>Feature sequence001 2612 1140 gene locus_tag LOCUS_00010 2612 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3219 3488 gene locus_tag LOCUS_00020 3219 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3764 4915 gene locus_tag LOCUS_00030 3764 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4918 5847 gene locus_tag LOCUS_00040 4918 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5837 6496 gene locus_tag LOCUS_00050 5837 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6607 7410 gene locus_tag LOCUS_00060 6607 7410 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_00060 7403 8314 gene locus_tag LOCUS_00070 gene parB 7403 8314 CDS product putative chromosome-partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q50201 protein_id gnl|my_center|LOCUS_00070 9327 8335 gene locus_tag LOCUS_00080 9327 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9678 9352 gene locus_tag LOCUS_00090 9678 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00090 10733 9768 gene locus_tag LOCUS_00100 gene trxB 10733 9768 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52215 protein_id gnl|my_center|LOCUS_00100 10785 10934 gene locus_tag LOCUS_00110 10785 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11900 11061 gene locus_tag LOCUS_00120 11900 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169470.1 protein_id gnl|my_center|LOCUS_00120 13510 11897 gene locus_tag LOCUS_00130 13510 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13581 13892 gene locus_tag LOCUS_00140 13581 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 13973 14980 gene locus_tag LOCUS_00150 13973 14980 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036031.1 protein_id gnl|my_center|LOCUS_00150 14977 16215 gene locus_tag LOCUS_00160 14977 16215 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_00160 16272 16712 gene locus_tag LOCUS_00170 16272 16712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909035.1 protein_id gnl|my_center|LOCUS_00170 16799 17647 gene locus_tag LOCUS_00180 gene panB 16799 17647 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C32 protein_id gnl|my_center|LOCUS_00180 17827 18171 gene locus_tag LOCUS_00190 gene rpsF 17827 18171 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MB49 protein_id gnl|my_center|LOCUS_00190 18199 18645 gene locus_tag LOCUS_00200 gene ssb 18199 18645 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46390 protein_id gnl|my_center|LOCUS_00200 18645 19130 gene locus_tag LOCUS_00210 18645 19130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19127 19573 gene locus_tag LOCUS_00220 gene rplI 19127 19573 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9D7 protein_id gnl|my_center|LOCUS_00220 19735 21189 gene locus_tag LOCUS_00230 gene dnaC 19735 21189 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAG8 protein_id gnl|my_center|LOCUS_00230 21198 21401 gene locus_tag LOCUS_00240 21198 21401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 21458 22564 gene locus_tag LOCUS_00250 21458 22564 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978023.1 protein_id gnl|my_center|LOCUS_00250 25420 22571 gene locus_tag LOCUS_00260 25420 22571 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228917.1 protein_id gnl|my_center|LOCUS_00260 27683 25446 gene locus_tag LOCUS_00270 27683 25446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 28679 27756 gene locus_tag LOCUS_00280 28679 27756 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438698.1 protein_id gnl|my_center|LOCUS_00280 29668 28676 gene locus_tag LOCUS_00290 29668 28676 CDS product trans-3-hydroxy-L-proline dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81HB1 protein_id gnl|my_center|LOCUS_00290 29794 29723 gene locus_tag LOCUS_t00010 29794 29723 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 29882 30460 gene locus_tag LOCUS_00300 29882 30460 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_00300 30491 31051 gene locus_tag LOCUS_00310 gene dcd 30491 31051 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJL3 protein_id gnl|my_center|LOCUS_00310 33294 31048 gene locus_tag LOCUS_00320 33294 31048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_00320 34185 33436 gene locus_tag LOCUS_00330 gene gpmA 34185 33436 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QR00 protein_id gnl|my_center|LOCUS_00330 34378 36186 gene locus_tag LOCUS_00340 gene dnaK 34378 36186 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MIX5 protein_id gnl|my_center|LOCUS_00340 36183 36779 gene locus_tag LOCUS_00350 36183 36779 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_00350 36799 37686 gene locus_tag LOCUS_00360 gene dnaJ 36799 37686 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403245.1 protein_id gnl|my_center|LOCUS_00360 37755 38138 gene locus_tag LOCUS_00370 37755 38138 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230871.1 protein_id gnl|my_center|LOCUS_00370 38392 39672 gene locus_tag LOCUS_00380 gene purA 38392 39672 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H632 protein_id gnl|my_center|LOCUS_00380 39682 40911 gene locus_tag LOCUS_00390 gene purD 39682 40911 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGV0 protein_id gnl|my_center|LOCUS_00390 40935 41390 gene locus_tag LOCUS_00400 gene purE 40935 41390 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CV6 protein_id gnl|my_center|LOCUS_00400 41403 42821 gene locus_tag LOCUS_00410 41403 42821 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CK34 protein_id gnl|my_center|LOCUS_00410 42834 43727 gene locus_tag LOCUS_00420 gene purC 42834 43727 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF0 protein_id gnl|my_center|LOCUS_00420 43729 43998 gene locus_tag LOCUS_00430 gene purS 43729 43998 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU3 protein_id gnl|my_center|LOCUS_00430 43998 44660 gene locus_tag LOCUS_00440 gene purQ 43998 44660 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPA5 protein_id gnl|my_center|LOCUS_00440 44724 46922 gene locus_tag LOCUS_00450 gene purL 44724 46922 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU5 protein_id gnl|my_center|LOCUS_00450 46973 48502 gene locus_tag LOCUS_00460 gene purF 46973 48502 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKK3 protein_id gnl|my_center|LOCUS_00460 48540 49577 gene locus_tag LOCUS_00470 gene purM 48540 49577 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB6 protein_id gnl|my_center|LOCUS_00470 49587 50135 gene locus_tag LOCUS_00480 gene pyrE 49587 50135 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8R7 protein_id gnl|my_center|LOCUS_00480 50171 51574 gene locus_tag LOCUS_00490 50171 51574 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404528.1 protein_id gnl|my_center|LOCUS_00490 51590 52321 gene locus_tag LOCUS_00500 51590 52321 CDS product 2-haloalkanoic acid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249065.1 protein_id gnl|my_center|LOCUS_00500 <53103 52322 gene locus_tag LOCUS_00510 <53103 52322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000531489.1:protein-tyrosine-phosphatase >Feature sequence002 1025 510 gene locus_tag LOCUS_00520 1025 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 1654 1031 gene locus_tag LOCUS_00530 1654 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 2728 1703 gene locus_tag LOCUS_00540 gene acd 2728 1703 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228928.1 protein_id gnl|my_center|LOCUS_00540 3897 2737 gene locus_tag LOCUS_00550 3897 2737 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_00550 4958 3900 gene locus_tag LOCUS_00560 4958 3900 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225238.1 protein_id gnl|my_center|LOCUS_00560 5722 4955 gene locus_tag LOCUS_00570 5722 4955 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_00570 6608 5715 gene locus_tag LOCUS_00580 6608 5715 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_00580 6676 7479 gene locus_tag LOCUS_00590 6676 7479 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730965.1 protein_id gnl|my_center|LOCUS_00590 7495 8424 gene locus_tag LOCUS_00600 7495 8424 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_00600 9216 8431 gene locus_tag LOCUS_00610 gene fabG 9216 8431 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_00610 10149 9235 gene locus_tag LOCUS_00620 10149 9235 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085741.1 protein_id gnl|my_center|LOCUS_00620 10230 11138 gene locus_tag LOCUS_00630 10230 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 11212 11667 gene locus_tag LOCUS_00640 11212 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 11674 12414 gene locus_tag LOCUS_00650 11674 12414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 12437 14755 gene locus_tag LOCUS_00660 12437 14755 CDS product magnesium-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029584.1 protein_id gnl|my_center|LOCUS_00660 15124 14771 gene locus_tag LOCUS_00670 15124 14771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 15335 16345 gene locus_tag LOCUS_00680 15335 16345 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909001.1 protein_id gnl|my_center|LOCUS_00680 17565 16354 gene locus_tag LOCUS_00690 gene mct 17565 16354 CDS product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC36 protein_id gnl|my_center|LOCUS_00690 17832 17581 gene locus_tag LOCUS_00700 17832 17581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00700 19584 18121 gene locus_tag LOCUS_00710 19584 18121 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_00710 19691 20383 gene locus_tag LOCUS_00720 19691 20383 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_00720 20465 21667 gene locus_tag LOCUS_00730 gene fadA3 20465 21667 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405724.1 protein_id gnl|my_center|LOCUS_00730 22567 21677 gene locus_tag LOCUS_00740 22567 21677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 23615 22584 gene locus_tag LOCUS_00750 gene ilvC 23615 22584 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYR6 protein_id gnl|my_center|LOCUS_00750 24159 23662 gene locus_tag LOCUS_00760 gene ilvH 24159 23662 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_00760 25898 24156 gene locus_tag LOCUS_00770 gene ilvB 25898 24156 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42463 protein_id gnl|my_center|LOCUS_00770 27761 26070 gene locus_tag LOCUS_00780 gene ilvD 27761 26070 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06069 protein_id gnl|my_center|LOCUS_00780 27903 29126 gene locus_tag LOCUS_00790 27903 29126 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029304.1 protein_id gnl|my_center|LOCUS_00790 30556 29123 gene locus_tag LOCUS_00800 gene gatB 30556 29123 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGY5 protein_id gnl|my_center|LOCUS_00800 31988 30549 gene locus_tag LOCUS_00810 gene gatA 31988 30549 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EEA6 protein_id gnl|my_center|LOCUS_00810 32287 31988 gene locus_tag LOCUS_00820 gene gatC 32287 31988 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUW9 protein_id gnl|my_center|LOCUS_00820 34284 32326 gene locus_tag LOCUS_00830 34284 32326 CDS product putative serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XA16 protein_id gnl|my_center|LOCUS_00830 34317 34730 gene locus_tag LOCUS_00840 34317 34730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 36816 34735 gene locus_tag LOCUS_00850 gene ligA 36816 34735 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCA1 protein_id gnl|my_center|LOCUS_00850 36919 37764 gene locus_tag LOCUS_00860 36919 37764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 38793 37765 gene locus_tag LOCUS_00870 gene mnmA 38793 37765 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFH2 protein_id gnl|my_center|LOCUS_00870 39926 38790 gene locus_tag LOCUS_00880 39926 38790 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_00880 39983 40420 gene locus_tag LOCUS_00890 39983 40420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 41090 40434 gene locus_tag LOCUS_00900 41090 40434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 41796 41344 gene locus_tag LOCUS_00910 41796 41344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 43194 41875 gene locus_tag LOCUS_00920 gene murA 43194 41875 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CL1 protein_id gnl|my_center|LOCUS_00920 >Feature sequence003 <1 1048 gene locus_tag LOCUS_00930 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728260.1:cytochrome P450 1562 1263 gene locus_tag LOCUS_00940 1562 1263 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804583.1 protein_id gnl|my_center|LOCUS_00940 1689 3221 gene locus_tag LOCUS_00950 1689 3221 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_00950 3390 4508 gene locus_tag LOCUS_00960 3390 4508 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066799.1 protein_id gnl|my_center|LOCUS_00960 4638 6191 gene locus_tag LOCUS_00970 4638 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 6441 6166 gene locus_tag LOCUS_00980 6441 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 6440 8020 gene locus_tag LOCUS_00990 6440 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 8030 8815 gene locus_tag LOCUS_01000 8030 8815 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_01000 8823 9689 gene locus_tag LOCUS_01010 gene tauD 8823 9689 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114311.1 protein_id gnl|my_center|LOCUS_01010 10582 9713 gene locus_tag LOCUS_01020 10582 9713 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478191.1 protein_id gnl|my_center|LOCUS_01020 10694 11626 gene locus_tag LOCUS_01030 10694 11626 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 protein_id gnl|my_center|LOCUS_01030 11626 12864 gene locus_tag LOCUS_01040 11626 12864 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_01040 12906 14084 gene locus_tag LOCUS_01050 gene atoB 12906 14084 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225687.1 protein_id gnl|my_center|LOCUS_01050 14103 15179 gene locus_tag LOCUS_01060 gene adh 14103 15179 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_01060 16079 15204 gene locus_tag LOCUS_01070 16079 15204 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_01070 16909 16118 gene locus_tag LOCUS_01080 16909 16118 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530480.1 protein_id gnl|my_center|LOCUS_01080 17120 16911 gene locus_tag LOCUS_01090 17120 16911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 17444 17151 gene locus_tag LOCUS_01100 17444 17151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 18522 17470 gene locus_tag LOCUS_01110 18522 17470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_01110 19699 18587 gene locus_tag LOCUS_01120 19699 18587 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_01120 21345 19702 gene locus_tag LOCUS_01130 gene betA 21345 19702 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGN2 protein_id gnl|my_center|LOCUS_01130 21450 22625 gene locus_tag LOCUS_01140 21450 22625 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730272.1 protein_id gnl|my_center|LOCUS_01140 22681 23496 gene locus_tag LOCUS_01150 22681 23496 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_01150 23504 25612 gene locus_tag LOCUS_01160 23504 25612 CDS product N-methylhydantoinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706373.1 protein_id gnl|my_center|LOCUS_01160 25609 27213 gene locus_tag LOCUS_01170 25609 27213 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706372.1 protein_id gnl|my_center|LOCUS_01170 27271 28458 gene locus_tag LOCUS_01180 27271 28458 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706369.1 protein_id gnl|my_center|LOCUS_01180 29177 28455 gene locus_tag LOCUS_01190 29177 28455 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_01190 29959 29174 gene locus_tag LOCUS_01200 29959 29174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_01200 31746 29956 gene locus_tag LOCUS_01210 31746 29956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 32870 31743 gene locus_tag LOCUS_01220 32870 31743 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 protein_id gnl|my_center|LOCUS_01220 34983 32893 gene locus_tag LOCUS_01230 34983 32893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 36200 34980 gene locus_tag LOCUS_01240 gene opuAA 36200 34980 CDS product glycine/betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370609.1 protein_id gnl|my_center|LOCUS_01240 36323 37237 gene locus_tag LOCUS_01250 gene ilvE2 36323 37237 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_01250 37234 37959 gene locus_tag LOCUS_01260 37234 37959 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_01260 37959 38222 gene locus_tag LOCUS_01270 37959 38222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 38298 38534 gene locus_tag LOCUS_01280 38298 38534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01280 38921 38526 gene locus_tag LOCUS_01290 38921 38526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 40193 38925 gene locus_tag LOCUS_01300 40193 38925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709437.1 protein_id gnl|my_center|LOCUS_01300 40855 40238 gene locus_tag LOCUS_01310 40855 40238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 42906 40915 gene locus_tag LOCUS_01320 42906 40915 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_01320 >Feature sequence004 1345 50 gene locus_tag LOCUS_01330 gene metX 1345 50 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIW8 protein_id gnl|my_center|LOCUS_01330 2680 1514 gene locus_tag LOCUS_01340 2680 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 3268 2756 gene locus_tag LOCUS_01350 3268 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 4022 3285 gene locus_tag LOCUS_01360 4022 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 5914 4118 gene locus_tag LOCUS_01370 5914 4118 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388194.1 protein_id gnl|my_center|LOCUS_01370 6604 5957 gene locus_tag LOCUS_01380 gene tdk 6604 5957 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50519 protein_id gnl|my_center|LOCUS_01380 6756 7553 gene locus_tag LOCUS_01390 6756 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_01390 7941 7558 gene locus_tag LOCUS_01400 7941 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 8111 8755 gene locus_tag LOCUS_01410 gene lexA 8111 8755 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187P1 protein_id gnl|my_center|LOCUS_01410 9820 8765 gene locus_tag LOCUS_01420 9820 8765 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_01420 10663 9839 gene locus_tag LOCUS_01430 gene dapD 10663 9839 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_01430 11827 10709 gene locus_tag LOCUS_01440 11827 10709 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_01440 13197 11824 gene locus_tag LOCUS_01450 gene hflX 13197 11824 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0N6 protein_id gnl|my_center|LOCUS_01450 13993 13190 gene locus_tag LOCUS_01460 13993 13190 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811895.1 protein_id gnl|my_center|LOCUS_01460 14984 14004 gene locus_tag LOCUS_01470 gene miaA 14984 14004 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBD2 protein_id gnl|my_center|LOCUS_01470 16410 14977 gene locus_tag LOCUS_01480 gene miaB 16410 14977 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69963 protein_id gnl|my_center|LOCUS_01480 17679 16534 gene locus_tag LOCUS_01490 gene recA 17679 16534 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9REV6 protein_id gnl|my_center|LOCUS_01490 17902 18315 gene locus_tag LOCUS_01500 gene msrB 17902 18315 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65450 protein_id gnl|my_center|LOCUS_01500 19599 18355 gene locus_tag LOCUS_01510 gene cinA 19599 18355 CDS product putative competence-damage inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKI6 protein_id gnl|my_center|LOCUS_01510 20196 19609 gene locus_tag LOCUS_01520 20196 19609 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_01520 21437 20193 gene locus_tag LOCUS_01530 gene rimO 21437 20193 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2H6 protein_id gnl|my_center|LOCUS_01530 22439 21474 gene locus_tag LOCUS_01540 22439 21474 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_01540 24901 22469 gene locus_tag LOCUS_01550 24901 22469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 26623 24968 gene locus_tag LOCUS_01560 gene rnj 26623 24968 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86842 protein_id gnl|my_center|LOCUS_01560 27547 26642 gene locus_tag LOCUS_01570 gene dapA 27547 26642 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJK7 protein_id gnl|my_center|LOCUS_01570 28194 27550 gene locus_tag LOCUS_01580 28194 27550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405892.1 protein_id gnl|my_center|LOCUS_01580 28927 28199 gene locus_tag LOCUS_01590 28927 28199 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC66 protein_id gnl|my_center|LOCUS_01590 29709 28924 gene locus_tag LOCUS_01600 gene dapB 29709 28924 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WP23 protein_id gnl|my_center|LOCUS_01600 32204 29787 gene locus_tag LOCUS_01610 gene pnp 32204 29787 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVQ5 protein_id gnl|my_center|LOCUS_01610 32638 32369 gene locus_tag LOCUS_01620 gene rpsO 32638 32369 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT0 protein_id gnl|my_center|LOCUS_01620 33788 32784 gene locus_tag LOCUS_01630 33788 32784 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097237.1 protein_id gnl|my_center|LOCUS_01630 34994 33789 gene locus_tag LOCUS_01640 34994 33789 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926041.1 protein_id gnl|my_center|LOCUS_01640 35096 35623 gene locus_tag LOCUS_01650 35096 35623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 35643 36113 gene locus_tag LOCUS_01660 35643 36113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 36118 36525 gene locus_tag LOCUS_01670 36118 36525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 36527 37504 gene locus_tag LOCUS_01680 36527 37504 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104312.1 protein_id gnl|my_center|LOCUS_01680 38531 37521 gene locus_tag LOCUS_01690 38531 37521 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097237.1 protein_id gnl|my_center|LOCUS_01690 38590 39975 gene locus_tag LOCUS_01700 38590 39975 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455014.1 protein_id gnl|my_center|LOCUS_01700 40771 40028 gene locus_tag LOCUS_01710 40771 40028 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYP8 protein_id gnl|my_center|LOCUS_01710 41817 40768 gene locus_tag LOCUS_01720 gene mer 41817 40768 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_01720 >Feature sequence005 1257 841 gene locus_tag LOCUS_01730 1257 841 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947304.1 protein_id gnl|my_center|LOCUS_01730 1569 1327 gene locus_tag LOCUS_01740 1569 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 2363 1593 gene locus_tag LOCUS_01750 2363 1593 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_01750 4305 2371 gene locus_tag LOCUS_01760 gene sdhA 4305 2371 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_01760 5157 4309 gene locus_tag LOCUS_01770 5157 4309 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_01770 5405 6847 gene locus_tag LOCUS_01780 5405 6847 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730585.1 protein_id gnl|my_center|LOCUS_01780 7702 6863 gene locus_tag LOCUS_01790 gene htdY 7702 6863 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 protein_id gnl|my_center|LOCUS_01790 7807 8805 gene locus_tag LOCUS_01800 7807 8805 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730117.1 protein_id gnl|my_center|LOCUS_01800 8934 10955 gene locus_tag LOCUS_01810 8934 10955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_01810 11044 11355 gene locus_tag LOCUS_01820 11044 11355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 11394 11588 gene locus_tag LOCUS_01830 11394 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 11666 11953 gene locus_tag LOCUS_01840 11666 11953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 12199 11960 gene locus_tag LOCUS_01850 12199 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 12388 13542 gene locus_tag LOCUS_01860 12388 13542 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481386.1 protein_id gnl|my_center|LOCUS_01860 13604 14272 gene locus_tag LOCUS_01870 gene phoU 13604 14272 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RS84 protein_id gnl|my_center|LOCUS_01870 14402 15163 gene locus_tag LOCUS_01880 gene surE 14402 15163 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731558.1 protein_id gnl|my_center|LOCUS_01880 15261 16556 gene locus_tag LOCUS_01890 15261 16556 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 protein_id gnl|my_center|LOCUS_01890 17722 16553 gene locus_tag LOCUS_01900 17722 16553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_01900 17904 18407 gene locus_tag LOCUS_01910 17904 18407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 18404 18634 gene locus_tag LOCUS_01920 18404 18634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 18636 19640 gene locus_tag LOCUS_01930 18636 19640 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976188.1 protein_id gnl|my_center|LOCUS_01930 20276 19644 gene locus_tag LOCUS_01940 20276 19644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 20549 20277 gene locus_tag LOCUS_01950 20549 20277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 20689 21744 gene locus_tag LOCUS_01960 20689 21744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476281.1 protein_id gnl|my_center|LOCUS_01960 21840 24797 gene locus_tag LOCUS_01970 21840 24797 CDS product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FCI4 protein_id gnl|my_center|LOCUS_01970 25249 24806 gene locus_tag LOCUS_01980 25249 24806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 25337 26083 gene locus_tag LOCUS_01990 25337 26083 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706236.1 protein_id gnl|my_center|LOCUS_01990 26080 26826 gene locus_tag LOCUS_02000 26080 26826 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331278.1 protein_id gnl|my_center|LOCUS_02000 26868 26944 gene locus_tag LOCUS_t00020 26868 26944 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 28353 27043 gene locus_tag LOCUS_02010 28353 27043 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_02010 29077 28574 gene locus_tag LOCUS_02020 29077 28574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919683.1 protein_id gnl|my_center|LOCUS_02020 29558 29085 gene locus_tag LOCUS_02030 29558 29085 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707273.1 protein_id gnl|my_center|LOCUS_02030 29652 30788 gene locus_tag LOCUS_02040 gene ald 29652 30788 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU16 protein_id gnl|my_center|LOCUS_02040 32338 30785 gene locus_tag LOCUS_02050 32338 30785 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976326.1 protein_id gnl|my_center|LOCUS_02050 34750 32339 gene locus_tag LOCUS_02060 34750 32339 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533447.1 protein_id gnl|my_center|LOCUS_02060 37228 34781 gene locus_tag LOCUS_02070 37228 34781 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708705.1 protein_id gnl|my_center|LOCUS_02070 37365 38738 gene locus_tag LOCUS_02080 37365 38738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 38772 39788 gene locus_tag LOCUS_02090 gene acoA 38772 39788 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2A0 protein_id gnl|my_center|LOCUS_02090 39785 40819 gene locus_tag LOCUS_02100 39785 40819 CDS product TPP-dependent acetoin dehydrogenase complex, E1 protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_02100 >Feature sequence006 841 275 gene locus_tag LOCUS_02110 841 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 1151 894 gene locus_tag LOCUS_02120 1151 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 1674 1156 gene locus_tag LOCUS_02130 1674 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 2421 1768 gene locus_tag LOCUS_02140 2421 1768 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583598.1 protein_id gnl|my_center|LOCUS_02140 3131 2418 gene locus_tag LOCUS_02150 3131 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 4238 3141 gene locus_tag LOCUS_02160 gene ftsZ 4238 3141 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45500 protein_id gnl|my_center|LOCUS_02160 5113 4391 gene locus_tag LOCUS_02170 5113 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 6060 5110 gene locus_tag LOCUS_02180 gene murB 6060 5110 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18579 protein_id gnl|my_center|LOCUS_02180 7417 6035 gene locus_tag LOCUS_02190 gene murC 7417 6035 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61679 protein_id gnl|my_center|LOCUS_02190 8537 7407 gene locus_tag LOCUS_02200 8537 7407 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460696.1 protein_id gnl|my_center|LOCUS_02200 9576 8554 gene locus_tag LOCUS_02210 9576 8554 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_02210 11018 9717 gene locus_tag LOCUS_02220 gene murD 11018 9717 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK56 protein_id gnl|my_center|LOCUS_02220 12070 11018 gene locus_tag LOCUS_02230 gene mraY 12070 11018 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DEC7 protein_id gnl|my_center|LOCUS_02230 13476 12067 gene locus_tag LOCUS_02240 gene murE 13476 12067 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182Z8 protein_id gnl|my_center|LOCUS_02240 15242 13476 gene locus_tag LOCUS_02250 gene ftsI 15242 13476 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035957.1 protein_id gnl|my_center|LOCUS_02250 15697 15320 gene locus_tag LOCUS_02260 15697 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 16590 15694 gene locus_tag LOCUS_02270 gene rsmH 16590 15694 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60396 protein_id gnl|my_center|LOCUS_02270 17224 16799 gene locus_tag LOCUS_02280 gene mraZ 17224 16799 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAF5 protein_id gnl|my_center|LOCUS_02280 18045 17404 gene locus_tag LOCUS_02290 18045 17404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 19173 18310 gene locus_tag LOCUS_02300 19173 18310 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727626.1 protein_id gnl|my_center|LOCUS_02300 19580 19188 gene locus_tag LOCUS_02310 19580 19188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 20924 19674 gene locus_tag LOCUS_02320 gene dinB 20924 19674 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAG1 protein_id gnl|my_center|LOCUS_02320 21460 20921 gene locus_tag LOCUS_02330 21460 20921 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173948.1 protein_id gnl|my_center|LOCUS_02330 21540 21815 gene locus_tag LOCUS_02340 21540 21815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 21808 22662 gene locus_tag LOCUS_02350 21808 22662 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553464.1 protein_id gnl|my_center|LOCUS_02350 22783 23466 gene locus_tag LOCUS_02360 gene regX 22783 23466 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_02360 23493 24917 gene locus_tag LOCUS_02370 gene mtrB 23493 24917 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_02370 24917 25546 gene locus_tag LOCUS_02380 24917 25546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 25564 27045 gene locus_tag LOCUS_02390 gene glpK2 25564 27045 CDS product glycerol kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1E4 protein_id gnl|my_center|LOCUS_02390 27521 27069 gene locus_tag LOCUS_02400 27521 27069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 28671 27541 gene locus_tag LOCUS_02410 28671 27541 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028156.1 protein_id gnl|my_center|LOCUS_02410 29789 28668 gene locus_tag LOCUS_02420 gene queG 29789 28668 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81I72 protein_id gnl|my_center|LOCUS_02420 30036 29815 gene locus_tag LOCUS_02430 30036 29815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 30261 31529 gene locus_tag LOCUS_02440 30261 31529 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918241.1 protein_id gnl|my_center|LOCUS_02440 32494 31541 gene locus_tag LOCUS_02450 32494 31541 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977073.1 protein_id gnl|my_center|LOCUS_02450 34227 32677 gene locus_tag LOCUS_02460 34227 32677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 34313 35746 gene locus_tag LOCUS_02470 34313 35746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_02470 >Feature sequence007 1030 260 gene locus_tag LOCUS_02480 1030 260 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_02480 1130 2134 gene locus_tag LOCUS_02490 1130 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 2139 2750 gene locus_tag LOCUS_02500 2139 2750 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_02500 3769 2759 gene locus_tag LOCUS_02510 3769 2759 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031165.1 protein_id gnl|my_center|LOCUS_02510 4537 3773 gene locus_tag LOCUS_02520 4537 3773 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069020.1 protein_id gnl|my_center|LOCUS_02520 5706 4534 gene locus_tag LOCUS_02530 5706 4534 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_02530 8032 5726 gene locus_tag LOCUS_02540 gene cutL 8032 5726 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_02540 9186 8029 gene locus_tag LOCUS_02550 9186 8029 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_02550 9364 10575 gene locus_tag LOCUS_02560 9364 10575 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_02560 11879 10593 gene locus_tag LOCUS_02570 gene kynU 11879 10593 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK35 protein_id gnl|my_center|LOCUS_02570 12540 11872 gene locus_tag LOCUS_02580 12540 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703805.1 protein_id gnl|my_center|LOCUS_02580 13118 12549 gene locus_tag LOCUS_02590 13118 12549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401399.1 protein_id gnl|my_center|LOCUS_02590 13866 13123 gene locus_tag LOCUS_02600 gene fabG1 13866 13123 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337557.1 protein_id gnl|my_center|LOCUS_02600 15083 13869 gene locus_tag LOCUS_02610 15083 13869 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_02610 15194 17800 gene locus_tag LOCUS_02620 gene valS 15194 17800 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MAR0 protein_id gnl|my_center|LOCUS_02620 17793 18608 gene locus_tag LOCUS_02630 17793 18608 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_02630 19010 18615 gene locus_tag LOCUS_02640 19010 18615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 19040 19429 gene locus_tag LOCUS_02650 19040 19429 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775840.1 protein_id gnl|my_center|LOCUS_02650 19407 20123 gene locus_tag LOCUS_02660 gene modA 19407 20123 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090881.1 protein_id gnl|my_center|LOCUS_02660 20120 20899 gene locus_tag LOCUS_02670 20120 20899 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_02670 20902 21915 gene locus_tag LOCUS_02680 20902 21915 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_02680 21978 22988 gene locus_tag LOCUS_02690 21978 22988 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_02690 23068 24162 gene locus_tag LOCUS_02700 23068 24162 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_02700 24175 25404 gene locus_tag LOCUS_02710 24175 25404 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_02710 25429 26964 gene locus_tag LOCUS_02720 25429 26964 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_02720 26980 29424 gene locus_tag LOCUS_02730 26980 29424 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_02730 29439 30752 gene locus_tag LOCUS_02740 29439 30752 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_02740 30821 31756 gene locus_tag LOCUS_02750 30821 31756 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_02750 32572 31766 gene locus_tag LOCUS_02760 32572 31766 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_02760 32632 33666 gene locus_tag LOCUS_02770 32632 33666 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728239.1 protein_id gnl|my_center|LOCUS_02770 33670 34830 gene locus_tag LOCUS_02780 33670 34830 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728240.1 protein_id gnl|my_center|LOCUS_02780 34936 36153 gene locus_tag LOCUS_02790 34936 36153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 >Feature sequence008 <1 673 gene locus_tag LOCUS_02800 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393496.1:pyridoxal-5'-phosphate-dependent protein subunit beta 670 1896 gene locus_tag LOCUS_02810 gene thrC 670 1896 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223912.1 protein_id gnl|my_center|LOCUS_02810 2148 1906 gene locus_tag LOCUS_02820 2148 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972720.1 protein_id gnl|my_center|LOCUS_02820 2923 2150 gene locus_tag LOCUS_02830 2923 2150 CDS product creatinine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223881.1 protein_id gnl|my_center|LOCUS_02830 3562 2981 gene locus_tag LOCUS_02840 gene ubiX 3562 2981 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N5S3 protein_id gnl|my_center|LOCUS_02840 3674 4531 gene locus_tag LOCUS_02850 3674 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 4524 5762 gene locus_tag LOCUS_02860 gene codA 4524 5762 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223886.1 protein_id gnl|my_center|LOCUS_02860 5786 7132 gene locus_tag LOCUS_02870 5786 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_02870 8102 7140 gene locus_tag LOCUS_02880 8102 7140 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_02880 9679 8099 gene locus_tag LOCUS_02890 9679 8099 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_02890 10898 9741 gene locus_tag LOCUS_02900 10898 9741 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_02900 11061 11813 gene locus_tag LOCUS_02910 11061 11813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537900.1 protein_id gnl|my_center|LOCUS_02910 11810 12679 gene locus_tag LOCUS_02920 gene ssuC 11810 12679 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223884.1 protein_id gnl|my_center|LOCUS_02920 13103 12711 gene locus_tag LOCUS_02930 13103 12711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 13206 14171 gene locus_tag LOCUS_02940 gene mer 13206 14171 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_02940 14171 15535 gene locus_tag LOCUS_02950 14171 15535 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 protein_id gnl|my_center|LOCUS_02950 15880 15548 gene locus_tag LOCUS_02960 15880 15548 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230429.1 protein_id gnl|my_center|LOCUS_02960 16018 16758 gene locus_tag LOCUS_02970 16018 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 16758 19679 gene locus_tag LOCUS_02980 16758 19679 CDS product hypoxanthine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583611.1 protein_id gnl|my_center|LOCUS_02980 19682 21013 gene locus_tag LOCUS_02990 19682 21013 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897229.1 protein_id gnl|my_center|LOCUS_02990 21006 21809 gene locus_tag LOCUS_03000 21006 21809 CDS product xanthine dehydrogenase accessory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386049.1 protein_id gnl|my_center|LOCUS_03000 21812 22615 gene locus_tag LOCUS_03010 21812 22615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03010 22585 23322 gene locus_tag LOCUS_03020 22585 23322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_03020 23332 24297 gene locus_tag LOCUS_03030 gene mer 23332 24297 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_03030 24299 24997 gene locus_tag LOCUS_03040 24299 24997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 26298 25000 gene locus_tag LOCUS_03050 26298 25000 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727577.1 protein_id gnl|my_center|LOCUS_03050 27296 26295 gene locus_tag LOCUS_03060 27296 26295 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_03060 28376 27324 gene locus_tag LOCUS_03070 28376 27324 CDS product chlorohydrolase/aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705208.1 protein_id gnl|my_center|LOCUS_03070 30975 28369 gene locus_tag LOCUS_03080 30975 28369 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869184.1 protein_id gnl|my_center|LOCUS_03080 31921 30953 gene locus_tag LOCUS_03090 31921 30953 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085362.1 protein_id gnl|my_center|LOCUS_03090 33174 31918 gene locus_tag LOCUS_03100 33174 31918 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_03100 35452 33167 gene locus_tag LOCUS_03110 35452 33167 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226424.1 protein_id gnl|my_center|LOCUS_03110 35949 35449 gene locus_tag LOCUS_03120 gene coxS 35949 35449 CDS product carbon-monoxide dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223812.1 protein_id gnl|my_center|LOCUS_03120 >Feature sequence009 259 564 gene locus_tag LOCUS_03130 259 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 586 2100 gene locus_tag LOCUS_03140 gene secD 586 2100 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B608 protein_id gnl|my_center|LOCUS_03140 2097 3197 gene locus_tag LOCUS_03150 gene secF 2097 3197 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53956 protein_id gnl|my_center|LOCUS_03150 3198 5444 gene locus_tag LOCUS_03160 gene relA 3198 5444 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52560 protein_id gnl|my_center|LOCUS_03160 5469 6728 gene locus_tag LOCUS_03170 gene hisS 5469 6728 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q833I1 protein_id gnl|my_center|LOCUS_03170 6725 8464 gene locus_tag LOCUS_03180 gene aspS 6725 8464 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHW1 protein_id gnl|my_center|LOCUS_03180 8507 9832 gene locus_tag LOCUS_03190 8507 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703586.1 protein_id gnl|my_center|LOCUS_03190 10189 12768 gene locus_tag LOCUS_03200 gene alaS 10189 12768 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61701 protein_id gnl|my_center|LOCUS_03200 12773 13186 gene locus_tag LOCUS_03210 12773 13186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 13197 14435 gene locus_tag LOCUS_03220 13197 14435 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257814.1 protein_id gnl|my_center|LOCUS_03220 14481 15302 gene locus_tag LOCUS_03230 14481 15302 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249220.1 protein_id gnl|my_center|LOCUS_03230 15367 15912 gene locus_tag LOCUS_03240 gene aroK 15367 15912 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L67 protein_id gnl|my_center|LOCUS_03240 15905 16909 gene locus_tag LOCUS_03250 gene rifG 15905 16909 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWY6 protein_id gnl|my_center|LOCUS_03250 16935 17378 gene locus_tag LOCUS_03260 gene aroQ1 16935 17378 CDS product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFR5 protein_id gnl|my_center|LOCUS_03260 17375 18472 gene locus_tag LOCUS_03270 gene yqhT 17375 18472 CDS product putative peptidase YqhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54518 protein_id gnl|my_center|LOCUS_03270 18491 19054 gene locus_tag LOCUS_03280 gene efp 18491 19054 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI92 protein_id gnl|my_center|LOCUS_03280 19086 19499 gene locus_tag LOCUS_03290 gene nusB 19086 19499 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2S4 protein_id gnl|my_center|LOCUS_03290 19652 20218 gene locus_tag LOCUS_03300 gene pyrR 19652 20218 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK44 protein_id gnl|my_center|LOCUS_03300 20215 21186 gene locus_tag LOCUS_03310 gene pyrB 20215 21186 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2K5 protein_id gnl|my_center|LOCUS_03310 21183 22475 gene locus_tag LOCUS_03320 gene pyrC 21183 22475 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXR3 protein_id gnl|my_center|LOCUS_03320 22472 23572 gene locus_tag LOCUS_03330 gene carA 22472 23572 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK41 protein_id gnl|my_center|LOCUS_03330 23578 26868 gene locus_tag LOCUS_03340 23578 26868 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJR3 protein_id gnl|my_center|LOCUS_03340 26872 27804 gene locus_tag LOCUS_03350 gene pyrD 26872 27804 CDS product dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB9 protein_id gnl|my_center|LOCUS_03350 27797 28561 gene locus_tag LOCUS_03360 gene pyrF 27797 28561 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77888 protein_id gnl|my_center|LOCUS_03360 28573 28941 gene locus_tag LOCUS_03370 28573 28941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_03370 28938 29495 gene locus_tag LOCUS_03380 gene gmk 28938 29495 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182S8 protein_id gnl|my_center|LOCUS_03380 29587 29928 gene locus_tag LOCUS_03390 29587 29928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 29946 31187 gene locus_tag LOCUS_03400 29946 31187 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027808.1 protein_id gnl|my_center|LOCUS_03400 31204 32400 gene locus_tag LOCUS_03410 gene metK 31204 32400 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0Y3 protein_id gnl|my_center|LOCUS_03410 >Feature sequence010 1888 290 gene locus_tag LOCUS_03420 1888 290 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_03420 3089 1905 gene locus_tag LOCUS_03430 3089 1905 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 protein_id gnl|my_center|LOCUS_03430 3211 4023 gene locus_tag LOCUS_03440 gene paaG 3211 4023 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228963.1 protein_id gnl|my_center|LOCUS_03440 5186 4020 gene locus_tag LOCUS_03450 5186 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 6106 5246 gene locus_tag LOCUS_03460 6106 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03460 7500 6340 gene locus_tag LOCUS_03470 7500 6340 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_03470 7519 7968 gene locus_tag LOCUS_03480 7519 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 7965 9767 gene locus_tag LOCUS_03490 gene aceK 7965 9767 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMM4 protein_id gnl|my_center|LOCUS_03490 9742 10449 gene locus_tag LOCUS_03500 gene rpe 9742 10449 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEV5 protein_id gnl|my_center|LOCUS_03500 10486 11097 gene locus_tag LOCUS_03510 gene clpP2 10486 11097 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NN01 protein_id gnl|my_center|LOCUS_03510 11116 11198 gene locus_tag LOCUS_t00030 11116 11198 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11229 13646 gene locus_tag LOCUS_03520 11229 13646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 14238 13651 gene locus_tag LOCUS_03530 14238 13651 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHP2 protein_id gnl|my_center|LOCUS_03530 14960 14238 gene locus_tag LOCUS_03540 gene rph 14960 14238 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFY8 protein_id gnl|my_center|LOCUS_03540 15036 15515 gene locus_tag LOCUS_03550 gene smpB 15036 15515 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QU63 protein_id gnl|my_center|LOCUS_03550 16327 16034 gene locus_tag LOCUS_03560 16327 16034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 16476 16910 gene locus_tag LOCUS_03570 16476 16910 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_03570 17558 16911 gene locus_tag LOCUS_03580 17558 16911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 18321 17569 gene locus_tag LOCUS_03590 18321 17569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 18433 20001 gene locus_tag LOCUS_03600 18433 20001 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729521.1 protein_id gnl|my_center|LOCUS_03600 21114 20005 gene locus_tag LOCUS_03610 21114 20005 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708578.1 protein_id gnl|my_center|LOCUS_03610 22064 21111 gene locus_tag LOCUS_03620 22064 21111 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530045.1 protein_id gnl|my_center|LOCUS_03620 22171 23463 gene locus_tag LOCUS_03630 gene cysD 22171 23463 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_03630 23470 24273 gene locus_tag LOCUS_03640 23470 24273 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_03640 25543 24281 gene locus_tag LOCUS_03650 gene acd 25543 24281 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225726.1 protein_id gnl|my_center|LOCUS_03650 25638 27359 gene locus_tag LOCUS_03660 gene proS 25638 27359 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ED5 protein_id gnl|my_center|LOCUS_03660 27413 27778 gene locus_tag LOCUS_03670 27413 27778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 27857 28339 gene locus_tag LOCUS_03680 27857 28339 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853867.1 protein_id gnl|my_center|LOCUS_03680 28396 28851 gene locus_tag LOCUS_03690 28396 28851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 28873 29391 gene locus_tag LOCUS_03700 gene ogt 28873 29391 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73R74 protein_id gnl|my_center|LOCUS_03700 29414 30205 gene locus_tag LOCUS_03710 29414 30205 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064414.1 protein_id gnl|my_center|LOCUS_03710 31765 30206 gene locus_tag LOCUS_03720 31765 30206 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 protein_id gnl|my_center|LOCUS_03720 31857 31933 gene locus_tag LOCUS_t00040 31857 31933 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 32535 31987 gene locus_tag LOCUS_03730 32535 31987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 >Feature sequence011 650 351 gene locus_tag LOCUS_03740 gene ndhE 650 351 CDS product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMW3 protein_id gnl|my_center|LOCUS_03740 1204 650 gene locus_tag LOCUS_03750 1204 650 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_03750 1713 1204 gene locus_tag LOCUS_03760 gene nuoI2 1713 1204 CDS product NADH-quinone oxidoreductase subunit I 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2V8 protein_id gnl|my_center|LOCUS_03760 2750 1713 gene locus_tag LOCUS_03770 gene nuoH 2750 1713 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2V9 protein_id gnl|my_center|LOCUS_03770 3919 2747 gene locus_tag LOCUS_03780 gene nuoD1 3919 2747 CDS product NADH-quinone oxidoreductase subunit D 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X853 protein_id gnl|my_center|LOCUS_03780 4626 3919 gene locus_tag LOCUS_03790 4626 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 5113 4613 gene locus_tag LOCUS_03800 5113 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 5484 5104 gene locus_tag LOCUS_03810 gene nuoA 5484 5104 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814W6 protein_id gnl|my_center|LOCUS_03810 7084 5594 gene locus_tag LOCUS_03820 gene nuoN-1 7084 5594 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_03820 8685 7087 gene locus_tag LOCUS_03830 gene nuoM-1 8685 7087 CDS product NADH:ubiquinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_03830 10601 8682 gene locus_tag LOCUS_03840 gene nuoL-1 10601 8682 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_03840 10903 10598 gene locus_tag LOCUS_03850 gene nuoK1 10903 10598 CDS product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G98 protein_id gnl|my_center|LOCUS_03850 11490 10900 gene locus_tag LOCUS_03860 11490 10900 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_03860 12104 11490 gene locus_tag LOCUS_03870 12104 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 13324 12101 gene locus_tag LOCUS_03880 gene nuoH 13324 12101 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAR1 protein_id gnl|my_center|LOCUS_03880 15804 13321 gene locus_tag LOCUS_03890 gene nuoG 15804 13321 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYJ0 protein_id gnl|my_center|LOCUS_03890 17225 15801 gene locus_tag LOCUS_03900 17225 15801 CDS product NADH-quinone oxidoreductase, F subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702874.1 protein_id gnl|my_center|LOCUS_03900 17861 17226 gene locus_tag LOCUS_03910 17861 17226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 19186 17861 gene locus_tag LOCUS_03920 gene nuoD 19186 17861 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVN5 protein_id gnl|my_center|LOCUS_03920 19650 19183 gene locus_tag LOCUS_03930 19650 19183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 20249 19647 gene locus_tag LOCUS_03940 gene nuoB1 20249 19647 CDS product NADH-quinone oxidoreductase subunit B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAQ5 protein_id gnl|my_center|LOCUS_03940 20755 20249 gene locus_tag LOCUS_03950 20755 20249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 21819 20806 gene locus_tag LOCUS_03960 21819 20806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 23018 21819 gene locus_tag LOCUS_03970 23018 21819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 23912 23037 gene locus_tag LOCUS_03980 23912 23037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 24716 23955 gene locus_tag LOCUS_03990 24716 23955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 25519 24731 gene locus_tag LOCUS_04000 25519 24731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 25977 25561 gene locus_tag LOCUS_04010 25977 25561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 26429 25974 gene locus_tag LOCUS_04020 26429 25974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 26738 27493 gene locus_tag LOCUS_04030 26738 27493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 27526 28791 gene locus_tag LOCUS_04040 27526 28791 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_04040 28864 30477 gene locus_tag LOCUS_04050 gene pgi 28864 30477 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CD75 protein_id gnl|my_center|LOCUS_04050 31748 30474 gene locus_tag LOCUS_04060 gene hemL 31748 30474 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXW0 protein_id gnl|my_center|LOCUS_04060 >Feature sequence012 686 384 gene locus_tag LOCUS_04070 686 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 806 2068 gene locus_tag LOCUS_04080 gene acd 806 2068 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225726.1 protein_id gnl|my_center|LOCUS_04080 3371 2088 gene locus_tag LOCUS_04090 3371 2088 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730081.1 protein_id gnl|my_center|LOCUS_04090 5176 3440 gene locus_tag LOCUS_04100 5176 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 5275 7431 gene locus_tag LOCUS_04110 5275 7431 CDS product molybdopterin-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230850.1 protein_id gnl|my_center|LOCUS_04110 8627 7434 gene locus_tag LOCUS_04120 8627 7434 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_04120 9850 8663 gene locus_tag LOCUS_04130 gene yeaW 9850 8663 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067809.1 protein_id gnl|my_center|LOCUS_04130 10500 9946 gene locus_tag LOCUS_04140 10500 9946 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846372.1 protein_id gnl|my_center|LOCUS_04140 10542 11021 gene locus_tag LOCUS_04150 gene nodN 10542 11021 CDS product nodulation protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25200 protein_id gnl|my_center|LOCUS_04150 11062 12210 gene locus_tag LOCUS_04160 11062 12210 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227362.1 protein_id gnl|my_center|LOCUS_04160 13469 12228 gene locus_tag LOCUS_04170 gene cypA 13469 12228 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240954.1 protein_id gnl|my_center|LOCUS_04170 13561 14400 gene locus_tag LOCUS_04180 13561 14400 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566240.1 protein_id gnl|my_center|LOCUS_04180 16145 14412 gene locus_tag LOCUS_04190 16145 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 16240 16425 gene locus_tag LOCUS_04200 16240 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 16450 16746 gene locus_tag LOCUS_04210 16450 16746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 16751 17923 gene locus_tag LOCUS_04220 16751 17923 CDS product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702146.1 protein_id gnl|my_center|LOCUS_04220 18736 17927 gene locus_tag LOCUS_04230 18736 17927 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903641.1 protein_id gnl|my_center|LOCUS_04230 18762 19562 gene locus_tag LOCUS_04240 gene fabG 18762 19562 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_04240 19592 19960 gene locus_tag LOCUS_04250 19592 19960 CDS product limonene-1,2-epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920798.1 protein_id gnl|my_center|LOCUS_04250 19957 20763 gene locus_tag LOCUS_04260 19957 20763 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886886.1 protein_id gnl|my_center|LOCUS_04260 21965 20838 gene locus_tag LOCUS_04270 21965 20838 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066596.1 protein_id gnl|my_center|LOCUS_04270 22768 21989 gene locus_tag LOCUS_04280 22768 21989 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529864.1 protein_id gnl|my_center|LOCUS_04280 23562 22768 gene locus_tag LOCUS_04290 23562 22768 CDS product sulfonate ABC transporter ATP-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972284.1 protein_id gnl|my_center|LOCUS_04290 24431 23559 gene locus_tag LOCUS_04300 24431 23559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 25462 24461 gene locus_tag LOCUS_04310 gene hmd 25462 24461 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228421.1 protein_id gnl|my_center|LOCUS_04310 26968 25481 gene locus_tag LOCUS_04320 26968 25481 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_04320 28406 26994 gene locus_tag LOCUS_04330 gene hydA 28406 26994 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895004.1 protein_id gnl|my_center|LOCUS_04330 29442 28429 gene locus_tag LOCUS_04340 29442 28429 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence013 2298 673 gene locus_tag LOCUS_04350 gene aceB 2298 673 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WG51 protein_id gnl|my_center|LOCUS_04350 3145 2300 gene locus_tag LOCUS_04360 gene cpdA 3145 2300 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7A0 protein_id gnl|my_center|LOCUS_04360 3352 3280 gene locus_tag LOCUS_t00050 3352 3280 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3429 4898 gene locus_tag LOCUS_04370 gene tig 3429 4898 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DE09 protein_id gnl|my_center|LOCUS_04370 4895 5542 gene locus_tag LOCUS_04380 gene clpP 4895 5542 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZF9 protein_id gnl|my_center|LOCUS_04380 5585 6847 gene locus_tag LOCUS_04390 gene clpX 5585 6847 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F316 protein_id gnl|my_center|LOCUS_04390 6874 8181 gene locus_tag LOCUS_04400 6874 8181 CDS product dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028454.1 protein_id gnl|my_center|LOCUS_04400 8224 8631 gene locus_tag LOCUS_04410 8224 8631 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870778.1 protein_id gnl|my_center|LOCUS_04410 8774 9832 gene locus_tag LOCUS_04420 8774 9832 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976188.1 protein_id gnl|my_center|LOCUS_04420 9838 10662 gene locus_tag LOCUS_04430 9838 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 10668 11192 gene locus_tag LOCUS_04440 10668 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 11189 13456 gene locus_tag LOCUS_04450 11189 13456 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_04450 13462 14595 gene locus_tag LOCUS_04460 13462 14595 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_04460 14640 16616 gene locus_tag LOCUS_04470 14640 16616 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028452.1 protein_id gnl|my_center|LOCUS_04470 16613 17332 gene locus_tag LOCUS_04480 16613 17332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 17351 18931 gene locus_tag LOCUS_04490 17351 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 18984 19292 gene locus_tag LOCUS_04500 gene rplU 18984 19292 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NN50 protein_id gnl|my_center|LOCUS_04500 19297 19554 gene locus_tag LOCUS_04510 gene rpmA 19297 19554 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCJ5 protein_id gnl|my_center|LOCUS_04510 19640 20884 gene locus_tag LOCUS_04520 gene obg 19640 20884 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ8 protein_id gnl|my_center|LOCUS_04520 20877 21974 gene locus_tag LOCUS_04530 gene proB 20877 21974 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ7 protein_id gnl|my_center|LOCUS_04530 23644 21971 gene locus_tag LOCUS_04540 gene mviN 23644 21971 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403272.1 protein_id gnl|my_center|LOCUS_04540 23729 24691 gene locus_tag LOCUS_04550 23729 24691 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_04550 24712 26202 gene locus_tag LOCUS_04560 24712 26202 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729941.1 protein_id gnl|my_center|LOCUS_04560 27582 26209 gene locus_tag LOCUS_04570 gene aroH 27582 26209 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80574 protein_id gnl|my_center|LOCUS_04570 28469 27639 gene locus_tag LOCUS_04580 gene hrdD 28469 27639 CDS product RNA polymerase principal sigma factor HrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18249 protein_id gnl|my_center|LOCUS_04580 >Feature sequence014 1573 2250 gene locus_tag LOCUS_04590 1573 2250 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCH0 protein_id gnl|my_center|LOCUS_04590 2290 3180 gene locus_tag LOCUS_04600 2290 3180 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969767.1 protein_id gnl|my_center|LOCUS_04600 3181 4074 gene locus_tag LOCUS_04610 3181 4074 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_04610 4486 4067 gene locus_tag LOCUS_04620 4486 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 4587 5321 gene locus_tag LOCUS_04630 4587 5321 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404822.1 protein_id gnl|my_center|LOCUS_04630 6228 5314 gene locus_tag LOCUS_04640 gene dhmA 6228 5314 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3S9 protein_id gnl|my_center|LOCUS_04640 7078 6251 gene locus_tag LOCUS_04650 gene surE 7078 6251 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45681 protein_id gnl|my_center|LOCUS_04650 9046 7130 gene locus_tag LOCUS_04660 9046 7130 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_04660 10027 9092 gene locus_tag LOCUS_04670 gene fabH 10027 9092 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDA9 protein_id gnl|my_center|LOCUS_04670 10132 10869 gene locus_tag LOCUS_04680 10132 10869 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_04680 11089 11970 gene locus_tag LOCUS_04690 11089 11970 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_04690 11980 13047 gene locus_tag LOCUS_04700 11980 13047 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 protein_id gnl|my_center|LOCUS_04700 13032 13814 gene locus_tag LOCUS_04710 13032 13814 CDS product iron-enterobactin transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027158.1 protein_id gnl|my_center|LOCUS_04710 13872 14747 gene locus_tag LOCUS_04720 gene dhaA 13872 14747 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XB14 protein_id gnl|my_center|LOCUS_04720 16401 14740 gene locus_tag LOCUS_04730 16401 14740 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBN4 protein_id gnl|my_center|LOCUS_04730 17505 16462 gene locus_tag LOCUS_04740 17505 16462 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_04740 17580 18062 gene locus_tag LOCUS_04750 17580 18062 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054516.1 protein_id gnl|my_center|LOCUS_04750 18052 18549 gene locus_tag LOCUS_04760 18052 18549 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973393.1 protein_id gnl|my_center|LOCUS_04760 18809 18546 gene locus_tag LOCUS_04770 18809 18546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 19352 18813 gene locus_tag LOCUS_04780 19352 18813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 19442 20110 gene locus_tag LOCUS_04790 19442 20110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_04790 20107 20781 gene locus_tag LOCUS_04800 20107 20781 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_04800 20802 21560 gene locus_tag LOCUS_04810 gene ccmC 20802 21560 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705299.1 protein_id gnl|my_center|LOCUS_04810 21565 21723 gene locus_tag LOCUS_04820 21565 21723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 21729 22232 gene locus_tag LOCUS_04830 21729 22232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 22275 24248 gene locus_tag LOCUS_04840 22275 24248 CDS product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_04840 24235 24768 gene locus_tag LOCUS_04850 24235 24768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 24789 26015 gene locus_tag LOCUS_04860 24789 26015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 26495 26019 gene locus_tag LOCUS_04870 26495 26019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 27263 26544 gene locus_tag LOCUS_04880 27263 26544 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434132.1 protein_id gnl|my_center|LOCUS_04880 27458 28312 gene locus_tag LOCUS_04890 27458 28312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 28330 28560 gene locus_tag LOCUS_04900 28330 28560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 >Feature sequence015 1769 864 gene locus_tag LOCUS_04910 1769 864 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027895.1 protein_id gnl|my_center|LOCUS_04910 3153 1795 gene locus_tag LOCUS_04920 gene pafA 3153 1795 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ61 protein_id gnl|my_center|LOCUS_04920 3854 3177 gene locus_tag LOCUS_04930 gene psmA 3854 3177 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAT2 protein_id gnl|my_center|LOCUS_04930 4651 3857 gene locus_tag LOCUS_04940 gene prcB 4651 3857 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKQ5 protein_id gnl|my_center|LOCUS_04940 4882 4682 gene locus_tag LOCUS_04950 4882 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 6412 4895 gene locus_tag LOCUS_04960 6412 4895 CDS product proteasome accessory factor PafA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_04960 8239 6470 gene locus_tag LOCUS_04970 gene arc 8239 6470 CDS product proteasome-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ58 protein_id gnl|my_center|LOCUS_04970 8384 8614 gene locus_tag LOCUS_04980 8384 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 9342 8620 gene locus_tag LOCUS_04990 9342 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 10112 9339 gene locus_tag LOCUS_05000 10112 9339 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_05000 10534 10328 gene locus_tag LOCUS_05010 10534 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 11483 10863 gene locus_tag LOCUS_05020 11483 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 12918 11476 gene locus_tag LOCUS_05030 12918 11476 CDS product peptidase S13 (D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701272.1 protein_id gnl|my_center|LOCUS_05030 13073 15043 gene locus_tag LOCUS_05040 gene tkt 13073 15043 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_05040 15047 16138 gene locus_tag LOCUS_05050 gene tal 15047 16138 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWX9 protein_id gnl|my_center|LOCUS_05050 16184 16648 gene locus_tag LOCUS_05060 16184 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090577.1 protein_id gnl|my_center|LOCUS_05060 16638 19019 gene locus_tag LOCUS_05070 gene fbiC 16638 19019 CDS product FO synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228669.1 protein_id gnl|my_center|LOCUS_05070 19215 19021 gene locus_tag LOCUS_05080 19215 19021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 20436 19216 gene locus_tag LOCUS_05090 gene glcF 20436 19216 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCA7 protein_id gnl|my_center|LOCUS_05090 21310 20438 gene locus_tag LOCUS_05100 21310 20438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 22761 21307 gene locus_tag LOCUS_05110 22761 21307 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 protein_id gnl|my_center|LOCUS_05110 22849 24597 gene locus_tag LOCUS_05120 22849 24597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 24797 24594 gene locus_tag LOCUS_05130 24797 24594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 25896 24871 gene locus_tag LOCUS_05140 25896 24871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 26646 26059 gene locus_tag LOCUS_05150 gene mobA 26646 26059 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGH6 protein_id gnl|my_center|LOCUS_05150 26745 27050 gene locus_tag LOCUS_05160 26745 27050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 <28307 27054 gene locus_tag LOCUS_05170 <28307 27054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q180P2:pyruvate kinase >Feature sequence016 3036 1870 gene locus_tag LOCUS_05180 3036 1870 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143424.1 protein_id gnl|my_center|LOCUS_05180 4552 3017 gene locus_tag LOCUS_05190 gene caiC 4552 3017 CDS product putative crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9L4 protein_id gnl|my_center|LOCUS_05190 6126 4552 gene locus_tag LOCUS_05200 6126 4552 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706372.1 protein_id gnl|my_center|LOCUS_05200 8213 6123 gene locus_tag LOCUS_05210 8213 6123 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086402.1 protein_id gnl|my_center|LOCUS_05210 8508 8206 gene locus_tag LOCUS_05220 8508 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 9319 8600 gene locus_tag LOCUS_05230 gene pdhR 9319 8600 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223715.1 protein_id gnl|my_center|LOCUS_05230 9811 9320 gene locus_tag LOCUS_05240 9811 9320 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226958.1 protein_id gnl|my_center|LOCUS_05240 10852 9905 gene locus_tag LOCUS_05250 gene ribF 10852 9905 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0P3 protein_id gnl|my_center|LOCUS_05250 11418 10921 gene locus_tag LOCUS_05260 11418 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05260 12516 11641 gene locus_tag LOCUS_05270 gene truB 12516 11641 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD72 protein_id gnl|my_center|LOCUS_05270 12859 12524 gene locus_tag LOCUS_05280 gene rbfA 12859 12524 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y7F4 protein_id gnl|my_center|LOCUS_05280 12916 13689 gene locus_tag LOCUS_05290 gene hpcH 12916 13689 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085757.1 protein_id gnl|my_center|LOCUS_05290 16409 13686 gene locus_tag LOCUS_05300 gene infB 16409 13686 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17889 protein_id gnl|my_center|LOCUS_05300 17653 16409 gene locus_tag LOCUS_05310 gene nusA 17653 16409 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJM8 protein_id gnl|my_center|LOCUS_05310 18162 17650 gene locus_tag LOCUS_05320 gene rimP 18162 17650 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y4 protein_id gnl|my_center|LOCUS_05320 19495 18326 gene locus_tag LOCUS_05330 gene ispG 19495 18326 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NP12 protein_id gnl|my_center|LOCUS_05330 20995 19604 gene locus_tag LOCUS_05340 20995 19604 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 protein_id gnl|my_center|LOCUS_05340 22158 21001 gene locus_tag LOCUS_05350 gene dxr 22158 21001 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI09 protein_id gnl|my_center|LOCUS_05350 23429 22200 gene locus_tag LOCUS_05360 23429 22200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 24027 23455 gene locus_tag LOCUS_05370 gene frr 24027 23455 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P81101 protein_id gnl|my_center|LOCUS_05370 24795 24040 gene locus_tag LOCUS_05380 gene pyrH 24795 24040 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q831V1 protein_id gnl|my_center|LOCUS_05380 25589 24798 gene locus_tag LOCUS_05390 25589 24798 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201392.1 protein_id gnl|my_center|LOCUS_05390 26478 25582 gene locus_tag LOCUS_05400 gene rpsB 26478 25582 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVB8 protein_id gnl|my_center|LOCUS_05400 27391 26642 gene locus_tag LOCUS_05410 27391 26642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 >Feature sequence017 569 402 gene locus_tag LOCUS_05420 569 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 682 1497 gene locus_tag LOCUS_05430 682 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 1583 2725 gene locus_tag LOCUS_05440 1583 2725 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223896.1 protein_id gnl|my_center|LOCUS_05440 2739 3971 gene locus_tag LOCUS_05450 2739 3971 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_05450 3999 4421 gene locus_tag LOCUS_05460 3999 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 4488 5057 gene locus_tag LOCUS_05470 4488 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 5050 6123 gene locus_tag LOCUS_05480 5050 6123 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229260.1 protein_id gnl|my_center|LOCUS_05480 7234 6131 gene locus_tag LOCUS_05490 7234 6131 CDS product putative aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WI99 protein_id gnl|my_center|LOCUS_05490 8081 7221 gene locus_tag LOCUS_05500 8081 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 8834 8316 gene locus_tag LOCUS_05510 8834 8316 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942345.1 protein_id gnl|my_center|LOCUS_05510 10798 8831 gene locus_tag LOCUS_05520 gene thrS 10798 8831 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L278 protein_id gnl|my_center|LOCUS_05520 11522 10863 gene locus_tag LOCUS_05530 11522 10863 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878704.1 protein_id gnl|my_center|LOCUS_05530 11648 12415 gene locus_tag LOCUS_05540 11648 12415 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D7T0 protein_id gnl|my_center|LOCUS_05540 13344 12412 gene locus_tag LOCUS_05550 13344 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 14451 13405 gene locus_tag LOCUS_05560 14451 13405 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226804.1 protein_id gnl|my_center|LOCUS_05560 15741 14452 gene locus_tag LOCUS_05570 15741 14452 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_05570 15827 17635 gene locus_tag LOCUS_05580 15827 17635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 17639 19567 gene locus_tag LOCUS_05590 17639 19567 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 protein_id gnl|my_center|LOCUS_05590 19564 20280 gene locus_tag LOCUS_05600 19564 20280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967724.1 protein_id gnl|my_center|LOCUS_05600 20291 21085 gene locus_tag LOCUS_05610 20291 21085 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223511.1 protein_id gnl|my_center|LOCUS_05610 21087 21707 gene locus_tag LOCUS_05620 21087 21707 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887197.1 protein_id gnl|my_center|LOCUS_05620 21808 23514 gene locus_tag LOCUS_05630 21808 23514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975260.1 protein_id gnl|my_center|LOCUS_05630 23514 24467 gene locus_tag LOCUS_05640 23514 24467 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975258.1 protein_id gnl|my_center|LOCUS_05640 24460 24990 gene locus_tag LOCUS_05650 24460 24990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 25026 26018 gene locus_tag LOCUS_05660 25026 26018 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969988.1 protein_id gnl|my_center|LOCUS_05660 26631 26032 gene locus_tag LOCUS_05670 26631 26032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 26766 27149 gene locus_tag LOCUS_05680 26766 27149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence018 1721 72 gene locus_tag LOCUS_05690 gene groL1 1721 72 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40171 protein_id gnl|my_center|LOCUS_05690 2022 1732 gene locus_tag LOCUS_05700 gene groE 2022 1732 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVA7 protein_id gnl|my_center|LOCUS_05700 3205 2183 gene locus_tag LOCUS_05710 3205 2183 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_05710 3728 3198 gene locus_tag LOCUS_05720 3728 3198 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FA0 protein_id gnl|my_center|LOCUS_05720 4426 3725 gene locus_tag LOCUS_05730 4426 3725 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_05730 4950 4429 gene locus_tag LOCUS_05740 4950 4429 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 protein_id gnl|my_center|LOCUS_05740 5500 4943 gene locus_tag LOCUS_05750 5500 4943 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147255.1 protein_id gnl|my_center|LOCUS_05750 6427 5540 gene locus_tag LOCUS_05760 6427 5540 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_05760 6753 6454 gene locus_tag LOCUS_05770 6753 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7862 6750 gene locus_tag LOCUS_05780 7862 6750 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_05780 8968 7868 gene locus_tag LOCUS_05790 8968 7868 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI3 protein_id gnl|my_center|LOCUS_05790 10319 8949 gene locus_tag LOCUS_05800 10319 8949 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSR4 protein_id gnl|my_center|LOCUS_05800 10713 10348 gene locus_tag LOCUS_05810 gene acpS 10713 10348 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BAA6 protein_id gnl|my_center|LOCUS_05810 14140 10736 gene locus_tag LOCUS_05820 14140 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 15552 14233 gene locus_tag LOCUS_05830 gene glmM 15552 14233 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_05830 15984 15592 gene locus_tag LOCUS_05840 15984 15592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 16752 15997 gene locus_tag LOCUS_05850 16752 15997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 17635 16889 gene locus_tag LOCUS_05860 gene truA 17635 16889 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYV8 protein_id gnl|my_center|LOCUS_05860 18029 17676 gene locus_tag LOCUS_05870 18029 17676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 19021 18032 gene locus_tag LOCUS_05880 gene rpoA 19021 18032 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MG99 protein_id gnl|my_center|LOCUS_05880 19644 19027 gene locus_tag LOCUS_05890 gene rpsD 19644 19027 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CV49 protein_id gnl|my_center|LOCUS_05890 20027 19644 gene locus_tag LOCUS_05900 gene rpsK 20027 19644 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSL6 protein_id gnl|my_center|LOCUS_05900 20404 20027 gene locus_tag LOCUS_05910 gene rpsM 20404 20027 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY2 protein_id gnl|my_center|LOCUS_05910 20735 20538 gene locus_tag LOCUS_05920 gene infA 20735 20538 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD14 protein_id gnl|my_center|LOCUS_05920 21483 20905 gene locus_tag LOCUS_05930 gene adk 21483 20905 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGB3 protein_id gnl|my_center|LOCUS_05930 22833 21505 gene locus_tag LOCUS_05940 gene secY 22833 21505 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A5Z3 protein_id gnl|my_center|LOCUS_05940 23361 22876 gene locus_tag LOCUS_05950 gene rplO 23361 22876 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFD6 protein_id gnl|my_center|LOCUS_05950 23560 23363 gene locus_tag LOCUS_05960 gene rpmD 23560 23363 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFD7 protein_id gnl|my_center|LOCUS_05960 24149 23553 gene locus_tag LOCUS_05970 gene rpsE 24149 23553 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSG6 protein_id gnl|my_center|LOCUS_05970 24508 24149 gene locus_tag LOCUS_05980 gene rplR 24508 24149 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZAE3 protein_id gnl|my_center|LOCUS_05980 25041 24505 gene locus_tag LOCUS_05990 gene rplF 25041 24505 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFE0 protein_id gnl|my_center|LOCUS_05990 25457 25053 gene locus_tag LOCUS_06000 gene rpsH 25457 25053 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NSX8 protein_id gnl|my_center|LOCUS_06000 25655 25470 gene locus_tag LOCUS_06010 gene rpsZ 25655 25470 CDS product 30S ribosomal protein S14 type Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSG2 protein_id gnl|my_center|LOCUS_06010 26221 25655 gene locus_tag LOCUS_06020 gene rplE 26221 25655 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0C8 protein_id gnl|my_center|LOCUS_06020 26528 26214 gene locus_tag LOCUS_06030 gene rplX 26528 26214 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38513 protein_id gnl|my_center|LOCUS_06030 26897 26529 gene locus_tag LOCUS_06040 gene rplN 26897 26529 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSF9 protein_id gnl|my_center|LOCUS_06040 >Feature sequence019 2719 1100 gene locus_tag LOCUS_06050 gene yloV 2719 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34751 protein_id gnl|my_center|LOCUS_06050 2878 3102 gene locus_tag LOCUS_06060 2878 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3104 4912 gene locus_tag LOCUS_06070 gene pckG 3104 4912 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93JL5 protein_id gnl|my_center|LOCUS_06070 5291 4914 gene locus_tag LOCUS_06080 5291 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 6164 5343 gene locus_tag LOCUS_06090 6164 5343 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_06090 7316 6174 gene locus_tag LOCUS_06100 7316 6174 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_06100 8217 7333 gene locus_tag LOCUS_06110 8217 7333 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085668.1 protein_id gnl|my_center|LOCUS_06110 8253 8714 gene locus_tag LOCUS_06120 gene elaA 8253 8714 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223944.1 protein_id gnl|my_center|LOCUS_06120 8744 10783 gene locus_tag LOCUS_06130 gene uvrD2 8744 10783 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64321 protein_id gnl|my_center|LOCUS_06130 11703 10789 gene locus_tag LOCUS_06140 gene xth 11703 10789 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727225.1 protein_id gnl|my_center|LOCUS_06140 12344 11721 gene locus_tag LOCUS_06150 12344 11721 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918133.1 protein_id gnl|my_center|LOCUS_06150 12474 14108 gene locus_tag LOCUS_06160 12474 14108 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_06160 14707 14105 gene locus_tag LOCUS_06170 14707 14105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06170 15962 14709 gene locus_tag LOCUS_06180 15962 14709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06180 16876 15962 gene locus_tag LOCUS_06190 16876 15962 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MIN3 protein_id gnl|my_center|LOCUS_06190 16847 17707 gene locus_tag LOCUS_06200 16847 17707 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_06200 17712 18371 gene locus_tag LOCUS_06210 gene nucS 17712 18371 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4C3 protein_id gnl|my_center|LOCUS_06210 18371 19579 gene locus_tag LOCUS_06220 18371 19579 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893677.1 protein_id gnl|my_center|LOCUS_06220 19576 20178 gene locus_tag LOCUS_06230 19576 20178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 20380 20189 gene locus_tag LOCUS_06240 20380 20189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 21434 20457 gene locus_tag LOCUS_06250 21434 20457 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_06250 21498 21674 gene locus_tag LOCUS_06260 21498 21674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 22602 21724 gene locus_tag LOCUS_06270 gene mca 22602 21724 CDS product mycothiol S-conjugate amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DI54 protein_id gnl|my_center|LOCUS_06270 22708 23154 gene locus_tag LOCUS_06280 22708 23154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 23191 24159 gene locus_tag LOCUS_06290 23191 24159 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_06290 25391 24168 gene locus_tag LOCUS_06300 25391 24168 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_06300 <26550 25487 gene locus_tag LOCUS_06310 <26550 25487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083750457.1:divalent cation transporter >Feature sequence020 <1 1376 gene locus_tag LOCUS_06320 <1 1376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222793.1:betaine-aldehyde dehydrogenase 1376 2221 gene locus_tag LOCUS_06330 1376 2221 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_06330 3499 2225 gene locus_tag LOCUS_06340 gene deoA 3499 2225 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222773.1 protein_id gnl|my_center|LOCUS_06340 3915 3499 gene locus_tag LOCUS_06350 gene cdd 3915 3499 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727813.1 protein_id gnl|my_center|LOCUS_06350 4869 3970 gene locus_tag LOCUS_06360 4869 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 6850 4928 gene locus_tag LOCUS_06370 6850 4928 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919414.1 protein_id gnl|my_center|LOCUS_06370 8177 6852 gene locus_tag LOCUS_06380 8177 6852 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085724.1 protein_id gnl|my_center|LOCUS_06380 8324 8512 gene locus_tag LOCUS_06390 8324 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 8534 8980 gene locus_tag LOCUS_06400 8534 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 8973 9962 gene locus_tag LOCUS_06410 8973 9962 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029094.1 protein_id gnl|my_center|LOCUS_06410 9988 12081 gene locus_tag LOCUS_06420 gene cat5 9988 12081 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404999.1 protein_id gnl|my_center|LOCUS_06420 12103 13329 gene locus_tag LOCUS_06430 12103 13329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 14720 13326 gene locus_tag LOCUS_06440 14720 13326 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731301.1 protein_id gnl|my_center|LOCUS_06440 14834 16063 gene locus_tag LOCUS_06450 14834 16063 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 protein_id gnl|my_center|LOCUS_06450 16060 17154 gene locus_tag LOCUS_06460 16060 17154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 17147 17818 gene locus_tag LOCUS_06470 17147 17818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 17811 18785 gene locus_tag LOCUS_06480 gene speB 17811 18785 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_06480 18826 19887 gene locus_tag LOCUS_06490 gene potA 18826 19887 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBU2 protein_id gnl|my_center|LOCUS_06490 19887 20789 gene locus_tag LOCUS_06500 19887 20789 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257554.1 protein_id gnl|my_center|LOCUS_06500 20786 21616 gene locus_tag LOCUS_06510 20786 21616 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_06510 21670 22776 gene locus_tag LOCUS_06520 21670 22776 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257556.1 protein_id gnl|my_center|LOCUS_06520 23519 22872 gene locus_tag LOCUS_06530 23519 22872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_06530 24779 23565 gene locus_tag LOCUS_06540 24779 23565 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_06540 25918 24776 gene locus_tag LOCUS_06550 25918 24776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence021 321 2675 gene locus_tag LOCUS_06560 321 2675 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029751.1 protein_id gnl|my_center|LOCUS_06560 2668 3690 gene locus_tag LOCUS_06570 2668 3690 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_06570 3714 4457 gene locus_tag LOCUS_06580 3714 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868725.1 protein_id gnl|my_center|LOCUS_06580 4457 5257 gene locus_tag LOCUS_06590 4457 5257 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_06590 5257 6087 gene locus_tag LOCUS_06600 5257 6087 CDS product NAD+/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810952.1 protein_id gnl|my_center|LOCUS_06600 6187 7830 gene locus_tag LOCUS_06610 gene pyrG 6187 7830 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFU8 protein_id gnl|my_center|LOCUS_06610 7831 8385 gene locus_tag LOCUS_06620 gene nudF 7831 8385 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54570 protein_id gnl|my_center|LOCUS_06620 8393 8914 gene locus_tag LOCUS_06630 8393 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 9901 8921 gene locus_tag LOCUS_06640 gene trpS2 9901 8921 CDS product tryptophan--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZA7 protein_id gnl|my_center|LOCUS_06640 10318 11091 gene locus_tag LOCUS_06650 gene scpA 10318 11091 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408432.1 protein_id gnl|my_center|LOCUS_06650 11100 11741 gene locus_tag LOCUS_06660 11100 11741 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S231 protein_id gnl|my_center|LOCUS_06660 11742 12494 gene locus_tag LOCUS_06670 11742 12494 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_06670 12573 13634 gene locus_tag LOCUS_06680 12573 13634 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_06680 13631 14884 gene locus_tag LOCUS_06690 gene aroA 13631 14884 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLT3 protein_id gnl|my_center|LOCUS_06690 14881 15528 gene locus_tag LOCUS_06700 gene cmk 14881 15528 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HL58 protein_id gnl|my_center|LOCUS_06700 15528 16208 gene locus_tag LOCUS_06710 15528 16208 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_06710 17251 16205 gene locus_tag LOCUS_06720 gene ispH 17251 16205 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULU1 protein_id gnl|my_center|LOCUS_06720 17299 18669 gene locus_tag LOCUS_06730 17299 18669 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811141.1 protein_id gnl|my_center|LOCUS_06730 18666 19976 gene locus_tag LOCUS_06740 gene der 18666 19976 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EWW8 protein_id gnl|my_center|LOCUS_06740 20060 21133 gene locus_tag LOCUS_06750 20060 21133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 21143 21355 gene locus_tag LOCUS_06760 21143 21355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 22893 21370 gene locus_tag LOCUS_06770 22893 21370 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256433.1 protein_id gnl|my_center|LOCUS_06770 23960 22977 gene locus_tag LOCUS_06780 23960 22977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 24932 24003 gene locus_tag LOCUS_06790 24932 24003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence022 1080 1007 gene locus_tag LOCUS_t00060 1080 1007 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1198 1860 gene locus_tag LOCUS_06800 1198 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2378 1857 gene locus_tag LOCUS_06810 2378 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 2907 2383 gene locus_tag LOCUS_06820 2907 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3002 3274 gene locus_tag LOCUS_06830 3002 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3845 3264 gene locus_tag LOCUS_06840 3845 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 4361 3924 gene locus_tag LOCUS_06850 gene dut 4361 3924 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2A4 protein_id gnl|my_center|LOCUS_06850 4414 4962 gene locus_tag LOCUS_06860 gene orn 4414 4962 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEU2 protein_id gnl|my_center|LOCUS_06860 4959 6059 gene locus_tag LOCUS_06870 4959 6059 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258336.1 protein_id gnl|my_center|LOCUS_06870 6461 6796 gene locus_tag LOCUS_06880 6461 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 6854 7402 gene locus_tag LOCUS_06890 6854 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 7395 8495 gene locus_tag LOCUS_06900 7395 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 8492 9133 gene locus_tag LOCUS_06910 8492 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 9773 9138 gene locus_tag LOCUS_06920 gene pdxH 9773 9138 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7E7 protein_id gnl|my_center|LOCUS_06920 9832 10191 gene locus_tag LOCUS_06930 gene crcB1 9832 10191 CDS product putative fluoride ion transporter CrcB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WS52 protein_id gnl|my_center|LOCUS_06930 10188 10505 gene locus_tag LOCUS_06940 gene crcB 10188 10505 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHY7 protein_id gnl|my_center|LOCUS_06940 11788 10508 gene locus_tag LOCUS_06950 gene serS 11788 10508 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5E7 protein_id gnl|my_center|LOCUS_06950 12676 11798 gene locus_tag LOCUS_06960 12676 11798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 13067 12726 gene locus_tag LOCUS_06970 13067 12726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 13679 13083 gene locus_tag LOCUS_06980 13679 13083 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061308.1 protein_id gnl|my_center|LOCUS_06980 15618 13672 gene locus_tag LOCUS_06990 15618 13672 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819N3 protein_id gnl|my_center|LOCUS_06990 16817 15618 gene locus_tag LOCUS_07000 gene ctaC 16817 15618 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEM0 protein_id gnl|my_center|LOCUS_07000 17602 16814 gene locus_tag LOCUS_07010 17602 16814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 18199 17618 gene locus_tag LOCUS_07020 gene ctaE 18199 17618 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AEL8 protein_id gnl|my_center|LOCUS_07020 19797 18199 gene locus_tag LOCUS_07030 19797 18199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 20856 19969 gene locus_tag LOCUS_07040 gene ctaB 20856 19969 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAC2 protein_id gnl|my_center|LOCUS_07040 21728 20904 gene locus_tag LOCUS_07050 21728 20904 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_07050 21957 22030 gene locus_tag LOCUS_t00070 21957 22030 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 22085 22162 gene locus_tag LOCUS_t00080 22085 22162 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 22199 22272 gene locus_tag LOCUS_t00090 22199 22272 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 23544 22327 gene locus_tag LOCUS_07060 23544 22327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence023 <1 1090 gene locus_tag LOCUS_07070 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P36176:DNA replication and repair protein RecF 1083 1382 gene locus_tag LOCUS_07080 1083 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1549 3483 gene locus_tag LOCUS_07090 gene gyrB 1549 3483 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QRT3 protein_id gnl|my_center|LOCUS_07090 3483 5960 gene locus_tag LOCUS_07100 gene gyrA 3483 5960 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CU92 protein_id gnl|my_center|LOCUS_07100 6031 6702 gene locus_tag LOCUS_07110 6031 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 6761 6836 gene locus_tag LOCUS_t00100 6761 6836 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 6840 6977 gene locus_tag LOCUS_07120 6840 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 6977 7972 gene locus_tag LOCUS_07130 6977 7972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 7982 8560 gene locus_tag LOCUS_07140 7982 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 9311 8550 gene locus_tag LOCUS_07150 9311 8550 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118358.1 protein_id gnl|my_center|LOCUS_07150 9409 10398 gene locus_tag LOCUS_07160 9409 10398 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974245.1 protein_id gnl|my_center|LOCUS_07160 10430 11410 gene locus_tag LOCUS_07170 10430 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809641.1 protein_id gnl|my_center|LOCUS_07170 11506 11432 gene locus_tag LOCUS_t00110 11506 11432 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11659 11568 gene locus_tag LOCUS_t00120 11659 11568 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11720 11807 gene locus_tag LOCUS_t00130 11720 11807 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12749 11820 gene locus_tag LOCUS_07180 12749 11820 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_07180 12941 13579 gene locus_tag LOCUS_07190 12941 13579 CDS product glyoxalase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403266.1 protein_id gnl|my_center|LOCUS_07190 13607 14593 gene locus_tag LOCUS_07200 13607 14593 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390710.1 protein_id gnl|my_center|LOCUS_07200 14683 14599 gene locus_tag LOCUS_t00140 14683 14599 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14809 15942 gene locus_tag LOCUS_07210 14809 15942 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776670.1 protein_id gnl|my_center|LOCUS_07210 16004 17917 gene locus_tag LOCUS_07220 16004 17917 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 protein_id gnl|my_center|LOCUS_07220 18499 17918 gene locus_tag LOCUS_07230 18499 17918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 18562 18825 gene locus_tag LOCUS_07240 18562 18825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 19155 18904 gene locus_tag LOCUS_07250 19155 18904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 19258 19770 gene locus_tag LOCUS_07260 19258 19770 CDS product doxX subfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896605.1 protein_id gnl|my_center|LOCUS_07260 19851 19777 gene locus_tag LOCUS_t00150 19851 19777 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20728 19904 gene locus_tag LOCUS_07270 20728 19904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 20968 20741 gene locus_tag LOCUS_07280 20968 20741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 22224 20965 gene locus_tag LOCUS_07290 gene xseA 22224 20965 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_07290 >Feature sequence024 357 602 gene locus_tag LOCUS_07300 357 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 599 895 gene locus_tag LOCUS_07310 599 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 930 1655 gene locus_tag LOCUS_07320 gene hlyI 930 1655 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229810.1 protein_id gnl|my_center|LOCUS_07320 1719 2792 gene locus_tag LOCUS_07330 1719 2792 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_07330 2825 3199 gene locus_tag LOCUS_07340 2825 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 3275 4474 gene locus_tag LOCUS_07350 3275 4474 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0L5 protein_id gnl|my_center|LOCUS_07350 4530 6398 gene locus_tag LOCUS_07360 4530 6398 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_07360 6593 8167 gene locus_tag LOCUS_07370 gene leuA 6593 8167 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG97 protein_id gnl|my_center|LOCUS_07370 8192 9610 gene locus_tag LOCUS_07380 gene leuC 8192 9610 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33123 protein_id gnl|my_center|LOCUS_07380 9613 10209 gene locus_tag LOCUS_07390 gene leuD 9613 10209 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZM0 protein_id gnl|my_center|LOCUS_07390 10237 12309 gene locus_tag LOCUS_07400 10237 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871078.1 protein_id gnl|my_center|LOCUS_07400 12584 12330 gene locus_tag LOCUS_07410 12584 12330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 12869 12618 gene locus_tag LOCUS_07420 12869 12618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 13101 14510 gene locus_tag LOCUS_07430 13101 14510 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818T2 protein_id gnl|my_center|LOCUS_07430 14513 16168 gene locus_tag LOCUS_07440 14513 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 16178 16936 gene locus_tag LOCUS_07450 16178 16936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 16989 17528 gene locus_tag LOCUS_07460 16989 17528 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709194.1 protein_id gnl|my_center|LOCUS_07460 17550 19013 gene locus_tag LOCUS_07470 gene pepA 17550 19013 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67868 protein_id gnl|my_center|LOCUS_07470 19029 19781 gene locus_tag LOCUS_07480 gene cobB2 19029 19781 CDS product NAD-dependent protein deacetylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJM9 protein_id gnl|my_center|LOCUS_07480 19828 21003 gene locus_tag LOCUS_07490 19828 21003 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_07490 21114 22394 gene locus_tag LOCUS_07500 gene ugd 21114 22394 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222056.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence025 <1 550 gene locus_tag LOCUS_07510 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Y8P1:D-alanine--D-alanine ligase 1160 543 gene locus_tag LOCUS_07520 1160 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1222 3543 gene locus_tag LOCUS_07530 1222 3543 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_07530 3540 4760 gene locus_tag LOCUS_07540 3540 4760 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_07540 4757 6385 gene locus_tag LOCUS_07550 4757 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 6387 7316 gene locus_tag LOCUS_07560 6387 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 7374 9653 gene locus_tag LOCUS_07570 7374 9653 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203425.1 protein_id gnl|my_center|LOCUS_07570 9853 9650 gene locus_tag LOCUS_07580 9853 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 10631 10161 gene locus_tag LOCUS_07590 10631 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 10738 11325 gene locus_tag LOCUS_07600 10738 11325 CDS product (Fe-S)-cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_07600 12280 11330 gene locus_tag LOCUS_07610 gene fcl 12280 11330 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 protein_id gnl|my_center|LOCUS_07610 12703 12290 gene locus_tag LOCUS_07620 12703 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 13993 12878 gene locus_tag LOCUS_07630 gene acd 13993 12878 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_07630 14105 14806 gene locus_tag LOCUS_07640 14105 14806 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_07640 14803 15186 gene locus_tag LOCUS_07650 14803 15186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 15246 16013 gene locus_tag LOCUS_07660 15246 16013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228949.1 protein_id gnl|my_center|LOCUS_07660 16010 17248 gene locus_tag LOCUS_07670 16010 17248 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKN9 protein_id gnl|my_center|LOCUS_07670 17266 17727 gene locus_tag LOCUS_07680 gene iscU 17266 17727 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058819.1 protein_id gnl|my_center|LOCUS_07680 18030 17740 gene locus_tag LOCUS_07690 gene phhB 18030 17740 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7S9 protein_id gnl|my_center|LOCUS_07690 18776 18039 gene locus_tag LOCUS_07700 gene ynhD 18776 18039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 protein_id gnl|my_center|LOCUS_07700 19090 18773 gene locus_tag LOCUS_07710 19090 18773 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_07710 20358 19087 gene locus_tag LOCUS_07720 20358 19087 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_07720 20679 20449 gene locus_tag LOCUS_07730 20679 20449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 20813 21295 gene locus_tag LOCUS_07740 20813 21295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 21830 21303 gene locus_tag LOCUS_07750 21830 21303 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_07750 21859 22128 gene locus_tag LOCUS_07760 gene madF 21859 22128 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811628.1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence026 <1 1338 gene locus_tag LOCUS_07770 <1 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229710.1:ATPase 1353 2051 gene locus_tag LOCUS_07780 1353 2051 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887187.1 protein_id gnl|my_center|LOCUS_07780 3019 2045 gene locus_tag LOCUS_07790 3019 2045 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_07790 3195 3974 gene locus_tag LOCUS_07800 gene fixA 3195 3974 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_07800 3986 4951 gene locus_tag LOCUS_07810 3986 4951 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255686.1 protein_id gnl|my_center|LOCUS_07810 5720 4962 gene locus_tag LOCUS_07820 5720 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_07820 6237 5734 gene locus_tag LOCUS_07830 6237 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_07830 6942 6301 gene locus_tag LOCUS_07840 6942 6301 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600286.1 protein_id gnl|my_center|LOCUS_07840 6968 7642 gene locus_tag LOCUS_07850 6968 7642 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_07850 7699 8016 gene locus_tag LOCUS_07860 7699 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 9250 8027 gene locus_tag LOCUS_07870 9250 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 9332 9260 gene locus_tag LOCUS_t00160 9332 9260 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9459 10157 gene locus_tag LOCUS_07880 9459 10157 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_07880 11101 10154 gene locus_tag LOCUS_07890 gene glcK 11101 10154 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387212.1 protein_id gnl|my_center|LOCUS_07890 12026 11148 gene locus_tag LOCUS_07900 12026 11148 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014377.1 protein_id gnl|my_center|LOCUS_07900 12828 12028 gene locus_tag LOCUS_07910 12828 12028 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576383.1 protein_id gnl|my_center|LOCUS_07910 13625 12825 gene locus_tag LOCUS_07920 gene phnC 13625 12825 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078092.1 protein_id gnl|my_center|LOCUS_07920 14723 13668 gene locus_tag LOCUS_07930 14723 13668 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832012.1 protein_id gnl|my_center|LOCUS_07930 14912 15811 gene locus_tag LOCUS_07940 14912 15811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 15915 16211 gene locus_tag LOCUS_07950 15915 16211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088538.1 protein_id gnl|my_center|LOCUS_07950 16358 17995 gene locus_tag LOCUS_07960 gene argS 16358 17995 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46906 protein_id gnl|my_center|LOCUS_07960 17995 19266 gene locus_tag LOCUS_07970 gene lysA 17995 19266 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HLD5 protein_id gnl|my_center|LOCUS_07970 19320 20624 gene locus_tag LOCUS_07980 19320 20624 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIW9 protein_id gnl|my_center|LOCUS_07980 >Feature sequence027 507 878 gene locus_tag LOCUS_07990 507 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1647 907 gene locus_tag LOCUS_08000 1647 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_08000 1771 3015 gene locus_tag LOCUS_08010 1771 3015 CDS product linalool 8-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_08010 4639 3017 gene locus_tag LOCUS_08020 4639 3017 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225847.1 protein_id gnl|my_center|LOCUS_08020 5081 4710 gene locus_tag LOCUS_08030 5081 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 6002 5082 gene locus_tag LOCUS_08040 6002 5082 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861134.1 protein_id gnl|my_center|LOCUS_08040 6214 5999 gene locus_tag LOCUS_08050 6214 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 6520 6236 gene locus_tag LOCUS_08060 6520 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 7500 6517 gene locus_tag LOCUS_08070 7500 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_08070 7986 7615 gene locus_tag LOCUS_08080 7986 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 8072 8557 gene locus_tag LOCUS_08090 gene mmyF 8072 8557 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_08090 8558 9076 gene locus_tag LOCUS_08100 8558 9076 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_08100 9081 9992 gene locus_tag LOCUS_08110 9081 9992 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975951.1 protein_id gnl|my_center|LOCUS_08110 9993 10754 gene locus_tag LOCUS_08120 9993 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 10851 12254 gene locus_tag LOCUS_08130 10851 12254 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_08130 12294 12665 gene locus_tag LOCUS_08140 12294 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 12741 13712 gene locus_tag LOCUS_08150 12741 13712 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_08150 13672 14217 gene locus_tag LOCUS_08160 gene ybeY 13672 14217 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R5X4 protein_id gnl|my_center|LOCUS_08160 14210 15019 gene locus_tag LOCUS_08170 14210 15019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 15020 15907 gene locus_tag LOCUS_08180 gene era 15020 15907 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYT3 protein_id gnl|my_center|LOCUS_08180 15965 16681 gene locus_tag LOCUS_08190 gene uppS 15965 16681 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBI5 protein_id gnl|my_center|LOCUS_08190 16684 17400 gene locus_tag LOCUS_08200 gene recO 16684 17400 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MD78 protein_id gnl|my_center|LOCUS_08200 17445 18764 gene locus_tag LOCUS_08210 gene glyQS 17445 18764 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L2H9 protein_id gnl|my_center|LOCUS_08210 18773 20326 gene locus_tag LOCUS_08220 18773 20326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence028 1043 489 gene locus_tag LOCUS_08230 1043 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 2036 1293 gene locus_tag LOCUS_08240 2036 1293 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027093.1 protein_id gnl|my_center|LOCUS_08240 2181 3338 gene locus_tag LOCUS_08250 2181 3338 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728743.1 protein_id gnl|my_center|LOCUS_08250 3400 3762 gene locus_tag LOCUS_08260 3400 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_08260 4013 6067 gene locus_tag LOCUS_08270 4013 6067 CDS product N-methylproline demethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532328.1 protein_id gnl|my_center|LOCUS_08270 6130 7962 gene locus_tag LOCUS_08280 6130 7962 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_08280 9080 7959 gene locus_tag LOCUS_08290 9080 7959 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331277.1 protein_id gnl|my_center|LOCUS_08290 9315 10118 gene locus_tag LOCUS_08300 9315 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 11313 10123 gene locus_tag LOCUS_08310 11313 10123 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146836.1 protein_id gnl|my_center|LOCUS_08310 11441 11881 gene locus_tag LOCUS_08320 11441 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029140.1 protein_id gnl|my_center|LOCUS_08320 11904 12725 gene locus_tag LOCUS_08330 11904 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142342.1 protein_id gnl|my_center|LOCUS_08330 13336 12731 gene locus_tag LOCUS_08340 13336 12731 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_08340 14394 15497 gene locus_tag LOCUS_08350 gene adhC 14394 15497 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GY0 protein_id gnl|my_center|LOCUS_08350 16511 15579 gene locus_tag LOCUS_08360 16511 15579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 16822 16532 gene locus_tag LOCUS_08370 16822 16532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 17666 16851 gene locus_tag LOCUS_08380 17666 16851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 19398 17704 gene locus_tag LOCUS_08390 19398 17704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence029 619 1233 gene locus_tag LOCUS_08400 619 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08400 1220 2275 gene locus_tag LOCUS_08410 1220 2275 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013555.1 protein_id gnl|my_center|LOCUS_08410 3927 2272 gene locus_tag LOCUS_08420 3927 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 4650 3937 gene locus_tag LOCUS_08430 4650 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 5131 4652 gene locus_tag LOCUS_08440 5131 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 5248 6399 gene locus_tag LOCUS_08450 gene sucC 5248 6399 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJJ0 protein_id gnl|my_center|LOCUS_08450 6399 7283 gene locus_tag LOCUS_08460 gene sucD 6399 7283 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67547 protein_id gnl|my_center|LOCUS_08460 7308 7880 gene locus_tag LOCUS_08470 gene purN 7308 7880 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS22 protein_id gnl|my_center|LOCUS_08470 7891 9393 gene locus_tag LOCUS_08480 gene purH 7891 9393 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU9 protein_id gnl|my_center|LOCUS_08480 9427 10284 gene locus_tag LOCUS_08490 gene folD 9427 10284 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32879 protein_id gnl|my_center|LOCUS_08490 10346 11542 gene locus_tag LOCUS_08500 gene icd 10346 11542 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39126 protein_id gnl|my_center|LOCUS_08500 11526 13340 gene locus_tag LOCUS_08510 11526 13340 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 protein_id gnl|my_center|LOCUS_08510 13337 15163 gene locus_tag LOCUS_08520 13337 15163 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_08520 15262 16251 gene locus_tag LOCUS_08530 gene mdh 15262 16251 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A5J7 protein_id gnl|my_center|LOCUS_08530 16695 16261 gene locus_tag LOCUS_08540 16695 16261 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 protein_id gnl|my_center|LOCUS_08540 17113 16715 gene locus_tag LOCUS_08550 17113 16715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 17174 17521 gene locus_tag LOCUS_08560 17174 17521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 17523 18635 gene locus_tag LOCUS_08570 17523 18635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 18632 19564 gene locus_tag LOCUS_08580 18632 19564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence030 865 164 gene locus_tag LOCUS_08590 865 164 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805152.1 protein_id gnl|my_center|LOCUS_08590 1204 878 gene locus_tag LOCUS_08600 1204 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1670 1287 gene locus_tag LOCUS_08610 gene gcvH 1670 1287 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN55 protein_id gnl|my_center|LOCUS_08610 2303 1734 gene locus_tag LOCUS_08620 gene pgsA 2303 1734 CDS product phosphatidylglycerophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052288.1 protein_id gnl|my_center|LOCUS_08620 2395 2799 gene locus_tag LOCUS_08630 2395 2799 CDS product putative HIT-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49774 protein_id gnl|my_center|LOCUS_08630 4382 2814 gene locus_tag LOCUS_08640 4382 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 5655 4375 gene locus_tag LOCUS_08650 5655 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 5821 7611 gene locus_tag LOCUS_08660 5821 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 8674 7613 gene locus_tag LOCUS_08670 8674 7613 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948100.1 protein_id gnl|my_center|LOCUS_08670 9025 8675 gene locus_tag LOCUS_08680 9025 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 9925 9029 gene locus_tag LOCUS_08690 9925 9029 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLV9 protein_id gnl|my_center|LOCUS_08690 10636 9959 gene locus_tag LOCUS_08700 10636 9959 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_08700 11887 10787 gene locus_tag LOCUS_08710 gene prfB 11887 10787 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS78 protein_id gnl|my_center|LOCUS_08710 14532 11944 gene locus_tag LOCUS_08720 14532 11944 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_08720 15099 14566 gene locus_tag LOCUS_08730 15099 14566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 15328 15483 gene locus_tag LOCUS_08740 15328 15483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 16517 15486 gene locus_tag LOCUS_08750 gene adh 16517 15486 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_08750 16593 16520 gene locus_tag LOCUS_t00170 16593 16520 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16687 17856 gene locus_tag LOCUS_08760 16687 17856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 17849 18775 gene locus_tag LOCUS_08770 17849 18775 CDS product C-5 sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224651.1 protein_id gnl|my_center|LOCUS_08770 18996 18814 gene locus_tag LOCUS_08780 18996 18814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 19080 19007 gene locus_tag LOCUS_t00180 19080 19007 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence031 <1 2317 gene locus_tag LOCUS_08790 <1 2317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028773.1:membrane protein 2364 3332 gene locus_tag LOCUS_08800 2364 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 5407 3341 gene locus_tag LOCUS_08810 5407 3341 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXS5 protein_id gnl|my_center|LOCUS_08810 5546 6526 gene locus_tag LOCUS_08820 5546 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030173.1 protein_id gnl|my_center|LOCUS_08820 6582 7655 gene locus_tag LOCUS_08830 gene hemE 6582 7655 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69861 protein_id gnl|my_center|LOCUS_08830 7648 9027 gene locus_tag LOCUS_08840 gene hemY 7648 9027 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_08840 9024 10508 gene locus_tag LOCUS_08850 gene lnt 9024 10508 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EX26 protein_id gnl|my_center|LOCUS_08850 10965 10528 gene locus_tag LOCUS_08860 gene dtd 10965 10528 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZI9 protein_id gnl|my_center|LOCUS_08860 11026 12309 gene locus_tag LOCUS_08870 11026 12309 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_08870 12314 13063 gene locus_tag LOCUS_08880 12314 13063 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_08880 13050 14114 gene locus_tag LOCUS_08890 13050 14114 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_08890 14769 14131 gene locus_tag LOCUS_08900 14769 14131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_08900 15185 14772 gene locus_tag LOCUS_08910 15185 14772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 16272 15295 gene locus_tag LOCUS_08920 gene argK 16272 15295 CDS product LAO/AO transport system kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223478.1 protein_id gnl|my_center|LOCUS_08920 16651 16238 gene locus_tag LOCUS_08930 16651 16238 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_08930 18228 16648 gene locus_tag LOCUS_08940 18228 16648 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878783.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence032 270 195 gene locus_tag LOCUS_t00190 270 195 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 887 384 gene locus_tag LOCUS_08950 887 384 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223824.1 protein_id gnl|my_center|LOCUS_08950 2173 887 gene locus_tag LOCUS_08960 gene metY 2173 887 CDS product O-acetylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223825.1 protein_id gnl|my_center|LOCUS_08960 2686 2234 gene locus_tag LOCUS_08970 2686 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 2818 4167 gene locus_tag LOCUS_08980 2818 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 4189 4560 gene locus_tag LOCUS_08990 4189 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 5351 4572 gene locus_tag LOCUS_09000 5351 4572 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931160.1 protein_id gnl|my_center|LOCUS_09000 6703 5402 gene locus_tag LOCUS_09010 6703 5402 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226023.1 protein_id gnl|my_center|LOCUS_09010 6945 8594 gene locus_tag LOCUS_09020 gene accD2 6945 8594 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900245.1 protein_id gnl|my_center|LOCUS_09020 8591 10543 gene locus_tag LOCUS_09030 8591 10543 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726854.1 protein_id gnl|my_center|LOCUS_09030 10536 12293 gene locus_tag LOCUS_09040 10536 12293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702796.1 protein_id gnl|my_center|LOCUS_09040 12296 13516 gene locus_tag LOCUS_09050 12296 13516 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703853.1 protein_id gnl|my_center|LOCUS_09050 13492 14178 gene locus_tag LOCUS_09060 13492 14178 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230155.1 protein_id gnl|my_center|LOCUS_09060 14212 15009 gene locus_tag LOCUS_09070 14212 15009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702795.1 protein_id gnl|my_center|LOCUS_09070 15009 15779 gene locus_tag LOCUS_09080 gene paaG 15009 15779 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_09080 16573 15794 gene locus_tag LOCUS_09090 16573 15794 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088192.1 protein_id gnl|my_center|LOCUS_09090 17368 16589 gene locus_tag LOCUS_09100 17368 16589 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_09100 19254 17449 gene locus_tag LOCUS_09110 19254 17449 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_09110 19376 19303 gene locus_tag LOCUS_t00200 19376 19303 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence033 482 1033 gene locus_tag LOCUS_09120 gene hpt 482 1033 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230473.1 protein_id gnl|my_center|LOCUS_09120 1162 1671 gene locus_tag LOCUS_09130 1162 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1677 2534 gene locus_tag LOCUS_09140 gene panC 1677 2534 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67891 protein_id gnl|my_center|LOCUS_09140 2704 3498 gene locus_tag LOCUS_09150 gene coaX 2704 3498 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8N6 protein_id gnl|my_center|LOCUS_09150 3491 4900 gene locus_tag LOCUS_09160 gene lysS 3491 4900 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM49 protein_id gnl|my_center|LOCUS_09160 5914 4901 gene locus_tag LOCUS_09170 5914 4901 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727438.1 protein_id gnl|my_center|LOCUS_09170 6038 8584 gene locus_tag LOCUS_09180 6038 8584 CDS product ATP-dependent Clp protease ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_09180 8673 10130 gene locus_tag LOCUS_09190 8673 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 10159 10821 gene locus_tag LOCUS_09200 10159 10821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 11489 10818 gene locus_tag LOCUS_09210 11489 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 11564 12214 gene locus_tag LOCUS_09220 11564 12214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09220 12220 12702 gene locus_tag LOCUS_09230 gene ispF 12220 12702 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q839V8 protein_id gnl|my_center|LOCUS_09230 12792 13532 gene locus_tag LOCUS_09240 gene yacO 12792 13532 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_09240 13614 13540 gene locus_tag LOCUS_t00210 13614 13540 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13779 14402 gene locus_tag LOCUS_09250 13779 14402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 14405 15397 gene locus_tag LOCUS_09260 14405 15397 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_09260 15564 17177 gene locus_tag LOCUS_09270 gene groL2 15564 17177 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXU5 protein_id gnl|my_center|LOCUS_09270 17179 17571 gene locus_tag LOCUS_09280 17179 17571 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908343.1 protein_id gnl|my_center|LOCUS_09280 18437 17568 gene locus_tag LOCUS_09290 18437 17568 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226418.1 protein_id gnl|my_center|LOCUS_09290 <19112 18437 gene locus_tag LOCUS_09300 <19112 18437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031007.1:NADH dehydrogenase subunit F >Feature sequence034 <1 719 gene locus_tag LOCUS_09310 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74FE7:50S ribosomal protein L25 731 1357 gene locus_tag LOCUS_09320 gene pth 731 1357 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8YAD1 protein_id gnl|my_center|LOCUS_09320 1364 4822 gene locus_tag LOCUS_09330 gene mfd 1364 4822 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R3C5 protein_id gnl|my_center|LOCUS_09330 4841 5692 gene locus_tag LOCUS_09340 4841 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 5712 7127 gene locus_tag LOCUS_09350 5712 7127 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966488.1 protein_id gnl|my_center|LOCUS_09350 7230 8516 gene locus_tag LOCUS_09360 gene eno 7230 8516 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFH1 protein_id gnl|my_center|LOCUS_09360 8513 8842 gene locus_tag LOCUS_09370 8513 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 8940 11225 gene locus_tag LOCUS_09380 gene cutL 8940 11225 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_09380 11241 12194 gene locus_tag LOCUS_09390 11241 12194 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_09390 12187 12999 gene locus_tag LOCUS_09400 12187 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 12996 13793 gene locus_tag LOCUS_09410 12996 13793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 13881 14342 gene locus_tag LOCUS_09420 gene coxS 13881 14342 CDS product carbon-monoxide dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227068.1 protein_id gnl|my_center|LOCUS_09420 14339 15163 gene locus_tag LOCUS_09430 gene cutM 14339 15163 CDS product carbon-monoxide dehydrogenase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_09430 15211 16122 gene locus_tag LOCUS_09440 15211 16122 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388723.1 protein_id gnl|my_center|LOCUS_09440 16123 17244 gene locus_tag LOCUS_09450 16123 17244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_09450 17284 17598 gene locus_tag LOCUS_09460 17284 17598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09460 17602 18420 gene locus_tag LOCUS_09470 17602 18420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09470 >Feature sequence035 30 1007 gene locus_tag LOCUS_09480 30 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1801 1046 gene locus_tag LOCUS_09490 1801 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1902 2879 gene locus_tag LOCUS_09500 gene glpX 1902 2879 CDS product fructose-1,6-bisphosphatase class 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN21 protein_id gnl|my_center|LOCUS_09500 3308 2910 gene locus_tag LOCUS_09510 gene atpC 3308 2910 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37812 protein_id gnl|my_center|LOCUS_09510 4732 3314 gene locus_tag LOCUS_09520 gene atpD 4732 3314 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DH77 protein_id gnl|my_center|LOCUS_09520 5712 4759 gene locus_tag LOCUS_09530 gene atpG 5712 4759 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4D4 protein_id gnl|my_center|LOCUS_09530 7387 5774 gene locus_tag LOCUS_09540 gene atpA 7387 5774 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R202 protein_id gnl|my_center|LOCUS_09540 7947 7417 gene locus_tag LOCUS_09550 7947 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 8675 7950 gene locus_tag LOCUS_09560 8675 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 8963 8706 gene locus_tag LOCUS_09570 8963 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 9826 9059 gene locus_tag LOCUS_09580 gene atpB 9826 9059 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDS8 protein_id gnl|my_center|LOCUS_09580 10293 9829 gene locus_tag LOCUS_09590 10293 9829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 10555 10283 gene locus_tag LOCUS_09600 10555 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 11800 10652 gene locus_tag LOCUS_09610 gene wecA 11800 10652 CDS product decaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45830 protein_id gnl|my_center|LOCUS_09610 13048 11807 gene locus_tag LOCUS_09620 gene glyA 13048 11807 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E008 protein_id gnl|my_center|LOCUS_09620 13137 14441 gene locus_tag LOCUS_09630 13137 14441 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_09630 16010 14442 gene locus_tag LOCUS_09640 16010 14442 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 protein_id gnl|my_center|LOCUS_09640 16165 16959 gene locus_tag LOCUS_09650 16165 16959 CDS product citrate lyase subunit beta-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUZ0 protein_id gnl|my_center|LOCUS_09650 16975 17919 gene locus_tag LOCUS_09660 16975 17919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence036 497 1039 gene locus_tag LOCUS_09670 gene def 497 1039 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96113 protein_id gnl|my_center|LOCUS_09670 1017 1913 gene locus_tag LOCUS_09680 gene fmt 1017 1913 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X8F1 protein_id gnl|my_center|LOCUS_09680 1906 3033 gene locus_tag LOCUS_09690 gene sunL 1906 3033 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DNR8 protein_id gnl|my_center|LOCUS_09690 3832 3038 gene locus_tag LOCUS_09700 3832 3038 CDS product putative dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704240.1 protein_id gnl|my_center|LOCUS_09700 3880 4389 gene locus_tag LOCUS_09710 3880 4389 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227870.1 protein_id gnl|my_center|LOCUS_09710 4419 5444 gene locus_tag LOCUS_09720 gene ribD 4419 5444 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL76 protein_id gnl|my_center|LOCUS_09720 5498 6373 gene locus_tag LOCUS_09730 gene hisG 5498 6373 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_09730 6787 6389 gene locus_tag LOCUS_09740 6787 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 7143 7730 gene locus_tag LOCUS_09750 7143 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 7753 7947 gene locus_tag LOCUS_09760 gene rpmI 7753 7947 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEI4 protein_id gnl|my_center|LOCUS_09760 7996 8343 gene locus_tag LOCUS_09770 gene rplT 7996 8343 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G4L1 protein_id gnl|my_center|LOCUS_09770 8440 9189 gene locus_tag LOCUS_09780 gene tsnR 8440 9189 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908316.1 protein_id gnl|my_center|LOCUS_09780 9278 10276 gene locus_tag LOCUS_09790 gene pheS 9278 10276 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_09790 10323 12674 gene locus_tag LOCUS_09800 gene pheT 10323 12674 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ9 protein_id gnl|my_center|LOCUS_09800 12715 13695 gene locus_tag LOCUS_09810 12715 13695 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_09810 13736 14782 gene locus_tag LOCUS_09820 gene argC1 13736 14782 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGH7 protein_id gnl|my_center|LOCUS_09820 14779 15942 gene locus_tag LOCUS_09830 gene argJ 14779 15942 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DDT9 protein_id gnl|my_center|LOCUS_09830 15939 16880 gene locus_tag LOCUS_09840 gene argB 15939 16880 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG64 protein_id gnl|my_center|LOCUS_09840 >Feature sequence037 1453 185 gene locus_tag LOCUS_09850 1453 185 CDS product cytochrome P450 steroid C27-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730960.1 protein_id gnl|my_center|LOCUS_09850 2416 1505 gene locus_tag LOCUS_09860 2416 1505 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_09860 2517 2981 gene locus_tag LOCUS_09870 2517 2981 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_09870 3005 3934 gene locus_tag LOCUS_09880 gene map 3005 3934 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKR2 protein_id gnl|my_center|LOCUS_09880 5563 3947 gene locus_tag LOCUS_09890 5563 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 6794 5616 gene locus_tag LOCUS_09900 6794 5616 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_09900 8330 6795 gene locus_tag LOCUS_09910 8330 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 9210 8389 gene locus_tag LOCUS_09920 gene mutM 9210 8389 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX22 protein_id gnl|my_center|LOCUS_09920 9276 10097 gene locus_tag LOCUS_09930 9276 10097 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_09930 10084 10422 gene locus_tag LOCUS_09940 10084 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 11246 10419 gene locus_tag LOCUS_09950 11246 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899178.1 protein_id gnl|my_center|LOCUS_09950 13405 11246 gene locus_tag LOCUS_09960 13405 11246 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69998 protein_id gnl|my_center|LOCUS_09960 15803 13386 gene locus_tag LOCUS_09970 15803 13386 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50510 protein_id gnl|my_center|LOCUS_09970 16142 15825 gene locus_tag LOCUS_09980 16142 15825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence038 236 832 gene locus_tag LOCUS_09990 236 832 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_09990 854 1342 gene locus_tag LOCUS_10000 854 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_10000 1489 1959 gene locus_tag LOCUS_10010 1489 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1990 2337 gene locus_tag LOCUS_10020 1990 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 3147 2344 gene locus_tag LOCUS_10030 3147 2344 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_10030 4278 3190 gene locus_tag LOCUS_10040 gene aroC 4278 3190 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_10040 4346 5968 gene locus_tag LOCUS_10050 4346 5968 CDS product putative fatty-acid-CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704890.1 protein_id gnl|my_center|LOCUS_10050 6830 5970 gene locus_tag LOCUS_10060 6830 5970 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950459.1 protein_id gnl|my_center|LOCUS_10060 8200 6827 gene locus_tag LOCUS_10070 8200 6827 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014816.1 protein_id gnl|my_center|LOCUS_10070 9283 8204 gene locus_tag LOCUS_10080 9283 8204 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704886.1 protein_id gnl|my_center|LOCUS_10080 10478 9294 gene locus_tag LOCUS_10090 10478 9294 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_10090 11751 10522 gene locus_tag LOCUS_10100 11751 10522 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_10100 13047 11818 gene locus_tag LOCUS_10110 13047 11818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 14222 13122 gene locus_tag LOCUS_10120 14222 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 protein_id gnl|my_center|LOCUS_10120 14349 15116 gene locus_tag LOCUS_10130 14349 15116 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020468.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence039 <1 529 gene locus_tag LOCUS_10140 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225242.1:acyl-CoA dehydrogenase 578 1732 gene locus_tag LOCUS_10150 gene atoB 578 1732 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_10150 2754 1735 gene locus_tag LOCUS_10160 2754 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 4261 2738 gene locus_tag LOCUS_10170 4261 2738 CDS product AMP-dependent ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730162.1 protein_id gnl|my_center|LOCUS_10170 4588 4283 gene locus_tag LOCUS_10180 4588 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896282.1 protein_id gnl|my_center|LOCUS_10180 4702 5937 gene locus_tag LOCUS_10190 4702 5937 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228966.1 protein_id gnl|my_center|LOCUS_10190 5997 7337 gene locus_tag LOCUS_10200 gene gltX 5997 7337 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0A6 protein_id gnl|my_center|LOCUS_10200 7408 7480 gene locus_tag LOCUS_t00220 7408 7480 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7531 7604 gene locus_tag LOCUS_t00230 7531 7604 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8443 7658 gene locus_tag LOCUS_10210 8443 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 9181 8582 gene locus_tag LOCUS_10220 9181 8582 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_10220 10023 9328 gene locus_tag LOCUS_10230 10023 9328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 10352 10065 gene locus_tag LOCUS_10240 10352 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 10481 11338 gene locus_tag LOCUS_10250 10481 11338 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729048.1 protein_id gnl|my_center|LOCUS_10250 11711 11343 gene locus_tag LOCUS_10260 11711 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 12663 11704 gene locus_tag LOCUS_10270 gene dapA 12663 11704 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120364.1 protein_id gnl|my_center|LOCUS_10270 13686 12736 gene locus_tag LOCUS_10280 13686 12736 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_10280 14100 13699 gene locus_tag LOCUS_10290 14100 13699 CDS product putative pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704966.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence040 1014 91 gene locus_tag LOCUS_10300 gene hemB 1014 91 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYF5 protein_id gnl|my_center|LOCUS_10300 1856 1110 gene locus_tag LOCUS_10310 1856 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 2749 1853 gene locus_tag LOCUS_10320 gene hemC 2749 1853 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKN2 protein_id gnl|my_center|LOCUS_10320 4022 2763 gene locus_tag LOCUS_10330 gene hemA 4022 2763 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16618 protein_id gnl|my_center|LOCUS_10330 4790 4155 gene locus_tag LOCUS_10340 gene rex 4790 4155 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WX14 protein_id gnl|my_center|LOCUS_10340 5852 4962 gene locus_tag LOCUS_10350 5852 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_10350 6643 5852 gene locus_tag LOCUS_10360 gene proC 6643 5852 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A50 protein_id gnl|my_center|LOCUS_10360 7848 6640 gene locus_tag LOCUS_10370 7848 6640 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939181.1 protein_id gnl|my_center|LOCUS_10370 8348 7845 gene locus_tag LOCUS_10380 8348 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54139 protein_id gnl|my_center|LOCUS_10380 9565 8348 gene locus_tag LOCUS_10390 gene mshA 9565 8348 CDS product D-inositol 3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NTA6 protein_id gnl|my_center|LOCUS_10390 9804 9568 gene locus_tag LOCUS_10400 9804 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 9869 10456 gene locus_tag LOCUS_10410 gene gpm 9869 10456 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228468.1 protein_id gnl|my_center|LOCUS_10410 10646 10479 gene locus_tag LOCUS_10420 10646 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 11949 10669 gene locus_tag LOCUS_10430 11949 10669 CDS product FAD-linked oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_10430 13030 12014 gene locus_tag LOCUS_10440 13030 12014 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888021.1 protein_id gnl|my_center|LOCUS_10440 13837 13034 gene locus_tag LOCUS_10450 13837 13034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence041 31 312 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctcacccatcatcggaggcat 1655 744 gene locus_tag LOCUS_10460 1655 744 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727427.1 protein_id gnl|my_center|LOCUS_10460 2703 1693 gene locus_tag LOCUS_10470 2703 1693 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKP2 protein_id gnl|my_center|LOCUS_10470 2861 4213 gene locus_tag LOCUS_10480 gene glnA2 2861 4213 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223124.1 protein_id gnl|my_center|LOCUS_10480 4226 4909 gene locus_tag LOCUS_10490 4226 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 5120 4911 gene locus_tag LOCUS_10500 5120 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 5517 5170 gene locus_tag LOCUS_10510 5517 5170 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_10510 7088 5556 gene locus_tag LOCUS_10520 7088 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 7142 8020 gene locus_tag LOCUS_10530 7142 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 8345 8028 gene locus_tag LOCUS_10540 8345 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805013.1 protein_id gnl|my_center|LOCUS_10540 9365 8439 gene locus_tag LOCUS_10550 gene mmsB 9365 8439 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227993.1 protein_id gnl|my_center|LOCUS_10550 10311 9358 gene locus_tag LOCUS_10560 10311 9358 CDS product desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975103.1 protein_id gnl|my_center|LOCUS_10560 10416 10637 gene locus_tag LOCUS_10570 10416 10637 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065663.1 protein_id gnl|my_center|LOCUS_10570 10639 12174 gene locus_tag LOCUS_10580 10639 12174 CDS product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122835.1 protein_id gnl|my_center|LOCUS_10580 12188 12646 gene locus_tag LOCUS_10590 12188 12646 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708231.1 protein_id gnl|my_center|LOCUS_10590 13646 12660 gene locus_tag LOCUS_10600 13646 12660 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530364.1 protein_id gnl|my_center|LOCUS_10600 13810 14175 gene locus_tag LOCUS_10610 13810 14175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230896.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence042 483 944 gene locus_tag LOCUS_10620 483 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 919 1863 gene locus_tag LOCUS_10630 919 1863 CDS product putative RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45826 protein_id gnl|my_center|LOCUS_10630 1906 2991 gene locus_tag LOCUS_10640 1906 2991 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_10640 3034 3504 gene locus_tag LOCUS_10650 3034 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 3510 7052 gene locus_tag LOCUS_10660 gene dnaE 3510 7052 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63978 protein_id gnl|my_center|LOCUS_10660 7196 7864 gene locus_tag LOCUS_10670 7196 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 8043 8495 gene locus_tag LOCUS_10680 8043 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 8566 8958 gene locus_tag LOCUS_10690 8566 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 8986 10185 gene locus_tag LOCUS_10700 8986 10185 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039902.1 protein_id gnl|my_center|LOCUS_10700 10211 11077 gene locus_tag LOCUS_10710 gene menA 10211 11077 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CUN6 protein_id gnl|my_center|LOCUS_10710 11781 11074 gene locus_tag LOCUS_10720 gene ubiE 11781 11074 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU2 protein_id gnl|my_center|LOCUS_10720 11990 11781 gene locus_tag LOCUS_10730 11990 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 12950 12171 gene locus_tag LOCUS_10740 12950 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 12997 13638 gene locus_tag LOCUS_10750 gene nth 12997 13638 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NTL4 protein_id gnl|my_center|LOCUS_10750 13965 13771 gene locus_tag LOCUS_10760 13965 13771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence043 147 452 gene locus_tag LOCUS_10770 gene hup1 147 452 CDS product DNA-binding protein HU 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3H5 protein_id gnl|my_center|LOCUS_10770 527 952 gene locus_tag LOCUS_10780 gene fabZ 527 952 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94584 protein_id gnl|my_center|LOCUS_10780 2130 958 gene locus_tag LOCUS_10790 gene fabF 2130 958 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67612 protein_id gnl|my_center|LOCUS_10790 2366 2130 gene locus_tag LOCUS_10800 gene acpP 2366 2130 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKH6 protein_id gnl|my_center|LOCUS_10800 3155 2442 gene locus_tag LOCUS_10810 3155 2442 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_10810 4387 3206 gene locus_tag LOCUS_10820 4387 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 4645 5445 gene locus_tag LOCUS_10830 4645 5445 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529276.1 protein_id gnl|my_center|LOCUS_10830 5452 6375 gene locus_tag LOCUS_10840 5452 6375 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727131.1 protein_id gnl|my_center|LOCUS_10840 7002 6412 gene locus_tag LOCUS_10850 7002 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 7050 8681 gene locus_tag LOCUS_10860 7050 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 8738 8822 gene locus_tag LOCUS_t00240 8738 8822 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9271 8828 gene locus_tag LOCUS_10870 9271 8828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 9413 9676 gene locus_tag LOCUS_10880 9413 9676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 9676 10254 gene locus_tag LOCUS_10890 9676 10254 CDS product putative two-component response regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703361.1 protein_id gnl|my_center|LOCUS_10890 10306 12960 gene locus_tag LOCUS_10900 10306 12960 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729359.1 protein_id gnl|my_center|LOCUS_10900 12963 13712 gene locus_tag LOCUS_10910 12963 13712 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582685.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence044 90 1 gene locus_tag LOCUS_t00250 90 1 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 580 134 gene locus_tag LOCUS_10920 gene tadA 580 134 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81JC1 protein_id gnl|my_center|LOCUS_10920 692 781 gene locus_tag LOCUS_t00260 692 781 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 927 2567 gene locus_tag LOCUS_10930 927 2567 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458896.1 protein_id gnl|my_center|LOCUS_10930 2591 3205 gene locus_tag LOCUS_10940 gene recR 2591 3205 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI4 protein_id gnl|my_center|LOCUS_10940 3377 3790 gene locus_tag LOCUS_10950 3377 3790 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_10950 3798 4670 gene locus_tag LOCUS_10960 3798 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 5261 4683 gene locus_tag LOCUS_10970 5261 4683 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS17 protein_id gnl|my_center|LOCUS_10970 5346 6902 gene locus_tag LOCUS_10980 5346 6902 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_10980 6883 7113 gene locus_tag LOCUS_10990 6883 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 7904 7119 gene locus_tag LOCUS_11000 7904 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 7983 9206 gene locus_tag LOCUS_11010 7983 9206 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI7 protein_id gnl|my_center|LOCUS_11010 9262 10278 gene locus_tag LOCUS_11020 9262 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 10275 11012 gene locus_tag LOCUS_11030 10275 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 11082 12101 gene locus_tag LOCUS_11040 gene asd 11082 12101 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DK59 protein_id gnl|my_center|LOCUS_11040 12124 13212 gene locus_tag LOCUS_11050 12124 13212 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879898.1 protein_id gnl|my_center|LOCUS_11050 13470 13219 gene locus_tag LOCUS_11060 13470 13219 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868393.1 protein_id gnl|my_center|LOCUS_11060 13549 13848 gene locus_tag LOCUS_11070 13549 13848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence045 <1 1982 gene locus_tag LOCUS_11080 <1 1982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701711.1:putative lipase 2654 2097 gene locus_tag LOCUS_11090 2654 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2749 3960 gene locus_tag LOCUS_11100 2749 3960 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_11100 4893 3967 gene locus_tag LOCUS_11110 4893 3967 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 protein_id gnl|my_center|LOCUS_11110 5806 4907 gene locus_tag LOCUS_11120 5806 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(5306..5308),aa:Sec) note codon on position 167 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_11120 5907 6668 gene locus_tag LOCUS_11130 5907 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 6659 7981 gene locus_tag LOCUS_11140 6659 7981 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_11140 7984 9681 gene locus_tag LOCUS_11150 gene menD 7984 9681 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23970 protein_id gnl|my_center|LOCUS_11150 9678 10481 gene locus_tag LOCUS_11160 gene menH 9678 10481 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBD4 protein_id gnl|my_center|LOCUS_11160 10484 11500 gene locus_tag LOCUS_11170 10484 11500 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MK4 protein_id gnl|my_center|LOCUS_11170 12862 11501 gene locus_tag LOCUS_11180 12862 11501 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272198.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence046 874 599 gene locus_tag LOCUS_11190 gene rpsS 874 599 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYY4 protein_id gnl|my_center|LOCUS_11190 1714 881 gene locus_tag LOCUS_11200 gene rplB 1714 881 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGE7 protein_id gnl|my_center|LOCUS_11200 2008 1718 gene locus_tag LOCUS_11210 2008 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2661 2005 gene locus_tag LOCUS_11220 gene rplD 2661 2005 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSD2 protein_id gnl|my_center|LOCUS_11220 3359 2661 gene locus_tag LOCUS_11230 gene rplC 3359 2661 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0E0 protein_id gnl|my_center|LOCUS_11230 3630 4775 gene locus_tag LOCUS_11240 3630 4775 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_11240 5092 4772 gene locus_tag LOCUS_11250 gene rpsJ 5092 4772 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66337 protein_id gnl|my_center|LOCUS_11250 6295 5105 gene locus_tag LOCUS_11260 gene tuf1 6295 5105 CDS product elongation factor Tu-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40174 protein_id gnl|my_center|LOCUS_11260 8485 6359 gene locus_tag LOCUS_11270 gene fusA 8485 6359 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGH8 protein_id gnl|my_center|LOCUS_11270 8949 8479 gene locus_tag LOCUS_11280 gene rpsG 8949 8479 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EDB6 protein_id gnl|my_center|LOCUS_11280 9323 8952 gene locus_tag LOCUS_11290 gene rpsL 9323 8952 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4A3 protein_id gnl|my_center|LOCUS_11290 <13277 9437 gene locus_tag LOCUS_11300 <13277 9437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0A675:DNA-directed RNA polymerase subunit beta' >Feature sequence047 1427 474 gene locus_tag LOCUS_11310 1427 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522101.1 protein_id gnl|my_center|LOCUS_11310 1645 1484 gene locus_tag LOCUS_11320 1645 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 2652 1801 gene locus_tag LOCUS_11330 2652 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 3627 2758 gene locus_tag LOCUS_11340 3627 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3749 4999 gene locus_tag LOCUS_11350 3749 4999 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_11350 5039 5794 gene locus_tag LOCUS_11360 5039 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 7818 5803 gene locus_tag LOCUS_11370 7818 5803 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730604.1 protein_id gnl|my_center|LOCUS_11370 9694 7877 gene locus_tag LOCUS_11380 9694 7877 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_11380 9718 12267 gene locus_tag LOCUS_11390 9718 12267 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256961.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence048 1383 355 gene locus_tag LOCUS_11400 1383 355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057332.1 protein_id gnl|my_center|LOCUS_11400 1483 2256 gene locus_tag LOCUS_11410 gene yjkA 1483 2256 CDS product UPF0014 membrane protein YjkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34684 protein_id gnl|my_center|LOCUS_11410 2838 2260 gene locus_tag LOCUS_11420 gene maf 2838 2260 CDS product septum formation protein Maf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q817R9 protein_id gnl|my_center|LOCUS_11420 4044 2842 gene locus_tag LOCUS_11430 4044 2842 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKF6 protein_id gnl|my_center|LOCUS_11430 4954 4073 gene locus_tag LOCUS_11440 4954 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031741.1 protein_id gnl|my_center|LOCUS_11440 5675 4947 gene locus_tag LOCUS_11450 5675 4947 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083661.1 protein_id gnl|my_center|LOCUS_11450 6805 5654 gene locus_tag LOCUS_11460 6805 5654 CDS product microsomal epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_11460 7852 6815 gene locus_tag LOCUS_11470 7852 6815 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731394.1 protein_id gnl|my_center|LOCUS_11470 8013 9317 gene locus_tag LOCUS_11480 8013 9317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 9310 11466 gene locus_tag LOCUS_11490 9310 11466 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390232.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence049 2167 1358 gene locus_tag LOCUS_11500 2167 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2381 2307 gene locus_tag LOCUS_t00270 2381 2307 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2857 2432 gene locus_tag LOCUS_11510 2857 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 3460 2975 gene locus_tag LOCUS_11520 3460 2975 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214726.1 protein_id gnl|my_center|LOCUS_11520 4363 3473 gene locus_tag LOCUS_11530 gene moaA 4363 3473 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJ31 protein_id gnl|my_center|LOCUS_11530 5688 4474 gene locus_tag LOCUS_11540 5688 4474 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_11540 6305 5715 gene locus_tag LOCUS_11550 gene plsY 6305 5715 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZG9 protein_id gnl|my_center|LOCUS_11550 6339 6746 gene locus_tag LOCUS_11560 6339 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 8100 6757 gene locus_tag LOCUS_11570 8100 6757 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_11570 9506 8100 gene locus_tag LOCUS_11580 9506 8100 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_11580 9613 9999 gene locus_tag LOCUS_11590 9613 9999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 10443 10844 gene locus_tag LOCUS_11600 10443 10844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence050 667 1791 gene locus_tag LOCUS_11610 667 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1778 4138 gene locus_tag LOCUS_11620 1778 4138 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_11620 4131 4757 gene locus_tag LOCUS_11630 4131 4757 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728249.1 protein_id gnl|my_center|LOCUS_11630 6052 4766 gene locus_tag LOCUS_11640 6052 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 6100 6930 gene locus_tag LOCUS_11650 6100 6930 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920181.1 protein_id gnl|my_center|LOCUS_11650 6991 7635 gene locus_tag LOCUS_11660 6991 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 8838 7639 gene locus_tag LOCUS_11670 8838 7639 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730892.1 protein_id gnl|my_center|LOCUS_11670 8941 9858 gene locus_tag LOCUS_11680 8941 9858 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400489.1 protein_id gnl|my_center|LOCUS_11680 10418 9855 gene locus_tag LOCUS_11690 10418 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 10501 11184 gene locus_tag LOCUS_11700 gene rnhB 10501 11184 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69989 protein_id gnl|my_center|LOCUS_11700 11221 11607 gene locus_tag LOCUS_11710 11221 11607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence051 117 1310 gene locus_tag LOCUS_11720 gene argD 117 1310 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG65 protein_id gnl|my_center|LOCUS_11720 1289 2209 gene locus_tag LOCUS_11730 1289 2209 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_11730 2202 2675 gene locus_tag LOCUS_11740 gene argR 2202 2675 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPY9 protein_id gnl|my_center|LOCUS_11740 2690 3925 gene locus_tag LOCUS_11750 gene argG 2690 3925 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK0 protein_id gnl|my_center|LOCUS_11750 3925 5307 gene locus_tag LOCUS_11760 gene argH 3925 5307 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI1 protein_id gnl|my_center|LOCUS_11760 5304 5699 gene locus_tag LOCUS_11770 5304 5699 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226776.1 protein_id gnl|my_center|LOCUS_11770 5683 6249 gene locus_tag LOCUS_11780 5683 6249 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222931.1 protein_id gnl|my_center|LOCUS_11780 6781 6254 gene locus_tag LOCUS_11790 6781 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 9404 6783 gene locus_tag LOCUS_11800 9404 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 9461 10819 gene locus_tag LOCUS_11810 9461 10819 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808246.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence052 502 1650 gene locus_tag LOCUS_11820 502 1650 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_11820 1904 3553 gene locus_tag LOCUS_11830 1904 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3604 3864 gene locus_tag LOCUS_11840 gene rpmE2 3604 3864 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MGV4 protein_id gnl|my_center|LOCUS_11840 3895 4884 gene locus_tag LOCUS_11850 3895 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 4915 6015 gene locus_tag LOCUS_11860 gene prfA 4915 6015 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45872 protein_id gnl|my_center|LOCUS_11860 6028 6918 gene locus_tag LOCUS_11870 gene prmC 6028 6918 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULT2 protein_id gnl|my_center|LOCUS_11870 6915 7544 gene locus_tag LOCUS_11880 6915 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 7554 7997 gene locus_tag LOCUS_11890 7554 7997 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_11890 8012 9235 gene locus_tag LOCUS_11900 8012 9235 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804815.1 protein_id gnl|my_center|LOCUS_11900 10251 9634 gene locus_tag LOCUS_11910 10251 9634 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229194.1 protein_id gnl|my_center|LOCUS_11910 11463 10252 gene locus_tag LOCUS_11920 11463 10252 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089770.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence053 2 1369 gene locus_tag LOCUS_11930 gene nuoN-1 2 1369 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_11930 1359 2411 gene locus_tag LOCUS_11940 1359 2411 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_11940 2494 4488 gene locus_tag LOCUS_11950 gene acsA 2494 4488 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X928 protein_id gnl|my_center|LOCUS_11950 4496 4966 gene locus_tag LOCUS_11960 4496 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 5011 5892 gene locus_tag LOCUS_11970 5011 5892 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460068.1 protein_id gnl|my_center|LOCUS_11970 6377 5889 gene locus_tag LOCUS_11980 6377 5889 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747R1 protein_id gnl|my_center|LOCUS_11980 6454 6537 gene locus_tag LOCUS_t00280 6454 6537 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 7145 6555 gene locus_tag LOCUS_11990 7145 6555 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807699.1 protein_id gnl|my_center|LOCUS_11990 7165 7238 gene locus_tag LOCUS_t00290 7165 7238 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7241 7315 gene locus_tag LOCUS_t00300 7241 7315 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7438 7674 gene locus_tag LOCUS_12000 gene rpmB2 7438 7674 CDS product 50S ribosomal protein L28-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHA9 protein_id gnl|my_center|LOCUS_12000 7680 7841 gene locus_tag LOCUS_12010 gene rpmG 7680 7841 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS16 protein_id gnl|my_center|LOCUS_12010 7956 8031 gene locus_tag LOCUS_t00310 7956 8031 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 8117 8416 gene locus_tag LOCUS_12020 8117 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 8416 9261 gene locus_tag LOCUS_12030 gene nusG 8416 9261 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWV9 protein_id gnl|my_center|LOCUS_12030 9360 9785 gene locus_tag LOCUS_12040 gene rplK 9360 9785 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QS45 protein_id gnl|my_center|LOCUS_12040 9883 10575 gene locus_tag LOCUS_12050 gene rplA 9883 10575 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MH85 protein_id gnl|my_center|LOCUS_12050 >Feature sequence054 <1 1717 gene locus_tag LOCUS_12060 <1 1717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003901535.1:hydrolase 1767 2276 gene locus_tag LOCUS_12070 1767 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2499 4007 gene locus_tag LOCUS_12080 2499 4007 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223946.1 protein_id gnl|my_center|LOCUS_12080 4105 5496 gene locus_tag LOCUS_12090 4105 5496 CDS product putative cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701937.1 protein_id gnl|my_center|LOCUS_12090 5519 6709 gene locus_tag LOCUS_12100 gene metB 5519 6709 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229838.1 protein_id gnl|my_center|LOCUS_12100 8159 6978 gene locus_tag LOCUS_12110 8159 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 9746 8280 gene locus_tag LOCUS_12120 9746 8280 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_12120 9817 10689 gene locus_tag LOCUS_12130 9817 10689 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969107.1 protein_id gnl|my_center|LOCUS_12130 10716 11228 gene locus_tag LOCUS_12140 10716 11228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence055 1471 491 gene locus_tag LOCUS_12150 1471 491 CDS product putative luciferase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703166.1 protein_id gnl|my_center|LOCUS_12150 1564 3180 gene locus_tag LOCUS_12160 1564 3180 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227966.1 protein_id gnl|my_center|LOCUS_12160 3373 5259 gene locus_tag LOCUS_12170 3373 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 5256 6221 gene locus_tag LOCUS_12180 5256 6221 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_12180 6268 7176 gene locus_tag LOCUS_12190 6268 7176 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442797.1 protein_id gnl|my_center|LOCUS_12190 7173 8261 gene locus_tag LOCUS_12200 7173 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 8258 9328 gene locus_tag LOCUS_12210 8258 9328 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_12210 10526 9342 gene locus_tag LOCUS_12220 10526 9342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 protein_id gnl|my_center|LOCUS_12220 10934 10551 gene locus_tag LOCUS_12230 10934 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence056 3024 1402 gene locus_tag LOCUS_12240 3024 1402 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972418.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12240 3294 3055 gene locus_tag LOCUS_12250 3294 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12250 4523 3333 gene locus_tag LOCUS_12260 4523 3333 CDS product gamma-butyrobetaine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 protein_id gnl|my_center|LOCUS_12260 5475 4507 gene locus_tag LOCUS_12270 gene lcdH 5475 4507 CDS product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93RX5 protein_id gnl|my_center|LOCUS_12270 6384 5503 gene locus_tag LOCUS_12280 6384 5503 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030805.1 protein_id gnl|my_center|LOCUS_12280 6556 7341 gene locus_tag LOCUS_12290 gene fdhD 6556 7341 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R194 protein_id gnl|my_center|LOCUS_12290 7376 8059 gene locus_tag LOCUS_12300 7376 8059 CDS product putative heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTQ2 protein_id gnl|my_center|LOCUS_12300 8052 8420 gene locus_tag LOCUS_12310 8052 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 8516 9730 gene locus_tag LOCUS_12320 8516 9730 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDJ7 protein_id gnl|my_center|LOCUS_12320 >Feature sequence057 282 208 gene locus_tag LOCUS_t00320 282 208 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 379 2853 gene locus_tag LOCUS_12330 gene leuS 379 2853 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2J3 protein_id gnl|my_center|LOCUS_12330 3738 2866 gene locus_tag LOCUS_12340 3738 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_12340 4771 3743 gene locus_tag LOCUS_12350 4771 3743 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_12350 4850 5557 gene locus_tag LOCUS_12360 4850 5557 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_12360 5579 6037 gene locus_tag LOCUS_12370 5579 6037 CDS product benzoylsuccinyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729363.1 protein_id gnl|my_center|LOCUS_12370 6040 7227 gene locus_tag LOCUS_12380 6040 7227 CDS product putative lipid-transfer protein Ltp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703354.1 protein_id gnl|my_center|LOCUS_12380 7269 8009 gene locus_tag LOCUS_12390 gene paaG 7269 8009 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 protein_id gnl|my_center|LOCUS_12390 8029 8853 gene locus_tag LOCUS_12400 8029 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070726.1 protein_id gnl|my_center|LOCUS_12400 8865 9836 gene locus_tag LOCUS_12410 8865 9836 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730665.1 protein_id gnl|my_center|LOCUS_12410 9879 10679 gene locus_tag LOCUS_12420 gene echA19 9879 10679 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419179.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence058 44 1618 gene locus_tag LOCUS_12430 gene fadD3 44 1618 CDS product 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96843 protein_id gnl|my_center|LOCUS_12430 1671 4823 gene locus_tag LOCUS_12440 gene ileS 1671 4823 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D3M4 protein_id gnl|my_center|LOCUS_12440 4996 7404 gene locus_tag LOCUS_12450 4996 7404 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K496 protein_id gnl|my_center|LOCUS_12450 7404 8489 gene locus_tag LOCUS_12460 gene nrdB 7404 8489 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3C2 protein_id gnl|my_center|LOCUS_12460 10092 8542 gene locus_tag LOCUS_12470 10092 8542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence059 1144 875 gene locus_tag LOCUS_12480 1144 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1744 1367 gene locus_tag LOCUS_12490 1744 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 2153 1884 gene locus_tag LOCUS_12500 2153 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2767 2228 gene locus_tag LOCUS_12510 2767 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3560 2778 gene locus_tag LOCUS_12520 3560 2778 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225669.1 protein_id gnl|my_center|LOCUS_12520 3662 4633 gene locus_tag LOCUS_12530 3662 4633 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414686.1 protein_id gnl|my_center|LOCUS_12530 5393 4638 gene locus_tag LOCUS_12540 5393 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 6169 5414 gene locus_tag LOCUS_12550 6169 5414 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895777.1 protein_id gnl|my_center|LOCUS_12550 6278 6709 gene locus_tag LOCUS_12560 6278 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 6687 7193 gene locus_tag LOCUS_12570 6687 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 7222 7623 gene locus_tag LOCUS_12580 7222 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 8641 7625 gene locus_tag LOCUS_12590 8641 7625 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088453.1 protein_id gnl|my_center|LOCUS_12590 9005 8634 gene locus_tag LOCUS_12600 gene rsfS 9005 8634 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182L0 protein_id gnl|my_center|LOCUS_12600 10213 9026 gene locus_tag LOCUS_12610 10213 9026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence060 913 1842 gene locus_tag LOCUS_12620 913 1842 CDS product DNA-binding transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_236554.2 protein_id gnl|my_center|LOCUS_12620 1844 3199 gene locus_tag LOCUS_12630 1844 3199 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222858.1 protein_id gnl|my_center|LOCUS_12630 3261 4529 gene locus_tag LOCUS_12640 gene gltA 3261 4529 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBF3 protein_id gnl|my_center|LOCUS_12640 5708 4530 gene locus_tag LOCUS_12650 5708 4530 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090523.1 protein_id gnl|my_center|LOCUS_12650 5775 6956 gene locus_tag LOCUS_12660 gene hipO 5775 6956 CDS product hippurate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230672.1 protein_id gnl|my_center|LOCUS_12660 6958 7782 gene locus_tag LOCUS_12670 gene tesB 6958 7782 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_12670 7808 8755 gene locus_tag LOCUS_12680 7808 8755 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267509.1 protein_id gnl|my_center|LOCUS_12680 8805 9752 gene locus_tag LOCUS_12690 8805 9752 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence061 1246 494 gene locus_tag LOCUS_12700 gene fabG 1246 494 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_12700 1340 1957 gene locus_tag LOCUS_12710 1340 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2348 2028 gene locus_tag LOCUS_12720 2348 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 2320 2544 gene locus_tag LOCUS_12730 2320 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2588 3703 gene locus_tag LOCUS_12740 2588 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 4044 3700 gene locus_tag LOCUS_12750 4044 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269012.1 protein_id gnl|my_center|LOCUS_12750 4753 4049 gene locus_tag LOCUS_12760 4753 4049 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230619.1 protein_id gnl|my_center|LOCUS_12760 5700 4786 gene locus_tag LOCUS_12770 5700 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 6035 5688 gene locus_tag LOCUS_12780 6035 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 6073 7119 gene locus_tag LOCUS_12790 6073 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 8485 7112 gene locus_tag LOCUS_12800 8485 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 9342 8494 gene locus_tag LOCUS_12810 9342 8494 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024069.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence062 1059 631 gene locus_tag LOCUS_12820 1059 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 2961 1066 gene locus_tag LOCUS_12830 gene ftsH 2961 1066 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJQ4 protein_id gnl|my_center|LOCUS_12830 3043 3750 gene locus_tag LOCUS_12840 3043 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 3759 6329 gene locus_tag LOCUS_12850 3759 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 6326 7504 gene locus_tag LOCUS_12860 6326 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 7524 8873 gene locus_tag LOCUS_12870 gene manB 7524 8873 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_12870 8901 9137 gene locus_tag LOCUS_12880 8901 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895208.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence063 1876 884 gene locus_tag LOCUS_12890 1876 884 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068168.1 protein_id gnl|my_center|LOCUS_12890 2873 1869 gene locus_tag LOCUS_12900 gene pdhA 2873 1869 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPN3 protein_id gnl|my_center|LOCUS_12900 3165 3632 gene locus_tag LOCUS_12910 3165 3632 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726631.1 protein_id gnl|my_center|LOCUS_12910 3670 4404 gene locus_tag LOCUS_12920 3670 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 4405 4893 gene locus_tag LOCUS_12930 4405 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 4893 5453 gene locus_tag LOCUS_12940 4893 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 5524 5736 gene locus_tag LOCUS_12950 5524 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 6408 7430 gene locus_tag LOCUS_12960 gene trpD1 6408 7430 CDS product anthranilate phosphoribosyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68608 protein_id gnl|my_center|LOCUS_12960 8539 7763 gene locus_tag LOCUS_12970 8539 7763 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence064 1523 612 gene locus_tag LOCUS_12980 1523 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702680.1 protein_id gnl|my_center|LOCUS_12980 2046 1540 gene locus_tag LOCUS_12990 gene greA 2046 1540 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADK2 protein_id gnl|my_center|LOCUS_12990 2239 3156 gene locus_tag LOCUS_13000 2239 3156 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_13000 3146 4762 gene locus_tag LOCUS_13010 gene cimA 3146 4762 CDS product (R)-citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66682 protein_id gnl|my_center|LOCUS_13010 4807 5478 gene locus_tag LOCUS_13020 4807 5478 CDS product MIP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_13020 7548 5485 gene locus_tag LOCUS_13030 7548 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 7592 7786 gene locus_tag LOCUS_13040 7592 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 7818 8762 gene locus_tag LOCUS_13050 7818 8762 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence065 468 1331 gene locus_tag LOCUS_13060 468 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_13060 1751 1341 gene locus_tag LOCUS_13070 1751 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2223 1813 gene locus_tag LOCUS_13080 2223 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 2806 2330 gene locus_tag LOCUS_13090 gene fxsA 2806 2330 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941471.1 protein_id gnl|my_center|LOCUS_13090 2871 4160 gene locus_tag LOCUS_13100 gene selA 2871 4160 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIF3 protein_id gnl|my_center|LOCUS_13100 4179 5903 gene locus_tag LOCUS_13110 4179 5903 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_13110 7217 5928 gene locus_tag LOCUS_13120 7217 5928 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_13120 7595 7248 gene locus_tag LOCUS_13130 7595 7248 CDS product putative anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1F5 protein_id gnl|my_center|LOCUS_13130 7704 8078 gene locus_tag LOCUS_13140 7704 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 8083 8157 gene locus_tag LOCUS_t00330 8083 8157 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8214 8681 gene locus_tag LOCUS_13150 8214 8681 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727567.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence066 <1 521 gene locus_tag LOCUS_13160 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TLS5:formamidopyrimidine-DNA glycosylase 597 4094 gene locus_tag LOCUS_13170 gene smc 597 4094 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYI4 protein_id gnl|my_center|LOCUS_13170 4146 4850 gene locus_tag LOCUS_13180 4146 4850 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392988.1 protein_id gnl|my_center|LOCUS_13180 4860 6038 gene locus_tag LOCUS_13190 4860 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 6082 7359 gene locus_tag LOCUS_13200 6082 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 7379 7924 gene locus_tag LOCUS_13210 7379 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222274.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence067 4104 976 gene locus_tag LOCUS_13220 4104 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4197 5117 gene locus_tag LOCUS_13230 4197 5117 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_13230 5122 6102 gene locus_tag LOCUS_13240 gene gmd 5122 6102 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ72 protein_id gnl|my_center|LOCUS_13240 6099 7028 gene locus_tag LOCUS_13250 6099 7028 CDS product LPPG--FO 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_13250 7025 7735 gene locus_tag LOCUS_13260 7025 7735 CDS product F420-0--gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_13260 <8375 7732 gene locus_tag LOCUS_13270 <8375 7732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701256.1:putative UDP-glucose 4-epimerase GalE1 >Feature sequence068 745 1446 gene locus_tag LOCUS_13280 745 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031612.1 protein_id gnl|my_center|LOCUS_13280 2640 1447 gene locus_tag LOCUS_13290 2640 1447 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040046.1 protein_id gnl|my_center|LOCUS_13290 4056 2641 gene locus_tag LOCUS_13300 4056 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_13300 4175 5425 gene locus_tag LOCUS_13310 4175 5425 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063669.1 protein_id gnl|my_center|LOCUS_13310 6693 5428 gene locus_tag LOCUS_13320 6693 5428 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896238.1 protein_id gnl|my_center|LOCUS_13320 7413 6781 gene locus_tag LOCUS_13330 gene msrA 7413 6781 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_13330 8241 7426 gene locus_tag LOCUS_13340 8241 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416111.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence069 1247 66 gene locus_tag LOCUS_13350 1247 66 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028803.1 protein_id gnl|my_center|LOCUS_13350 1361 1278 gene locus_tag LOCUS_t00340 1361 1278 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1730 1434 gene locus_tag LOCUS_13360 1730 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1796 2740 gene locus_tag LOCUS_13370 1796 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 3987 2737 gene locus_tag LOCUS_13380 3987 2737 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_13380 4054 4830 gene locus_tag LOCUS_13390 4054 4830 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730027.1 protein_id gnl|my_center|LOCUS_13390 5425 4838 gene locus_tag LOCUS_13400 5425 4838 CDS product ribosomal-protein-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532763.1 protein_id gnl|my_center|LOCUS_13400 6420 5491 gene locus_tag LOCUS_13410 gene ppx 6420 5491 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229925.1 protein_id gnl|my_center|LOCUS_13410 6897 6436 gene locus_tag LOCUS_13420 6897 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080407.1 protein_id gnl|my_center|LOCUS_13420 7451 6867 gene locus_tag LOCUS_13430 7451 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 7999 7442 gene locus_tag LOCUS_13440 7999 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence070 <1 949 gene locus_tag LOCUS_13450 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259763.1:ABC transporter permease 954 2480 gene locus_tag LOCUS_13460 954 2480 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256433.1 protein_id gnl|my_center|LOCUS_13460 2485 3237 gene locus_tag LOCUS_13470 2485 3237 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974911.1 protein_id gnl|my_center|LOCUS_13470 3712 3239 gene locus_tag LOCUS_13480 3712 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227124.1 protein_id gnl|my_center|LOCUS_13480 5007 3715 gene locus_tag LOCUS_13490 5007 3715 CDS product ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230981.1 protein_id gnl|my_center|LOCUS_13490 5098 5928 gene locus_tag LOCUS_13500 5098 5928 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529754.1 protein_id gnl|my_center|LOCUS_13500 5928 6656 gene locus_tag LOCUS_13510 gene glnQ 5928 6656 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_13510 6699 7790 gene locus_tag LOCUS_13520 gene add 6699 7790 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFZ9 protein_id gnl|my_center|LOCUS_13520 >Feature sequence071 1492 173 gene locus_tag LOCUS_13530 1492 173 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_13530 3234 1489 gene locus_tag LOCUS_13540 3234 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 4599 3262 gene locus_tag LOCUS_13550 4599 3262 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_13550 5995 4679 gene locus_tag LOCUS_13560 gene murF 5995 4679 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2W8 protein_id gnl|my_center|LOCUS_13560 7729 6071 gene locus_tag LOCUS_13570 gene phnE 7729 6071 CDS product phosphate-import permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQ68 protein_id gnl|my_center|LOCUS_13570 >Feature sequence072 815 728 gene locus_tag LOCUS_t00350 815 728 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1049 825 gene locus_tag LOCUS_13580 gene secG 1049 825 CDS product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z469 protein_id gnl|my_center|LOCUS_13580 1858 1088 gene locus_tag LOCUS_13590 gene tpiA 1858 1088 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z520 protein_id gnl|my_center|LOCUS_13590 3032 1875 gene locus_tag LOCUS_13600 gene pgk 3032 1875 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI30 protein_id gnl|my_center|LOCUS_13600 4051 3050 gene locus_tag LOCUS_13610 gene gapA 4051 3050 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4Z2 protein_id gnl|my_center|LOCUS_13610 4973 4125 gene locus_tag LOCUS_13620 4973 4125 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CCP0 protein_id gnl|my_center|LOCUS_13620 5736 4996 gene locus_tag LOCUS_13630 5736 4996 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023449.1 protein_id gnl|my_center|LOCUS_13630 5793 6623 gene locus_tag LOCUS_13640 5793 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172618.1 protein_id gnl|my_center|LOCUS_13640 <7712 6616 gene locus_tag LOCUS_13650 <7712 6616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D4X3:UvrABC system protein C >Feature sequence073 <1 1221 gene locus_tag LOCUS_13660 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089277.1:cytochrome P450 2081 1218 gene locus_tag LOCUS_13670 2081 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2827 2078 gene locus_tag LOCUS_13680 gene livF 2827 2078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228916.1 protein_id gnl|my_center|LOCUS_13680 3642 2827 gene locus_tag LOCUS_13690 3642 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13690 5798 3639 gene locus_tag LOCUS_13700 5798 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13700 >Feature sequence074 143 838 gene locus_tag LOCUS_13710 143 838 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206301.1 protein_id gnl|my_center|LOCUS_13710 1752 877 gene locus_tag LOCUS_13720 1752 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_13720 1819 2259 gene locus_tag LOCUS_13730 1819 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2353 3435 gene locus_tag LOCUS_13740 2353 3435 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_13740 3448 4428 gene locus_tag LOCUS_13750 3448 4428 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_13750 4418 5404 gene locus_tag LOCUS_13760 4418 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 5388 5813 gene locus_tag LOCUS_13770 5388 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 5816 7015 gene locus_tag LOCUS_13780 5816 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704906.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence075 <1 1173 gene locus_tag LOCUS_13790 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VCB3:ATP-dependent DNA helicase RecG 1187 1795 gene locus_tag LOCUS_13800 1187 1795 CDS product GCN5-like N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_13800 1843 2373 gene locus_tag LOCUS_13810 1843 2373 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_13810 2432 2905 gene locus_tag LOCUS_13820 gene coaD 2432 2905 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPA5 protein_id gnl|my_center|LOCUS_13820 2908 3516 gene locus_tag LOCUS_13830 2908 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 3516 4055 gene locus_tag LOCUS_13840 3516 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 4413 5387 gene locus_tag LOCUS_13850 4413 5387 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_13850 5492 5782 gene locus_tag LOCUS_13860 5492 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 5760 6539 gene locus_tag LOCUS_13870 gene rnc 5760 6539 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBQ7 protein_id gnl|my_center|LOCUS_13870 >Feature sequence076 157 1653 gene locus_tag LOCUS_13880 157 1653 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_13880 1650 2741 gene locus_tag LOCUS_13890 1650 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3751 2738 gene locus_tag LOCUS_13900 3751 2738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_13900 4836 3751 gene locus_tag LOCUS_13910 4836 3751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_13910 5753 4839 gene locus_tag LOCUS_13920 5753 4839 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_13920 <6479 5743 gene locus_tag LOCUS_13930 <6479 5743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368602.1:peptide ABC transporter permease >Feature sequence077 262 1620 gene locus_tag LOCUS_13940 gene acoC 262 1620 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2A3 protein_id gnl|my_center|LOCUS_13940 2527 1613 gene locus_tag LOCUS_13950 gene psuG 2527 1613 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I109 protein_id gnl|my_center|LOCUS_13950 2722 3546 gene locus_tag LOCUS_13960 gene punA 2722 3546 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QT39 protein_id gnl|my_center|LOCUS_13960 3543 5231 gene locus_tag LOCUS_13970 3543 5231 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029947.1 protein_id gnl|my_center|LOCUS_13970 5228 6160 gene locus_tag LOCUS_13980 5228 6160 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence078 <1 697 gene locus_tag LOCUS_13990 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920425.1:cyclohexanone monooxygenase 715 1731 gene locus_tag LOCUS_14000 715 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1990 1736 gene locus_tag LOCUS_14010 gene rpsT 1990 1736 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDA3 protein_id gnl|my_center|LOCUS_14010 2111 3895 gene locus_tag LOCUS_14020 gene lepA 2111 3895 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0Y9 protein_id gnl|my_center|LOCUS_14020 3948 4952 gene locus_tag LOCUS_14030 gene hrcA 3948 4952 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX6 protein_id gnl|my_center|LOCUS_14030 4957 6057 gene locus_tag LOCUS_14040 gene dnaJ2 4957 6057 CDS product chaperone protein DnaJ 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDD7 protein_id gnl|my_center|LOCUS_14040 >Feature sequence079 349 2025 gene locus_tag LOCUS_14050 gene nadE2 349 2025 CDS product putative glutamine-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0Y0 protein_id gnl|my_center|LOCUS_14050 2136 3071 gene locus_tag LOCUS_14060 2136 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 3175 3080 gene locus_tag LOCUS_t00360 3175 3080 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 4145 3366 gene locus_tag LOCUS_14070 4145 3366 CDS product morphological differentiation-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975378.1 protein_id gnl|my_center|LOCUS_14070 4247 4582 gene locus_tag LOCUS_14080 gene rsbV 4247 4582 CDS product anti-sigma-B factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WVX8 protein_id gnl|my_center|LOCUS_14080 4592 5029 gene locus_tag LOCUS_14090 4592 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence080 70 819 gene locus_tag LOCUS_14100 70 819 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_14100 942 3464 gene locus_tag LOCUS_14110 942 3464 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775989.1 protein_id gnl|my_center|LOCUS_14110 3471 4238 gene locus_tag LOCUS_14120 gene etfB 3471 4238 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94550 protein_id gnl|my_center|LOCUS_14120 4235 5212 gene locus_tag LOCUS_14130 4235 5212 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887615.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence081 1384 185 gene locus_tag LOCUS_14140 1384 185 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708643.1 protein_id gnl|my_center|LOCUS_14140 3368 1368 gene locus_tag LOCUS_14150 3368 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3480 4625 gene locus_tag LOCUS_14160 3480 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 4634 5302 gene locus_tag LOCUS_14170 4634 5302 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896555.1 protein_id gnl|my_center|LOCUS_14170 5634 5305 gene locus_tag LOCUS_14180 5634 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence082 2754 757 gene locus_tag LOCUS_14190 2754 757 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975924.1 protein_id gnl|my_center|LOCUS_14190 3669 2782 gene locus_tag LOCUS_14200 3669 2782 CDS product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708374.1 protein_id gnl|my_center|LOCUS_14200 3999 3679 gene locus_tag LOCUS_14210 3999 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337732.1 protein_id gnl|my_center|LOCUS_14210 4646 4005 gene locus_tag LOCUS_14220 4646 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530684.1 protein_id gnl|my_center|LOCUS_14220 5386 4670 gene locus_tag LOCUS_14230 5386 4670 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence083 <1 705 gene locus_tag LOCUS_14240 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003129618.1:TatD family hydrolase 809 1567 gene locus_tag LOCUS_14250 809 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1575 2414 gene locus_tag LOCUS_14260 gene rsmA 1575 2414 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D7G5 protein_id gnl|my_center|LOCUS_14260 2418 3170 gene locus_tag LOCUS_14270 gene ispE 2418 3170 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX1 protein_id gnl|my_center|LOCUS_14270 3347 3422 gene locus_tag LOCUS_t00370 3347 3422 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3442 4665 gene locus_tag LOCUS_14280 3442 4665 CDS product creatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence084 188 2173 gene locus_tag LOCUS_14290 188 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 2163 3989 gene locus_tag LOCUS_14300 2163 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence085 1305 550 gene locus_tag LOCUS_14310 1305 550 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_14310 1336 1839 gene locus_tag LOCUS_14320 1336 1839 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921241.1 protein_id gnl|my_center|LOCUS_14320 2119 2679 gene locus_tag LOCUS_14330 2119 2679 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKF2 protein_id gnl|my_center|LOCUS_14330 4099 2690 gene locus_tag LOCUS_14340 4099 2690 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223302.1 protein_id gnl|my_center|LOCUS_14340 4836 4105 gene locus_tag LOCUS_14350 4836 4105 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence086 87 269 gene locus_tag LOCUS_14360 87 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 891 232 gene locus_tag LOCUS_14370 891 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1253 897 gene locus_tag LOCUS_14380 1253 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2114 1281 gene locus_tag LOCUS_14390 2114 1281 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_14390 3478 2138 gene locus_tag LOCUS_14400 3478 2138 CDS product retinal pigment epithelial membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731135.1 protein_id gnl|my_center|LOCUS_14400 3624 4055 gene locus_tag LOCUS_14410 3624 4055 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730079.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence087 496 1137 gene locus_tag LOCUS_14420 496 1137 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249420.1 protein_id gnl|my_center|LOCUS_14420 1134 2594 gene locus_tag LOCUS_14430 1134 2594 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867767.1 protein_id gnl|my_center|LOCUS_14430 2633 3232 gene locus_tag LOCUS_14440 2633 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 4103 3255 gene locus_tag LOCUS_14450 4103 3255 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_14450 <4992 4150 gene locus_tag LOCUS_14460 <4992 4150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083626.1:adenosine kinase >Feature sequence088 2501 1671 gene locus_tag LOCUS_14470 gene rfbD 2501 1671 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023678.1 protein_id gnl|my_center|LOCUS_14470 3469 2498 gene locus_tag LOCUS_14480 gene rfbB 3469 2498 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023679.1 protein_id gnl|my_center|LOCUS_14480 4031 3471 gene locus_tag LOCUS_14490 4031 3471 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870350.1 protein_id gnl|my_center|LOCUS_14490 <4983 4024 gene locus_tag LOCUS_14500 <4983 4024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257837.1:glucose-1-phosphate thymidylyltransferase >Feature sequence089 51 126 gene locus_tag LOCUS_t00380 51 126 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 155 228 gene locus_tag LOCUS_t00390 155 228 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 278 1477 gene locus_tag LOCUS_14510 278 1477 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897303.1 protein_id gnl|my_center|LOCUS_14510 1477 2592 gene locus_tag LOCUS_14520 1477 2592 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704886.1 protein_id gnl|my_center|LOCUS_14520 3500 2589 gene locus_tag LOCUS_14530 3500 2589 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_14530 4677 3502 gene locus_tag LOCUS_14540 gene fadA5 4677 3502 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I6XHI4 protein_id gnl|my_center|LOCUS_14540 >Feature sequence090 <1 758 gene locus_tag LOCUS_14550 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257167.1:glycosyl transferase family 1 758 1873 gene locus_tag LOCUS_14560 758 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1875 3110 gene locus_tag LOCUS_14570 1875 3110 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265553.1 protein_id gnl|my_center|LOCUS_14570 3165 3893 gene locus_tag LOCUS_14580 3165 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence091 <1 1627 gene locus_tag LOCUS_14590 <1 1627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776746.1:glycosyl transferase 2920 1640 gene locus_tag LOCUS_14600 2920 1640 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027197.1 protein_id gnl|my_center|LOCUS_14600 3603 2920 gene locus_tag LOCUS_14610 3603 2920 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027198.1 protein_id gnl|my_center|LOCUS_14610 3655 4668 gene locus_tag LOCUS_14620 3655 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence092 <1 580 gene locus_tag LOCUS_14630 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EH93:Na(+)/H(+) antiporter NhaA 629 3694 gene locus_tag LOCUS_14640 629 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence093 3929 330 gene locus_tag LOCUS_14650 gene rpoB 3929 330 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0L0 protein_id gnl|my_center|LOCUS_14650 4550 4167 gene locus_tag LOCUS_14660 gene rplL 4550 4167 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EE75 protein_id gnl|my_center|LOCUS_14660 >Feature sequence094 432 1307 gene locus_tag LOCUS_14670 gene lipg 432 1307 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890781.1 protein_id gnl|my_center|LOCUS_14670 2039 1326 gene locus_tag LOCUS_14680 2039 1326 CDS product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016437.1 protein_id gnl|my_center|LOCUS_14680 2161 3297 gene locus_tag LOCUS_14690 gene rmuC 2161 3297 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44733 protein_id gnl|my_center|LOCUS_14690 3445 4287 gene locus_tag LOCUS_14700 3445 4287 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972565.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence095 955 1320 gene locus_tag LOCUS_14710 955 1320 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972719.1 protein_id gnl|my_center|LOCUS_14710 1349 2818 gene locus_tag LOCUS_14720 gene gatA 1349 2818 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136108.1 protein_id gnl|my_center|LOCUS_14720 3326 2823 gene locus_tag LOCUS_14730 3326 2823 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230535.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence096 635 1291 gene locus_tag LOCUS_14740 635 1291 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731411.1 protein_id gnl|my_center|LOCUS_14740 3248 1281 gene locus_tag LOCUS_14750 3248 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 4393 3245 gene locus_tag LOCUS_14760 4393 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence097 421 1449 gene locus_tag LOCUS_14770 421 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1735 2505 gene locus_tag LOCUS_14780 1735 2505 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600573.1 protein_id gnl|my_center|LOCUS_14780 2881 3123 gene locus_tag LOCUS_14790 2881 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence098 549 55 gene locus_tag LOCUS_14800 gene ruvC 549 55 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAF2 protein_id gnl|my_center|LOCUS_14800 1352 609 gene locus_tag LOCUS_14810 1352 609 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62036 protein_id gnl|my_center|LOCUS_14810 1959 1384 gene locus_tag LOCUS_14820 gene pdxT 1959 1384 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCJ8 protein_id gnl|my_center|LOCUS_14820 2853 1963 gene locus_tag LOCUS_14830 gene pdxS 2853 1963 CDS product pyridoxal 5'-phosphate synthase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L286 protein_id gnl|my_center|LOCUS_14830 4068 2920 gene locus_tag LOCUS_14840 4068 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence099 1558 2700 gene locus_tag LOCUS_14850 1558 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3082 2714 gene locus_tag LOCUS_14860 3082 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 3133 3810 gene locus_tag LOCUS_14870 3133 3810 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704421.1 protein_id gnl|my_center|LOCUS_14870 <4409 3813 gene locus_tag LOCUS_14880 <4409 3813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SKI6:ribosomal RNA small subunit methyltransferase E >Feature sequence100 307 918 gene locus_tag LOCUS_14890 gene rpoE 307 918 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222027.1 protein_id gnl|my_center|LOCUS_14890 915 2075 gene locus_tag LOCUS_14900 915 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3168 2086 gene locus_tag LOCUS_14910 gene serC 3168 2086 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81BC0 protein_id gnl|my_center|LOCUS_14910 <4200 3263 gene locus_tag LOCUS_14920 <4200 3263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223416.1:poly-gamma-glutamate biosynthesis protein >Feature sequence101 2137 485 gene locus_tag LOCUS_14930 gene metG 2137 485 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKM1 protein_id gnl|my_center|LOCUS_14930 3016 2177 gene locus_tag LOCUS_14940 gene rsmI 3016 2177 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR7 protein_id gnl|my_center|LOCUS_14940 4082 3009 gene locus_tag LOCUS_14950 gene ychF 4082 3009 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03CJ4 protein_id gnl|my_center|LOCUS_14950 >Feature sequence102 738 1145 gene locus_tag LOCUS_14960 738 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1973 1164 gene locus_tag LOCUS_14970 1973 1164 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730139.1 protein_id gnl|my_center|LOCUS_14970 3052 1982 gene locus_tag LOCUS_14980 3052 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence103 1959 322 gene locus_tag LOCUS_14990 gene nuoM-1 1959 322 CDS product NADH:ubiquinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_14990 <3952 1972 gene locus_tag LOCUS_15000 <3952 1972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460436.1:NADH-quinone oxidoreductase subunit L >Feature sequence104 260 1387 gene locus_tag LOCUS_15010 260 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1817 1395 gene locus_tag LOCUS_15020 1817 1395 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230741.1 protein_id gnl|my_center|LOCUS_15020 1942 1867 gene locus_tag LOCUS_t00400 1942 1867 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3146 2013 gene locus_tag LOCUS_15030 3146 2013 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061599.1 protein_id gnl|my_center|LOCUS_15030 3245 3322 gene locus_tag LOCUS_t00410 3245 3322 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3378 3451 gene locus_tag LOCUS_t00420 3378 3451 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence105 150 584 gene locus_tag LOCUS_15040 150 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701975.1 protein_id gnl|my_center|LOCUS_15040 588 1976 gene locus_tag LOCUS_15050 588 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2611 1973 gene locus_tag LOCUS_15060 2611 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2966 2628 gene locus_tag LOCUS_15070 2966 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 3614 2979 gene locus_tag LOCUS_15080 3614 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence106 2612 63 gene locus_tag LOCUS_15090 2612 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence107 2175 568 gene locus_tag LOCUS_15100 2175 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2219 3067 gene locus_tag LOCUS_15110 2219 3067 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_15110 <3740 3071 gene locus_tag LOCUS_15120 <3740 3071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704354.1:putative biotin--acetyl-CoA-carboxylase ligase >Feature sequence108 <1 969 gene locus_tag LOCUS_15130 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MCU7:1-deoxy-D-xylulose-5-phosphate synthase 1761 973 gene locus_tag LOCUS_15140 1761 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1667 2365 gene locus_tag LOCUS_15150 1667 2365 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_15150 2375 3388 gene locus_tag LOCUS_15160 gene hemH 2375 3388 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QX29 protein_id gnl|my_center|LOCUS_15160 >Feature sequence109 870 1952 gene locus_tag LOCUS_15170 870 1952 CDS product putative zinc-type alcohol dehydrogenase AdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702819.1 protein_id gnl|my_center|LOCUS_15170 1979 2440 gene locus_tag LOCUS_15180 1979 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15180 2442 3017 gene locus_tag LOCUS_15190 2442 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15190 >Feature sequence110 1937 702 gene locus_tag LOCUS_15200 1937 702 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083734.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence111 1758 706 gene locus_tag LOCUS_15210 1758 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 2556 1762 gene locus_tag LOCUS_15220 gene tauD 2556 1762 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212310.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence112 2627 1461 gene locus_tag LOCUS_15230 2627 1461 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228841.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence113 589 104 gene locus_tag LOCUS_15240 589 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2148 586 gene locus_tag LOCUS_15250 gene guaA 2148 586 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGP2 protein_id gnl|my_center|LOCUS_15250 <3080 2151 gene locus_tag LOCUS_15260 <3080 2151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258696.1:aromatic-L-amino-acid decarboxylase >Feature sequence114 2156 909 gene locus_tag LOCUS_15270 2156 909 CDS product UDP-phosphate galactose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392197.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence115 <1 545 gene locus_tag LOCUS_15280 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926642.1:amidohydrolase 589 1125 gene locus_tag LOCUS_15290 589 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1128 1538 gene locus_tag LOCUS_15300 1128 1538 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_15300 1535 2014 gene locus_tag LOCUS_15310 1535 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 2930 1989 gene locus_tag LOCUS_15320 gene rihA 2930 1989 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P41409 protein_id gnl|my_center|LOCUS_15320 >Feature sequence116 2312 189 gene locus_tag LOCUS_15330 2312 189 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_15330 <2949 2363 gene locus_tag LOCUS_15340 <2949 2363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PDM1:methylenetetrahydrofolate reductase >Feature sequence117 1477 257 gene locus_tag LOCUS_15350 1477 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence118 32 370 gene locus_tag LOCUS_15360 32 370 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_15360 419 1255 gene locus_tag LOCUS_15370 419 1255 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728230.1 protein_id gnl|my_center|LOCUS_15370 1378 1584 gene locus_tag LOCUS_15380 1378 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1659 1964 gene locus_tag LOCUS_15390 1659 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 <2688 1978 gene locus_tag LOCUS_15400 <2688 1978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893406.1:LLM class F420-dependent oxidoreductase >Feature sequence119 304 2565 gene locus_tag LOCUS_15410 304 2565 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence120 60 308 gene locus_tag LOCUS_15420 60 308 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_15420 317 838 gene locus_tag LOCUS_15430 317 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 828 1547 gene locus_tag LOCUS_15440 gene trmD 828 1547 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2G4 protein_id gnl|my_center|LOCUS_15440 1649 1999 gene locus_tag LOCUS_15450 gene rplS 1649 1999 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2Q6 protein_id gnl|my_center|LOCUS_15450 >Feature sequence121 254 934 gene locus_tag LOCUS_15460 254 934 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211996.1 protein_id gnl|my_center|LOCUS_15460 2493 937 gene locus_tag LOCUS_15470 2493 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence122 1142 357 gene locus_tag LOCUS_15480 gene bdhA 1142 357 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084310.1 protein_id gnl|my_center|LOCUS_15480 2398 1154 gene locus_tag LOCUS_15490 2398 1154 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence123 95 553 gene locus_tag LOCUS_15500 95 553 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708231.1 protein_id gnl|my_center|LOCUS_15500 1549 563 gene locus_tag LOCUS_15510 1549 563 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530364.1 protein_id gnl|my_center|LOCUS_15510 1712 2077 gene locus_tag LOCUS_15520 1712 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230896.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence124 130 1155 gene locus_tag LOCUS_15530 gene ruvB 130 1155 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHT7 protein_id gnl|my_center|LOCUS_15530 1190 2194 gene locus_tag LOCUS_15540 gene queA 1190 2194 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E0D7 protein_id gnl|my_center|LOCUS_15540 >Feature sequence125 1223 1032 gene locus_tag LOCUS_15550 1223 1032 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730111.1 protein_id gnl|my_center|LOCUS_15550 <2351 1314 gene locus_tag LOCUS_15560 <2351 1314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224426.1:acetyl-CoA acetyltransferase >Feature sequence126 758 75 gene locus_tag LOCUS_15570 758 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLE7 protein_id gnl|my_center|LOCUS_15570 2244 748 gene locus_tag LOCUS_15580 2244 748 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence127 1782 1051 gene locus_tag LOCUS_15590 1782 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence128 >Feature sequence129 209 60 gene locus_tag LOCUS_15600 209 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1574 234 gene locus_tag LOCUS_15610 1574 234 CDS product retinal pigment epithelial membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731135.1 protein_id gnl|my_center|LOCUS_15610 1722 2153 gene locus_tag LOCUS_15620 1722 2153 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730079.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence130 <1 993 gene locus_tag LOCUS_15630 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225697.1:amidohydrolase 990 1880 gene locus_tag LOCUS_15640 990 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1984 1895 gene locus_tag LOCUS_t00430 1984 1895 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence131 9 1730 gene locus_tag LOCUS_15650 9 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence132 909 280 gene locus_tag LOCUS_15660 909 280 CDS product TIGR03085 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_15660 <2076 902 gene locus_tag LOCUS_15670 <2076 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027026.1:dioxygenase >Feature sequence133 <1 749 gene locus_tag LOCUS_15680 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086677.1:arylsulfatase <2019 753 gene locus_tag LOCUS_15690 <2019 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809350.1:MBL fold hydrolase >Feature sequence134 <1 817 gene locus_tag LOCUS_15700 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918828.1:acyl-CoA synthetase 847 1677 gene locus_tag LOCUS_15710 847 1677 CDS product putative enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704587.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence135 932 798 gene locus_tag LOCUS_15720 932 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1051 978 gene locus_tag LOCUS_t00440 1051 978 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 <1940 1102 gene locus_tag LOCUS_15730 <1940 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KY67:DNA helicase >Feature sequence136 656 856 gene locus_tag LOCUS_15740 gene cspLB 656 856 CDS product cold shock-like protein CspLB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A357 protein_id gnl|my_center|LOCUS_15740 1644 868 gene locus_tag LOCUS_15750 1644 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence137 <1897 331 gene locus_tag LOCUS_15760 <1897 331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WIW3:formate--tetrahydrofolate ligase >Feature sequence138 218 328 gene locus_tag LOCUS_r00010 218 328 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 407 1411 gene locus_tag LOCUS_15770 407 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence139 181 915 gene locus_tag LOCUS_15780 181 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence140 1375 476 gene locus_tag LOCUS_15790 1375 476 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199876.1 protein_id gnl|my_center|LOCUS_15790 <1864 1362 gene locus_tag LOCUS_15800 <1864 1362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970045.1:ABC transporter ATP-binding protein >Feature sequence141 259 1476 gene locus_tag LOCUS_15810 259 1476 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence142 1470 565 gene locus_tag LOCUS_15820 gene rbsK 1470 565 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A401 protein_id gnl|my_center|LOCUS_15820 >Feature sequence143 342 100 gene locus_tag LOCUS_15830 gene rpmC 342 100 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32989 protein_id gnl|my_center|LOCUS_15830 759 343 gene locus_tag LOCUS_15840 gene rplP 759 343 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHD5 protein_id gnl|my_center|LOCUS_15840 1700 762 gene locus_tag LOCUS_15850 1700 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence144 >Feature sequence145 <1727 777 gene locus_tag LOCUS_15860 <1727 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812443.1:branched-chain amino acid ABC transporter permease >Feature sequence146 >Feature sequence147 >Feature sequence148 <1 744 gene locus_tag LOCUS_15870 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528031.1:FAD-dependent oxidoreductase >Feature sequence149 466 1488 gene locus_tag LOCUS_15880 466 1488 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence150 1418 309 gene locus_tag LOCUS_15890 gene tgt 1418 309 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183P1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence151 >Feature sequence152 <1560 600 gene locus_tag LOCUS_15900 <1560 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986692.1:electron transfer flavoprotein subunit alpha >Feature sequence153 44 1063 gene locus_tag LOCUS_15910 gene phnD 44 1063 CDS product phosphate-import protein PhnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQ71 protein_id gnl|my_center|LOCUS_15910 >Feature sequence154 <1528 726 gene locus_tag LOCUS_15920 <1528 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817411.1:mannose-6-phosphate isomerase, class I