722 CDS product 2,5-diketo-D-gluconic acid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674118.1 protein_id gnl|my_center|LOCUS_13920 31980 31906 gene locus_tag LOCUS_t00080 31980 31906 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32989 32120 gene locus_tag LOCUS_13930 32989 32120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 33437 33162 gene locus_tag LOCUS_13940 gene clpS 33437 33162 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_13940 34299 33463 gene locus_tag LOCUS_13950 gene prmA 34299 33463 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_13950 35055 34306 gene locus_tag LOCUS_13960 gene tpiA 35055 34306 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI2 protein_id gnl|my_center|LOCUS_13960 35534 35052 gene locus_tag LOCUS_13970 gene tlpA 35534 35052 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963549.1 protein_id gnl|my_center|LOCUS_13970 36555 35590 gene locus_tag LOCUS_13980 gene oppB 36555 35590 CDS product glutathione ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928488.1 protein_id gnl|my_center|LOCUS_13980 38375 36663 gene locus_tag LOCUS_13990 38375 36663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 38931 38377 gene locus_tag LOCUS_14000 38931 38377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_14000 39058 39891 gene locus_tag LOCUS_14010 gene folP 39058 39891 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_14010 39942 40880 gene locus_tag LOCUS_14020 gene yrbG 39942 40880 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_14020 41972 40956 gene locus_tag LOCUS_14030 gene glnII 41972 40956 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_14030 42174 44357 gene locus_tag LOCUS_14040 gene glnA 42174 44357 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_14040 44770 45798 gene locus_tag LOCUS_14050 44770 45798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 45928 46356 gene locus_tag LOCUS_14060 45928 46356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 46361 47134 gene locus_tag LOCUS_14070 46361 47134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 47139 47540 gene locus_tag LOCUS_14080 gene csgF 47139 47540 CDS product curli production assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262786.1 protein_id gnl|my_center|LOCUS_14080 47548 48960 gene locus_tag LOCUS_14090 47548 48960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 48981 50474 gene locus_tag LOCUS_14100 48981 50474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 50557 51735 gene locus_tag LOCUS_14110 gene purM 50557 51735 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_14110 51783 52757 gene locus_tag LOCUS_14120 51783 52757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_14120 52842 53582 gene locus_tag LOCUS_14130 52842 53582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 53669 54202 gene locus_tag LOCUS_14140 53669 54202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 54565 54248 gene locus_tag LOCUS_14150 gene rhaM 54565 54248 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFZ6 protein_id gnl|my_center|LOCUS_14150 55878 54592 gene locus_tag LOCUS_14160 55878 54592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 57321 55936 gene locus_tag LOCUS_14170 57321 55936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 59287 57533 gene locus_tag LOCUS_14180 59287 57533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 62433 59302 gene locus_tag LOCUS_14190 62433 59302 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764385.1 protein_id gnl|my_center|LOCUS_14190 63971 62514 gene locus_tag LOCUS_14200 63971 62514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 65699 64008 gene locus_tag LOCUS_14210 65699 64008 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109149.1 protein_id gnl|my_center|LOCUS_14210 67204 65711 gene locus_tag LOCUS_14220 67204 65711 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107856.1 protein_id gnl|my_center|LOCUS_14220 70499 67221 gene locus_tag LOCUS_14230 70499 67221 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764381.1 protein_id gnl|my_center|LOCUS_14230 72735 70501 gene locus_tag LOCUS_14240 72735 70501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 73158 74378 gene locus_tag LOCUS_14250 73158 74378 CDS product family 88 glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107571.1 protein_id gnl|my_center|LOCUS_14250 74397 75401 gene locus_tag LOCUS_14260 74397 75401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 75577 76410 gene locus_tag LOCUS_14270 gene kduI 75577 76410 CDS product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K4 protein_id gnl|my_center|LOCUS_14270 76417 77178 gene locus_tag LOCUS_14280 gene kduD 76417 77178 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50842 protein_id gnl|my_center|LOCUS_14280 77211 78638 gene locus_tag LOCUS_14290 gene uxaC 77211 78638 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TY9 protein_id gnl|my_center|LOCUS_14290 78645 79658 gene locus_tag LOCUS_14300 78645 79658 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793314.1 protein_id gnl|my_center|LOCUS_14300 79670 80341 gene locus_tag LOCUS_14310 79670 80341 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_14310 80338 81330 gene locus_tag LOCUS_14320 80338 81330 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_14320 81332 81802 gene locus_tag LOCUS_14330 81332 81802 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001323190.1 protein_id gnl|my_center|LOCUS_14330 81799 83085 gene locus_tag LOCUS_14340 81799 83085 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_14340 83103 84545 gene locus_tag LOCUS_14350 gene uxaB 83103 84545 CDS product altronate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97L67 protein_id gnl|my_center|LOCUS_14350 84585 86201 gene locus_tag LOCUS_14360 84585 86201 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 protein_id gnl|my_center|LOCUS_14360 87276 86236 gene locus_tag LOCUS_14370 87276 86236 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732008.1 protein_id gnl|my_center|LOCUS_14370 87550 89016 gene locus_tag LOCUS_14380 87550 89016 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_14380 89091 91190 gene locus_tag LOCUS_14390 89091 91190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14390 91093 92163 gene locus_tag LOCUS_14400 91093 92163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14400 92168 93796 gene locus_tag LOCUS_14410 92168 93796 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_14410 93889 95784 gene locus_tag LOCUS_14420 93889 95784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 95787 96569 gene locus_tag LOCUS_14430 95787 96569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 96593 97408 gene locus_tag LOCUS_14440 96593 97408 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_14440 97424 98593 gene locus_tag LOCUS_14450 gene uxuA 97424 98593 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7U2 protein_id gnl|my_center|LOCUS_14450 98598 98948 gene locus_tag LOCUS_14460 98598 98948 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_14460 99010 100068 gene locus_tag LOCUS_14470 99010 100068 CDS product monoamine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403205.1 protein_id gnl|my_center|LOCUS_14470 100175 100585 gene locus_tag LOCUS_14480 gene gloA2 100175 100585 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 protein_id gnl|my_center|LOCUS_14480 100609 101388 gene locus_tag LOCUS_14490 100609 101388 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 protein_id gnl|my_center|LOCUS_14490 101381 101785 gene locus_tag LOCUS_14500 101381 101785 CDS product molybdenum-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977449.1 protein_id gnl|my_center|LOCUS_14500 101782 102453 gene locus_tag LOCUS_14510 101782 102453 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349469.1 protein_id gnl|my_center|LOCUS_14510 102450 103328 gene locus_tag LOCUS_14520 gene modC 102450 103328 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_14520 104396 103389 gene locus_tag LOCUS_14530 gene fbp 104396 103389 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWD9 protein_id gnl|my_center|LOCUS_14530 104711 105973 gene locus_tag LOCUS_14540 104711 105973 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence10 2878 371 gene locus_tag LOCUS_14550 gene mrcA 2878 371 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_14550 5035 3251 gene locus_tag LOCUS_14560 5035 3251 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_14560 5168 5764 gene locus_tag LOCUS_14570 5168 5764 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_14570 6169 5795 gene locus_tag LOCUS_14580 6169 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 6617 6171 gene locus_tag LOCUS_14590 6617 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 7619 6771 gene locus_tag LOCUS_14600 7619 6771 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_14600 8224 7775 gene locus_tag LOCUS_14610 8224 7775 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728N4 protein_id gnl|my_center|LOCUS_14610 9927 8356 gene locus_tag LOCUS_14620 gene lepB 9927 8356 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP1 protein_id gnl|my_center|LOCUS_14620 10712 10014 gene locus_tag LOCUS_14630 gene dapB 10712 10014 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_14630 11306 10716 gene locus_tag LOCUS_14640 11306 10716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_14640 12201 11296 gene locus_tag LOCUS_14650 gene parB 12201 11296 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_14650 12971 12204 gene locus_tag LOCUS_14660 gene parA 12971 12204 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_14660 13223 13447 gene locus_tag LOCUS_14670 13223 13447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 13580 14392 gene locus_tag LOCUS_14680 13580 14392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 14395 15570 gene locus_tag LOCUS_14690 14395 15570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 18475 15635 gene locus_tag LOCUS_14700 18475 15635 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_14700 19542 18661 gene locus_tag LOCUS_14710 gene ykuF 19542 18661 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_14710 21700 19571 gene locus_tag LOCUS_14720 gene mutB 21700 19571 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 protein_id gnl|my_center|LOCUS_14720 22285 21704 gene locus_tag LOCUS_14730 22285 21704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 23699 22338 gene locus_tag LOCUS_14740 gene mutA 23699 22338 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963259.1 protein_id gnl|my_center|LOCUS_14740 23937 23692 gene locus_tag LOCUS_14750 23937 23692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 24652 24044 gene locus_tag LOCUS_14760 gene udk 24652 24044 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 protein_id gnl|my_center|LOCUS_14760 25278 24865 gene locus_tag LOCUS_14770 25278 24865 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_14770 25835 25278 gene locus_tag LOCUS_14780 25835 25278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_14780 28133 25995 gene locus_tag LOCUS_14790 28133 25995 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_14790 28684 28316 gene locus_tag LOCUS_14800 28684 28316 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208086.1 protein_id gnl|my_center|LOCUS_14800 29862 28825 gene locus_tag LOCUS_14810 gene cydB 29862 28825 CDS product cytochrome D oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_14810 31256 29874 gene locus_tag LOCUS_14820 gene cydA 31256 29874 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_14820 33184 31847 gene locus_tag LOCUS_14830 33184 31847 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_14830 34154 33273 gene locus_tag LOCUS_14840 34154 33273 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_14840 34655 34185 gene locus_tag LOCUS_14850 34655 34185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 34755 35708 gene locus_tag LOCUS_14860 34755 35708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 37424 35709 gene locus_tag LOCUS_14870 37424 35709 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_14870 37881 39191 gene locus_tag LOCUS_14880 gene tilS 37881 39191 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_14880 39184 41184 gene locus_tag LOCUS_14890 gene dsbD 39184 41184 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_14890 41198 43042 gene locus_tag LOCUS_14900 gene gaa 41198 43042 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_14900 43048 44874 gene locus_tag LOCUS_14910 43048 44874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_14910 45653 47407 gene locus_tag LOCUS_14920 gene susA 45653 47407 CDS product neopullulanase SusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G0 protein_id gnl|my_center|LOCUS_14920 47409 49286 gene locus_tag LOCUS_14930 47409 49286 CDS product O-glycosyl hydrolase family 13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072207.1 protein_id gnl|my_center|LOCUS_14930 50089 49283 gene locus_tag LOCUS_14940 50089 49283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 50293 52020 gene locus_tag LOCUS_14950 50293 52020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 52110 53648 gene locus_tag LOCUS_14960 52110 53648 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_14960 53799 54428 gene locus_tag LOCUS_14970 53799 54428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764517.1 protein_id gnl|my_center|LOCUS_14970 54553 57420 gene locus_tag LOCUS_14980 54553 57420 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_14980 58234 57533 gene locus_tag LOCUS_14990 58234 57533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224502.1 protein_id gnl|my_center|LOCUS_14990 58412 59635 gene locus_tag LOCUS_15000 gene mntH 58412 59635 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_15000 59632 60387 gene locus_tag LOCUS_15010 59632 60387 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45347 protein_id gnl|my_center|LOCUS_15010 60426 61106 gene locus_tag LOCUS_15020 60426 61106 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831296.1 protein_id gnl|my_center|LOCUS_15020 61099 61959 gene locus_tag LOCUS_15030 61099 61959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932048.1 protein_id gnl|my_center|LOCUS_15030 62259 63227 gene locus_tag LOCUS_15040 62259 63227 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529392.1 protein_id gnl|my_center|LOCUS_15040 63369 65831 gene locus_tag LOCUS_15050 63369 65831 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_15050 66123 68117 gene locus_tag LOCUS_15060 66123 68117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 68141 68665 gene locus_tag LOCUS_15070 68141 68665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 68675 70858 gene locus_tag LOCUS_15080 68675 70858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 70931 71155 gene locus_tag LOCUS_15090 70931 71155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 71357 72589 gene locus_tag LOCUS_15100 71357 72589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 74150 73002 gene locus_tag LOCUS_15110 74150 73002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 75343 74153 gene locus_tag LOCUS_15120 gene hisC 75343 74153 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142470.1 protein_id gnl|my_center|LOCUS_15120 76034 75564 gene locus_tag LOCUS_15130 76034 75564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 76200 76667 gene locus_tag LOCUS_15140 76200 76667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 76737 78005 gene locus_tag LOCUS_15150 gene entS 76737 78005 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_15150 78654 78007 gene locus_tag LOCUS_15160 78654 78007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 79298 78657 gene locus_tag LOCUS_15170 79298 78657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 79889 79302 gene locus_tag LOCUS_15180 79889 79302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 80235 80699 gene locus_tag LOCUS_15190 80235 80699 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_15190 81515 80700 gene locus_tag LOCUS_15200 81515 80700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 82396 81512 gene locus_tag LOCUS_15210 gene cysM 82396 81512 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_15210 83233 82421 gene locus_tag LOCUS_15220 83233 82421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 83407 84189 gene locus_tag LOCUS_15230 gene truA1 83407 84189 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CJ2 protein_id gnl|my_center|LOCUS_15230 84314 84886 gene locus_tag LOCUS_15240 gene pfpI 84314 84886 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090767.1 protein_id gnl|my_center|LOCUS_15240 84963 86078 gene locus_tag LOCUS_15250 gene corA 84963 86078 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I04 protein_id gnl|my_center|LOCUS_15250 86536 86105 gene locus_tag LOCUS_15260 86536 86105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071321.1 protein_id gnl|my_center|LOCUS_15260 86646 87323 gene locus_tag LOCUS_15270 86646 87323 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_15270 87439 89295 gene locus_tag LOCUS_15280 gene parE 87439 89295 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_15280 89338 91965 gene locus_tag LOCUS_15290 gene parC 89338 91965 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_15290 91969 92418 gene locus_tag LOCUS_15300 gene mscL 91969 92418 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN97 protein_id gnl|my_center|LOCUS_15300 92533 94590 gene locus_tag LOCUS_15310 92533 94590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 95008 94631 gene locus_tag LOCUS_15320 95008 94631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962882.1 protein_id gnl|my_center|LOCUS_15320 95499 95062 gene locus_tag LOCUS_15330 95499 95062 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_15330 95728 96966 gene locus_tag LOCUS_15340 95728 96966 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_15340 97022 97501 gene locus_tag LOCUS_15350 97022 97501 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 protein_id gnl|my_center|LOCUS_15350 97589 100174 gene locus_tag LOCUS_15360 gene ppc 97589 100174 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8N7 protein_id gnl|my_center|LOCUS_15360 100177 100701 gene locus_tag LOCUS_15370 100177 100701 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_15370 100866 101294 gene locus_tag LOCUS_15380 100866 101294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15380 101269 101421 gene locus_tag LOCUS_15390 101269 101421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 102000 101464 gene locus_tag LOCUS_15400 gene kdsC 102000 101464 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_15400 102757 101990 gene locus_tag LOCUS_15410 102757 101990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_15410 102869 106111 gene locus_tag LOCUS_15420 gene ccsBA 102869 106111 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence11 882 64 gene locus_tag LOCUS_15430 882 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1988 939 gene locus_tag LOCUS_15440 gene batB 1988 939 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_15440 3023 2019 gene locus_tag LOCUS_15450 gene batA 3023 2019 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_15450 4695 3013 gene locus_tag LOCUS_15460 4695 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 protein_id gnl|my_center|LOCUS_15460 5569 4703 gene locus_tag LOCUS_15470 5569 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_15470 6659 5655 gene locus_tag LOCUS_15480 6659 5655 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_15480 7698 6871 gene locus_tag LOCUS_15490 7698 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 7860 8615 gene locus_tag LOCUS_15500 7860 8615 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940872.1 protein_id gnl|my_center|LOCUS_15500 8729 9868 gene locus_tag LOCUS_15510 8729 9868 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962316.1 protein_id gnl|my_center|LOCUS_15510 9865 10596 gene locus_tag LOCUS_15520 gene pphA 9865 10596 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 protein_id gnl|my_center|LOCUS_15520 10715 11836 gene locus_tag LOCUS_15530 gene ydjI 10715 11836 CDS product antifreeze protein, type I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337358.1 protein_id gnl|my_center|LOCUS_15530 11854 12945 gene locus_tag LOCUS_15540 11854 12945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_15540 14584 13031 gene locus_tag LOCUS_15550 gene pcd 14584 13031 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_15550 15340 14807 gene locus_tag LOCUS_15560 gene haaO 15340 14807 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_15560 15449 16510 gene locus_tag LOCUS_15570 gene iaaA 15449 16510 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_15570 16516 16749 gene locus_tag LOCUS_15580 16516 16749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15580 17579 17106 gene locus_tag LOCUS_15590 17579 17106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965528.1 protein_id gnl|my_center|LOCUS_15590 18167 23743 gene locus_tag LOCUS_15600 18167 23743 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964323.1 protein_id gnl|my_center|LOCUS_15600 23806 26172 gene locus_tag LOCUS_15610 gene pbpC 23806 26172 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_15610 26302 26808 gene locus_tag LOCUS_15620 26302 26808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 26819 27952 gene locus_tag LOCUS_15630 26819 27952 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_15630 27968 31108 gene locus_tag LOCUS_15640 27968 31108 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_15640 31110 32510 gene locus_tag LOCUS_15650 31110 32510 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 protein_id gnl|my_center|LOCUS_15650 33078 32575 gene locus_tag LOCUS_15660 33078 32575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 33539 33069 gene locus_tag LOCUS_15670 33539 33069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784138.1 protein_id gnl|my_center|LOCUS_15670 34197 33532 gene locus_tag LOCUS_15680 34197 33532 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680175.1 protein_id gnl|my_center|LOCUS_15680 34103 34288 gene locus_tag LOCUS_15690 34103 34288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 34336 35439 gene locus_tag LOCUS_15700 gene dinB2 34336 35439 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_15700 36931 35495 gene locus_tag LOCUS_15710 gene pykA 36931 35495 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_15710 37419 36931 gene locus_tag LOCUS_15720 37419 36931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 38260 37514 gene locus_tag LOCUS_15730 gene rnc 38260 37514 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 protein_id gnl|my_center|LOCUS_15730 39521 38268 gene locus_tag LOCUS_15740 gene fabF 39521 38268 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_15740 39774 39541 gene locus_tag LOCUS_15750 gene acpP 39774 39541 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_15750 39952 40521 gene locus_tag LOCUS_15760 gene purN 39952 40521 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 protein_id gnl|my_center|LOCUS_15760 40687 41322 gene locus_tag LOCUS_15770 40687 41322 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_15770 41493 42416 gene locus_tag LOCUS_15780 41493 42416 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_15780 42470 44368 gene locus_tag LOCUS_15790 gene purF 42470 44368 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_15790 45335 45174 gene locus_tag LOCUS_15800 45335 45174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15800 45782 45375 gene locus_tag LOCUS_15810 45782 45375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15810 45994 49137 gene locus_tag LOCUS_15820 45994 49137 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_15820 49387 50763 gene locus_tag LOCUS_15830 49387 50763 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_15830 50854 52290 gene locus_tag LOCUS_15840 50854 52290 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_15840 52370 55069 gene locus_tag LOCUS_15850 52370 55069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_15850 55175 55618 gene locus_tag LOCUS_15860 55175 55618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 55618 56607 gene locus_tag LOCUS_15870 gene apbE 55618 56607 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZN4 protein_id gnl|my_center|LOCUS_15870 56604 56816 gene locus_tag LOCUS_15880 56604 56816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 56829 58103 gene locus_tag LOCUS_15890 56829 58103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963601.1 protein_id gnl|my_center|LOCUS_15890 58250 60193 gene locus_tag LOCUS_15900 58250 60193 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963992.1 protein_id gnl|my_center|LOCUS_15900 60318 60707 gene locus_tag LOCUS_15910 60318 60707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 60903 62213 gene locus_tag LOCUS_15920 60903 62213 CDS product voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037141.1 protein_id gnl|my_center|LOCUS_15920 62563 62210 gene locus_tag LOCUS_15930 62563 62210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 64315 62951 gene locus_tag LOCUS_15940 gene nagA 64315 62951 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_15940 65438 64341 gene locus_tag LOCUS_15950 65438 64341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_15950 66355 65429 gene locus_tag LOCUS_15960 66355 65429 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_15960 67018 66362 gene locus_tag LOCUS_15970 67018 66362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 67196 67122 gene locus_tag LOCUS_t00090 67196 67122 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 67382 67816 gene locus_tag LOCUS_15980 67382 67816 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964325.1 protein_id gnl|my_center|LOCUS_15980 67860 69194 gene locus_tag LOCUS_15990 67860 69194 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106119.1 protein_id gnl|my_center|LOCUS_15990 69847 69200 gene locus_tag LOCUS_16000 69847 69200 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022240.1 protein_id gnl|my_center|LOCUS_16000 70094 70546 gene locus_tag LOCUS_16010 70094 70546 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_16010 70556 71335 gene locus_tag LOCUS_16020 gene lpxH 70556 71335 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_16020 71679 71332 gene locus_tag LOCUS_16030 71679 71332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 73435 71741 gene locus_tag LOCUS_16040 gene recJ 73435 71741 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_16040 75033 73435 gene locus_tag LOCUS_16050 75033 73435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 75098 75514 gene locus_tag LOCUS_16060 75098 75514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 76188 75511 gene locus_tag LOCUS_16070 gene rsmI 76188 75511 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 protein_id gnl|my_center|LOCUS_16070 77065 76190 gene locus_tag LOCUS_16080 77065 76190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963207.1 protein_id gnl|my_center|LOCUS_16080 77167 77808 gene locus_tag LOCUS_16090 gene tdk 77167 77808 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_16090 77809 78906 gene locus_tag LOCUS_16100 77809 78906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 78982 79401 gene locus_tag LOCUS_16110 gene mscL 78982 79401 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI6 protein_id gnl|my_center|LOCUS_16110 79698 80687 gene locus_tag LOCUS_16120 gene asd 79698 80687 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_16120 80892 83057 gene locus_tag LOCUS_16130 80892 83057 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_16130 83433 84359 gene locus_tag LOCUS_16140 83433 84359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_16140 85510 84374 gene locus_tag LOCUS_16150 85510 84374 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_16150 87081 85729 gene locus_tag LOCUS_16160 gene accC 87081 85729 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_16160 87695 87195 gene locus_tag LOCUS_16170 gene accB 87695 87195 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_16170 88718 87723 gene locus_tag LOCUS_16180 gene fabH3 88718 87723 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_16180 89081 88881 gene locus_tag LOCUS_16190 gene rpmF 89081 88881 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_16190 89645 89091 gene locus_tag LOCUS_16200 89645 89091 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_16200 90819 89749 gene locus_tag LOCUS_16210 gene pdxA 90819 89749 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_16210 90883 91467 gene locus_tag LOCUS_16220 gene ribE 90883 91467 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_16220 91693 91454 gene locus_tag LOCUS_16230 91693 91454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 92109 93326 gene locus_tag LOCUS_16240 92109 93326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 95228 93408 gene locus_tag LOCUS_16250 95228 93408 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046961.1 protein_id gnl|my_center|LOCUS_16250 96889 95216 gene locus_tag LOCUS_16260 96889 95216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 99871 96893 gene locus_tag LOCUS_16270 99871 96893 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939035.1 protein_id gnl|my_center|LOCUS_16270 100935 99838 gene locus_tag LOCUS_16280 100935 99838 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9T7 protein_id gnl|my_center|LOCUS_16280 101489 101070 gene locus_tag LOCUS_16290 101489 101070 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010535380.1 protein_id gnl|my_center|LOCUS_16290 101805 102491 gene locus_tag LOCUS_16300 101805 102491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 102491 103591 gene locus_tag LOCUS_16310 102491 103591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 104564 104208 gene locus_tag LOCUS_16320 104564 104208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence12 172 88 gene locus_tag LOCUS_t00100 172 88 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 290 218 gene locus_tag LOCUS_t00110 290 218 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3009 382 gene locus_tag LOCUS_16330 gene mutS 3009 382 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWN3 protein_id gnl|my_center|LOCUS_16330 3167 3706 gene locus_tag LOCUS_16340 3167 3706 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_16340 3834 3968 gene locus_tag LOCUS_16350 3834 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 5025 3961 gene locus_tag LOCUS_16360 5025 3961 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962567.1 protein_id gnl|my_center|LOCUS_16360 5198 5917 gene locus_tag LOCUS_16370 5198 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_16370 5924 8599 gene locus_tag LOCUS_16380 5924 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962569.1 protein_id gnl|my_center|LOCUS_16380 10633 8672 gene locus_tag LOCUS_16390 10633 8672 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_16390 10880 11437 gene locus_tag LOCUS_16400 10880 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 12708 11434 gene locus_tag LOCUS_16410 12708 11434 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_16410 13851 12721 gene locus_tag LOCUS_16420 gene porR 13851 12721 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_16420 14003 15247 gene locus_tag LOCUS_16430 gene kdtA 14003 15247 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_16430 15885 15229 gene locus_tag LOCUS_16440 15885 15229 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107439.1 protein_id gnl|my_center|LOCUS_16440 16041 16253 gene locus_tag LOCUS_16450 16041 16253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 16300 16500 gene locus_tag LOCUS_16460 16300 16500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 17341 16574 gene locus_tag LOCUS_16470 17341 16574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 17440 18702 gene locus_tag LOCUS_16480 17440 18702 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_16480 18702 19448 gene locus_tag LOCUS_16490 18702 19448 CDS product DNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_16490 19494 19712 gene locus_tag LOCUS_16500 19494 19712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 19964 20200 gene locus_tag LOCUS_16510 19964 20200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 21153 20272 gene locus_tag LOCUS_16520 gene fabD 21153 20272 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_16520 21198 21671 gene locus_tag LOCUS_16530 21198 21671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 22173 21673 gene locus_tag LOCUS_16540 22173 21673 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119906.1 protein_id gnl|my_center|LOCUS_16540 23119 22271 gene locus_tag LOCUS_16550 23119 22271 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057658.1 protein_id gnl|my_center|LOCUS_16550 23597 23100 gene locus_tag LOCUS_16560 gene dfrA 23597 23100 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_16560 24028 23600 gene locus_tag LOCUS_16570 24028 23600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962500.1 protein_id gnl|my_center|LOCUS_16570 24087 25157 gene locus_tag LOCUS_16580 24087 25157 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_16580 25347 25637 gene locus_tag LOCUS_16590 25347 25637 CDS product 1,4-alpha-glucan-branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704632.1 protein_id gnl|my_center|LOCUS_16590 26643 25672 gene locus_tag LOCUS_16600 26643 25672 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_16600 27819 26653 gene locus_tag LOCUS_16610 27819 26653 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119788.1 protein_id gnl|my_center|LOCUS_16610 28314 27901 gene locus_tag LOCUS_16620 28314 27901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 29184 28333 gene locus_tag LOCUS_16630 gene thyA 29184 28333 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 protein_id gnl|my_center|LOCUS_16630 29320 29694 gene locus_tag LOCUS_16640 29320 29694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 31112 29697 gene locus_tag LOCUS_16650 gene yeiM 31112 29697 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_16650 31744 31118 gene locus_tag LOCUS_16660 31744 31118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_16660 32798 31830 gene locus_tag LOCUS_16670 gene etfA 32798 31830 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_16670 33609 32863 gene locus_tag LOCUS_16680 gene etfB 33609 32863 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_16680 33894 34871 gene locus_tag LOCUS_16690 gene pdhB 33894 34871 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_16690 35041 37533 gene locus_tag LOCUS_16700 35041 37533 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_16700 37703 38230 gene locus_tag LOCUS_16710 gene ppa 37703 38230 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH9 protein_id gnl|my_center|LOCUS_16710 38367 40757 gene locus_tag LOCUS_16720 38367 40757 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_16720 40825 41853 gene locus_tag LOCUS_16730 40825 41853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119948.1 protein_id gnl|my_center|LOCUS_16730 42784 41876 gene locus_tag LOCUS_16740 gene astE 42784 41876 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XDZ0 protein_id gnl|my_center|LOCUS_16740 43848 42796 gene locus_tag LOCUS_16750 gene gshB 43848 42796 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CU65 protein_id gnl|my_center|LOCUS_16750 45683 43851 gene locus_tag LOCUS_16760 45683 43851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 46520 45906 gene locus_tag LOCUS_16770 46520 45906 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_16770 47319 46525 gene locus_tag LOCUS_16780 47319 46525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962437.1 protein_id gnl|my_center|LOCUS_16780 48256 47573 gene locus_tag LOCUS_16790 48256 47573 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787526.1 protein_id gnl|my_center|LOCUS_16790 49736 48249 gene locus_tag LOCUS_16800 49736 48249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 49920 50684 gene locus_tag LOCUS_16810 49920 50684 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_16810 50750 51586 gene locus_tag LOCUS_16820 50750 51586 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_16820 51649 54324 gene locus_tag LOCUS_16830 51649 54324 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_16830 54749 54507 gene locus_tag LOCUS_16840 54749 54507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 55794 54868 gene locus_tag LOCUS_16850 55794 54868 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_16850 57138 55885 gene locus_tag LOCUS_16860 gene metK 57138 55885 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_16860 57623 61006 gene locus_tag LOCUS_16870 57623 61006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 61023 61445 gene locus_tag LOCUS_16880 61023 61445 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403972.1 protein_id gnl|my_center|LOCUS_16880 61544 62710 gene locus_tag LOCUS_16890 gene metZ 61544 62710 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI7 protein_id gnl|my_center|LOCUS_16890 62738 63151 gene locus_tag LOCUS_16900 62738 63151 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388926.1 protein_id gnl|my_center|LOCUS_16900 63287 63916 gene locus_tag LOCUS_16910 63287 63916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 63985 66081 gene locus_tag LOCUS_16920 63985 66081 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_16920 66071 66832 gene locus_tag LOCUS_16930 gene cysG 66071 66832 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521268.1 protein_id gnl|my_center|LOCUS_16930 66834 67418 gene locus_tag LOCUS_16940 gene cysG 66834 67418 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 protein_id gnl|my_center|LOCUS_16940 67462 68514 gene locus_tag LOCUS_16950 67462 68514 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_16950 68891 68511 gene locus_tag LOCUS_16960 68891 68511 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_16960 69744 68884 gene locus_tag LOCUS_16970 69744 68884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 70345 69758 gene locus_tag LOCUS_16980 70345 69758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 70817 71842 gene locus_tag LOCUS_16990 70817 71842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16990 71852 74578 gene locus_tag LOCUS_17000 71852 74578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17000 74646 75599 gene locus_tag LOCUS_17010 74646 75599 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU8 protein_id gnl|my_center|LOCUS_17010 75648 76739 gene locus_tag LOCUS_17020 75648 76739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 78316 76736 gene locus_tag LOCUS_17030 78316 76736 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943191.1 protein_id gnl|my_center|LOCUS_17030 78501 79253 gene locus_tag LOCUS_17040 78501 79253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 79263 80372 gene locus_tag LOCUS_17050 79263 80372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 80477 80956 gene locus_tag LOCUS_17060 80477 80956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 82006 80957 gene locus_tag LOCUS_17070 82006 80957 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_17070 82109 82663 gene locus_tag LOCUS_17080 gene ruvC 82109 82663 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_17080 82826 83806 gene locus_tag LOCUS_17090 82826 83806 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_17090 83872 84621 gene locus_tag LOCUS_17100 83872 84621 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_17100 84624 84974 gene locus_tag LOCUS_17110 84624 84974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172064.1 protein_id gnl|my_center|LOCUS_17110 84990 85619 gene locus_tag LOCUS_17120 84990 85619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 85600 86124 gene locus_tag LOCUS_17130 85600 86124 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202944.1 protein_id gnl|my_center|LOCUS_17130 86126 86497 gene locus_tag LOCUS_17140 86126 86497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_17140 86542 88317 gene locus_tag LOCUS_17150 86542 88317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_17150 88318 89319 gene locus_tag LOCUS_17160 88318 89319 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_17160 89359 89676 gene locus_tag LOCUS_17170 89359 89676 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_17170 89680 90540 gene locus_tag LOCUS_17180 89680 90540 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339313.1 protein_id gnl|my_center|LOCUS_17180 91582 90782 gene locus_tag LOCUS_17190 91582 90782 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_17190 92130 93716 gene locus_tag LOCUS_17200 gene aldH 92130 93716 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206892.1 protein_id gnl|my_center|LOCUS_17200 93800 95524 gene locus_tag LOCUS_17210 93800 95524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_17210 95549 96556 gene locus_tag LOCUS_17220 95549 96556 CDS product putative 4-hydroxyproline 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92WS1 protein_id gnl|my_center|LOCUS_17220 96611 98887 gene locus_tag LOCUS_17230 96611 98887 CDS product dipeptidyl peptidase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638894.2 protein_id gnl|my_center|LOCUS_17230 98890 100140 gene locus_tag LOCUS_17240 gene dadA 98890 100140 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_17240 101369 100269 gene locus_tag LOCUS_17250 101369 100269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_17250 101746 103194 gene locus_tag LOCUS_17260 101746 103194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence13 165 1376 gene locus_tag LOCUS_17270 gene nqrB 165 1376 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US0 protein_id gnl|my_center|LOCUS_17270 1379 2113 gene locus_tag LOCUS_17280 gene nqrC 1379 2113 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_17280 2116 2763 gene locus_tag LOCUS_17290 gene nqrD 2116 2763 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_17290 2815 3546 gene locus_tag LOCUS_17300 gene nqrE 2815 3546 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L1 protein_id gnl|my_center|LOCUS_17300 3549 4856 gene locus_tag LOCUS_17310 gene nqrF 3549 4856 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_17310 5074 6819 gene locus_tag LOCUS_17320 5074 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 6890 7690 gene locus_tag LOCUS_17330 6890 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 7837 8289 gene locus_tag LOCUS_17340 7837 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 8300 8917 gene locus_tag LOCUS_17350 8300 8917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 8899 9687 gene locus_tag LOCUS_17360 8899 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 9687 10439 gene locus_tag LOCUS_17370 9687 10439 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_17370 10498 10860 gene locus_tag LOCUS_17380 10498 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 10857 11873 gene locus_tag LOCUS_17390 10857 11873 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_17390 13965 11866 gene locus_tag LOCUS_17400 13965 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 14729 13962 gene locus_tag LOCUS_17410 14729 13962 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_17410 15265 14726 gene locus_tag LOCUS_17420 15265 14726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 16105 15287 gene locus_tag LOCUS_17430 gene map 16105 15287 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_17430 17600 16194 gene locus_tag LOCUS_17440 17600 16194 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_17440 18946 17597 gene locus_tag LOCUS_17450 18946 17597 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_17450 20621 18954 gene locus_tag LOCUS_17460 20621 18954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_17460 21301 20627 gene locus_tag LOCUS_17470 21301 20627 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_17470 22301 21441 gene locus_tag LOCUS_17480 22301 21441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 22514 23632 gene locus_tag LOCUS_17490 22514 23632 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_17490 23934 23638 gene locus_tag LOCUS_17500 23934 23638 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_17500 24109 24756 gene locus_tag LOCUS_17510 gene yhfK 24109 24756 CDS product putative sugar epimerase YhfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07609 protein_id gnl|my_center|LOCUS_17510 24908 24825 gene locus_tag LOCUS_t00120 24908 24825 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25039 24966 gene locus_tag LOCUS_t00130 25039 24966 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 25182 25109 gene locus_tag LOCUS_t00140 25182 25109 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 25304 25822 gene locus_tag LOCUS_17520 gene aroK 25304 25822 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 protein_id gnl|my_center|LOCUS_17520 26317 25814 gene locus_tag LOCUS_17530 gene pyrR2 26317 25814 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_17530 26928 26314 gene locus_tag LOCUS_17540 gene tpm 26928 26314 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_17540 27289 26906 gene locus_tag LOCUS_17550 27289 26906 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_17550 27369 28271 gene locus_tag LOCUS_17560 27369 28271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963560.1 protein_id gnl|my_center|LOCUS_17560 28931 28347 gene locus_tag LOCUS_17570 28931 28347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 29996 29043 gene locus_tag LOCUS_17580 gene tktC 29996 29043 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_17580 30927 30082 gene locus_tag LOCUS_17590 gene tktA 30927 30082 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_17590 31125 32255 gene locus_tag LOCUS_17600 gene tgt 31125 32255 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_17600 32256 33332 gene locus_tag LOCUS_17610 32256 33332 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_17610 33439 34236 gene locus_tag LOCUS_17620 33439 34236 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_17620 34331 35284 gene locus_tag LOCUS_17630 gene accA 34331 35284 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_17630 35454 37016 gene locus_tag LOCUS_17640 gene dnaB 35454 37016 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_17640 37173 37742 gene locus_tag LOCUS_17650 37173 37742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 37907 39091 gene locus_tag LOCUS_17660 37907 39091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_17660 39091 39630 gene locus_tag LOCUS_17670 39091 39630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 39725 39934 gene locus_tag LOCUS_17680 39725 39934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973278.1 protein_id gnl|my_center|LOCUS_17680 39938 40555 gene locus_tag LOCUS_17690 39938 40555 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_17690 41413 40637 gene locus_tag LOCUS_17700 41413 40637 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_17700 42556 41558 gene locus_tag LOCUS_17710 42556 41558 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_17710 43012 42566 gene locus_tag LOCUS_17720 43012 42566 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_17720 43123 44151 gene locus_tag LOCUS_17730 gene holA 43123 44151 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_17730 44874 44161 gene locus_tag LOCUS_17740 44874 44161 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_17740 45914 44877 gene locus_tag LOCUS_17750 gene tsaD 45914 44877 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_17750 46165 50523 gene locus_tag LOCUS_17760 46165 50523 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_17760 50745 51731 gene locus_tag LOCUS_17770 gene pfkA 50745 51731 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_17770 51761 52762 gene locus_tag LOCUS_17780 gene gapA3 51761 52762 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H007 protein_id gnl|my_center|LOCUS_17780 52830 53690 gene locus_tag LOCUS_17790 52830 53690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_17790 54147 53767 gene locus_tag LOCUS_17800 gene yjgF 54147 53767 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_17800 56930 54171 gene locus_tag LOCUS_17810 56930 54171 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_17810 57118 58215 gene locus_tag LOCUS_17820 57118 58215 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_17820 58275 59225 gene locus_tag LOCUS_17830 58275 59225 CDS product organic solvent ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_17830 59231 60574 gene locus_tag LOCUS_17840 59231 60574 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_17840 60607 61041 gene locus_tag LOCUS_17850 60607 61041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_17850 61074 61865 gene locus_tag LOCUS_17860 61074 61865 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_17860 62086 62682 gene locus_tag LOCUS_17870 62086 62682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 62686 63303 gene locus_tag LOCUS_17880 62686 63303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 63313 63945 gene locus_tag LOCUS_17890 63313 63945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 64035 64520 gene locus_tag LOCUS_17900 64035 64520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_17900 64528 67443 gene locus_tag LOCUS_17910 64528 67443 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_17910 67516 68670 gene locus_tag LOCUS_17920 67516 68670 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_17920 69241 68747 gene locus_tag LOCUS_17930 69241 68747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 69383 72310 gene locus_tag LOCUS_17940 69383 72310 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_17940 73080 72307 gene locus_tag LOCUS_17950 73080 72307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 73554 73081 gene locus_tag LOCUS_17960 73554 73081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_17960 73690 74109 gene locus_tag LOCUS_17970 73690 74109 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340074.1 protein_id gnl|my_center|LOCUS_17970 74289 75266 gene locus_tag LOCUS_17980 74289 75266 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_17980 75274 76413 gene locus_tag LOCUS_17990 75274 76413 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_17990 76413 77414 gene locus_tag LOCUS_18000 76413 77414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 78159 77419 gene locus_tag LOCUS_18010 78159 77419 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_18010 78268 81093 gene locus_tag LOCUS_18020 78268 81093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_18020 81375 84377 gene locus_tag LOCUS_18030 81375 84377 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_18030 84388 85866 gene locus_tag LOCUS_18040 84388 85866 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_18040 85881 88001 gene locus_tag LOCUS_18050 85881 88001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 88058 89668 gene locus_tag LOCUS_18060 88058 89668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 89643 91964 gene locus_tag LOCUS_18070 89643 91964 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_18070 91964 92728 gene locus_tag LOCUS_18080 91964 92728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 92837 94393 gene locus_tag LOCUS_18090 92837 94393 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613941.1 protein_id gnl|my_center|LOCUS_18090 94661 94446 gene locus_tag LOCUS_18100 94661 94446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 95229 94816 gene locus_tag LOCUS_18110 95229 94816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 95507 96889 gene locus_tag LOCUS_18120 95507 96889 CDS product polygalacturonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109141.1 protein_id gnl|my_center|LOCUS_18120 97258 98898 gene locus_tag LOCUS_18130 97258 98898 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920663.1 protein_id gnl|my_center|LOCUS_18130 98930 100246 gene locus_tag LOCUS_18140 gene tldD 98930 100246 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_18140 100362 100982 gene locus_tag LOCUS_18150 100362 100982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920665.1 protein_id gnl|my_center|LOCUS_18150 100992 101984 gene locus_tag LOCUS_18160 100992 101984 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640601.1 protein_id gnl|my_center|LOCUS_18160 101991 102887 gene locus_tag LOCUS_18170 101991 102887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence14 3220 2006 gene locus_tag LOCUS_18180 3220 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108514.1 protein_id gnl|my_center|LOCUS_18180 4439 3231 gene locus_tag LOCUS_18190 4439 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108515.1 protein_id gnl|my_center|LOCUS_18190 6431 4452 gene locus_tag LOCUS_18200 6431 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108516.1 protein_id gnl|my_center|LOCUS_18200 9627 6436 gene locus_tag LOCUS_18210 9627 6436 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765284.1 protein_id gnl|my_center|LOCUS_18210 12493 10172 gene locus_tag LOCUS_18220 12493 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729998.1 protein_id gnl|my_center|LOCUS_18220 12775 13950 gene locus_tag LOCUS_18230 12775 13950 CDS product molybdopterin molybdenumtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727247.1 protein_id gnl|my_center|LOCUS_18230 13953 14294 gene locus_tag LOCUS_18240 13953 14294 CDS product ModE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546328.1 protein_id gnl|my_center|LOCUS_18240 14356 14874 gene locus_tag LOCUS_18250 gene mobA 14356 14874 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q835J2 protein_id gnl|my_center|LOCUS_18250 14871 15110 gene locus_tag LOCUS_18260 14871 15110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 15120 16178 gene locus_tag LOCUS_18270 gene moeB2 15120 16178 CDS product molybdopterin biosynthesis protein MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899922.1 protein_id gnl|my_center|LOCUS_18270 16175 16603 gene locus_tag LOCUS_18280 16175 16603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 16665 17582 gene locus_tag LOCUS_18290 gene moaCB 16665 17582 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_18290 17677 18582 gene locus_tag LOCUS_18300 gene moaA 17677 18582 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y870 protein_id gnl|my_center|LOCUS_18300 18747 20480 gene locus_tag LOCUS_18310 18747 20480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 22012 20477 gene locus_tag LOCUS_18320 gene glgA 22012 20477 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071682.1 protein_id gnl|my_center|LOCUS_18320 22419 24242 gene locus_tag LOCUS_18330 22419 24242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 25073 24303 gene locus_tag LOCUS_18340 25073 24303 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J055 protein_id gnl|my_center|LOCUS_18340 25204 25839 gene locus_tag LOCUS_18350 25204 25839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 27128 25836 gene locus_tag LOCUS_18360 gene pabB 27128 25836 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_18360 27390 27205 gene locus_tag LOCUS_18370 27390 27205 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704042.1 protein_id gnl|my_center|LOCUS_18370 27517 28056 gene locus_tag LOCUS_18380 27517 28056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 28817 28077 gene locus_tag LOCUS_18390 28817 28077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 28939 29403 gene locus_tag LOCUS_18400 gene smpB 28939 29403 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 protein_id gnl|my_center|LOCUS_18400 29516 31975 gene locus_tag LOCUS_18410 29516 31975 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_18410 32018 32404 gene locus_tag LOCUS_18420 32018 32404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 32414 32926 gene locus_tag LOCUS_18430 32414 32926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 33570 32923 gene locus_tag LOCUS_18440 33570 32923 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695801.1 protein_id gnl|my_center|LOCUS_18440 34424 33615 gene locus_tag LOCUS_18450 34424 33615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 35093 34428 gene locus_tag LOCUS_18460 35093 34428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 35637 35107 gene locus_tag LOCUS_18470 35637 35107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 35829 36428 gene locus_tag LOCUS_18480 35829 36428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 36428 37282 gene locus_tag LOCUS_18490 36428 37282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 37294 39264 gene locus_tag LOCUS_18500 37294 39264 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941642.1 protein_id gnl|my_center|LOCUS_18500 39299 39736 gene locus_tag LOCUS_18510 39299 39736 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_18510 39736 40170 gene locus_tag LOCUS_18520 39736 40170 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_18520 40173 40334 gene locus_tag LOCUS_18530 40173 40334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 40337 41020 gene locus_tag LOCUS_18540 40337 41020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 41036 42766 gene locus_tag LOCUS_18550 41036 42766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 42775 43074 gene locus_tag LOCUS_18560 42775 43074 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_18560 43086 43499 gene locus_tag LOCUS_18570 43086 43499 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_18570 43502 46594 gene locus_tag LOCUS_18580 43502 46594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 46588 49293 gene locus_tag LOCUS_18590 46588 49293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 49305 53984 gene locus_tag LOCUS_18600 49305 53984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 54048 55529 gene locus_tag LOCUS_18610 54048 55529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 55541 55987 gene locus_tag LOCUS_18620 55541 55987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 55999 56322 gene locus_tag LOCUS_18630 55999 56322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 56333 60904 gene locus_tag LOCUS_18640 56333 60904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 60916 61737 gene locus_tag LOCUS_18650 60916 61737 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788692.1 protein_id gnl|my_center|LOCUS_18650 61737 63068 gene locus_tag LOCUS_18660 61737 63068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 63552 63235 gene locus_tag LOCUS_18670 63552 63235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 66156 63799 gene locus_tag LOCUS_18680 66156 63799 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_18680 66714 67247 gene locus_tag LOCUS_18690 66714 67247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 67258 67464 gene locus_tag LOCUS_18700 67258 67464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 69195 67918 gene locus_tag LOCUS_18710 69195 67918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_18710 69428 70186 gene locus_tag LOCUS_18720 69428 70186 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_18720 71890 70451 gene locus_tag LOCUS_18730 71890 70451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 75408 71887 gene locus_tag LOCUS_18740 75408 71887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 76826 75534 gene locus_tag LOCUS_18750 gene crnA 76826 75534 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_18750 77770 77099 gene locus_tag LOCUS_18760 77770 77099 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_18760 79580 77781 gene locus_tag LOCUS_18770 79580 77781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 80164 79586 gene locus_tag LOCUS_18780 80164 79586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 80553 80176 gene locus_tag LOCUS_18790 gene nirD-2 80553 80176 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_18790 83088 80584 gene locus_tag LOCUS_18800 gene nirB 83088 80584 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205570.1 protein_id gnl|my_center|LOCUS_18800 84250 83774 gene locus_tag LOCUS_18810 84250 83774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18810 85014 84313 gene locus_tag LOCUS_18820 85014 84313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18820 85318 85244 gene locus_tag LOCUS_t00150 85318 85244 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 86269 85451 gene locus_tag LOCUS_18830 86269 85451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 86454 89555 gene locus_tag LOCUS_18840 86454 89555 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963084.1 protein_id gnl|my_center|LOCUS_18840 89552 90781 gene locus_tag LOCUS_18850 89552 90781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 90852 92321 gene locus_tag LOCUS_18860 90852 92321 CDS product glycosyl hydrolase family 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963086.1 protein_id gnl|my_center|LOCUS_18860 92357 92965 gene locus_tag LOCUS_18870 92357 92965 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_18870 <93822 93064 gene locus_tag LOCUS_18880 <93822 93064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963087.1:glycosyl transferase family 1 >Feature sequence15 408 49 gene locus_tag LOCUS_18890 408 49 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_18890 1426 446 gene locus_tag LOCUS_18900 1426 446 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_18900 2151 1558 gene locus_tag LOCUS_18910 gene ctaE 2151 1558 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_18910 2978 2151 gene locus_tag LOCUS_18920 gene ctaB 2978 2151 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_18920 3557 3255 gene locus_tag LOCUS_18930 3557 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920128.1 protein_id gnl|my_center|LOCUS_18930 5730 3613 gene locus_tag LOCUS_18940 5730 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964216.1 protein_id gnl|my_center|LOCUS_18940 6675 5902 gene locus_tag LOCUS_18950 6675 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 7516 6788 gene locus_tag LOCUS_18960 7516 6788 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_18960 7958 7572 gene locus_tag LOCUS_18970 7958 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 8331 7951 gene locus_tag LOCUS_18980 gene gcvH 8331 7951 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_18980 15587 8346 gene locus_tag LOCUS_18990 gene sprA 15587 8346 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_18990 16241 15660 gene locus_tag LOCUS_19000 gene ruvA 16241 15660 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_19000 18625 16316 gene locus_tag LOCUS_19010 gene maeB 18625 16316 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_19010 19627 18698 gene locus_tag LOCUS_19020 gene ydjE 19627 18698 CDS product putative sugar kinase YdjE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34768 protein_id gnl|my_center|LOCUS_19020 20796 19624 gene locus_tag LOCUS_19030 20796 19624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 22275 20797 gene locus_tag LOCUS_19040 gene suc1 22275 20797 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_19040 23367 22435 gene locus_tag LOCUS_19050 gene queG 23367 22435 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_19050 24686 23364 gene locus_tag LOCUS_19060 24686 23364 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_19060 25712 24690 gene locus_tag LOCUS_19070 gene ruvB 25712 24690 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_19070 27517 25832 gene locus_tag LOCUS_19080 gene ctaD 27517 25832 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_19080 28755 27688 gene locus_tag LOCUS_19090 gene ctaC 28755 27688 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_19090 30101 28782 gene locus_tag LOCUS_19100 gene actF 30101 28782 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_19100 30832 30170 gene locus_tag LOCUS_19110 gene actE 30832 30170 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_19110 31375 30836 gene locus_tag LOCUS_19120 gene actD 31375 30836 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_19120 33165 31378 gene locus_tag LOCUS_19130 gene actC 33165 31378 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_19130 36285 33199 gene locus_tag LOCUS_19140 gene actB 36285 33199 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_19140 37685 36345 gene locus_tag LOCUS_19150 gene actA 37685 36345 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_19150 37906 38292 gene locus_tag LOCUS_19160 37906 38292 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962542.1 protein_id gnl|my_center|LOCUS_19160 41169 38365 gene locus_tag LOCUS_19170 gene infB 41169 38365 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 protein_id gnl|my_center|LOCUS_19170 42453 41224 gene locus_tag LOCUS_19180 gene nusA 42453 41224 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_19180 42927 42463 gene locus_tag LOCUS_19190 gene rimP 42927 42463 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV6 protein_id gnl|my_center|LOCUS_19190 43096 43929 gene locus_tag LOCUS_19200 gene uspA 43096 43929 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_19200 44040 44360 gene locus_tag LOCUS_19210 44040 44360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 44493 44420 gene locus_tag LOCUS_t00160 44493 44420 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 44850 48137 gene locus_tag LOCUS_19220 44850 48137 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 protein_id gnl|my_center|LOCUS_19220 48137 48787 gene locus_tag LOCUS_19230 48137 48787 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_19230 49080 48784 gene locus_tag LOCUS_19240 49080 48784 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_19240 50606 49155 gene locus_tag LOCUS_19250 50606 49155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 51950 50736 gene locus_tag LOCUS_19260 51950 50736 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_19260 52084 53079 gene locus_tag LOCUS_19270 gene aspG 52084 53079 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_19270 53814 53377 gene locus_tag LOCUS_19280 53814 53377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 53924 54694 gene locus_tag LOCUS_19290 53924 54694 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_19290 54818 55876 gene locus_tag LOCUS_19300 54818 55876 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_19300 55860 56885 gene locus_tag LOCUS_19310 gene ansA 55860 56885 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_19310 56981 57069 gene locus_tag LOCUS_t00170 56981 57069 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 57143 57934 gene locus_tag LOCUS_19320 57143 57934 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_19320 57966 58406 gene locus_tag LOCUS_19330 57966 58406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 58420 59025 gene locus_tag LOCUS_19340 58420 59025 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_19340 59047 59526 gene locus_tag LOCUS_19350 59047 59526 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108110.1 protein_id gnl|my_center|LOCUS_19350 59682 60347 gene locus_tag LOCUS_19360 59682 60347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_19360 60910 60335 gene locus_tag LOCUS_19370 60910 60335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 62451 60943 gene locus_tag LOCUS_19380 gene rpoN 62451 60943 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_19380 63145 62510 gene locus_tag LOCUS_19390 63145 62510 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963563.1 protein_id gnl|my_center|LOCUS_19390 63909 63151 gene locus_tag LOCUS_19400 63909 63151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 64643 63912 gene locus_tag LOCUS_19410 64643 63912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 65423 64689 gene locus_tag LOCUS_19420 65423 64689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 66158 65517 gene locus_tag LOCUS_19430 66158 65517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 67756 66317 gene locus_tag LOCUS_19440 gene asnS 67756 66317 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_19440 70294 67883 gene locus_tag LOCUS_19450 70294 67883 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_19450 72566 70419 gene locus_tag LOCUS_19460 72566 70419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962609.1 protein_id gnl|my_center|LOCUS_19460 73211 72648 gene locus_tag LOCUS_19470 gene frr 73211 72648 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_19470 73967 73260 gene locus_tag LOCUS_19480 gene pyrH 73967 73260 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_19480 75053 74088 gene locus_tag LOCUS_19490 gene tsf 75053 74088 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKH3 protein_id gnl|my_center|LOCUS_19490 75938 75150 gene locus_tag LOCUS_19500 gene rpsB 75938 75150 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_19500 76519 76133 gene locus_tag LOCUS_19510 gene rpsI 76519 76133 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU3 protein_id gnl|my_center|LOCUS_19510 76975 76520 gene locus_tag LOCUS_19520 gene rplM 76975 76520 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 protein_id gnl|my_center|LOCUS_19520 77509 80583 gene locus_tag LOCUS_19530 77509 80583 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792393.1 protein_id gnl|my_center|LOCUS_19530 80594 82159 gene locus_tag LOCUS_19540 80594 82159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796344.1 protein_id gnl|my_center|LOCUS_19540 85097 82251 gene locus_tag LOCUS_19550 gene polA 85097 82251 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_19550 85248 85547 gene locus_tag LOCUS_19560 85248 85547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087848.1 protein_id gnl|my_center|LOCUS_19560 86848 85613 gene locus_tag LOCUS_19570 gene sucB 86848 85613 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_19570 <89708 86897 gene locus_tag LOCUS_19580 <89708 86897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964496.1:2-oxoglutarate dehydrogenase subunit E1 >Feature sequence16 916 29 gene locus_tag LOCUS_19590 916 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1844 921 gene locus_tag LOCUS_19600 1844 921 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_19600 3135 1846 gene locus_tag LOCUS_19610 gene natB 3135 1846 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_19610 4091 3135 gene locus_tag LOCUS_19620 gene natA 4091 3135 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_19620 5531 4404 gene locus_tag LOCUS_19630 gene dnaJ 5531 4404 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_19630 6149 5574 gene locus_tag LOCUS_19640 gene grpE 6149 5574 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_19640 6210 6974 gene locus_tag LOCUS_19650 6210 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 7981 7052 gene locus_tag LOCUS_19660 7981 7052 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_19660 8104 9708 gene locus_tag LOCUS_19670 gene lnt 8104 9708 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCC4 protein_id gnl|my_center|LOCUS_19670 11111 9723 gene locus_tag LOCUS_19680 11111 9723 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_19680 12159 11146 gene locus_tag LOCUS_19690 12159 11146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 13486 12116 gene locus_tag LOCUS_19700 13486 12116 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_19700 14540 13479 gene locus_tag LOCUS_19710 14540 13479 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963378.1 protein_id gnl|my_center|LOCUS_19710 15654 14542 gene locus_tag LOCUS_19720 15654 14542 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963379.1 protein_id gnl|my_center|LOCUS_19720 16640 15651 gene locus_tag LOCUS_19730 16640 15651 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963382.1 protein_id gnl|my_center|LOCUS_19730 18181 16640 gene locus_tag LOCUS_19740 18181 16640 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963383.1 protein_id gnl|my_center|LOCUS_19740 19317 18178 gene locus_tag LOCUS_19750 19317 18178 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963384.1 protein_id gnl|my_center|LOCUS_19750 20390 19317 gene locus_tag LOCUS_19760 20390 19317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 21790 20387 gene locus_tag LOCUS_19770 21790 20387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963386.1 protein_id gnl|my_center|LOCUS_19770 23003 21879 gene locus_tag LOCUS_19780 gene neuC 23003 21879 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963387.1 protein_id gnl|my_center|LOCUS_19780 24040 23000 gene locus_tag LOCUS_19790 gene neuB 24040 23000 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963388.1 protein_id gnl|my_center|LOCUS_19790 24719 24057 gene locus_tag LOCUS_19800 gene neuA 24719 24057 CDS product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963389.1 protein_id gnl|my_center|LOCUS_19800 25660 24716 gene locus_tag LOCUS_19810 25660 24716 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963393.1 protein_id gnl|my_center|LOCUS_19810 26352 25660 gene locus_tag LOCUS_19820 26352 25660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 27380 26466 gene locus_tag LOCUS_19830 27380 26466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 28632 27367 gene locus_tag LOCUS_19840 28632 27367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 29604 28633 gene locus_tag LOCUS_19850 29604 28633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 30543 29608 gene locus_tag LOCUS_19860 30543 29608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 31336 30563 gene locus_tag LOCUS_19870 31336 30563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 32288 31341 gene locus_tag LOCUS_19880 32288 31341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 33117 32302 gene locus_tag LOCUS_19890 33117 32302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 33956 33114 gene locus_tag LOCUS_19900 33956 33114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 34554 33985 gene locus_tag LOCUS_19910 34554 33985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 35882 34941 gene locus_tag LOCUS_19920 35882 34941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 36904 35879 gene locus_tag LOCUS_19930 36904 35879 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963754.1 protein_id gnl|my_center|LOCUS_19930 37901 36912 gene locus_tag LOCUS_19940 37901 36912 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963393.1 protein_id gnl|my_center|LOCUS_19940 38994 37906 gene locus_tag LOCUS_19950 38994 37906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 39799 38996 gene locus_tag LOCUS_19960 39799 38996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 41161 39812 gene locus_tag LOCUS_19970 41161 39812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 41937 41194 gene locus_tag LOCUS_19980 41937 41194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 42739 41921 gene locus_tag LOCUS_19990 42739 41921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 43910 42732 gene locus_tag LOCUS_20000 gene xapH 43910 42732 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_20000 44621 43911 gene locus_tag LOCUS_20010 44621 43911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 45550 44846 gene locus_tag LOCUS_20020 45550 44846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288205.1 protein_id gnl|my_center|LOCUS_20020 48046 45563 gene locus_tag LOCUS_20030 gene wzc 48046 45563 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_20030 48838 48047 gene locus_tag LOCUS_20040 gene wza 48838 48047 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 protein_id gnl|my_center|LOCUS_20040 51263 49062 gene locus_tag LOCUS_20050 gene recQ1 51263 49062 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 protein_id gnl|my_center|LOCUS_20050 51348 52316 gene locus_tag LOCUS_20060 gene kdsD 51348 52316 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_20060 52316 53161 gene locus_tag LOCUS_20070 gene tatC 52316 53161 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_20070 53209 53574 gene locus_tag LOCUS_20080 53209 53574 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_20080 53632 54372 gene locus_tag LOCUS_20090 gene lptB 53632 54372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_20090 55572 54388 gene locus_tag LOCUS_20100 55572 54388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 56531 55734 gene locus_tag LOCUS_20110 56531 55734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 57158 56535 gene locus_tag LOCUS_20120 gene yjhB 57158 56535 CDS product putative ADP-ribose pyrophosphatase YjhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0SPC3 protein_id gnl|my_center|LOCUS_20120 58253 57165 gene locus_tag LOCUS_20130 58253 57165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 59111 58371 gene locus_tag LOCUS_20140 gene pssA 59111 58371 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_20140 59368 60375 gene locus_tag LOCUS_20150 59368 60375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_20150 61066 60383 gene locus_tag LOCUS_20160 61066 60383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_20160 61580 61068 gene locus_tag LOCUS_20170 61580 61068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 61685 62755 gene locus_tag LOCUS_20180 61685 62755 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_20180 62906 63838 gene locus_tag LOCUS_20190 gene ppiC 62906 63838 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_20190 63965 64153 gene locus_tag LOCUS_20200 63965 64153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 64922 64158 gene locus_tag LOCUS_20210 64922 64158 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ8 protein_id gnl|my_center|LOCUS_20210 65369 65085 gene locus_tag LOCUS_20220 65369 65085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 66127 65432 gene locus_tag LOCUS_20230 66127 65432 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_20230 66982 66212 gene locus_tag LOCUS_20240 66982 66212 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_20240 68872 66989 gene locus_tag LOCUS_20250 68872 66989 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_20250 69311 68925 gene locus_tag LOCUS_20260 69311 68925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_20260 69360 69548 gene locus_tag LOCUS_20270 69360 69548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 69631 70686 gene locus_tag LOCUS_20280 69631 70686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963854.1 protein_id gnl|my_center|LOCUS_20280 70909 72117 gene locus_tag LOCUS_20290 70909 72117 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_20290 73501 72107 gene locus_tag LOCUS_20300 73501 72107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 73856 73608 gene locus_tag LOCUS_20310 73856 73608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 73992 74912 gene locus_tag LOCUS_20320 gene lipA 73992 74912 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_20320 74923 75918 gene locus_tag LOCUS_20330 gene gapA1 74923 75918 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963588.1 protein_id gnl|my_center|LOCUS_20330 76082 78196 gene locus_tag LOCUS_20340 76082 78196 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_20340 79206 78193 gene locus_tag LOCUS_20350 gene lpxK 79206 78193 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_20350 79388 80482 gene locus_tag LOCUS_20360 gene yqfO 79388 80482 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX9 protein_id gnl|my_center|LOCUS_20360 >Feature sequence17 541 143 gene locus_tag LOCUS_20370 541 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 753 538 gene locus_tag LOCUS_20380 753 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1126 722 gene locus_tag LOCUS_20390 1126 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_20390 3675 1123 gene locus_tag LOCUS_20400 gene sprE 3675 1123 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_20400 3805 4998 gene locus_tag LOCUS_20410 3805 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 5716 5003 gene locus_tag LOCUS_20420 5716 5003 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_20420 7254 5785 gene locus_tag LOCUS_20430 7254 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 7360 8412 gene locus_tag LOCUS_20440 gene paaE 7360 8412 CDS product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_20440 8612 8472 gene locus_tag LOCUS_20450 8612 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 9571 8624 gene locus_tag LOCUS_20460 9571 8624 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939052.1 protein_id gnl|my_center|LOCUS_20460 10630 9638 gene locus_tag LOCUS_20470 10630 9638 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964556.1 protein_id gnl|my_center|LOCUS_20470 11296 10682 gene locus_tag LOCUS_20480 11296 10682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_20480 12299 11304 gene locus_tag LOCUS_20490 12299 11304 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106543.1 protein_id gnl|my_center|LOCUS_20490 12976 12296 gene locus_tag LOCUS_20500 12976 12296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 13860 12937 gene locus_tag LOCUS_20510 13860 12937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964559.1 protein_id gnl|my_center|LOCUS_20510 13942 14157 gene locus_tag LOCUS_20520 13942 14157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 15505 14234 gene locus_tag LOCUS_20530 gene purD 15505 14234 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_20530 15576 16874 gene locus_tag LOCUS_20540 gene capK 15576 16874 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964561.1 protein_id gnl|my_center|LOCUS_20540 17641 16871 gene locus_tag LOCUS_20550 gene tuaG 17641 16871 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426498.1 protein_id gnl|my_center|LOCUS_20550 18971 17619 gene locus_tag LOCUS_20560 gene wcaJ 18971 17619 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_20560 19161 20240 gene locus_tag LOCUS_20570 gene rfaG 19161 20240 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476428.1 protein_id gnl|my_center|LOCUS_20570 21060 20218 gene locus_tag LOCUS_20580 21060 20218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 22537 21470 gene locus_tag LOCUS_20590 22537 21470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 23847 22537 gene locus_tag LOCUS_20600 23847 22537 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_20600 24836 23889 gene locus_tag LOCUS_20610 24836 23889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 26528 24837 gene locus_tag LOCUS_20620 26528 24837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_20620 28040 26547 gene locus_tag LOCUS_20630 28040 26547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_20630 28906 28040 gene locus_tag LOCUS_20640 28906 28040 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_20640 29026 29232 gene locus_tag LOCUS_20650 gene tatA 29026 29232 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G3 protein_id gnl|my_center|LOCUS_20650 30276 29308 gene locus_tag LOCUS_20660 30276 29308 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_20660 31906 30296 gene locus_tag LOCUS_20670 31906 30296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 33179 31992 gene locus_tag LOCUS_20680 gene pgk 33179 31992 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_20680 33319 34467 gene locus_tag LOCUS_20690 gene holB 33319 34467 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_20690 35075 34512 gene locus_tag LOCUS_20700 35075 34512 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962186.1 protein_id gnl|my_center|LOCUS_20700 36129 35287 gene locus_tag LOCUS_20710 36129 35287 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_20710 38061 36184 gene locus_tag LOCUS_20720 gene mnmG 38061 36184 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_20720 38554 38141 gene locus_tag LOCUS_20730 gene ybeY 38554 38141 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_20730 41942 38547 gene locus_tag LOCUS_20740 41942 38547 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_20740 42156 43670 gene locus_tag LOCUS_20750 gene gltX 42156 43670 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 protein_id gnl|my_center|LOCUS_20750 44324 43665 gene locus_tag LOCUS_20760 44324 43665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 44414 45433 gene locus_tag LOCUS_20770 44414 45433 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_20770 45746 45504 gene locus_tag LOCUS_20780 45746 45504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 46147 45749 gene locus_tag LOCUS_20790 46147 45749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 46528 46154 gene locus_tag LOCUS_20800 46528 46154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 48705 46675 gene locus_tag LOCUS_20810 gene glnS 48705 46675 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_20810 48914 49270 gene locus_tag LOCUS_20820 gene folB 48914 49270 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_20820 49322 49393 gene locus_tag LOCUS_t00180 49322 49393 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 50580 49864 gene locus_tag LOCUS_20830 50580 49864 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_20830 51371 50703 gene locus_tag LOCUS_20840 51371 50703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 53725 51521 gene locus_tag LOCUS_20850 gene rnr 53725 51521 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_20850 54739 55179 gene locus_tag LOCUS_20860 54739 55179 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986713.1 protein_id gnl|my_center|LOCUS_20860 55608 55225 gene locus_tag LOCUS_20870 55608 55225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 57370 55745 gene locus_tag LOCUS_20880 gene prc 57370 55745 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 protein_id gnl|my_center|LOCUS_20880 58192 57374 gene locus_tag LOCUS_20890 58192 57374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680721.1 protein_id gnl|my_center|LOCUS_20890 58592 58203 gene locus_tag LOCUS_20900 58592 58203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 61247 58677 gene locus_tag LOCUS_20910 61247 58677 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_20910 63215 61371 gene locus_tag LOCUS_20920 63215 61371 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_20920 64880 63222 gene locus_tag LOCUS_20930 64880 63222 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_20930 65821 64964 gene locus_tag LOCUS_20940 65821 64964 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_20940 66051 67928 gene locus_tag LOCUS_20950 66051 67928 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_20950 68082 69176 gene locus_tag LOCUS_20960 gene gfo 68082 69176 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036051.1 protein_id gnl|my_center|LOCUS_20960 69385 69215 gene locus_tag LOCUS_20970 69385 69215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 71182 69386 gene locus_tag LOCUS_20980 gene lepA 71182 69386 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_20980 71352 73757 gene locus_tag LOCUS_20990 71352 73757 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_20990 73881 74885 gene locus_tag LOCUS_21000 73881 74885 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_21000 76092 74890 gene locus_tag LOCUS_21010 76092 74890 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_21010 76494 76102 gene locus_tag LOCUS_21020 gene rbfA 76494 76102 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 protein_id gnl|my_center|LOCUS_21020 76594 77016 gene locus_tag LOCUS_21030 76594 77016 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_21030 77087 77163 gene locus_tag LOCUS_t00190 77087 77163 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 78065 77373 gene locus_tag LOCUS_21040 78065 77373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 78612 78055 gene locus_tag LOCUS_21050 78612 78055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence18 283 1728 gene locus_tag LOCUS_21060 283 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2759 1725 gene locus_tag LOCUS_21070 2759 1725 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016192.1 protein_id gnl|my_center|LOCUS_21070 3234 2920 gene locus_tag LOCUS_21080 3234 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 4124 3240 gene locus_tag LOCUS_21090 4124 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016190.1 protein_id gnl|my_center|LOCUS_21090 4320 4922 gene locus_tag LOCUS_21100 4320 4922 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273869.1 protein_id gnl|my_center|LOCUS_21100 5117 4914 gene locus_tag LOCUS_21110 5117 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 5516 5226 gene locus_tag LOCUS_21120 5516 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 6025 5513 gene locus_tag LOCUS_21130 6025 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 6677 6604 gene locus_tag LOCUS_t00200 6677 6604 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6823 7554 gene locus_tag LOCUS_21140 gene coaX 6823 7554 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B4 protein_id gnl|my_center|LOCUS_21140 7554 8810 gene locus_tag LOCUS_21150 7554 8810 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_21150 8841 10217 gene locus_tag LOCUS_21160 8841 10217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 10218 10808 gene locus_tag LOCUS_21170 10218 10808 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 protein_id gnl|my_center|LOCUS_21170 10808 10999 gene locus_tag LOCUS_21180 10808 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 11005 12291 gene locus_tag LOCUS_21190 11005 12291 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_21190 12389 14512 gene locus_tag LOCUS_21200 12389 14512 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_21200 15501 14581 gene locus_tag LOCUS_21210 15501 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_21210 16549 15503 gene locus_tag LOCUS_21220 16549 15503 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258998.1 protein_id gnl|my_center|LOCUS_21220 17913 16585 gene locus_tag LOCUS_21230 gene mvaA 17913 16585 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_21230 18372 20543 gene locus_tag LOCUS_21240 gene pepX1 18372 20543 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_21240 20550 21962 gene locus_tag LOCUS_21250 20550 21962 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707249.1 protein_id gnl|my_center|LOCUS_21250 21978 23720 gene locus_tag LOCUS_21260 21978 23720 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404697.1 protein_id gnl|my_center|LOCUS_21260 23761 24309 gene locus_tag LOCUS_21270 23761 24309 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_21270 26350 24317 gene locus_tag LOCUS_21280 26350 24317 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_21280 26985 26404 gene locus_tag LOCUS_21290 26985 26404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 28138 27017 gene locus_tag LOCUS_21300 gene lpxB 28138 27017 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_21300 28957 28175 gene locus_tag LOCUS_21310 gene surE 28957 28175 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_21310 29082 31229 gene locus_tag LOCUS_21320 29082 31229 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_21320 31332 32351 gene locus_tag LOCUS_21330 31332 32351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 32352 33158 gene locus_tag LOCUS_21340 gene nucA 32352 33158 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_21340 34426 33161 gene locus_tag LOCUS_21350 gene rodA 34426 33161 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_21350 36270 34426 gene locus_tag LOCUS_21360 gene pbpA 36270 34426 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_21360 36842 36336 gene locus_tag LOCUS_21370 gene mreD 36842 36336 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_21370 37599 36832 gene locus_tag LOCUS_21380 gene mreC 37599 36832 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 protein_id gnl|my_center|LOCUS_21380 38699 37671 gene locus_tag LOCUS_21390 gene mreB 38699 37671 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_21390 40298 38772 gene locus_tag LOCUS_21400 gene purH 40298 38772 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_21400 40437 41690 gene locus_tag LOCUS_21410 40437 41690 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_21410 42157 41693 gene locus_tag LOCUS_21420 42157 41693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 42667 42209 gene locus_tag LOCUS_21430 42667 42209 CDS product GAF domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_21430 42705 43247 gene locus_tag LOCUS_21440 42705 43247 CDS product exosortase family protein XrtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964136.1 protein_id gnl|my_center|LOCUS_21440 43244 43681 gene locus_tag LOCUS_21450 43244 43681 CDS product exosortase F system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964135.1 protein_id gnl|my_center|LOCUS_21450 43716 44252 gene locus_tag LOCUS_21460 43716 44252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 46013 44370 gene locus_tag LOCUS_21470 gene groL 46013 44370 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_21470 46364 46089 gene locus_tag LOCUS_21480 gene groS 46364 46089 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_21480 46854 46510 gene locus_tag LOCUS_21490 46854 46510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 47841 46909 gene locus_tag LOCUS_21500 47841 46909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_21500 48357 47842 gene locus_tag LOCUS_21510 48357 47842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_21510 49665 48406 gene locus_tag LOCUS_21520 49665 48406 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_21520 51120 49675 gene locus_tag LOCUS_21530 gene miaB 51120 49675 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_21530 51375 53921 gene locus_tag LOCUS_21540 gene topA 51375 53921 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_21540 53925 55091 gene locus_tag LOCUS_21550 gene fjo29 53925 55091 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_21550 55199 56572 gene locus_tag LOCUS_21560 gene gldK 55199 56572 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_21560 56639 57277 gene locus_tag LOCUS_21570 gene gldL 56639 57277 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_21570 57324 58856 gene locus_tag LOCUS_21580 gene gldM 57324 58856 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_21580 58907 59758 gene locus_tag LOCUS_21590 gene gldN 58907 59758 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_21590 59829 60884 gene locus_tag LOCUS_21600 gene fjo30 59829 60884 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_21600 61200 60871 gene locus_tag LOCUS_21610 61200 60871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_21610 61395 63302 gene locus_tag LOCUS_21620 61395 63302 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_21620 63391 64530 gene locus_tag LOCUS_21630 63391 64530 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932152.1 protein_id gnl|my_center|LOCUS_21630 64535 67732 gene locus_tag LOCUS_21640 64535 67732 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_21640 67719 69056 gene locus_tag LOCUS_21650 67719 69056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 69060 69242 gene locus_tag LOCUS_21660 69060 69242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 69274 69630 gene locus_tag LOCUS_21670 69274 69630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 71195 69627 gene locus_tag LOCUS_21680 71195 69627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 71323 71396 gene locus_tag LOCUS_t00210 71323 71396 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 72035 72403 gene locus_tag LOCUS_21690 72035 72403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 72411 72911 gene locus_tag LOCUS_21700 72411 72911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 72892 73155 gene locus_tag LOCUS_21710 72892 73155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 73169 73435 gene locus_tag LOCUS_21720 73169 73435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 73443 73706 gene locus_tag LOCUS_21730 73443 73706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 73708 74010 gene locus_tag LOCUS_21740 73708 74010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 74087 75355 gene locus_tag LOCUS_21750 gene eriC 74087 75355 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080004.1 protein_id gnl|my_center|LOCUS_21750 75904 76191 gene locus_tag LOCUS_21760 75904 76191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 76210 77388 gene locus_tag LOCUS_21770 76210 77388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962655.1 protein_id gnl|my_center|LOCUS_21770 77630 78478 gene locus_tag LOCUS_21780 gene traP 77630 78478 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361991.1 protein_id gnl|my_center|LOCUS_21780 78563 78862 gene locus_tag LOCUS_21790 78563 78862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence19 85 10 gene locus_tag LOCUS_t00220 85 10 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1373 150 gene locus_tag LOCUS_21800 gene folC 1373 150 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_21800 2203 1373 gene locus_tag LOCUS_21810 2203 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964028.1 protein_id gnl|my_center|LOCUS_21810 2746 2354 gene locus_tag LOCUS_21820 2746 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 3452 2748 gene locus_tag LOCUS_21830 3452 2748 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_21830 4953 3529 gene locus_tag LOCUS_21840 gene nhaB 4953 3529 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2S5 protein_id gnl|my_center|LOCUS_21840 6263 5037 gene locus_tag LOCUS_21850 6263 5037 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_21850 7403 6330 gene locus_tag LOCUS_21860 7403 6330 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_21860 7640 8782 gene locus_tag LOCUS_21870 7640 8782 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_21870 9432 8860 gene locus_tag LOCUS_21880 9432 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 11212 9563 gene locus_tag LOCUS_21890 11212 9563 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087177.1 protein_id gnl|my_center|LOCUS_21890 11646 12815 gene locus_tag LOCUS_21900 11646 12815 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAU4 protein_id gnl|my_center|LOCUS_21900 12831 13868 gene locus_tag LOCUS_21910 gene galT 12831 13868 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31764 protein_id gnl|my_center|LOCUS_21910 13870 14883 gene locus_tag LOCUS_21920 13870 14883 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_21920 16082 15060 gene locus_tag LOCUS_21930 gene galE 16082 15060 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_21930 16885 16079 gene locus_tag LOCUS_21940 gene nagD 16885 16079 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULY1 protein_id gnl|my_center|LOCUS_21940 20128 16952 gene locus_tag LOCUS_21950 20128 16952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 21139 20129 gene locus_tag LOCUS_21960 21139 20129 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYB8 protein_id gnl|my_center|LOCUS_21960 21322 21807 gene locus_tag LOCUS_21970 21322 21807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 21837 22517 gene locus_tag LOCUS_21980 21837 22517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_21980 22524 23336 gene locus_tag LOCUS_21990 gene deoD 22524 23336 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH2 protein_id gnl|my_center|LOCUS_21990 23426 23764 gene locus_tag LOCUS_22000 23426 23764 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 protein_id gnl|my_center|LOCUS_22000 23835 24902 gene locus_tag LOCUS_22010 23835 24902 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_22010 25014 25628 gene locus_tag LOCUS_22020 25014 25628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 25699 28914 gene locus_tag LOCUS_22030 25699 28914 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_22030 28945 30387 gene locus_tag LOCUS_22040 28945 30387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_22040 30398 31735 gene locus_tag LOCUS_22050 30398 31735 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943755.1 protein_id gnl|my_center|LOCUS_22050 31663 32544 gene locus_tag LOCUS_22060 31663 32544 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2I9 protein_id gnl|my_center|LOCUS_22060 32572 33540 gene locus_tag LOCUS_22070 32572 33540 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_22070 35093 33606 gene locus_tag LOCUS_22080 35093 33606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 36244 35315 gene locus_tag LOCUS_22090 gene era 36244 35315 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_22090 37167 36415 gene locus_tag LOCUS_22100 37167 36415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 38498 37281 gene locus_tag LOCUS_22110 38498 37281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 39141 38509 gene locus_tag LOCUS_22120 39141 38509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 40629 39160 gene locus_tag LOCUS_22130 40629 39160 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109009.1 protein_id gnl|my_center|LOCUS_22130 40991 40632 gene locus_tag LOCUS_22140 40991 40632 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_22140 41951 41154 gene locus_tag LOCUS_22150 41951 41154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_22150 42203 43672 gene locus_tag LOCUS_22160 42203 43672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_22160 43835 44743 gene locus_tag LOCUS_22170 43835 44743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 46043 44811 gene locus_tag LOCUS_22180 gene clpX 46043 44811 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_22180 46792 46118 gene locus_tag LOCUS_22190 gene clpP 46792 46118 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_22190 48267 46945 gene locus_tag LOCUS_22200 gene tig 48267 46945 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_22200 48704 48363 gene locus_tag LOCUS_22210 48704 48363 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_22210 50325 48823 gene locus_tag LOCUS_22220 50325 48823 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_22220 51602 50340 gene locus_tag LOCUS_22230 51602 50340 CDS product putative outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1M2 protein_id gnl|my_center|LOCUS_22230 52644 51874 gene locus_tag LOCUS_22240 52644 51874 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_22240 53359 52646 gene locus_tag LOCUS_22250 gene pdxJ 53359 52646 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 protein_id gnl|my_center|LOCUS_22250 53446 54108 gene locus_tag LOCUS_22260 53446 54108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_22260 54128 55012 gene locus_tag LOCUS_22270 gene nadK 54128 55012 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_22270 55112 55804 gene locus_tag LOCUS_22280 55112 55804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_22280 55814 56554 gene locus_tag LOCUS_22290 gene uppS 55814 56554 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_22290 56559 59141 gene locus_tag LOCUS_22300 gene bamA 56559 59141 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 protein_id gnl|my_center|LOCUS_22300 59175 59981 gene locus_tag LOCUS_22310 gene skp 59175 59981 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964196.1 protein_id gnl|my_center|LOCUS_22310 60054 60566 gene locus_tag LOCUS_22320 60054 60566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 60639 61430 gene locus_tag LOCUS_22330 gene murI 60639 61430 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D7 protein_id gnl|my_center|LOCUS_22330 62302 61427 gene locus_tag LOCUS_22340 62302 61427 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_22340 62522 63466 gene locus_tag LOCUS_22350 62522 63466 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 protein_id gnl|my_center|LOCUS_22350 63561 63761 gene locus_tag LOCUS_22360 63561 63761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_22360 63956 64813 gene locus_tag LOCUS_22370 63956 64813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_22370 65510 64836 gene locus_tag LOCUS_22380 65510 64836 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_22380 66782 65514 gene locus_tag LOCUS_22390 66782 65514 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_22390 68148 66823 gene locus_tag LOCUS_22400 68148 66823 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_22400 69366 68215 gene locus_tag LOCUS_22410 69366 68215 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_22410 70655 69396 gene locus_tag LOCUS_22420 70655 69396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_22420 71909 70665 gene locus_tag LOCUS_22430 71909 70665 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_22430 72603 71902 gene locus_tag LOCUS_22440 72603 71902 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_22440 72944 72723 gene locus_tag LOCUS_22450 72944 72723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 73530 72955 gene locus_tag LOCUS_22460 gene yozB 73530 72955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_22460 74280 73531 gene locus_tag LOCUS_22470 gene ypmQ 74280 73531 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_22470 74917 74291 gene locus_tag LOCUS_22480 74917 74291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964209.1 protein_id gnl|my_center|LOCUS_22480 75400 75041 gene locus_tag LOCUS_22490 75400 75041 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_22490 <76374 75437 gene locus_tag LOCUS_22500 <76374 75437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964207.1:cytochrome oxidase subunit III >Feature sequence20 2233 1223 gene locus_tag LOCUS_22510 2233 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_22510 2391 2813 gene locus_tag LOCUS_22520 2391 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_22520 3620 2799 gene locus_tag LOCUS_22530 3620 2799 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_22530 5213 3711 gene locus_tag LOCUS_22540 5213 3711 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 protein_id gnl|my_center|LOCUS_22540 6755 5346 gene locus_tag LOCUS_22550 6755 5346 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_22550 8250 6838 gene locus_tag LOCUS_22560 gene gntZ 8250 6838 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPK6 protein_id gnl|my_center|LOCUS_22560 8455 9993 gene locus_tag LOCUS_22570 gene zwf 8455 9993 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P08 protein_id gnl|my_center|LOCUS_22570 10026 10736 gene locus_tag LOCUS_22580 10026 10736 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464630.1 protein_id gnl|my_center|LOCUS_22580 11639 10752 gene locus_tag LOCUS_22590 11639 10752 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 protein_id gnl|my_center|LOCUS_22590 12828 11722 gene locus_tag LOCUS_22600 12828 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 14650 13022 gene locus_tag LOCUS_22610 14650 13022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791109.1 protein_id gnl|my_center|LOCUS_22610 17739 14668 gene locus_tag LOCUS_22620 17739 14668 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_22620 18249 20390 gene locus_tag LOCUS_22630 18249 20390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 24496 20441 gene locus_tag LOCUS_22640 24496 20441 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_22640 24941 26140 gene locus_tag LOCUS_22650 24941 26140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767016.1 protein_id gnl|my_center|LOCUS_22650 26171 29272 gene locus_tag LOCUS_22660 gene lacZ 26171 29272 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56307 protein_id gnl|my_center|LOCUS_22660 29284 31242 gene locus_tag LOCUS_22670 29284 31242 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_22670 31243 32136 gene locus_tag LOCUS_22680 31243 32136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 32160 33347 gene locus_tag LOCUS_22690 32160 33347 CDS product glycosyl hydrolase family 88 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767015.1 protein_id gnl|my_center|LOCUS_22690 33414 35396 gene locus_tag LOCUS_22700 33414 35396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767024.1 protein_id gnl|my_center|LOCUS_22700 35495 36214 gene locus_tag LOCUS_22710 35495 36214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 36217 36804 gene locus_tag LOCUS_22720 36217 36804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 36931 40050 gene locus_tag LOCUS_22730 gene lacZ 36931 40050 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56307 protein_id gnl|my_center|LOCUS_22730 41011 40109 gene locus_tag LOCUS_22740 41011 40109 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442783.1 protein_id gnl|my_center|LOCUS_22740 41685 41014 gene locus_tag LOCUS_22750 41685 41014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 42914 41751 gene locus_tag LOCUS_22760 42914 41751 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 protein_id gnl|my_center|LOCUS_22760 43805 42924 gene locus_tag LOCUS_22770 43805 42924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 45778 43970 gene locus_tag LOCUS_22780 45778 43970 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_22780 47081 45891 gene locus_tag LOCUS_22790 47081 45891 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_22790 47485 47129 gene locus_tag LOCUS_22800 47485 47129 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_22800 49937 47529 gene locus_tag LOCUS_22810 49937 47529 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_22810 50398 49934 gene locus_tag LOCUS_22820 50398 49934 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_22820 52302 50533 gene locus_tag LOCUS_22830 gene fadD 52302 50533 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_22830 53393 52545 gene locus_tag LOCUS_22840 53393 52545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 53859 53473 gene locus_tag LOCUS_22850 53859 53473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 57529 53873 gene locus_tag LOCUS_22860 gene purL 57529 53873 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXH5 protein_id gnl|my_center|LOCUS_22860 58939 57722 gene locus_tag LOCUS_22870 gene rsmB 58939 57722 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_22870 59056 60066 gene locus_tag LOCUS_22880 59056 60066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_22880 60590 60147 gene locus_tag LOCUS_22890 60590 60147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_22890 61104 60607 gene locus_tag LOCUS_22900 61104 60607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 61654 61136 gene locus_tag LOCUS_22910 61654 61136 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_22910 63911 62088 gene locus_tag LOCUS_22920 gene msbA 63911 62088 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_22920 65784 64066 gene locus_tag LOCUS_22930 65784 64066 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 protein_id gnl|my_center|LOCUS_22930 66847 65900 gene locus_tag LOCUS_22940 66847 65900 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_22940 67388 66855 gene locus_tag LOCUS_22950 67388 66855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 >Feature sequence21 239 754 gene locus_tag LOCUS_22960 239 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964495.1 protein_id gnl|my_center|LOCUS_22960 1076 735 gene locus_tag LOCUS_22970 1076 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964494.1 protein_id gnl|my_center|LOCUS_22970 2061 1087 gene locus_tag LOCUS_22980 2061 1087 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_22980 2225 2830 gene locus_tag LOCUS_22990 2225 2830 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_22990 2830 4209 gene locus_tag LOCUS_23000 2830 4209 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_23000 4229 5407 gene locus_tag LOCUS_23010 4229 5407 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_23010 5409 8912 gene locus_tag LOCUS_23020 5409 8912 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_23020 9160 10908 gene locus_tag LOCUS_23030 gene aspS 9160 10908 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_23030 12932 10980 gene locus_tag LOCUS_23040 12932 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 15792 12967 gene locus_tag LOCUS_23050 15792 12967 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_23050 15979 17310 gene locus_tag LOCUS_23060 gene dgt 15979 17310 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_23060 17347 20019 gene locus_tag LOCUS_23070 17347 20019 CDS product peptidase M36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962455.1 protein_id gnl|my_center|LOCUS_23070 21794 20025 gene locus_tag LOCUS_23080 gene dxs 21794 20025 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWC0 protein_id gnl|my_center|LOCUS_23080 21891 22346 gene locus_tag LOCUS_23090 gene tadA 21891 22346 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_23090 22354 24258 gene locus_tag LOCUS_23100 22354 24258 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963092.1 protein_id gnl|my_center|LOCUS_23100 24261 24926 gene locus_tag LOCUS_23110 gene dnaQ 24261 24926 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932717.1 protein_id gnl|my_center|LOCUS_23110 25503 24919 gene locus_tag LOCUS_23120 25503 24919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 25969 25490 gene locus_tag LOCUS_23130 25969 25490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 27552 26050 gene locus_tag LOCUS_23140 27552 26050 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390242.1 protein_id gnl|my_center|LOCUS_23140 27700 28863 gene locus_tag LOCUS_23150 27700 28863 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 protein_id gnl|my_center|LOCUS_23150 31492 30197 gene locus_tag LOCUS_23160 31492 30197 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640497.1 protein_id gnl|my_center|LOCUS_23160 31818 31489 gene locus_tag LOCUS_23170 31818 31489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 32568 31963 gene locus_tag LOCUS_23180 32568 31963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 33073 32744 gene locus_tag LOCUS_23190 33073 32744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 34566 33163 gene locus_tag LOCUS_23200 34566 33163 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195116.1 protein_id gnl|my_center|LOCUS_23200 34996 35505 gene locus_tag LOCUS_23210 34996 35505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 35680 37851 gene locus_tag LOCUS_23220 35680 37851 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882559.1 protein_id gnl|my_center|LOCUS_23220 39500 37863 gene locus_tag LOCUS_23230 39500 37863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 40012 40503 gene locus_tag LOCUS_23240 40012 40503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 41636 40500 gene locus_tag LOCUS_23250 41636 40500 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204968.1 protein_id gnl|my_center|LOCUS_23250 42223 41636 gene locus_tag LOCUS_23260 42223 41636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_23260 42392 42964 gene locus_tag LOCUS_23270 42392 42964 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_23270 42974 43195 gene locus_tag LOCUS_23280 42974 43195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 43501 43208 gene locus_tag LOCUS_23290 43501 43208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 45090 43501 gene locus_tag LOCUS_23300 45090 43501 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_23300 45530 45090 gene locus_tag LOCUS_23310 45530 45090 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_23310 46224 45619 gene locus_tag LOCUS_23320 46224 45619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_23320 46333 46782 gene locus_tag LOCUS_23330 46333 46782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 46775 47785 gene locus_tag LOCUS_23340 46775 47785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144116.1 protein_id gnl|my_center|LOCUS_23340 48836 47775 gene locus_tag LOCUS_23350 48836 47775 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_23350 48950 51766 gene locus_tag LOCUS_23360 48950 51766 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_23360 51802 53208 gene locus_tag LOCUS_23370 51802 53208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 53365 53910 gene locus_tag LOCUS_23380 gene def 53365 53910 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93LE9 protein_id gnl|my_center|LOCUS_23380 53985 54563 gene locus_tag LOCUS_23390 53985 54563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 54563 56425 gene locus_tag LOCUS_23400 54563 56425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 56422 57048 gene locus_tag LOCUS_23410 gene nreC 56422 57048 CDS product oxygen regulatory protein NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CN75 protein_id gnl|my_center|LOCUS_23410 57138 57443 gene locus_tag LOCUS_23420 57138 57443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 58387 57440 gene locus_tag LOCUS_23430 58387 57440 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203227.1 protein_id gnl|my_center|LOCUS_23430 58466 59692 gene locus_tag LOCUS_23440 gene hflX 58466 59692 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 protein_id gnl|my_center|LOCUS_23440 60721 59774 gene locus_tag LOCUS_23450 60721 59774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 61314 60811 gene locus_tag LOCUS_23460 61314 60811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_23460 61660 61331 gene locus_tag LOCUS_23470 61660 61331 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_23470 62021 61665 gene locus_tag LOCUS_23480 62021 61665 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564327.1 protein_id gnl|my_center|LOCUS_23480 62458 62024 gene locus_tag LOCUS_23490 gene sufE 62458 62024 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_23490 62844 62458 gene locus_tag LOCUS_23500 62844 62458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 64165 62927 gene locus_tag LOCUS_23510 gene sufS 64165 62927 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_23510 <64762 64207 gene locus_tag LOCUS_23520 <64762 64207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964480.1:Fe-S cluster assembly protein SufD >Feature sequence22 1085 2947 gene locus_tag LOCUS_23530 1085 2947 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P21 protein_id gnl|my_center|LOCUS_23530 2951 4837 gene locus_tag LOCUS_23540 2951 4837 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785386.1 protein_id gnl|my_center|LOCUS_23540 4844 5491 gene locus_tag LOCUS_23550 4844 5491 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016415.1 protein_id gnl|my_center|LOCUS_23550 5523 6542 gene locus_tag LOCUS_23560 5523 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038032.1 protein_id gnl|my_center|LOCUS_23560 6661 8295 gene locus_tag LOCUS_23570 6661 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 10270 8306 gene locus_tag LOCUS_23580 10270 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 11926 10289 gene locus_tag LOCUS_23590 11926 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 12897 12145 gene locus_tag LOCUS_23600 12897 12145 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_23600 13085 14680 gene locus_tag LOCUS_23610 gene glpA 13085 14680 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404213.1 protein_id gnl|my_center|LOCUS_23610 14744 16237 gene locus_tag LOCUS_23620 gene glpK 14744 16237 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHM7 protein_id gnl|my_center|LOCUS_23620 16248 16979 gene locus_tag LOCUS_23630 gene glpF 16248 16979 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_23630 16999 17778 gene locus_tag LOCUS_23640 16999 17778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 18463 17780 gene locus_tag LOCUS_23650 18463 17780 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760381.1 protein_id gnl|my_center|LOCUS_23650 20220 18478 gene locus_tag LOCUS_23660 20220 18478 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_23660 20416 21840 gene locus_tag LOCUS_23670 20416 21840 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 protein_id gnl|my_center|LOCUS_23670 22825 21932 gene locus_tag LOCUS_23680 22825 21932 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021841.1 protein_id gnl|my_center|LOCUS_23680 24162 22825 gene locus_tag LOCUS_23690 gene xylE 24162 22825 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_23690 25735 24170 gene locus_tag LOCUS_23700 gene sacC 25735 24170 CDS product levanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05656 protein_id gnl|my_center|LOCUS_23700 25893 26939 gene locus_tag LOCUS_23710 25893 26939 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_23710 26942 27598 gene locus_tag LOCUS_23720 gene pgmB2 26942 27598 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_23720 27601 29907 gene locus_tag LOCUS_23730 27601 29907 CDS product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_23730 29989 30447 gene locus_tag LOCUS_23740 29989 30447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 30534 31154 gene locus_tag LOCUS_23750 30534 31154 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KF51 protein_id gnl|my_center|LOCUS_23750 32053 31151 gene locus_tag LOCUS_23760 32053 31151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 33411 32062 gene locus_tag LOCUS_23770 33411 32062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 36746 33507 gene locus_tag LOCUS_23780 36746 33507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 40089 36739 gene locus_tag LOCUS_23790 40089 36739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 43337 40089 gene locus_tag LOCUS_23800 43337 40089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 45179 43551 gene locus_tag LOCUS_23810 45179 43551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_23810 48364 45185 gene locus_tag LOCUS_23820 48364 45185 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403137.1 protein_id gnl|my_center|LOCUS_23820 48811 50067 gene locus_tag LOCUS_23830 48811 50067 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_23830 50540 50064 gene locus_tag LOCUS_23840 50540 50064 CDS product TspO/MBR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_23840 50647 51729 gene locus_tag LOCUS_23850 gene mvaD 50647 51729 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_23850 51760 52698 gene locus_tag LOCUS_23860 gene mvaK 51760 52698 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_23860 52725 53639 gene locus_tag LOCUS_23870 52725 53639 CDS product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_23870 54032 53697 gene locus_tag LOCUS_23880 54032 53697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 54408 55262 gene locus_tag LOCUS_23890 54408 55262 CDS product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962486.1 protein_id gnl|my_center|LOCUS_23890 55396 56796 gene locus_tag LOCUS_23900 gene speA 55396 56796 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_23900 56783 57727 gene locus_tag LOCUS_23910 56783 57727 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_23910 57711 58691 gene locus_tag LOCUS_23920 57711 58691 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_23920 60361 58760 gene locus_tag LOCUS_23930 60361 58760 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028586.1 protein_id gnl|my_center|LOCUS_23930 60570 61289 gene locus_tag LOCUS_23940 60570 61289 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789838.1 protein_id gnl|my_center|LOCUS_23940 61282 61911 gene locus_tag LOCUS_23950 61282 61911 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802698.1 protein_id gnl|my_center|LOCUS_23950 61908 63548 gene locus_tag LOCUS_23960 61908 63548 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661302.1 protein_id gnl|my_center|LOCUS_23960 64198 63545 gene locus_tag LOCUS_23970 64198 63545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence23 <1 1096 gene locus_tag LOCUS_23980 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXX6:UvrABC system protein A 1133 1822 gene locus_tag LOCUS_23990 1133 1822 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_23990 1943 4774 gene locus_tag LOCUS_24000 1943 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962879.1 protein_id gnl|my_center|LOCUS_24000 4964 7375 gene locus_tag LOCUS_24010 4964 7375 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_24010 8943 7417 gene locus_tag LOCUS_24020 8943 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 9454 8936 gene locus_tag LOCUS_24030 9454 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 10350 9511 gene locus_tag LOCUS_24040 gene menB 10350 9511 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_24040 11241 10399 gene locus_tag LOCUS_24050 11241 10399 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_24050 11832 11491 gene locus_tag LOCUS_24060 11832 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963785.1 protein_id gnl|my_center|LOCUS_24060 13614 11899 gene locus_tag LOCUS_24070 gene menD 13614 11899 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_24070 14757 13645 gene locus_tag LOCUS_24080 gene menF 14757 13645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 protein_id gnl|my_center|LOCUS_24080 15184 14759 gene locus_tag LOCUS_24090 15184 14759 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_24090 15350 16003 gene locus_tag LOCUS_24100 15350 16003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 16501 17226 gene locus_tag LOCUS_24110 16501 17226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 18598 17582 gene locus_tag LOCUS_24120 18598 17582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 18905 19408 gene locus_tag LOCUS_24130 18905 19408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 19786 20064 gene locus_tag LOCUS_24140 19786 20064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 20103 20468 gene locus_tag LOCUS_24150 20103 20468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24150 22615 20699 gene locus_tag LOCUS_24160 gene dnaK 22615 20699 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_24160 24855 23575 gene locus_tag LOCUS_24170 24855 23575 CDS product SOS mutagenesis and repair protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202620.1 protein_id gnl|my_center|LOCUS_24170 25223 24852 gene locus_tag LOCUS_24180 25223 24852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 25340 26773 gene locus_tag LOCUS_24190 gene sdaA 25340 26773 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_24190 30141 26770 gene locus_tag LOCUS_24200 30141 26770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 30682 30233 gene locus_tag LOCUS_24210 30682 30233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404629.1 protein_id gnl|my_center|LOCUS_24210 30822 31640 gene locus_tag LOCUS_24220 gene panB 30822 31640 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_24220 31673 32377 gene locus_tag LOCUS_24230 31673 32377 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_24230 32675 32427 gene locus_tag LOCUS_24240 32675 32427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 33674 32802 gene locus_tag LOCUS_24250 33674 32802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104336.1 protein_id gnl|my_center|LOCUS_24250 35312 33750 gene locus_tag LOCUS_24260 35312 33750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 protein_id gnl|my_center|LOCUS_24260 35440 36612 gene locus_tag LOCUS_24270 35440 36612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 36709 38094 gene locus_tag LOCUS_24280 gene leuC 36709 38094 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L7 protein_id gnl|my_center|LOCUS_24280 38095 38682 gene locus_tag LOCUS_24290 38095 38682 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_24290 38785 39900 gene locus_tag LOCUS_24300 gene leuB 38785 39900 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54354 protein_id gnl|my_center|LOCUS_24300 40738 39977 gene locus_tag LOCUS_24310 40738 39977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 42332 40941 gene locus_tag LOCUS_24320 42332 40941 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_24320 45576 42370 gene locus_tag LOCUS_24330 45576 42370 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_24330 46683 45601 gene locus_tag LOCUS_24340 46683 45601 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_24340 47216 46845 gene locus_tag LOCUS_24350 47216 46845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 48699 47401 gene locus_tag LOCUS_24360 gene argH 48699 47401 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 protein_id gnl|my_center|LOCUS_24360 49825 48761 gene locus_tag LOCUS_24370 49825 48761 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_24370 50601 49825 gene locus_tag LOCUS_24380 gene argB 50601 49825 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT7 protein_id gnl|my_center|LOCUS_24380 51561 50611 gene locus_tag LOCUS_24390 51561 50611 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_24390 52753 51620 gene locus_tag LOCUS_24400 52753 51620 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_24400 53553 52753 gene locus_tag LOCUS_24410 gene proC 53553 52753 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR3 protein_id gnl|my_center|LOCUS_24410 54617 53640 gene locus_tag LOCUS_24420 gene argC 54617 53640 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A7 protein_id gnl|my_center|LOCUS_24420 55801 54614 gene locus_tag LOCUS_24430 55801 54614 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_24430 56514 55849 gene locus_tag LOCUS_24440 56514 55849 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_24440 58496 56901 gene locus_tag LOCUS_24450 58496 56901 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941484.1 protein_id gnl|my_center|LOCUS_24450 59898 58591 gene locus_tag LOCUS_24460 gene ilvA 59898 58591 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT3 protein_id gnl|my_center|LOCUS_24460 61434 59935 gene locus_tag LOCUS_24470 gene ilvC 61434 59935 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN4 protein_id gnl|my_center|LOCUS_24470 62076 61549 gene locus_tag LOCUS_24480 gene ilvH 62076 61549 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_24480 62993 62079 gene locus_tag LOCUS_24490 62993 62079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence24 169 251 gene locus_tag LOCUS_t00230 169 251 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 782 1855 gene locus_tag LOCUS_24500 782 1855 CDS product adenosine monophosphate-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSZ0 protein_id gnl|my_center|LOCUS_24500 6713 2367 gene locus_tag LOCUS_24510 6713 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 8815 7604 gene locus_tag LOCUS_24520 8815 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 9041 9439 gene locus_tag LOCUS_24530 9041 9439 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010535380.1 protein_id gnl|my_center|LOCUS_24530 9850 10671 gene locus_tag LOCUS_24540 9850 10671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 10852 11643 gene locus_tag LOCUS_24550 10852 11643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280038.1 protein_id gnl|my_center|LOCUS_24550 12934 11720 gene locus_tag LOCUS_24560 12934 11720 CDS product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403845.1 protein_id gnl|my_center|LOCUS_24560 13717 13403 gene locus_tag LOCUS_24570 13717 13403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 14541 13714 gene locus_tag LOCUS_24580 14541 13714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 14723 14538 gene locus_tag LOCUS_24590 14723 14538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 15776 14922 gene locus_tag LOCUS_24600 gene traP 15776 14922 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361991.1 protein_id gnl|my_center|LOCUS_24600 17196 16018 gene locus_tag LOCUS_24610 17196 16018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962655.1 protein_id gnl|my_center|LOCUS_24610 17493 17215 gene locus_tag LOCUS_24620 17493 17215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 18438 17995 gene locus_tag LOCUS_24630 18438 17995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 18764 18513 gene locus_tag LOCUS_24640 18764 18513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 21294 19186 gene locus_tag LOCUS_24650 21294 19186 CDS product oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532900.1 protein_id gnl|my_center|LOCUS_24650 22013 21354 gene locus_tag LOCUS_24660 22013 21354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339093.1 protein_id gnl|my_center|LOCUS_24660 22506 22027 gene locus_tag LOCUS_24670 22506 22027 CDS product oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523768.1 protein_id gnl|my_center|LOCUS_24670 23796 22675 gene locus_tag LOCUS_24680 23796 22675 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107623.1 protein_id gnl|my_center|LOCUS_24680 24481 23984 gene locus_tag LOCUS_24690 24481 23984 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930808.1 protein_id gnl|my_center|LOCUS_24690 25052 24492 gene locus_tag LOCUS_24700 25052 24492 CDS product nodulation protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_24700 27219 26179 gene locus_tag LOCUS_24710 27219 26179 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108430.1 protein_id gnl|my_center|LOCUS_24710 27724 30759 gene locus_tag LOCUS_24720 27724 30759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 31841 30819 gene locus_tag LOCUS_24730 31841 30819 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704826.1 protein_id gnl|my_center|LOCUS_24730 34434 31972 gene locus_tag LOCUS_24740 34434 31972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 35645 34761 gene locus_tag LOCUS_24750 35645 34761 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602530.1 protein_id gnl|my_center|LOCUS_24750 36845 35664 gene locus_tag LOCUS_24760 36845 35664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 37661 36954 gene locus_tag LOCUS_24770 37661 36954 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_24770 38743 37658 gene locus_tag LOCUS_24780 38743 37658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 38885 41143 gene locus_tag LOCUS_24790 38885 41143 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 protein_id gnl|my_center|LOCUS_24790 41145 43019 gene locus_tag LOCUS_24800 41145 43019 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_24800 43066 44037 gene locus_tag LOCUS_24810 43066 44037 CDS product 1,4-beta-mannosyl-N-acetylglucosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8Y4 protein_id gnl|my_center|LOCUS_24810 44040 45098 gene locus_tag LOCUS_24820 44040 45098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 45103 46212 gene locus_tag LOCUS_24830 45103 46212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 46219 48435 gene locus_tag LOCUS_24840 46219 48435 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109056.1 protein_id gnl|my_center|LOCUS_24840 48454 50781 gene locus_tag LOCUS_24850 48454 50781 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107598.1 protein_id gnl|my_center|LOCUS_24850 50798 53029 gene locus_tag LOCUS_24860 50798 53029 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800561.1 protein_id gnl|my_center|LOCUS_24860 53224 55155 gene locus_tag LOCUS_24870 53224 55155 CDS product putative glucosamine-6-phosphate deaminase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB53 protein_id gnl|my_center|LOCUS_24870 55213 57033 gene locus_tag LOCUS_24880 gene sglT 55213 57033 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_24880 57339 59777 gene locus_tag LOCUS_24890 57339 59777 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109396.1 protein_id gnl|my_center|LOCUS_24890 59786 61237 gene locus_tag LOCUS_24900 59786 61237 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence25 2087 141 gene locus_tag LOCUS_24910 2087 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_24910 2219 2884 gene locus_tag LOCUS_24920 2219 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 4181 3324 gene locus_tag LOCUS_24930 4181 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 5693 4194 gene locus_tag LOCUS_24940 5693 4194 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769373.1 protein_id gnl|my_center|LOCUS_24940 8715 5710 gene locus_tag LOCUS_24950 8715 5710 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_24950 8986 9588 gene locus_tag LOCUS_24960 gene rnhB 8986 9588 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_24960 9655 12141 gene locus_tag LOCUS_24970 9655 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 12330 13055 gene locus_tag LOCUS_24980 12330 13055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 13757 13059 gene locus_tag LOCUS_24990 gene lipB 13757 13059 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_24990 14184 15878 gene locus_tag LOCUS_25000 gene lysS 14184 15878 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 protein_id gnl|my_center|LOCUS_25000 16191 15937 gene locus_tag LOCUS_25010 16191 15937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 16310 16816 gene locus_tag LOCUS_25020 16310 16816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 18219 16927 gene locus_tag LOCUS_25030 gene hemL 18219 16927 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW4 protein_id gnl|my_center|LOCUS_25030 19052 18219 gene locus_tag LOCUS_25040 19052 18219 CDS product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 protein_id gnl|my_center|LOCUS_25040 20005 19058 gene locus_tag LOCUS_25050 gene acdS 20005 19058 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_25050 20248 21714 gene locus_tag LOCUS_25060 20248 21714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 22166 24235 gene locus_tag LOCUS_25070 22166 24235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962778.1 protein_id gnl|my_center|LOCUS_25070 24918 25460 gene locus_tag LOCUS_25080 24918 25460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_25080 26351 25599 gene locus_tag LOCUS_25090 26351 25599 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_25090 26551 28302 gene locus_tag LOCUS_25100 gene phhA 26551 28302 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964058.1 protein_id gnl|my_center|LOCUS_25100 28905 28294 gene locus_tag LOCUS_25110 28905 28294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 protein_id gnl|my_center|LOCUS_25110 29635 28985 gene locus_tag LOCUS_25120 29635 28985 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965552.1 protein_id gnl|my_center|LOCUS_25120 30512 29787 gene locus_tag LOCUS_25130 30512 29787 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_25130 32379 30595 gene locus_tag LOCUS_25140 32379 30595 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 protein_id gnl|my_center|LOCUS_25140 32617 32432 gene locus_tag LOCUS_25150 32617 32432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 34233 33160 gene locus_tag LOCUS_25160 34233 33160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 34925 34416 gene locus_tag LOCUS_25170 34925 34416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 35875 34997 gene locus_tag LOCUS_25180 35875 34997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_25180 38489 35955 gene locus_tag LOCUS_25190 gene alaS 38489 35955 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 protein_id gnl|my_center|LOCUS_25190 38698 39675 gene locus_tag LOCUS_25200 38698 39675 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_25200 39675 40004 gene locus_tag LOCUS_25210 39675 40004 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_25210 40015 40629 gene locus_tag LOCUS_25220 40015 40629 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964048.1 protein_id gnl|my_center|LOCUS_25220 40629 41069 gene locus_tag LOCUS_25230 40629 41069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_25230 41066 41872 gene locus_tag LOCUS_25240 41066 41872 CDS product methanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964050.1 protein_id gnl|my_center|LOCUS_25240 41944 42396 gene locus_tag LOCUS_25250 41944 42396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 43215 42385 gene locus_tag LOCUS_25260 43215 42385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 46000 43199 gene locus_tag LOCUS_25270 46000 43199 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_25270 48830 46119 gene locus_tag LOCUS_25280 48830 46119 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_25280 50288 48987 gene locus_tag LOCUS_25290 gene der 50288 48987 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_25290 50603 51406 gene locus_tag LOCUS_25300 50603 51406 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261101.1 protein_id gnl|my_center|LOCUS_25300 51533 52237 gene locus_tag LOCUS_25310 51533 52237 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_25310 52354 52788 gene locus_tag LOCUS_25320 52354 52788 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004417824.1 protein_id gnl|my_center|LOCUS_25320 53314 52790 gene locus_tag LOCUS_25330 53314 52790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 54653 53628 gene locus_tag LOCUS_25340 54653 53628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_25340 54781 56082 gene locus_tag LOCUS_25350 54781 56082 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_25350 56085 57674 gene locus_tag LOCUS_25360 56085 57674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 58053 58742 gene locus_tag LOCUS_25370 58053 58742 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_25370 58742 60214 gene locus_tag LOCUS_25380 58742 60214 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence26 2131 137 gene locus_tag LOCUS_25390 2131 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 2529 3575 gene locus_tag LOCUS_25400 gene dinB 2529 3575 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHU9 protein_id gnl|my_center|LOCUS_25400 4402 4581 gene locus_tag LOCUS_25410 4402 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 4997 5839 gene locus_tag LOCUS_25420 4997 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 7250 5994 gene locus_tag LOCUS_25430 gene umuC 7250 5994 CDS product SOS mutagenesis and repair protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_25430 7671 7252 gene locus_tag LOCUS_25440 7671 7252 CDS product SOS-response transcriptional regulator UmuD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202621.1 protein_id gnl|my_center|LOCUS_25440 7982 7719 gene locus_tag LOCUS_25450 7982 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 8024 8767 gene locus_tag LOCUS_25460 8024 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 9103 8843 gene locus_tag LOCUS_25470 9103 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 10045 9329 gene locus_tag LOCUS_25480 10045 9329 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_25480 10159 11649 gene locus_tag LOCUS_25490 10159 11649 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_25490 11649 12959 gene locus_tag LOCUS_25500 gene xylA 11649 12959 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M2 protein_id gnl|my_center|LOCUS_25500 13504 16698 gene locus_tag LOCUS_25510 13504 16698 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_25510 16749 18602 gene locus_tag LOCUS_25520 16749 18602 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_25520 18652 21678 gene locus_tag LOCUS_25530 18652 21678 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203442.1 protein_id gnl|my_center|LOCUS_25530 21702 23444 gene locus_tag LOCUS_25540 21702 23444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_25540 23445 24503 gene locus_tag LOCUS_25550 23445 24503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 24541 26712 gene locus_tag LOCUS_25560 24541 26712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 26897 28378 gene locus_tag LOCUS_25570 gene xylP 26897 28378 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039190.1 protein_id gnl|my_center|LOCUS_25570 28394 29533 gene locus_tag LOCUS_25580 gene xynA 28394 29533 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3F6 protein_id gnl|my_center|LOCUS_25580 29596 31113 gene locus_tag LOCUS_25590 29596 31113 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890798.1 protein_id gnl|my_center|LOCUS_25590 31125 32483 gene locus_tag LOCUS_25600 31125 32483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 32542 33510 gene locus_tag LOCUS_25610 gene xsa 32542 33510 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_25610 33601 34971 gene locus_tag LOCUS_25620 33601 34971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 39098 35043 gene locus_tag LOCUS_25630 39098 35043 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_25630 42011 39258 gene locus_tag LOCUS_25640 42011 39258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_25640 43258 42092 gene locus_tag LOCUS_25650 gene uxuA 43258 42092 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650A0 protein_id gnl|my_center|LOCUS_25650 43999 43259 gene locus_tag LOCUS_25660 43999 43259 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_25660 46235 44001 gene locus_tag LOCUS_25670 gene aguA 46235 44001 CDS product xylan alpha-1,2-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3G9 protein_id gnl|my_center|LOCUS_25670 46356 48302 gene locus_tag LOCUS_25680 46356 48302 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_25680 50171 48333 gene locus_tag LOCUS_25690 gene yyaL 50171 48333 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_25690 50716 53703 gene locus_tag LOCUS_25700 50716 53703 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_25700 53717 55201 gene locus_tag LOCUS_25710 53717 55201 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_25710 55339 58647 gene locus_tag LOCUS_25720 55339 58647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence27 60 398 gene locus_tag LOCUS_25730 gene rpsF 60 398 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 protein_id gnl|my_center|LOCUS_25730 401 700 gene locus_tag LOCUS_25740 gene rpsR 401 700 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_25740 714 1163 gene locus_tag LOCUS_25750 gene rplI 714 1163 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P1 protein_id gnl|my_center|LOCUS_25750 1234 1710 gene locus_tag LOCUS_25760 1234 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 protein_id gnl|my_center|LOCUS_25760 3005 1764 gene locus_tag LOCUS_25770 3005 1764 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_25770 3146 4516 gene locus_tag LOCUS_25780 gene hisS 3146 4516 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H160 protein_id gnl|my_center|LOCUS_25780 6039 4585 gene locus_tag LOCUS_25790 6039 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_25790 6220 6912 gene locus_tag LOCUS_25800 gene phnP 6220 6912 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_25800 6918 7403 gene locus_tag LOCUS_25810 6918 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963236.1 protein_id gnl|my_center|LOCUS_25810 8056 7400 gene locus_tag LOCUS_25820 8056 7400 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_25820 8387 8058 gene locus_tag LOCUS_25830 8387 8058 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963234.1 protein_id gnl|my_center|LOCUS_25830 9643 8390 gene locus_tag LOCUS_25840 gene pyrC2 9643 8390 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_25840 11559 9640 gene locus_tag LOCUS_25850 11559 9640 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_25850 12881 11634 gene locus_tag LOCUS_25860 12881 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 14133 12922 gene locus_tag LOCUS_25870 14133 12922 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038285.1 protein_id gnl|my_center|LOCUS_25870 15062 14271 gene locus_tag LOCUS_25880 15062 14271 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_25880 15705 15043 gene locus_tag LOCUS_25890 gene lolD 15705 15043 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_25890 16011 16565 gene locus_tag LOCUS_25900 gene msrA 16011 16565 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_25900 16577 17176 gene locus_tag LOCUS_25910 gene folE 16577 17176 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P85 protein_id gnl|my_center|LOCUS_25910 17289 17597 gene locus_tag LOCUS_25920 17289 17597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962796.1 protein_id gnl|my_center|LOCUS_25920 18047 17667 gene locus_tag LOCUS_25930 18047 17667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 20685 18139 gene locus_tag LOCUS_25940 gene clpA 20685 18139 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_25940 20935 23478 gene locus_tag LOCUS_25950 gene gyrA 20935 23478 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_25950 23507 24772 gene locus_tag LOCUS_25960 23507 24772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962908.1 protein_id gnl|my_center|LOCUS_25960 26152 24854 gene locus_tag LOCUS_25970 26152 24854 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_25970 29082 26155 gene locus_tag LOCUS_25980 29082 26155 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_25980 29641 30762 gene locus_tag LOCUS_25990 gene csgA 29641 30762 CDS product curlin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071155.1 protein_id gnl|my_center|LOCUS_25990 31916 30843 gene locus_tag LOCUS_26000 31916 30843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_26000 32694 31924 gene locus_tag LOCUS_26010 32694 31924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 33852 32770 gene locus_tag LOCUS_26020 gene gcvT 33852 32770 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_26020 35247 33907 gene locus_tag LOCUS_26030 35247 33907 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_26030 36222 35293 gene locus_tag LOCUS_26040 gene thrB 36222 35293 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_26040 38672 36234 gene locus_tag LOCUS_26050 38672 36234 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_26050 39006 40538 gene locus_tag LOCUS_26060 39006 40538 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ4 protein_id gnl|my_center|LOCUS_26060 41117 40602 gene locus_tag LOCUS_26070 41117 40602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 41592 41161 gene locus_tag LOCUS_26080 41592 41161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962798.1 protein_id gnl|my_center|LOCUS_26080 42340 41705 gene locus_tag LOCUS_26090 42340 41705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962799.1 protein_id gnl|my_center|LOCUS_26090 43408 42455 gene locus_tag LOCUS_26100 gene serA 43408 42455 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_26100 44504 43440 gene locus_tag LOCUS_26110 gene serC 44504 43440 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 protein_id gnl|my_center|LOCUS_26110 45748 44687 gene locus_tag LOCUS_26120 45748 44687 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_26120 45888 46238 gene locus_tag LOCUS_26130 gene fdx1 45888 46238 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_26130 48963 46309 gene locus_tag LOCUS_26140 48963 46309 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962806.1 protein_id gnl|my_center|LOCUS_26140 49317 50411 gene locus_tag LOCUS_26150 gene engD 49317 50411 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC6 protein_id gnl|my_center|LOCUS_26150 50907 50500 gene locus_tag LOCUS_26160 50907 50500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_26160 51036 52430 gene locus_tag LOCUS_26170 51036 52430 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709100.1 protein_id gnl|my_center|LOCUS_26170 52495 52965 gene locus_tag LOCUS_26180 52495 52965 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460718.1 protein_id gnl|my_center|LOCUS_26180 53347 53045 gene locus_tag LOCUS_26190 53347 53045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209910.1 protein_id gnl|my_center|LOCUS_26190 54358 53372 gene locus_tag LOCUS_26200 54358 53372 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706684.1 protein_id gnl|my_center|LOCUS_26200 54821 56503 gene locus_tag LOCUS_26210 gene ilvD 54821 56503 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 protein_id gnl|my_center|LOCUS_26210 >Feature sequence28 730 230 gene locus_tag LOCUS_26220 730 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 2113 935 gene locus_tag LOCUS_26230 gene ppiA 2113 935 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963995.1 protein_id gnl|my_center|LOCUS_26230 2670 2116 gene locus_tag LOCUS_26240 gene gldI 2670 2116 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T4 protein_id gnl|my_center|LOCUS_26240 3679 2663 gene locus_tag LOCUS_26250 gene fjo19 3679 2663 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_26250 3756 4781 gene locus_tag LOCUS_26260 3756 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 4893 5312 gene locus_tag LOCUS_26270 gene ndk 4893 5312 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_26270 5671 5375 gene locus_tag LOCUS_26280 5671 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_26280 6162 5740 gene locus_tag LOCUS_26290 6162 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 7262 6183 gene locus_tag LOCUS_26300 gene recF 7262 6183 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_26300 7415 8179 gene locus_tag LOCUS_26310 7415 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_26310 8194 8685 gene locus_tag LOCUS_26320 gene ribH 8194 8685 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_26320 8834 9115 gene locus_tag LOCUS_26330 8834 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 9205 11091 gene locus_tag LOCUS_26340 gene mutL 9205 11091 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_26340 11134 11901 gene locus_tag LOCUS_26350 11134 11901 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_26350 11905 12789 gene locus_tag LOCUS_26360 11905 12789 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_26360 12789 13814 gene locus_tag LOCUS_26370 12789 13814 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_26370 14432 13809 gene locus_tag LOCUS_26380 14432 13809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 protein_id gnl|my_center|LOCUS_26380 14666 16912 gene locus_tag LOCUS_26390 14666 16912 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_26390 17378 16902 gene locus_tag LOCUS_26400 17378 16902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 18776 17544 gene locus_tag LOCUS_26410 18776 17544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_26410 19075 19737 gene locus_tag LOCUS_26420 19075 19737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 20064 19798 gene locus_tag LOCUS_26430 20064 19798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 20241 25229 gene locus_tag LOCUS_26440 20241 25229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 25222 27516 gene locus_tag LOCUS_26450 25222 27516 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_26450 28270 27521 gene locus_tag LOCUS_26460 28270 27521 CDS product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987352.1 protein_id gnl|my_center|LOCUS_26460 29318 28374 gene locus_tag LOCUS_26470 gene irk 29318 28374 CDS product inward rectifier potassium channel Irk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_26470 29630 30103 gene locus_tag LOCUS_26480 29630 30103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 30794 30417 gene locus_tag LOCUS_26490 30794 30417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 32989 30872 gene locus_tag LOCUS_26500 gene yyaL 32989 30872 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_26500 33293 34093 gene locus_tag LOCUS_26510 gene yagT 33293 34093 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037859.1 protein_id gnl|my_center|LOCUS_26510 34156 35148 gene locus_tag LOCUS_26520 34156 35148 CDS product FAD-binding molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_26520 35196 37364 gene locus_tag LOCUS_26530 35196 37364 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706200.1 protein_id gnl|my_center|LOCUS_26530 38473 37439 gene locus_tag LOCUS_26540 gene pucA 38473 37439 CDS product putative xanthine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32147 protein_id gnl|my_center|LOCUS_26540 38710 40548 gene locus_tag LOCUS_26550 38710 40548 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267573.1 protein_id gnl|my_center|LOCUS_26550 40877 40545 gene locus_tag LOCUS_26560 40877 40545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 41087 42148 gene locus_tag LOCUS_26570 41087 42148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_26570 42241 43308 gene locus_tag LOCUS_26580 42241 43308 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_26580 43419 43628 gene locus_tag LOCUS_26590 43419 43628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26590 43622 44632 gene locus_tag LOCUS_26600 43622 44632 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810300.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26600 47229 44707 gene locus_tag LOCUS_26610 47229 44707 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_26610 47796 47422 gene locus_tag LOCUS_26620 47796 47422 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_26620 49621 47864 gene locus_tag LOCUS_26630 49621 47864 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_26630 49865 50812 gene locus_tag LOCUS_26640 gene nusB 49865 50812 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_26640 50855 51322 gene locus_tag LOCUS_26650 50855 51322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_26650 51393 51626 gene locus_tag LOCUS_26660 gene yajC 51393 51626 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_26660 52590 51760 gene locus_tag LOCUS_26670 52590 51760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence29 1168 812 gene locus_tag LOCUS_26680 1168 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 2460 1288 gene locus_tag LOCUS_26690 2460 1288 CDS product sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963088.1 protein_id gnl|my_center|LOCUS_26690 2865 2545 gene locus_tag LOCUS_26700 2865 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 3254 5239 gene locus_tag LOCUS_26710 3254 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963167.1 protein_id gnl|my_center|LOCUS_26710 5366 5839 gene locus_tag LOCUS_26720 5366 5839 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81E75 protein_id gnl|my_center|LOCUS_26720 8656 5882 gene locus_tag LOCUS_26730 8656 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 9716 8715 gene locus_tag LOCUS_26740 9716 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 10667 9864 gene locus_tag LOCUS_26750 10667 9864 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_26750 11378 10731 gene locus_tag LOCUS_26760 11378 10731 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_26760 11381 12106 gene locus_tag LOCUS_26770 11381 12106 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DSX6 protein_id gnl|my_center|LOCUS_26770 12680 12138 gene locus_tag LOCUS_26780 12680 12138 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_26780 13339 12710 gene locus_tag LOCUS_26790 13339 12710 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_26790 14062 13340 gene locus_tag LOCUS_26800 14062 13340 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_26800 14184 15173 gene locus_tag LOCUS_26810 14184 15173 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108173.1 protein_id gnl|my_center|LOCUS_26810 15151 16011 gene locus_tag LOCUS_26820 15151 16011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 16004 16750 gene locus_tag LOCUS_26830 16004 16750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 16747 17967 gene locus_tag LOCUS_26840 16747 17967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 17969 19012 gene locus_tag LOCUS_26850 17969 19012 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_26850 19012 20352 gene locus_tag LOCUS_26860 19012 20352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_26860 20434 22380 gene locus_tag LOCUS_26870 gene thrS 20434 22380 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 protein_id gnl|my_center|LOCUS_26870 22487 22954 gene locus_tag LOCUS_26880 gene infC 22487 22954 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP1 protein_id gnl|my_center|LOCUS_26880 23074 23271 gene locus_tag LOCUS_26890 gene rpmI 23074 23271 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_26890 23431 23724 gene locus_tag LOCUS_26900 gene rplT 23431 23724 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_26900 23985 23818 gene locus_tag LOCUS_26910 23985 23818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 24208 23990 gene locus_tag LOCUS_26920 24208 23990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26920 26193 24214 gene locus_tag LOCUS_26930 26193 24214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 protein_id gnl|my_center|LOCUS_26930 27807 26275 gene locus_tag LOCUS_26940 gene guaA 27807 26275 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_26940 28203 28937 gene locus_tag LOCUS_26950 28203 28937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 29888 29007 gene locus_tag LOCUS_26960 29888 29007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 32267 30003 gene locus_tag LOCUS_26970 gene acnA 32267 30003 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_26970 33467 32514 gene locus_tag LOCUS_26980 33467 32514 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_26980 34916 33471 gene locus_tag LOCUS_26990 gene surA 34916 33471 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT1 protein_id gnl|my_center|LOCUS_26990 35706 34879 gene locus_tag LOCUS_27000 35706 34879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 36100 36336 gene locus_tag LOCUS_27010 36100 36336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 protein_id gnl|my_center|LOCUS_27010 36483 37010 gene locus_tag LOCUS_27020 36483 37010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 38543 37071 gene locus_tag LOCUS_27030 gene guaB 38543 37071 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_27030 38732 39949 gene locus_tag LOCUS_27040 38732 39949 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_27040 39982 41106 gene locus_tag LOCUS_27050 gene irpA 39982 41106 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_27050 41106 42455 gene locus_tag LOCUS_27060 41106 42455 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_27060 42433 44889 gene locus_tag LOCUS_27070 gene fecA 42433 44889 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_27070 45815 44949 gene locus_tag LOCUS_27080 gene mvaB 45815 44949 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_27080 47812 45878 gene locus_tag LOCUS_27090 47812 45878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 48896 47874 gene locus_tag LOCUS_27100 gene pyrD 48896 47874 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_27100 49069 50304 gene locus_tag LOCUS_27110 gene pepT 49069 50304 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W1 protein_id gnl|my_center|LOCUS_27110 50378 50953 gene locus_tag LOCUS_27120 50378 50953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 51082 51585 gene locus_tag LOCUS_27130 51082 51585 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KML0 protein_id gnl|my_center|LOCUS_27130 <53009 51771 gene locus_tag LOCUS_27140 <53009 51771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962898.1:ornithine--oxo-acid transaminase >Feature sequence30 74 853 gene locus_tag LOCUS_27150 74 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_27150 1006 1650 gene locus_tag LOCUS_27160 gene msrA 1006 1650 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_27160 1647 2081 gene locus_tag LOCUS_27170 1647 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 2393 3505 gene locus_tag LOCUS_27180 2393 3505 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_27180 3599 4246 gene locus_tag LOCUS_27190 3599 4246 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_27190 4380 5675 gene locus_tag LOCUS_27200 gene cry 4380 5675 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_27200 5668 7221 gene locus_tag LOCUS_27210 5668 7221 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964142.1 protein_id gnl|my_center|LOCUS_27210 7501 7638 gene locus_tag LOCUS_27220 7501 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 7853 8635 gene locus_tag LOCUS_27230 7853 8635 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924976.1 protein_id gnl|my_center|LOCUS_27230 8814 9572 gene locus_tag LOCUS_27240 gene trn2 8814 9572 CDS product tropinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_27240 11431 9599 gene locus_tag LOCUS_27250 11431 9599 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338226.1 protein_id gnl|my_center|LOCUS_27250 12220 11489 gene locus_tag LOCUS_27260 12220 11489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_27260 13655 12435 gene locus_tag LOCUS_27270 13655 12435 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 protein_id gnl|my_center|LOCUS_27270 14544 13828 gene locus_tag LOCUS_27280 14544 13828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_27280 14732 15445 gene locus_tag LOCUS_27290 14732 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 16735 15500 gene locus_tag LOCUS_27300 16735 15500 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195764.1 protein_id gnl|my_center|LOCUS_27300 16800 18089 gene locus_tag LOCUS_27310 gene kynU 16800 18089 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_27310 18123 19526 gene locus_tag LOCUS_27320 gene kmo 18123 19526 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_27320 19528 20184 gene locus_tag LOCUS_27330 19528 20184 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_27330 20686 20408 gene locus_tag LOCUS_27340 20686 20408 CDS product Sec-independent protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964182.1 protein_id gnl|my_center|LOCUS_27340 23068 20768 gene locus_tag LOCUS_27350 23068 20768 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_27350 23598 23137 gene locus_tag LOCUS_27360 23598 23137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 24442 23717 gene locus_tag LOCUS_27370 24442 23717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964228.1 protein_id gnl|my_center|LOCUS_27370 25360 24581 gene locus_tag LOCUS_27380 25360 24581 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 protein_id gnl|my_center|LOCUS_27380 25495 26199 gene locus_tag LOCUS_27390 gene pepE 25495 26199 CDS product dipeptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_27390 26624 26196 gene locus_tag LOCUS_27400 26624 26196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 26753 27040 gene locus_tag LOCUS_27410 26753 27040 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025680.1 protein_id gnl|my_center|LOCUS_27410 27047 27499 gene locus_tag LOCUS_27420 27047 27499 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633757.1 protein_id gnl|my_center|LOCUS_27420 27496 28233 gene locus_tag LOCUS_27430 27496 28233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 28250 29014 gene locus_tag LOCUS_27440 28250 29014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 29114 30631 gene locus_tag LOCUS_27450 gene gpmI 29114 30631 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_27450 30644 31228 gene locus_tag LOCUS_27460 30644 31228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 31339 31911 gene locus_tag LOCUS_27470 31339 31911 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_27470 31980 33050 gene locus_tag LOCUS_27480 31980 33050 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267673.1 protein_id gnl|my_center|LOCUS_27480 33332 33550 gene locus_tag LOCUS_27490 33332 33550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 33572 33784 gene locus_tag LOCUS_27500 33572 33784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 33877 34770 gene locus_tag LOCUS_27510 33877 34770 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941331.1 protein_id gnl|my_center|LOCUS_27510 34767 34979 gene locus_tag LOCUS_27520 34767 34979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 35024 36142 gene locus_tag LOCUS_27530 35024 36142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 36201 36491 gene locus_tag LOCUS_27540 36201 36491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 37133 36510 gene locus_tag LOCUS_27550 37133 36510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 37424 38596 gene locus_tag LOCUS_27560 37424 38596 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_27560 38777 39103 gene locus_tag LOCUS_27570 38777 39103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 39100 40149 gene locus_tag LOCUS_27580 39100 40149 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_208825.1 protein_id gnl|my_center|LOCUS_27580 40146 40988 gene locus_tag LOCUS_27590 40146 40988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 41263 41718 gene locus_tag LOCUS_27600 41263 41718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 41722 41997 gene locus_tag LOCUS_27610 41722 41997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 42156 42947 gene locus_tag LOCUS_27620 gene axeA 42156 42947 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120225.1 protein_id gnl|my_center|LOCUS_27620 43165 43635 gene locus_tag LOCUS_27630 43165 43635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 43794 44249 gene locus_tag LOCUS_27640 43794 44249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 44407 45084 gene locus_tag LOCUS_27650 44407 45084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 45560 45252 gene locus_tag LOCUS_27660 45560 45252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 45685 46197 gene locus_tag LOCUS_27670 45685 46197 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119583.1 protein_id gnl|my_center|LOCUS_27670 46344 47024 gene locus_tag LOCUS_27680 46344 47024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 47085 48080 gene locus_tag LOCUS_27690 47085 48080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 48441 48755 gene locus_tag LOCUS_27700 48441 48755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 48906 49709 gene locus_tag LOCUS_27710 48906 49709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 49827 50045 gene locus_tag LOCUS_27720 49827 50045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 50149 50400 gene locus_tag LOCUS_27730 50149 50400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 50566 50919 gene locus_tag LOCUS_27740 50566 50919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 >Feature sequence31 1 1380 gene locus_tag LOCUS_27750 1 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_27750 1620 1997 gene locus_tag LOCUS_27760 1620 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2093 3373 gene locus_tag LOCUS_27770 2093 3373 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_27770 3513 5063 gene locus_tag LOCUS_27780 3513 5063 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_27780 6130 5144 gene locus_tag LOCUS_27790 6130 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 6633 6136 gene locus_tag LOCUS_27800 6633 6136 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_27800 6669 7400 gene locus_tag LOCUS_27810 6669 7400 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_27810 7497 8291 gene locus_tag LOCUS_27820 7497 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 9252 8368 gene locus_tag LOCUS_27830 9252 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964516.1 protein_id gnl|my_center|LOCUS_27830 9490 9654 gene locus_tag LOCUS_27840 9490 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 10350 9658 gene locus_tag LOCUS_27850 10350 9658 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_27850 11573 10449 gene locus_tag LOCUS_27860 11573 10449 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_27860 14028 11680 gene locus_tag LOCUS_27870 14028 11680 CDS product ferrichrome-iron receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797093.1 protein_id gnl|my_center|LOCUS_27870 15944 14253 gene locus_tag LOCUS_27880 15944 14253 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 protein_id gnl|my_center|LOCUS_27880 16502 16032 gene locus_tag LOCUS_27890 16502 16032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 16681 16502 gene locus_tag LOCUS_27900 16681 16502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963197.1 protein_id gnl|my_center|LOCUS_27900 16971 18599 gene locus_tag LOCUS_27910 16971 18599 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_27910 18605 19024 gene locus_tag LOCUS_27920 18605 19024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 19060 20148 gene locus_tag LOCUS_27930 19060 20148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 20295 21470 gene locus_tag LOCUS_27940 20295 21470 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108639.1 protein_id gnl|my_center|LOCUS_27940 22795 21476 gene locus_tag LOCUS_27950 22795 21476 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_27950 23351 22890 gene locus_tag LOCUS_27960 23351 22890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 24512 23436 gene locus_tag LOCUS_27970 gene menE 24512 23436 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_27970 25507 24524 gene locus_tag LOCUS_27980 gene yyaK 25507 24524 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_27980 26545 25511 gene locus_tag LOCUS_27990 gene menC 26545 25511 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_27990 27236 26556 gene locus_tag LOCUS_28000 27236 26556 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0P5 protein_id gnl|my_center|LOCUS_28000 28227 27325 gene locus_tag LOCUS_28010 gene menA 28227 27325 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW2 protein_id gnl|my_center|LOCUS_28010 28444 30192 gene locus_tag LOCUS_28020 28444 30192 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415176.1 protein_id gnl|my_center|LOCUS_28020 30282 30818 gene locus_tag LOCUS_28030 30282 30818 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403648.1 protein_id gnl|my_center|LOCUS_28030 31023 32201 gene locus_tag LOCUS_28040 31023 32201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108514.1 protein_id gnl|my_center|LOCUS_28040 33234 32287 gene locus_tag LOCUS_28050 33234 32287 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529392.1 protein_id gnl|my_center|LOCUS_28050 34047 33253 gene locus_tag LOCUS_28060 34047 33253 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_28060 34457 34065 gene locus_tag LOCUS_28070 34457 34065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 34593 35450 gene locus_tag LOCUS_28080 34593 35450 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202094.1 protein_id gnl|my_center|LOCUS_28080 35693 36280 gene locus_tag LOCUS_28090 35693 36280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 37264 36329 gene locus_tag LOCUS_28100 37264 36329 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_28100 38470 37271 gene locus_tag LOCUS_28110 gene mnmA 38470 37271 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_28110 40492 38630 gene locus_tag LOCUS_28120 gene yidC 40492 38630 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U2 protein_id gnl|my_center|LOCUS_28120 42244 40604 gene locus_tag LOCUS_28130 gene pyrG 42244 40604 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_28130 42595 42347 gene locus_tag LOCUS_28140 42595 42347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 protein_id gnl|my_center|LOCUS_28140 43164 42598 gene locus_tag LOCUS_28150 43164 42598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 44534 43167 gene locus_tag LOCUS_28160 gene norM 44534 43167 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_28160 44683 45240 gene locus_tag LOCUS_28170 44683 45240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 46845 45313 gene locus_tag LOCUS_28180 46845 45313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_28180 48316 46931 gene locus_tag LOCUS_28190 48316 46931 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_28190 49328 48462 gene locus_tag LOCUS_28200 49328 48462 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962727.1 protein_id gnl|my_center|LOCUS_28200 <50213 49350 gene locus_tag LOCUS_28210 <50213 49350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962827.1:Fis family transcriptional regulator >Feature sequence32 2273 2650 gene locus_tag LOCUS_28220 2273 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 2663 3559 gene locus_tag LOCUS_28230 2663 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 3648 5141 gene locus_tag LOCUS_28240 3648 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 5224 5511 gene locus_tag LOCUS_28250 5224 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 8112 5563 gene locus_tag LOCUS_28260 8112 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 9531 8122 gene locus_tag LOCUS_28270 9531 8122 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769526.1 protein_id gnl|my_center|LOCUS_28270 12543 9544 gene locus_tag LOCUS_28280 12543 9544 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_28280 14070 14306 gene locus_tag LOCUS_28290 14070 14306 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202039.1 protein_id gnl|my_center|LOCUS_28290 14572 14862 gene locus_tag LOCUS_28300 14572 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 15102 17474 gene locus_tag LOCUS_28310 15102 17474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 17467 17694 gene locus_tag LOCUS_28320 17467 17694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 17706 18230 gene locus_tag LOCUS_28330 17706 18230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 18233 19471 gene locus_tag LOCUS_28340 18233 19471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 20621 19482 gene locus_tag LOCUS_28350 20621 19482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 23787 20608 gene locus_tag LOCUS_28360 23787 20608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 protein_id gnl|my_center|LOCUS_28360 24616 23780 gene locus_tag LOCUS_28370 24616 23780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_28370 24722 25297 gene locus_tag LOCUS_28380 24722 25297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 26112 26903 gene locus_tag LOCUS_28390 26112 26903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 27217 27486 gene locus_tag LOCUS_28400 27217 27486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 27533 27745 gene locus_tag LOCUS_28410 27533 27745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 28225 28076 gene locus_tag LOCUS_28420 28225 28076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 29595 29428 gene locus_tag LOCUS_28430 29595 29428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 29790 30509 gene locus_tag LOCUS_28440 29790 30509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 30512 32938 gene locus_tag LOCUS_28450 30512 32938 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958551.1 protein_id gnl|my_center|LOCUS_28450 33093 33560 gene locus_tag LOCUS_28460 33093 33560 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105103.1 protein_id gnl|my_center|LOCUS_28460 33566 34543 gene locus_tag LOCUS_28470 33566 34543 CDS product FAD-binding molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_28470 34543 36732 gene locus_tag LOCUS_28480 34543 36732 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268937.1 protein_id gnl|my_center|LOCUS_28480 37508 36816 gene locus_tag LOCUS_28490 37508 36816 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975108.1 protein_id gnl|my_center|LOCUS_28490 39060 37636 gene locus_tag LOCUS_28500 39060 37636 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_28500 39929 39060 gene locus_tag LOCUS_28510 39929 39060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 40372 40938 gene locus_tag LOCUS_28520 40372 40938 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454679.1 protein_id gnl|my_center|LOCUS_28520 41021 41938 gene locus_tag LOCUS_28530 41021 41938 CDS product dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900117.1 protein_id gnl|my_center|LOCUS_28530 42854 42492 gene locus_tag LOCUS_28540 42854 42492 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293546.1 protein_id gnl|my_center|LOCUS_28540 42872 43771 gene locus_tag LOCUS_28550 42872 43771 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207439.1 protein_id gnl|my_center|LOCUS_28550 43746 44117 gene locus_tag LOCUS_28560 43746 44117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974572.1 protein_id gnl|my_center|LOCUS_28560 44512 44288 gene locus_tag LOCUS_28570 44512 44288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28570 44878 44513 gene locus_tag LOCUS_28580 44878 44513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 45534 45926 gene locus_tag LOCUS_28590 45534 45926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 46380 46018 gene locus_tag LOCUS_28600 46380 46018 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_28600 47356 46358 gene locus_tag LOCUS_28610 47356 46358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 47949 47383 gene locus_tag LOCUS_28620 47949 47383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 48517 48861 gene locus_tag LOCUS_28630 48517 48861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 49640 49227 gene locus_tag LOCUS_28640 49640 49227 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_28640 49818 49624 gene locus_tag LOCUS_28650 49818 49624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence33 365 976 gene locus_tag LOCUS_28660 365 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 1070 3508 gene locus_tag LOCUS_28670 1070 3508 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_28670 3735 4181 gene locus_tag LOCUS_28680 3735 4181 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324679.1 protein_id gnl|my_center|LOCUS_28680 4352 4798 gene locus_tag LOCUS_28690 4352 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 4998 9380 gene locus_tag LOCUS_28700 gene dnaE 4998 9380 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_28700 9558 11348 gene locus_tag LOCUS_28710 gene glgB 9558 11348 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYJ7 protein_id gnl|my_center|LOCUS_28710 11581 11898 gene locus_tag LOCUS_28720 11581 11898 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_28720 12205 12750 gene locus_tag LOCUS_28730 gene clpP 12205 12750 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA83 protein_id gnl|my_center|LOCUS_28730 12954 13886 gene locus_tag LOCUS_28740 12954 13886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_28740 14000 14074 gene locus_tag LOCUS_t00240 14000 14074 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 14340 15524 gene locus_tag LOCUS_28750 14340 15524 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_28750 15624 16529 gene locus_tag LOCUS_28760 15624 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 16550 16864 gene locus_tag LOCUS_28770 16550 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 16983 17354 gene locus_tag LOCUS_28780 16983 17354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 17474 21889 gene locus_tag LOCUS_28790 17474 21889 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_28790 21908 23167 gene locus_tag LOCUS_28800 21908 23167 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_28800 23283 23621 gene locus_tag LOCUS_28810 23283 23621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 23637 24059 gene locus_tag LOCUS_28820 23637 24059 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763608.1 protein_id gnl|my_center|LOCUS_28820 24104 24457 gene locus_tag LOCUS_28830 24104 24457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 24500 24721 gene locus_tag LOCUS_28840 24500 24721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 24728 25531 gene locus_tag LOCUS_28850 24728 25531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 25537 25791 gene locus_tag LOCUS_28860 25537 25791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 25916 26233 gene locus_tag LOCUS_28870 25916 26233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 26255 27145 gene locus_tag LOCUS_28880 26255 27145 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 protein_id gnl|my_center|LOCUS_28880 27276 27593 gene locus_tag LOCUS_28890 27276 27593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28890 27699 28055 gene locus_tag LOCUS_28900 27699 28055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 28082 30070 gene locus_tag LOCUS_28910 28082 30070 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 protein_id gnl|my_center|LOCUS_28910 30108 30542 gene locus_tag LOCUS_28920 30108 30542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 30630 32033 gene locus_tag LOCUS_28930 gene lpdA1 30630 32033 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_28930 32042 33442 gene locus_tag LOCUS_28940 gene nhaA 32042 33442 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O26076 protein_id gnl|my_center|LOCUS_28940 33449 33724 gene locus_tag LOCUS_28950 33449 33724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28950 33752 34240 gene locus_tag LOCUS_28960 33752 34240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28960 34326 34913 gene locus_tag LOCUS_28970 gene lspA 34326 34913 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U05 protein_id gnl|my_center|LOCUS_28970 34968 35966 gene locus_tag LOCUS_28980 34968 35966 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864071.1 protein_id gnl|my_center|LOCUS_28980 35977 37926 gene locus_tag LOCUS_28990 35977 37926 CDS product cadmium/zinc/cobalt-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_28990 38556 39131 gene locus_tag LOCUS_29000 38556 39131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29000 39132 39407 gene locus_tag LOCUS_29010 39132 39407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29010 39685 39969 gene locus_tag LOCUS_29020 39685 39969 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 protein_id gnl|my_center|LOCUS_29020 39973 40725 gene locus_tag LOCUS_29030 39973 40725 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963684.1 protein_id gnl|my_center|LOCUS_29030 40709 41371 gene locus_tag LOCUS_29040 40709 41371 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_29040 42247 41642 gene locus_tag LOCUS_29050 42247 41642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 42629 42258 gene locus_tag LOCUS_29060 42629 42258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 43448 42867 gene locus_tag LOCUS_29070 43448 42867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962571.1 protein_id gnl|my_center|LOCUS_29070 44244 46646 gene locus_tag LOCUS_29080 44244 46646 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005842190.1 protein_id gnl|my_center|LOCUS_29080 46651 47232 gene locus_tag LOCUS_29090 46651 47232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 47235 48077 gene locus_tag LOCUS_29100 47235 48077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 48203 48712 gene locus_tag LOCUS_29110 48203 48712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 48744 49673 gene locus_tag LOCUS_29120 48744 49673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 >Feature sequence34 143 562 gene locus_tag LOCUS_29130 gene mraZ 143 562 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_29130 549 1445 gene locus_tag LOCUS_29140 gene rsmH 549 1445 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 protein_id gnl|my_center|LOCUS_29140 1452 1769 gene locus_tag LOCUS_29150 1452 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 1777 3768 gene locus_tag LOCUS_29160 gene ftsI 1777 3768 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_29160 3765 5228 gene locus_tag LOCUS_29170 gene murE 3765 5228 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_29170 5263 6495 gene locus_tag LOCUS_29180 gene mraY 5263 6495 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_29180 6496 7830 gene locus_tag LOCUS_29190 gene murD 6496 7830 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_29190 7841 9043 gene locus_tag LOCUS_29200 gene ftsW 7841 9043 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_29200 9065 10159 gene locus_tag LOCUS_29210 gene murG 9065 10159 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_29210 10160 11509 gene locus_tag LOCUS_29220 gene murC 10160 11509 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_29220 11506 12222 gene locus_tag LOCUS_29230 11506 12222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 12226 13569 gene locus_tag LOCUS_29240 gene ftsA 12226 13569 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_29240 13663 15714 gene locus_tag LOCUS_29250 gene ftsZ 13663 15714 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H191 protein_id gnl|my_center|LOCUS_29250 15883 16332 gene locus_tag LOCUS_29260 15883 16332 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_29260 16471 16545 gene locus_tag LOCUS_t00250 16471 16545 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16848 17957 gene locus_tag LOCUS_29270 16848 17957 CDS product L-fucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035399.1 protein_id gnl|my_center|LOCUS_29270 18857 18018 gene locus_tag LOCUS_29280 18857 18018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 19111 20091 gene locus_tag LOCUS_29290 19111 20091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 20241 21011 gene locus_tag LOCUS_29300 20241 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 21126 22202 gene locus_tag LOCUS_29310 gene prfA 21126 22202 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_29310 22229 23050 gene locus_tag LOCUS_29320 gene pyrF 22229 23050 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_29320 23068 23847 gene locus_tag LOCUS_29330 23068 23847 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_29330 24821 23844 gene locus_tag LOCUS_29340 24821 23844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 25532 24831 gene locus_tag LOCUS_29350 25532 24831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_29350 26429 25575 gene locus_tag LOCUS_29360 gene purU 26429 25575 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z3 protein_id gnl|my_center|LOCUS_29360 26594 30007 gene locus_tag LOCUS_29370 gene icmF 26594 30007 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_29370 30669 30142 gene locus_tag LOCUS_29380 30669 30142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 31142 30759 gene locus_tag LOCUS_29390 31142 30759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 31257 31724 gene locus_tag LOCUS_29400 31257 31724 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 protein_id gnl|my_center|LOCUS_29400 32930 31716 gene locus_tag LOCUS_29410 32930 31716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075798.1 protein_id gnl|my_center|LOCUS_29410 33515 32958 gene locus_tag LOCUS_29420 33515 32958 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_29420 34342 33506 gene locus_tag LOCUS_29430 34342 33506 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_29430 34826 34623 gene locus_tag LOCUS_29440 34826 34623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 35002 35640 gene locus_tag LOCUS_29450 35002 35640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 36742 35723 gene locus_tag LOCUS_29460 gene murB 36742 35723 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_29460 37932 36742 gene locus_tag LOCUS_29470 gene aspC2 37932 36742 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_29470 38047 39405 gene locus_tag LOCUS_29480 38047 39405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 39871 39485 gene locus_tag LOCUS_29490 39871 39485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 40068 42701 gene locus_tag LOCUS_29500 gene valS 40068 42701 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H092 protein_id gnl|my_center|LOCUS_29500 43047 42775 gene locus_tag LOCUS_29510 43047 42775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 43710 43057 gene locus_tag LOCUS_29520 gene psd 43710 43057 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_29520 44503 43700 gene locus_tag LOCUS_29530 gene cdsA 44503 43700 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 protein_id gnl|my_center|LOCUS_29530 45119 44505 gene locus_tag LOCUS_29540 45119 44505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_29540 47199 45226 gene locus_tag LOCUS_29550 gene ftsH 47199 45226 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_29550 47580 47209 gene locus_tag LOCUS_29560 gene rsfS 47580 47209 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_29560 47666 48394 gene locus_tag LOCUS_29570 gene birA 47666 48394 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_29570 48783 48391 gene locus_tag LOCUS_29580 48783 48391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 protein_id gnl|my_center|LOCUS_29580 49513 48827 gene locus_tag LOCUS_29590 gene pyrE 49513 48827 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 protein_id gnl|my_center|LOCUS_29590 >Feature sequence35 1579 2838 gene locus_tag LOCUS_29600 1579 2838 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_29600 3181 4158 gene locus_tag LOCUS_29610 3181 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 4161 4547 gene locus_tag LOCUS_29620 gene apaG 4161 4547 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_29620 4678 6303 gene locus_tag LOCUS_29630 gene pruA 4678 6303 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_29630 6453 6731 gene locus_tag LOCUS_29640 6453 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 7412 6783 gene locus_tag LOCUS_29650 gene rsmG 7412 6783 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_29650 7553 8659 gene locus_tag LOCUS_29660 7553 8659 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_29660 8675 9871 gene locus_tag LOCUS_29670 gene aspC1 8675 9871 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_29670 10507 9947 gene locus_tag LOCUS_29680 10507 9947 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816758.1 protein_id gnl|my_center|LOCUS_29680 11576 10599 gene locus_tag LOCUS_29690 11576 10599 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_29690 13098 11635 gene locus_tag LOCUS_29700 13098 11635 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_29700 14497 13148 gene locus_tag LOCUS_29710 14497 13148 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_29710 14715 15443 gene locus_tag LOCUS_29720 gene menG 14715 15443 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_29720 15448 16149 gene locus_tag LOCUS_29730 gene porT 15448 16149 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_29730 16149 16898 gene locus_tag LOCUS_29740 16149 16898 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_29740 17622 16909 gene locus_tag LOCUS_29750 17622 16909 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_29750 17628 20222 gene locus_tag LOCUS_29760 17628 20222 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_29760 20292 21359 gene locus_tag LOCUS_29770 gene fbaA 20292 21359 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_29770 21538 22395 gene locus_tag LOCUS_29780 gene accD 21538 22395 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_29780 22491 22760 gene locus_tag LOCUS_29790 gene rpsO 22491 22760 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H184 protein_id gnl|my_center|LOCUS_29790 23006 25228 gene locus_tag LOCUS_29800 gene pnp 23006 25228 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H185 protein_id gnl|my_center|LOCUS_29800 25612 26418 gene locus_tag LOCUS_29810 gene proI 25612 26418 CDS product pyrroline-5-carboxylate reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54552 protein_id gnl|my_center|LOCUS_29810 26423 27193 gene locus_tag LOCUS_29820 26423 27193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 27269 28468 gene locus_tag LOCUS_29830 gene proA 27269 28468 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYC9 protein_id gnl|my_center|LOCUS_29830 28694 31426 gene locus_tag LOCUS_29840 28694 31426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 31662 32525 gene locus_tag LOCUS_29850 gene rpoD 31662 32525 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_29850 32721 33128 gene locus_tag LOCUS_29860 32721 33128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 33167 33826 gene locus_tag LOCUS_29870 gene rpe 33167 33826 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_29870 35548 34073 gene locus_tag LOCUS_29880 35548 34073 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_29880 37836 35917 gene locus_tag LOCUS_29890 37836 35917 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_29890 38772 37849 gene locus_tag LOCUS_29900 38772 37849 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_29900 <45498 38808 gene locus_tag LOCUS_29910 <45498 38808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098386.1:type I secretion C-terminal target domain-containing protein >Feature sequence36 125 559 gene locus_tag LOCUS_29920 125 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29920 2257 815 gene locus_tag LOCUS_29930 2257 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789122.1 protein_id gnl|my_center|LOCUS_29930 5365 2273 gene locus_tag LOCUS_29940 5365 2273 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203176.1 protein_id gnl|my_center|LOCUS_29940 6658 5378 gene locus_tag LOCUS_29950 6658 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 6814 7416 gene locus_tag LOCUS_29960 6814 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 7656 7399 gene locus_tag LOCUS_29970 7656 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 8052 8555 gene locus_tag LOCUS_29980 8052 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 8577 9005 gene locus_tag LOCUS_29990 8577 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 9018 9467 gene locus_tag LOCUS_30000 9018 9467 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108556.1 protein_id gnl|my_center|LOCUS_30000 10008 10292 gene locus_tag LOCUS_30010 10008 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 10309 11340 gene locus_tag LOCUS_30020 10309 11340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 11345 12931 gene locus_tag LOCUS_30030 11345 12931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 13190 13543 gene locus_tag LOCUS_30040 13190 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 13661 14869 gene locus_tag LOCUS_30050 13661 14869 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947886.1 protein_id gnl|my_center|LOCUS_30050 15008 18154 gene locus_tag LOCUS_30060 gene mexF2 15008 18154 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947887.1 protein_id gnl|my_center|LOCUS_30060 18220 19656 gene locus_tag LOCUS_30070 18220 19656 CDS product multidrug efflux system outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040261.1 protein_id gnl|my_center|LOCUS_30070 19813 20703 gene locus_tag LOCUS_30080 19813 20703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 20802 21482 gene locus_tag LOCUS_30090 20802 21482 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161829.1 protein_id gnl|my_center|LOCUS_30090 22308 21712 gene locus_tag LOCUS_30100 22308 21712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 23051 23323 gene locus_tag LOCUS_30110 23051 23323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 23392 23742 gene locus_tag LOCUS_30120 23392 23742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 23855 23980 gene locus_tag LOCUS_30130 23855 23980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 24067 24915 gene locus_tag LOCUS_30140 gene yhxC 24067 24915 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432004.1 protein_id gnl|my_center|LOCUS_30140 27172 24986 gene locus_tag LOCUS_30150 27172 24986 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZR9 protein_id gnl|my_center|LOCUS_30150 28207 27662 gene locus_tag LOCUS_30160 28207 27662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 28467 28204 gene locus_tag LOCUS_30170 28467 28204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125597.1 protein_id gnl|my_center|LOCUS_30170 29903 28476 gene locus_tag LOCUS_30180 29903 28476 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119875.1 protein_id gnl|my_center|LOCUS_30180 31656 29893 gene locus_tag LOCUS_30190 31656 29893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119876.1 protein_id gnl|my_center|LOCUS_30190 32528 31656 gene locus_tag LOCUS_30200 gene sbnA 32528 31656 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570807.1 protein_id gnl|my_center|LOCUS_30200 32807 33370 gene locus_tag LOCUS_30210 32807 33370 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119942.1 protein_id gnl|my_center|LOCUS_30210 34012 33422 gene locus_tag LOCUS_30220 34012 33422 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_30220 34991 34137 gene locus_tag LOCUS_30230 34991 34137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 35930 35001 gene locus_tag LOCUS_30240 35930 35001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 36569 35952 gene locus_tag LOCUS_30250 36569 35952 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310175.1 protein_id gnl|my_center|LOCUS_30250 37422 36580 gene locus_tag LOCUS_30260 37422 36580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 37955 37425 gene locus_tag LOCUS_30270 37955 37425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 40420 38009 gene locus_tag LOCUS_30280 40420 38009 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005842190.1 protein_id gnl|my_center|LOCUS_30280 40465 40674 gene locus_tag LOCUS_30290 40465 40674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 41016 40729 gene locus_tag LOCUS_30300 41016 40729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 41265 41765 gene locus_tag LOCUS_30310 41265 41765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 42691 42035 gene locus_tag LOCUS_30320 42691 42035 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_30320 43340 42675 gene locus_tag LOCUS_30330 43340 42675 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964384.1 protein_id gnl|my_center|LOCUS_30330 43610 43341 gene locus_tag LOCUS_30340 43610 43341 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963685.1 protein_id gnl|my_center|LOCUS_30340 44831 44001 gene locus_tag LOCUS_30350 44831 44001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963653.1 protein_id gnl|my_center|LOCUS_30350 >Feature sequence37 57 132 gene locus_tag LOCUS_t00260 57 132 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3345 301 gene locus_tag LOCUS_30360 3345 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 4282 3530 gene locus_tag LOCUS_30370 4282 3530 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_30370 4625 6940 gene locus_tag LOCUS_30380 4625 6940 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_30380 7256 8551 gene locus_tag LOCUS_30390 gene bla 7256 8551 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037998.1 protein_id gnl|my_center|LOCUS_30390 8817 9638 gene locus_tag LOCUS_30400 8817 9638 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104035.1 protein_id gnl|my_center|LOCUS_30400 9631 12267 gene locus_tag LOCUS_30410 9631 12267 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_30410 12287 12730 gene locus_tag LOCUS_30420 12287 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 12741 13991 gene locus_tag LOCUS_30430 gene nhaP 12741 13991 CDS product Na(+)/H(+) antiporter NhaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD29 protein_id gnl|my_center|LOCUS_30430 14100 14786 gene locus_tag LOCUS_30440 14100 14786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 16095 15040 gene locus_tag LOCUS_30450 16095 15040 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_30450 16998 16105 gene locus_tag LOCUS_30460 gene gldA 16998 16105 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_30460 17426 18250 gene locus_tag LOCUS_30470 gene pheA 17426 18250 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_30470 18247 19395 gene locus_tag LOCUS_30480 gene aspC3 18247 19395 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 protein_id gnl|my_center|LOCUS_30480 19382 20242 gene locus_tag LOCUS_30490 gene tyrA 19382 20242 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_30490 20271 21362 gene locus_tag LOCUS_30500 20271 21362 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_30500 22079 21432 gene locus_tag LOCUS_30510 22079 21432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 22611 22156 gene locus_tag LOCUS_30520 22611 22156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 22692 23645 gene locus_tag LOCUS_30530 gene rsgA 22692 23645 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 protein_id gnl|my_center|LOCUS_30530 23655 24107 gene locus_tag LOCUS_30540 gene dtd 23655 24107 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2P0 protein_id gnl|my_center|LOCUS_30540 24155 26056 gene locus_tag LOCUS_30550 24155 26056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 26060 28084 gene locus_tag LOCUS_30560 26060 28084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 28089 30077 gene locus_tag LOCUS_30570 28089 30077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 30168 30494 gene locus_tag LOCUS_30580 30168 30494 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_30580 30520 31743 gene locus_tag LOCUS_30590 gene aroA 30520 31743 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW83 protein_id gnl|my_center|LOCUS_30590 31916 32971 gene locus_tag LOCUS_30600 gene queA 31916 32971 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_30600 33086 34129 gene locus_tag LOCUS_30610 gene rlmN 33086 34129 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_30610 34157 35134 gene locus_tag LOCUS_30620 34157 35134 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_30620 35395 35823 gene locus_tag LOCUS_30630 35395 35823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 35804 36544 gene locus_tag LOCUS_30640 35804 36544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 36630 37664 gene locus_tag LOCUS_30650 36630 37664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964174.1 protein_id gnl|my_center|LOCUS_30650 37784 39763 gene locus_tag LOCUS_30660 gene dnaG 37784 39763 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_30660 40398 39760 gene locus_tag LOCUS_30670 40398 39760 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964170.1 protein_id gnl|my_center|LOCUS_30670 41284 40496 gene locus_tag LOCUS_30680 gene nadE 41284 40496 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 protein_id gnl|my_center|LOCUS_30680 41430 42350 gene locus_tag LOCUS_30690 gene gldB 41430 42350 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_30690 42361 42684 gene locus_tag LOCUS_30700 gene gldC 42361 42684 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_30700 42823 43080 gene locus_tag LOCUS_30710 42823 43080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 43675 43067 gene locus_tag LOCUS_30720 gene engB 43675 43067 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 protein_id gnl|my_center|LOCUS_30720 44451 43687 gene locus_tag LOCUS_30730 gene pcbD 44451 43687 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_30730 >Feature sequence38 428 985 gene locus_tag LOCUS_30740 428 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 1868 1236 gene locus_tag LOCUS_30750 1868 1236 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707260.1 protein_id gnl|my_center|LOCUS_30750 1975 2850 gene locus_tag LOCUS_30760 gene gltC 1975 2850 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722212.1 protein_id gnl|my_center|LOCUS_30760 3091 3762 gene locus_tag LOCUS_30770 3091 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 5443 4124 gene locus_tag LOCUS_30780 5443 4124 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362018.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30780 5690 9010 gene locus_tag LOCUS_30790 5690 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 9010 9810 gene locus_tag LOCUS_30800 9010 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 10181 10981 gene locus_tag LOCUS_30810 gene trp1400B 10181 10981 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815813.1 protein_id gnl|my_center|LOCUS_30810 11473 13860 gene locus_tag LOCUS_30820 11473 13860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 14120 15337 gene locus_tag LOCUS_30830 14120 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 15766 18279 gene locus_tag LOCUS_30840 15766 18279 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYW8 protein_id gnl|my_center|LOCUS_30840 18350 19084 gene locus_tag LOCUS_30850 18350 19084 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021349.1 protein_id gnl|my_center|LOCUS_30850 19788 19081 gene locus_tag LOCUS_30860 gene nrtR 19788 19081 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072071.1 protein_id gnl|my_center|LOCUS_30860 19872 22280 gene locus_tag LOCUS_30870 19872 22280 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_30870 22909 22343 gene locus_tag LOCUS_30880 22909 22343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 22980 23606 gene locus_tag LOCUS_30890 22980 23606 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787873.1 protein_id gnl|my_center|LOCUS_30890 23654 24013 gene locus_tag LOCUS_30900 23654 24013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_30900 24010 24423 gene locus_tag LOCUS_30910 24010 24423 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_30910 25154 24420 gene locus_tag LOCUS_30920 25154 24420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728394.1 protein_id gnl|my_center|LOCUS_30920 26023 25274 gene locus_tag LOCUS_30930 26023 25274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 26534 26118 gene locus_tag LOCUS_30940 26534 26118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 27877 27104 gene locus_tag LOCUS_30950 27877 27104 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 protein_id gnl|my_center|LOCUS_30950 28898 27879 gene locus_tag LOCUS_30960 28898 27879 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109044.1 protein_id gnl|my_center|LOCUS_30960 29385 30098 gene locus_tag LOCUS_30970 29385 30098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30970 30143 31153 gene locus_tag LOCUS_30980 gene rlmF 30143 31153 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHV5 protein_id gnl|my_center|LOCUS_30980 32966 31161 gene locus_tag LOCUS_30990 32966 31161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 35434 33182 gene locus_tag LOCUS_31000 gene katG 35434 33182 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066164.1 protein_id gnl|my_center|LOCUS_31000 35832 36323 gene locus_tag LOCUS_31010 35832 36323 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266812.1 protein_id gnl|my_center|LOCUS_31010 37228 36320 gene locus_tag LOCUS_31020 37228 36320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 37462 38985 gene locus_tag LOCUS_31030 gene aldA 37462 38985 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYG9 protein_id gnl|my_center|LOCUS_31030 38957 39370 gene locus_tag LOCUS_31040 38957 39370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701719.1 protein_id gnl|my_center|LOCUS_31040 39766 39428 gene locus_tag LOCUS_31050 gene csaA 39766 39428 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_31050 40071 39766 gene locus_tag LOCUS_31060 40071 39766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 40201 40773 gene locus_tag LOCUS_31070 40201 40773 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_31070 40774 41427 gene locus_tag LOCUS_31080 40774 41427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 41501 43258 gene locus_tag LOCUS_31090 41501 43258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_31090 <43910 43226 gene locus_tag LOCUS_31100 <43910 43226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962822.1:NUDIX domain-containing protein >Feature sequence39 2244 1342 gene locus_tag LOCUS_31110 2244 1342 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_31110 3069 2380 gene locus_tag LOCUS_31120 3069 2380 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_31120 3451 6387 gene locus_tag LOCUS_31130 3451 6387 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108592.1 protein_id gnl|my_center|LOCUS_31130 6400 7968 gene locus_tag LOCUS_31140 6400 7968 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_31140 8218 9768 gene locus_tag LOCUS_31150 gene abf2 8218 9768 CDS product intracellular exo-alpha-L-arabinofuranosidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94552 protein_id gnl|my_center|LOCUS_31150 9779 11311 gene locus_tag LOCUS_31160 9779 11311 CDS product endo-arabinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107221.1 protein_id gnl|my_center|LOCUS_31160 11313 12326 gene locus_tag LOCUS_31170 11313 12326 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107223.1 protein_id gnl|my_center|LOCUS_31170 12330 13310 gene locus_tag LOCUS_31180 gene abnA 12330 13310 CDS product extracellular endo-alpha-(1->5)-L-arabinanase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94522 protein_id gnl|my_center|LOCUS_31180 13312 15678 gene locus_tag LOCUS_31190 13312 15678 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_31190 15701 17695 gene locus_tag LOCUS_31200 15701 17695 CDS product alpha-L-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_31200 17786 19483 gene locus_tag LOCUS_31210 gene araB 17786 19483 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR10 protein_id gnl|my_center|LOCUS_31210 19476 20174 gene locus_tag LOCUS_31220 19476 20174 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 protein_id gnl|my_center|LOCUS_31220 20206 21855 gene locus_tag LOCUS_31230 gene yidK 20206 21855 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087134.1 protein_id gnl|my_center|LOCUS_31230 21899 23410 gene locus_tag LOCUS_31240 gene araA 21899 23410 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNR7 protein_id gnl|my_center|LOCUS_31240 23431 24615 gene locus_tag LOCUS_31250 gene galM 23431 24615 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_31250 25255 24680 gene locus_tag LOCUS_31260 25255 24680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_31260 26883 25258 gene locus_tag LOCUS_31270 26883 25258 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_31270 28360 26930 gene locus_tag LOCUS_31280 28360 26930 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_31280 30607 28403 gene locus_tag LOCUS_31290 30607 28403 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_31290 30714 32525 gene locus_tag LOCUS_31300 30714 32525 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_31300 33654 32581 gene locus_tag LOCUS_31310 33654 32581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 33760 34692 gene locus_tag LOCUS_31320 33760 34692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_31320 34700 35530 gene locus_tag LOCUS_31330 34700 35530 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_31330 35644 38361 gene locus_tag LOCUS_31340 35644 38361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 38515 40515 gene locus_tag LOCUS_31350 gene uvrB 38515 40515 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY25 protein_id gnl|my_center|LOCUS_31350 41236 40517 gene locus_tag LOCUS_31360 41236 40517 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_31360 <42225 41229 gene locus_tag LOCUS_31370 <42225 41229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107797.1:histidine kinase >Feature sequence40 316 35 gene locus_tag LOCUS_31380 316 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 3070 623 gene locus_tag LOCUS_31390 gene fecA 3070 623 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_31390 4041 3079 gene locus_tag LOCUS_31400 4041 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 5604 4447 gene locus_tag LOCUS_31410 gene irpA 5604 4447 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_31410 6867 5644 gene locus_tag LOCUS_31420 6867 5644 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_31420 7149 7529 gene locus_tag LOCUS_31430 7149 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 7633 11385 gene locus_tag LOCUS_31440 7633 11385 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_31440 11382 12599 gene locus_tag LOCUS_31450 11382 12599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 12604 13170 gene locus_tag LOCUS_31460 12604 13170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 13235 15622 gene locus_tag LOCUS_31470 13235 15622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 15641 15835 gene locus_tag LOCUS_31480 15641 15835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 15955 16542 gene locus_tag LOCUS_31490 15955 16542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 16543 16995 gene locus_tag LOCUS_31500 16543 16995 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_31500 17019 17579 gene locus_tag LOCUS_31510 17019 17579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 17636 18067 gene locus_tag LOCUS_31520 17636 18067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704036.1 protein_id gnl|my_center|LOCUS_31520 18665 19306 gene locus_tag LOCUS_31530 18665 19306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 19484 20842 gene locus_tag LOCUS_31540 19484 20842 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_31540 20835 21383 gene locus_tag LOCUS_31550 20835 21383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680200.1 protein_id gnl|my_center|LOCUS_31550 21413 22009 gene locus_tag LOCUS_31560 21413 22009 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810329.1 protein_id gnl|my_center|LOCUS_31560 22267 22824 gene locus_tag LOCUS_31570 22267 22824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 22843 23325 gene locus_tag LOCUS_31580 22843 23325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 23334 24578 gene locus_tag LOCUS_31590 23334 24578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 24602 25192 gene locus_tag LOCUS_31600 24602 25192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 25350 25643 gene locus_tag LOCUS_31610 25350 25643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 25718 27073 gene locus_tag LOCUS_31620 25718 27073 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_31620 27088 29625 gene locus_tag LOCUS_31630 27088 29625 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_31630 29724 30341 gene locus_tag LOCUS_31640 29724 30341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 30359 30838 gene locus_tag LOCUS_31650 30359 30838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_31650 30907 32691 gene locus_tag LOCUS_31660 30907 32691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 32756 32932 gene locus_tag LOCUS_31670 32756 32932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 32945 33511 gene locus_tag LOCUS_31680 32945 33511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 33655 33975 gene locus_tag LOCUS_31690 33655 33975 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 protein_id gnl|my_center|LOCUS_31690 34210 36480 gene locus_tag LOCUS_31700 34210 36480 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_31700 36504 36716 gene locus_tag LOCUS_31710 36504 36716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 36842 37516 gene locus_tag LOCUS_31720 36842 37516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 38843 37629 gene locus_tag LOCUS_31730 38843 37629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 >Feature sequence41 949 2154 gene locus_tag LOCUS_31740 949 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 4581 2206 gene locus_tag LOCUS_31750 4581 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 4766 5908 gene locus_tag LOCUS_31760 4766 5908 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_31760 9318 5980 gene locus_tag LOCUS_31770 9318 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 11022 9415 gene locus_tag LOCUS_31780 11022 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_31780 13978 11024 gene locus_tag LOCUS_31790 13978 11024 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_31790 15743 14484 gene locus_tag LOCUS_31800 15743 14484 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_31800 16896 15856 gene locus_tag LOCUS_31810 16896 15856 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963027.1 protein_id gnl|my_center|LOCUS_31810 19063 16982 gene locus_tag LOCUS_31820 gene ptrB 19063 16982 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_31820 19235 19558 gene locus_tag LOCUS_31830 19235 19558 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY02 protein_id gnl|my_center|LOCUS_31830 19566 19871 gene locus_tag LOCUS_31840 19566 19871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 19881 20264 gene locus_tag LOCUS_31850 gene ywkD 19881 20264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45871 protein_id gnl|my_center|LOCUS_31850 20311 21282 gene locus_tag LOCUS_31860 20311 21282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 22309 21272 gene locus_tag LOCUS_31870 22309 21272 CDS product luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524633.1 protein_id gnl|my_center|LOCUS_31870 22379 22870 gene locus_tag LOCUS_31880 22379 22870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 23063 24085 gene locus_tag LOCUS_31890 23063 24085 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583096.1 protein_id gnl|my_center|LOCUS_31890 24194 25507 gene locus_tag LOCUS_31900 24194 25507 CDS product exopolygalacturonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109139.1 protein_id gnl|my_center|LOCUS_31900 25898 25512 gene locus_tag LOCUS_31910 25898 25512 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_31910 27331 25904 gene locus_tag LOCUS_31920 27331 25904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 27789 27514 gene locus_tag LOCUS_31930 27789 27514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 29111 27924 gene locus_tag LOCUS_31940 gene kbl 29111 27924 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_31940 30076 29123 gene locus_tag LOCUS_31950 gene ltd 30076 29123 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_31950 30244 30705 gene locus_tag LOCUS_31960 30244 30705 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_31960 31625 30708 gene locus_tag LOCUS_31970 31625 30708 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119404.1 protein_id gnl|my_center|LOCUS_31970 31766 32761 gene locus_tag LOCUS_31980 31766 32761 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245931.1 protein_id gnl|my_center|LOCUS_31980 32761 33360 gene locus_tag LOCUS_31990 32761 33360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 35553 33397 gene locus_tag LOCUS_32000 35553 33397 CDS product folate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141367.1 protein_id gnl|my_center|LOCUS_32000 35816 36259 gene locus_tag LOCUS_32010 35816 36259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 37591 36317 gene locus_tag LOCUS_32020 gene glyA 37591 36317 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_32020 >Feature sequence42 192 1031 gene locus_tag LOCUS_32030 gene crtB 192 1031 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_32030 1033 1485 gene locus_tag LOCUS_32040 gene crtZ 1033 1485 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_32040 1482 2195 gene locus_tag LOCUS_32050 1482 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_32050 3815 2211 gene locus_tag LOCUS_32060 gene bshC 3815 2211 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_32060 4022 6580 gene locus_tag LOCUS_32070 4022 6580 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_32070 6582 7163 gene locus_tag LOCUS_32080 6582 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 7167 10019 gene locus_tag LOCUS_32090 7167 10019 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_32090 10107 11099 gene locus_tag LOCUS_32100 10107 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 11505 11062 gene locus_tag LOCUS_32110 11505 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 12846 11539 gene locus_tag LOCUS_32120 gene rimO 12846 11539 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_32120 12930 14006 gene locus_tag LOCUS_32130 12930 14006 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_32130 15692 14007 gene locus_tag LOCUS_32140 gene gatA 15692 14007 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759455.1 protein_id gnl|my_center|LOCUS_32140 16691 15738 gene locus_tag LOCUS_32150 gene ftsY 16691 15738 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 protein_id gnl|my_center|LOCUS_32150 16975 16823 gene locus_tag LOCUS_32160 16975 16823 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_32160 17161 16979 gene locus_tag LOCUS_32170 gene rpmG 17161 16979 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_32170 17424 17185 gene locus_tag LOCUS_32180 gene rpmB 17424 17185 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_32180 18751 17504 gene locus_tag LOCUS_32190 18751 17504 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 protein_id gnl|my_center|LOCUS_32190 19092 18751 gene locus_tag LOCUS_32200 19092 18751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 19725 19111 gene locus_tag LOCUS_32210 19725 19111 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_32210 20679 19729 gene locus_tag LOCUS_32220 20679 19729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 21459 20683 gene locus_tag LOCUS_32230 21459 20683 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_32230 22937 21609 gene locus_tag LOCUS_32240 gene bfmBB 22937 21609 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_32240 24139 23021 gene locus_tag LOCUS_32250 24139 23021 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962750.1 protein_id gnl|my_center|LOCUS_32250 24760 24143 gene locus_tag LOCUS_32260 gene recR 24760 24143 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_32260 26016 24883 gene locus_tag LOCUS_32270 gene wecB 26016 24883 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27828 protein_id gnl|my_center|LOCUS_32270 27265 25994 gene locus_tag LOCUS_32280 gene wbpO 27265 25994 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_32280 28272 27265 gene locus_tag LOCUS_32290 28272 27265 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_32290 28461 28952 gene locus_tag LOCUS_32300 28461 28952 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_32300 28987 29934 gene locus_tag LOCUS_32310 28987 29934 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_32310 29939 30808 gene locus_tag LOCUS_32320 29939 30808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_32320 30887 32029 gene locus_tag LOCUS_32330 30887 32029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 33604 32033 gene locus_tag LOCUS_32340 33604 32033 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_32340 >Feature sequence43 391 735 gene locus_tag LOCUS_32350 391 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 1865 807 gene locus_tag LOCUS_32360 1865 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_32360 2431 1907 gene locus_tag LOCUS_32370 2431 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_32370 3496 2465 gene locus_tag LOCUS_32380 3496 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 4947 3517 gene locus_tag LOCUS_32390 gene cca 4947 3517 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_32390 5632 5045 gene locus_tag LOCUS_32400 5632 5045 CDS product translation factor Sua5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_32400 6534 5635 gene locus_tag LOCUS_32410 6534 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 7613 6546 gene locus_tag LOCUS_32420 7613 6546 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355946.1 protein_id gnl|my_center|LOCUS_32420 7678 8436 gene locus_tag LOCUS_32430 7678 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963748.1 protein_id gnl|my_center|LOCUS_32430 9196 8438 gene locus_tag LOCUS_32440 9196 8438 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_32440 10272 9199 gene locus_tag LOCUS_32450 10272 9199 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707880.1 protein_id gnl|my_center|LOCUS_32450 11252 10272 gene locus_tag LOCUS_32460 11252 10272 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962750.1 protein_id gnl|my_center|LOCUS_32460 12145 11330 gene locus_tag LOCUS_32470 gene dapD 12145 11330 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_32470 12379 12813 gene locus_tag LOCUS_32480 12379 12813 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_32480 12852 13439 gene locus_tag LOCUS_32490 gene def 12852 13439 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_32490 13609 14037 gene locus_tag LOCUS_32500 13609 14037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 14137 14910 gene locus_tag LOCUS_32510 14137 14910 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_32510 15061 16017 gene locus_tag LOCUS_32520 15061 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 16789 16034 gene locus_tag LOCUS_32530 16789 16034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 17072 17467 gene locus_tag LOCUS_32540 17072 17467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 17480 18199 gene locus_tag LOCUS_32550 17480 18199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 protein_id gnl|my_center|LOCUS_32550 18202 18921 gene locus_tag LOCUS_32560 18202 18921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 18938 21004 gene locus_tag LOCUS_32570 18938 21004 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121033.1 protein_id gnl|my_center|LOCUS_32570 21117 21428 gene locus_tag LOCUS_32580 21117 21428 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377064.1 protein_id gnl|my_center|LOCUS_32580 21558 26453 gene locus_tag LOCUS_32590 21558 26453 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121034.1 protein_id gnl|my_center|LOCUS_32590 26707 28311 gene locus_tag LOCUS_32600 26707 28311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 28357 28863 gene locus_tag LOCUS_32610 28357 28863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 29344 28871 gene locus_tag LOCUS_32620 gene rlmH 29344 28871 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_32620 29471 30328 gene locus_tag LOCUS_32630 gene nadC 29471 30328 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_32630 30328 31278 gene locus_tag LOCUS_32640 gene yfkH 30328 31278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_32640 31360 31788 gene locus_tag LOCUS_32650 31360 31788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 protein_id gnl|my_center|LOCUS_32650 31857 34313 gene locus_tag LOCUS_32660 gene priA 31857 34313 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 protein_id gnl|my_center|LOCUS_32660 35062 34361 gene locus_tag LOCUS_32670 35062 34361 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_32670 >Feature sequence44 750 4064 gene locus_tag LOCUS_32680 gene treS 750 4064 CDS product trehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933743.1 protein_id gnl|my_center|LOCUS_32680 4071 4706 gene locus_tag LOCUS_32690 4071 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989716.1 protein_id gnl|my_center|LOCUS_32690 4794 6656 gene locus_tag LOCUS_32700 gene mscS1 4794 6656 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963046.1 protein_id gnl|my_center|LOCUS_32700 6696 7070 gene locus_tag LOCUS_32710 6696 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 7834 7067 gene locus_tag LOCUS_32720 7834 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 8651 7953 gene locus_tag LOCUS_32730 8651 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 9890 8841 gene locus_tag LOCUS_32740 gene adhC1 9890 8841 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706187.1 protein_id gnl|my_center|LOCUS_32740 10873 10022 gene locus_tag LOCUS_32750 10873 10022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392621.1 protein_id gnl|my_center|LOCUS_32750 11340 10891 gene locus_tag LOCUS_32760 11340 10891 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 protein_id gnl|my_center|LOCUS_32760 13293 11407 gene locus_tag LOCUS_32770 13293 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 14398 13358 gene locus_tag LOCUS_32780 14398 13358 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064866.1 protein_id gnl|my_center|LOCUS_32780 14532 15110 gene locus_tag LOCUS_32790 14532 15110 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H133 protein_id gnl|my_center|LOCUS_32790 17248 15530 gene locus_tag LOCUS_32800 17248 15530 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_32800 17805 17236 gene locus_tag LOCUS_32810 17805 17236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 19148 17910 gene locus_tag LOCUS_32820 19148 17910 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_32820 20603 19257 gene locus_tag LOCUS_32830 gene rhlE 20603 19257 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_32830 21729 20692 gene locus_tag LOCUS_32840 21729 20692 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_32840 22620 21733 gene locus_tag LOCUS_32850 22620 21733 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259145.1 protein_id gnl|my_center|LOCUS_32850 22878 24992 gene locus_tag LOCUS_32860 22878 24992 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108019.1 protein_id gnl|my_center|LOCUS_32860 25691 24993 gene locus_tag LOCUS_32870 25691 24993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 26737 26144 gene locus_tag LOCUS_32880 gene hisIE 26737 26144 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 protein_id gnl|my_center|LOCUS_32880 27522 26767 gene locus_tag LOCUS_32890 gene hisF 27522 26767 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_32890 28046 27525 gene locus_tag LOCUS_32900 28046 27525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424650.1 protein_id gnl|my_center|LOCUS_32900 28911 28039 gene locus_tag LOCUS_32910 gene hisA 28911 28039 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_32910 29757 29176 gene locus_tag LOCUS_32920 gene hisH 29757 29176 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY77 protein_id gnl|my_center|LOCUS_32920 30919 29762 gene locus_tag LOCUS_32930 gene hisB 30919 29762 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 protein_id gnl|my_center|LOCUS_32930 31981 30929 gene locus_tag LOCUS_32940 gene hisC 31981 30929 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY79 protein_id gnl|my_center|LOCUS_32940 33271 31985 gene locus_tag LOCUS_32950 gene hisD 33271 31985 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY80 protein_id gnl|my_center|LOCUS_32950 34159 33299 gene locus_tag LOCUS_32960 gene hisG 34159 33299 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY81 protein_id gnl|my_center|LOCUS_32960 >Feature sequence45 707 1114 gene locus_tag LOCUS_32970 707 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_32970 1211 2164 gene locus_tag LOCUS_32980 gene oxyR 1211 2164 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_32980 2422 2225 gene locus_tag LOCUS_32990 2422 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963849.1 protein_id gnl|my_center|LOCUS_32990 3364 2564 gene locus_tag LOCUS_33000 3364 2564 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201260.1 protein_id gnl|my_center|LOCUS_33000 3940 3485 gene locus_tag LOCUS_33010 3940 3485 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_33010 4085 4597 gene locus_tag LOCUS_33020 4085 4597 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206114.1 protein_id gnl|my_center|LOCUS_33020 4713 5057 gene locus_tag LOCUS_33030 4713 5057 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_33030 5050 6786 gene locus_tag LOCUS_33040 5050 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_33040 6818 7552 gene locus_tag LOCUS_33050 6818 7552 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704223.1 protein_id gnl|my_center|LOCUS_33050 7811 8596 gene locus_tag LOCUS_33060 7811 8596 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_33060 8607 9197 gene locus_tag LOCUS_33070 8607 9197 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_33070 9376 11844 gene locus_tag LOCUS_33080 9376 11844 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383264.1 protein_id gnl|my_center|LOCUS_33080 11953 13686 gene locus_tag LOCUS_33090 11953 13686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 13686 14660 gene locus_tag LOCUS_33100 13686 14660 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_33100 15624 14743 gene locus_tag LOCUS_33110 15624 14743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_33110 15857 16294 gene locus_tag LOCUS_33120 15857 16294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_33120 16378 17073 gene locus_tag LOCUS_33130 16378 17073 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_33130 17122 18426 gene locus_tag LOCUS_33140 gene phrB1 17122 18426 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_33140 18518 18709 gene locus_tag LOCUS_33150 18518 18709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 19446 18706 gene locus_tag LOCUS_33160 19446 18706 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_33160 20137 19451 gene locus_tag LOCUS_33170 20137 19451 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763958.1 protein_id gnl|my_center|LOCUS_33170 20414 20118 gene locus_tag LOCUS_33180 20414 20118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 20547 21068 gene locus_tag LOCUS_33190 20547 21068 CDS product putative 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTG7 protein_id gnl|my_center|LOCUS_33190 22451 21138 gene locus_tag LOCUS_33200 gene murA 22451 21138 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 protein_id gnl|my_center|LOCUS_33200 23104 22472 gene locus_tag LOCUS_33210 23104 22472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_33210 23516 23226 gene locus_tag LOCUS_33220 23516 23226 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_33220 23674 24213 gene locus_tag LOCUS_33230 23674 24213 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_33230 24210 26114 gene locus_tag LOCUS_33240 gene recQ2 24210 26114 CDS product ATP-dependent DNA helicase RecQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 protein_id gnl|my_center|LOCUS_33240 26111 27076 gene locus_tag LOCUS_33250 gene fmt 26111 27076 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H148 protein_id gnl|my_center|LOCUS_33250 27267 27539 gene locus_tag LOCUS_33260 gene hupB 27267 27539 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_33260 27652 28215 gene locus_tag LOCUS_33270 27652 28215 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_33270 29062 28220 gene locus_tag LOCUS_33280 29062 28220 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_33280 29507 29115 gene locus_tag LOCUS_33290 29507 29115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_33290 29688 29762 gene locus_tag LOCUS_t00270 29688 29762 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 30291 30572 gene locus_tag LOCUS_33300 30291 30572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 >Feature sequence46 189 665 gene locus_tag LOCUS_33310 189 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 757 1575 gene locus_tag LOCUS_33320 757 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263015.1 protein_id gnl|my_center|LOCUS_33320 2964 1651 gene locus_tag LOCUS_33330 2964 1651 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_33330 3657 2971 gene locus_tag LOCUS_33340 3657 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_33340 3894 5783 gene locus_tag LOCUS_33350 gene htpG 3894 5783 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_33350 5987 7387 gene locus_tag LOCUS_33360 5987 7387 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CS0 protein_id gnl|my_center|LOCUS_33360 7392 7934 gene locus_tag LOCUS_33370 7392 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 7938 8546 gene locus_tag LOCUS_33380 gene pncA 7938 8546 CDS product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946032.1 protein_id gnl|my_center|LOCUS_33380 8696 9307 gene locus_tag LOCUS_33390 8696 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 9350 10093 gene locus_tag LOCUS_33400 9350 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021949.1 protein_id gnl|my_center|LOCUS_33400 10266 10667 gene locus_tag LOCUS_33410 10266 10667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 10747 11580 gene locus_tag LOCUS_33420 10747 11580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 12685 12065 gene locus_tag LOCUS_33430 12685 12065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 12868 13746 gene locus_tag LOCUS_33440 gene mltR 12868 13746 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762608.1 protein_id gnl|my_center|LOCUS_33440 14088 14954 gene locus_tag LOCUS_33450 14088 14954 CDS product transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790194.1 protein_id gnl|my_center|LOCUS_33450 15756 14980 gene locus_tag LOCUS_33460 15756 14980 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_33460 16005 16502 gene locus_tag LOCUS_33470 16005 16502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 16510 17424 gene locus_tag LOCUS_33480 16510 17424 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682158.1 protein_id gnl|my_center|LOCUS_33480 17591 18343 gene locus_tag LOCUS_33490 17591 18343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963060.1 protein_id gnl|my_center|LOCUS_33490 18688 18422 gene locus_tag LOCUS_33500 18688 18422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963895.1 protein_id gnl|my_center|LOCUS_33500 19699 18731 gene locus_tag LOCUS_33510 19699 18731 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_33510 20188 19778 gene locus_tag LOCUS_33520 gene ygcM 20188 19778 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_33520 20706 20188 gene locus_tag LOCUS_33530 gene idi 20706 20188 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_33530 22733 20811 gene locus_tag LOCUS_33540 22733 20811 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_33540 23719 22748 gene locus_tag LOCUS_33550 23719 22748 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_33550 <25720 23733 gene locus_tag LOCUS_33560 <25720 23733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105890.1:RTX toxin >Feature sequence47 <1 1122 gene locus_tag LOCUS_33570 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYU7:elongation factor Tu 1220 1293 gene locus_tag LOCUS_t00280 1220 1293 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1382 1579 gene locus_tag LOCUS_33580 gene secE 1382 1579 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU6 protein_id gnl|my_center|LOCUS_33580 1590 2150 gene locus_tag LOCUS_33590 gene nusG 1590 2150 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU5 protein_id gnl|my_center|LOCUS_33590 2220 2657 gene locus_tag LOCUS_33600 gene rplK 2220 2657 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU4 protein_id gnl|my_center|LOCUS_33600 2679 3377 gene locus_tag LOCUS_33610 gene rplA 2679 3377 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU3 protein_id gnl|my_center|LOCUS_33610 3388 3909 gene locus_tag LOCUS_33620 gene rplJ 3388 3909 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU2 protein_id gnl|my_center|LOCUS_33620 3971 4345 gene locus_tag LOCUS_33630 gene rplL 3971 4345 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU1 protein_id gnl|my_center|LOCUS_33630 4534 8346 gene locus_tag LOCUS_33640 gene rpoB 4534 8346 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU0 protein_id gnl|my_center|LOCUS_33640 8437 12738 gene locus_tag LOCUS_33650 gene rpoC 8437 12738 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT9 protein_id gnl|my_center|LOCUS_33650 12801 13115 gene locus_tag LOCUS_33660 12801 13115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_33660 14900 13311 gene locus_tag LOCUS_33670 gene prfC 14900 13311 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT6 protein_id gnl|my_center|LOCUS_33670 15492 15929 gene locus_tag LOCUS_33680 15492 15929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 >Feature sequence48 1175 2254 gene locus_tag LOCUS_33690 1175 2254 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WXS5 protein_id gnl|my_center|LOCUS_33690 6387 2257 gene locus_tag LOCUS_33700 6387 2257 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_33700 6718 8652 gene locus_tag LOCUS_33710 6718 8652 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_33710 8645 10018 gene locus_tag LOCUS_33720 gene xynD 8645 10018 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_33720 10033 12477 gene locus_tag LOCUS_33730 10033 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107570.1 protein_id gnl|my_center|LOCUS_33730 12539 14896 gene locus_tag LOCUS_33740 12539 14896 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_33740 14919 17546 gene locus_tag LOCUS_33750 14919 17546 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_33750 17543 18646 gene locus_tag LOCUS_33760 17543 18646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 18650 19786 gene locus_tag LOCUS_33770 gene yieL 18650 19786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31471 protein_id gnl|my_center|LOCUS_33770 >Feature sequence49 373 35 gene locus_tag LOCUS_33780 373 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 1944 394 gene locus_tag LOCUS_33790 gene porX 1944 394 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_33790 1995 3251 gene locus_tag LOCUS_33800 1995 3251 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_33800 3273 4304 gene locus_tag LOCUS_33810 gene lpxD 3273 4304 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_33810 4294 5703 gene locus_tag LOCUS_33820 gene fabZ 4294 5703 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_33820 5708 6493 gene locus_tag LOCUS_33830 gene lpxA 5708 6493 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_33830 6536 7102 gene locus_tag LOCUS_33840 gene efp 6536 7102 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_33840 7106 8038 gene locus_tag LOCUS_33850 7106 8038 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_33850 8040 8453 gene locus_tag LOCUS_33860 8040 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963120.1 protein_id gnl|my_center|LOCUS_33860 8513 9385 gene locus_tag LOCUS_33870 gene sucD 8513 9385 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_33870 9581 11713 gene locus_tag LOCUS_33880 9581 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 11715 12245 gene locus_tag LOCUS_33890 11715 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 12256 12738 gene locus_tag LOCUS_33900 12256 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 12770 13699 gene locus_tag LOCUS_33910 12770 13699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 13707 14690 gene locus_tag LOCUS_33920 13707 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 14830 15576 gene locus_tag LOCUS_33930 14830 15576 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_33930 15598 17637 gene locus_tag LOCUS_33940 15598 17637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_33940 17655 18470 gene locus_tag LOCUS_33950 17655 18470 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013490.1 protein_id gnl|my_center|LOCUS_33950 19128 18526 gene locus_tag LOCUS_33960 19128 18526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 19745 19128 gene locus_tag LOCUS_33970 19745 19128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 >Feature sequence50 240 416 gene locus_tag LOCUS_33980 240 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 661 927 gene locus_tag LOCUS_33990 661 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 1012 2208 gene locus_tag LOCUS_34000 gene ald 1012 2208 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_34000 2223 2609 gene locus_tag LOCUS_34010 2223 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 3860 2685 gene locus_tag LOCUS_34020 gene putA 3860 2685 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_34020 3949 5028 gene locus_tag LOCUS_34030 gene aroB 3949 5028 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_34030 5105 5434 gene locus_tag LOCUS_34040 5105 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 6471 5515 gene locus_tag LOCUS_34050 gene trxB1 6471 5515 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_34050 6706 7833 gene locus_tag LOCUS_34060 6706 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_34060 7830 8273 gene locus_tag LOCUS_34070 7830 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 8720 8274 gene locus_tag LOCUS_34080 8720 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 8964 9039 gene locus_tag LOCUS_t00290 8964 9039 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9254 10498 gene locus_tag LOCUS_34090 9254 10498 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_34090 12629 10902 gene locus_tag LOCUS_34100 gene xylB 12629 10902 CDS product xylosidase/arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639444.2 protein_id gnl|my_center|LOCUS_34100 14765 12678 gene locus_tag LOCUS_34110 14765 12678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 17684 15012 gene locus_tag LOCUS_34120 17684 15012 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639455.2 protein_id gnl|my_center|LOCUS_34120 >Feature sequence51 <1 1447 gene locus_tag LOCUS_34130 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYW8:chromosomal replication initiator protein DnaA 1524 1982 gene locus_tag LOCUS_34140 1524 1982 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 protein_id gnl|my_center|LOCUS_34140 1992 2711 gene locus_tag LOCUS_34150 1992 2711 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_34150 3418 2759 gene locus_tag LOCUS_34160 3418 2759 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963343.1 protein_id gnl|my_center|LOCUS_34160 4694 3651 gene locus_tag LOCUS_34170 gene pabC 4694 3651 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_34170 5226 4684 gene locus_tag LOCUS_34180 5226 4684 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_34180 6023 5214 gene locus_tag LOCUS_34190 gene dapF 6023 5214 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_34190 6125 7522 gene locus_tag LOCUS_34200 gene degP/Q 6125 7522 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_34200 7647 9095 gene locus_tag LOCUS_34210 gene gapA2 7647 9095 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX7 protein_id gnl|my_center|LOCUS_34210 9276 9884 gene locus_tag LOCUS_34220 9276 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 9957 10634 gene locus_tag LOCUS_34230 gene trmD 9957 10634 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_34230 10770 11120 gene locus_tag LOCUS_34240 gene rplS 10770 11120 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_34240 11742 13967 gene locus_tag LOCUS_34250 gene icd 11742 13967 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225341.1 protein_id gnl|my_center|LOCUS_34250 14069 16444 gene locus_tag LOCUS_34260 14069 16444 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_34260 16444 17253 gene locus_tag LOCUS_34270 16444 17253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 17342 18160 gene locus_tag LOCUS_34280 gene murQ 17342 18160 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_34280 18150 18371 gene locus_tag LOCUS_34290 18150 18371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 18697 18446 gene locus_tag LOCUS_34300 gene rpmE 18697 18446 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_34300 >Feature sequence52 507 139 gene locus_tag LOCUS_34310 507 139 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_34310 806 1387 gene locus_tag LOCUS_34320 gene phnA 806 1387 CDS product PhnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 protein_id gnl|my_center|LOCUS_34320 1477 2250 gene locus_tag LOCUS_34330 1477 2250 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267531.1 protein_id gnl|my_center|LOCUS_34330 3993 2596 gene locus_tag LOCUS_34340 3993 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_34340 4324 4406 gene locus_tag LOCUS_t00300 4324 4406 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4788 6575 gene locus_tag LOCUS_34350 4788 6575 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310162.1 protein_id gnl|my_center|LOCUS_34350 6913 7674 gene locus_tag LOCUS_34360 6913 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962948.1 protein_id gnl|my_center|LOCUS_34360 7871 8638 gene locus_tag LOCUS_34370 7871 8638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 8631 9734 gene locus_tag LOCUS_34380 8631 9734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 10144 12024 gene locus_tag LOCUS_34390 10144 12024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 12017 12808 gene locus_tag LOCUS_34400 12017 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 13415 13573 gene locus_tag LOCUS_34410 13415 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 14072 14245 gene locus_tag LOCUS_34420 14072 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 14256 14600 gene locus_tag LOCUS_34430 14256 14600 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_34430 14675 15019 gene locus_tag LOCUS_34440 14675 15019 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_34440 15103 15483 gene locus_tag LOCUS_34450 15103 15483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 15495 15692 gene locus_tag LOCUS_34460 15495 15692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 16229 16516 gene locus_tag LOCUS_34470 16229 16516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 >Feature sequence53 470 1561 gene locus_tag LOCUS_34480 470 1561 CDS product DNA polymerase III, subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963113.1 protein_id gnl|my_center|LOCUS_34480 1885 2223 gene locus_tag LOCUS_34490 1885 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 2223 2804 gene locus_tag LOCUS_34500 gene miaE 2223 2804 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_34500 3472 2885 gene locus_tag LOCUS_34510 3472 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402867.1 protein_id gnl|my_center|LOCUS_34510 4441 3542 gene locus_tag LOCUS_34520 gene ppx 4441 3542 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_34520 6527 4443 gene locus_tag LOCUS_34530 gene ppk 6527 4443 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY90 protein_id gnl|my_center|LOCUS_34530 7013 6531 gene locus_tag LOCUS_34540 gene sixA 7013 6531 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_34540 7669 7025 gene locus_tag LOCUS_34550 gene pdxH 7669 7025 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 protein_id gnl|my_center|LOCUS_34550 8739 7819 gene locus_tag LOCUS_34560 gene rnz 8739 7819 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_34560 9203 8868 gene locus_tag LOCUS_34570 9203 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963901.1 protein_id gnl|my_center|LOCUS_34570 10132 9200 gene locus_tag LOCUS_34580 gene pyrB 10132 9200 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_34580 10687 10148 gene locus_tag LOCUS_34590 gene pyrR1 10687 10148 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_34590 11574 10903 gene locus_tag LOCUS_34600 11574 10903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_34600 11711 12796 gene locus_tag LOCUS_34610 11711 12796 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_34610 13006 14082 gene locus_tag LOCUS_34620 gene pslN 13006 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113726.1 protein_id gnl|my_center|LOCUS_34620 >Feature sequence54 27 1415 gene locus_tag LOCUS_34630 27 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 5341 1412 gene locus_tag LOCUS_34640 5341 1412 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_34640 5679 7262 gene locus_tag LOCUS_34650 5679 7262 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108604.1 protein_id gnl|my_center|LOCUS_34650 11391 7396 gene locus_tag LOCUS_34660 11391 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 12197 13213 gene locus_tag LOCUS_34670 12197 13213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 13550 14653 gene locus_tag LOCUS_34680 13550 14653 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_34680 >Feature sequence55 417 345 gene locus_tag LOCUS_t00310 417 345 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 660 587 gene locus_tag LOCUS_t00320 660 587 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 798 715 gene locus_tag LOCUS_t00330 798 715 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 968 894 gene locus_tag LOCUS_t00340 968 894 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1368 1066 gene locus_tag LOCUS_34690 1368 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_34690 2302 1412 gene locus_tag LOCUS_34700 gene xerC 2302 1412 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_34700 2673 2479 gene locus_tag LOCUS_34710 gene rpsU 2673 2479 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_34710 3934 2765 gene locus_tag LOCUS_34720 3934 2765 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_34720 4815 4015 gene locus_tag LOCUS_34730 4815 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963324.1 protein_id gnl|my_center|LOCUS_34730 6503 4905 gene locus_tag LOCUS_34740 gene dagA 6503 4905 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_34740 8586 6904 gene locus_tag LOCUS_34750 gene dagA 8586 6904 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_34750 9686 8679 gene locus_tag LOCUS_34760 9686 8679 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_34760 9911 9693 gene locus_tag LOCUS_34770 9911 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_34770 11259 9967 gene locus_tag LOCUS_34780 11259 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_34780 11347 11874 gene locus_tag LOCUS_34790 11347 11874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 12859 11879 gene locus_tag LOCUS_34800 12859 11879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 13677 13018 gene locus_tag LOCUS_34810 13677 13018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 <15083 13811 gene locus_tag LOCUS_34820 <15083 13811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964285.1:permease >Feature sequence56 366 1763 gene locus_tag LOCUS_34830 366 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_34830 1889 2869 gene locus_tag LOCUS_34840 1889 2869 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_34840 2859 3875 gene locus_tag LOCUS_34850 2859 3875 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_34850 3955 4686 gene locus_tag LOCUS_34860 3955 4686 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_34860 4772 6805 gene locus_tag LOCUS_34870 4772 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963876.1 protein_id gnl|my_center|LOCUS_34870 6816 7442 gene locus_tag LOCUS_34880 6816 7442 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260949.1 protein_id gnl|my_center|LOCUS_34880 8504 7491 gene locus_tag LOCUS_34890 8504 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 9255 8716 gene locus_tag LOCUS_34900 9255 8716 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_34900 10007 9252 gene locus_tag LOCUS_34910 gene kdsB 10007 9252 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_34910 10580 10014 gene locus_tag LOCUS_34920 10580 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_34920 12019 10586 gene locus_tag LOCUS_34930 12019 10586 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_34930 12137 12784 gene locus_tag LOCUS_34940 12137 12784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 12774 13571 gene locus_tag LOCUS_34950 12774 13571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 protein_id gnl|my_center|LOCUS_34950 13568 14104 gene locus_tag LOCUS_34960 13568 14104 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_34960 14160 14561 gene locus_tag LOCUS_34970 14160 14561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 >Feature sequence57 2656 830 gene locus_tag LOCUS_34980 2656 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_34980 3304 2729 gene locus_tag LOCUS_34990 3304 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 4409 3357 gene locus_tag LOCUS_35000 4409 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088024.1 protein_id gnl|my_center|LOCUS_35000 5815 4544 gene locus_tag LOCUS_35010 gene purA 5815 4544 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_35010 6304 5816 gene locus_tag LOCUS_35020 gene fur 6304 5816 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_35020 8545 6329 gene locus_tag LOCUS_35030 gene relA 8545 6329 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_35030 9885 8647 gene locus_tag LOCUS_35040 9885 8647 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_35040 10747 9896 gene locus_tag LOCUS_35050 10747 9896 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_35050 11689 10769 gene locus_tag LOCUS_35060 11689 10769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 12388 11693 gene locus_tag LOCUS_35070 12388 11693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_35070 12902 12405 gene locus_tag LOCUS_35080 12902 12405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 protein_id gnl|my_center|LOCUS_35080 14320 12908 gene locus_tag LOCUS_35090 gene trmA 14320 12908 CDS product tRNA (uracil-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_35090 >Feature sequence58 1511 1708 gene locus_tag LOCUS_35100 1511 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963717.1 protein_id gnl|my_center|LOCUS_35100 4361 1857 gene locus_tag LOCUS_35110 4361 1857 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_35110 4792 4448 gene locus_tag LOCUS_35120 4792 4448 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_35120 5901 4795 gene locus_tag LOCUS_35130 gene prfB 5901 4795 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_35130 7040 6042 gene locus_tag LOCUS_35140 7040 6042 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888626.1 protein_id gnl|my_center|LOCUS_35140 8041 7097 gene locus_tag LOCUS_35150 8041 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_35150 9550 8087 gene locus_tag LOCUS_35160 9550 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_35160 9742 12144 gene locus_tag LOCUS_35170 9742 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_35170 12148 12603 gene locus_tag LOCUS_35180 12148 12603 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 protein_id gnl|my_center|LOCUS_35180 12590 13858 gene locus_tag LOCUS_35190 12590 13858 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_35190 13886 14137 gene locus_tag LOCUS_35200 13886 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 >Feature sequence59 863 12 gene locus_tag LOCUS_35210 863 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 1570 1061 gene locus_tag LOCUS_35220 1570 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 2528 1686 gene locus_tag LOCUS_35230 2528 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 3084 2530 gene locus_tag LOCUS_35240 3084 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 5518 3116 gene locus_tag LOCUS_35250 5518 3116 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005842190.1 protein_id gnl|my_center|LOCUS_35250 6079 5792 gene locus_tag LOCUS_35260 6079 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 6269 6901 gene locus_tag LOCUS_35270 6269 6901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 7785 7123 gene locus_tag LOCUS_35280 7785 7123 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_35280 8083 7769 gene locus_tag LOCUS_35290 8083 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 8809 8525 gene locus_tag LOCUS_35300 8809 8525 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 protein_id gnl|my_center|LOCUS_35300 9954 9103 gene locus_tag LOCUS_35310 9954 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963653.1 protein_id gnl|my_center|LOCUS_35310 11024 10011 gene locus_tag LOCUS_35320 11024 10011 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35320 13345 11228 gene locus_tag LOCUS_35330 13345 11228 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_35330 13657 13364 gene locus_tag LOCUS_35340 13657 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 >Feature sequence60 <1 513 gene locus_tag LOCUS_35350 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931870.1:penicillin-binding protein 647 1513 gene locus_tag LOCUS_35360 gene rpoD 647 1513 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_35360 2174 1587 gene locus_tag LOCUS_35370 2174 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 4604 2196 gene locus_tag LOCUS_35380 gene phuR 4604 2196 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_35380 5059 4742 gene locus_tag LOCUS_35390 5059 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 5823 5083 gene locus_tag LOCUS_35400 5823 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 7336 5807 gene locus_tag LOCUS_35410 7336 5807 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 protein_id gnl|my_center|LOCUS_35410 7591 7974 gene locus_tag LOCUS_35420 7591 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 8764 8045 gene locus_tag LOCUS_35430 8764 8045 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_35430 8902 9519 gene locus_tag LOCUS_35440 8902 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 9520 9801 gene locus_tag LOCUS_35450 gene ydzA 9520 9801 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_35450 9812 10423 gene locus_tag LOCUS_35460 gene ddpX 9812 10423 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H017 protein_id gnl|my_center|LOCUS_35460 >Feature sequence61 224 850 gene locus_tag LOCUS_35470 gene yqfA 224 850 CDS product channel protein hemolysin III family subfamily YqfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072423.1 protein_id gnl|my_center|LOCUS_35470 1275 847 gene locus_tag LOCUS_35480 1275 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_35480 1946 1278 gene locus_tag LOCUS_35490 1946 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_35490 2021 3184 gene locus_tag LOCUS_35500 2021 3184 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_35500 3996 3247 gene locus_tag LOCUS_35510 3996 3247 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_35510 5248 4073 gene locus_tag LOCUS_35520 5248 4073 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_35520 5541 7586 gene locus_tag LOCUS_35530 5541 7586 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_35530 7728 7812 gene locus_tag LOCUS_t00350 7728 7812 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7832 7907 gene locus_tag LOCUS_t00360 7832 7907 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8235 9368 gene locus_tag LOCUS_35540 8235 9368 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_35540 10832 9621 gene locus_tag LOCUS_35550 10832 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 11122 10829 gene locus_tag LOCUS_35560 11122 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 >Feature sequence62 403 1548 gene locus_tag LOCUS_35570 403 1548 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_35570 4011 1549 gene locus_tag LOCUS_35580 4011 1549 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_35580 5708 4017 gene locus_tag LOCUS_35590 5708 4017 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_35590 5993 6283 gene locus_tag LOCUS_35600 5993 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963282.1 protein_id gnl|my_center|LOCUS_35600 6294 6584 gene locus_tag LOCUS_35610 6294 6584 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 protein_id gnl|my_center|LOCUS_35610 6793 7653 gene locus_tag LOCUS_35620 6793 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35620 7657 8361 gene locus_tag LOCUS_35630 7657 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35630 9163 8432 gene locus_tag LOCUS_35640 9163 8432 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_35640 9536 9252 gene locus_tag LOCUS_35650 gene pcbD 9536 9252 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L66 protein_id gnl|my_center|LOCUS_35650 9694 11160 gene locus_tag LOCUS_35660 gene pepD 9694 11160 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964033.1 protein_id gnl|my_center|LOCUS_35660 >Feature sequence63 2 250 gene locus_tag LOCUS_35670 2 250 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_35670 367 1917 gene locus_tag LOCUS_35680 367 1917 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626351.1 protein_id gnl|my_center|LOCUS_35680 1919 2134 gene locus_tag LOCUS_35690 1919 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396617.1 protein_id gnl|my_center|LOCUS_35690 2239 2811 gene locus_tag LOCUS_35700 2239 2811 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_35700 3151 4143 gene locus_tag LOCUS_35710 gene lpxD 3151 4143 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZZ4 protein_id gnl|my_center|LOCUS_35710 5066 4140 gene locus_tag LOCUS_35720 5066 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 5392 5129 gene locus_tag LOCUS_35730 5392 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 5690 6151 gene locus_tag LOCUS_35740 5690 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 6282 7844 gene locus_tag LOCUS_35750 6282 7844 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 protein_id gnl|my_center|LOCUS_35750 7849 8103 gene locus_tag LOCUS_35760 7849 8103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 8093 8590 gene locus_tag LOCUS_35770 gene msrA 8093 8590 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53W34 protein_id gnl|my_center|LOCUS_35770 8732 9406 gene locus_tag LOCUS_35780 8732 9406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 >Feature sequence64 318 1382 gene locus_tag LOCUS_35790 318 1382 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_35790 1809 2483 gene locus_tag LOCUS_35800 1809 2483 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_35800 2556 3773 gene locus_tag LOCUS_35810 2556 3773 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_35810 3874 6246 gene locus_tag LOCUS_35820 3874 6246 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_35820 6337 7092 gene locus_tag LOCUS_35830 6337 7092 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105573.1 protein_id gnl|my_center|LOCUS_35830 7199 8851 gene locus_tag LOCUS_35840 7199 8851 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943191.1 protein_id gnl|my_center|LOCUS_35840 >Feature sequence65 596 1438 gene locus_tag LOCUS_35850 596 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423269.1 protein_id gnl|my_center|LOCUS_35850 1480 1734 gene locus_tag LOCUS_35860 1480 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 1750 3126 gene locus_tag LOCUS_35870 1750 3126 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947965.1 protein_id gnl|my_center|LOCUS_35870 3155 4657 gene locus_tag LOCUS_35880 3155 4657 CDS product putative thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWR3 protein_id gnl|my_center|LOCUS_35880 >Feature sequence66 <1 703 gene locus_tag LOCUS_35890 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H008:ATP-dependent 6-phosphofructokinase 707 1696 gene locus_tag LOCUS_35900 gene ldhA 707 1696 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973390.1 protein_id gnl|my_center|LOCUS_35900 1739 2512 gene locus_tag LOCUS_35910 1739 2512 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087150.1 protein_id gnl|my_center|LOCUS_35910 2537 3235 gene locus_tag LOCUS_35920 gene uspA 2537 3235 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35920 >Feature sequence67 423 1478 gene locus_tag LOCUS_35930 423 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 2010 2276 gene locus_tag LOCUS_35940 2010 2276 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948267.1 protein_id gnl|my_center|LOCUS_35940 2372 3154 gene locus_tag LOCUS_35950 2372 3154 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948268.1 protein_id gnl|my_center|LOCUS_35950 >Feature sequence68 788 315 gene locus_tag LOCUS_35960 788 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35960 1100 807 gene locus_tag LOCUS_35970 1100 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 1751 1107 gene locus_tag LOCUS_35980 1751 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence69 490 1410 gene locus_tag LOCUS_35990 490 1410 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932981.1 protein_id gnl|my_center|LOCUS_35990