>Feature sequence01 855 2399 gene locus_tag LOCUS_00010 855 2399 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 protein_id gnl|my_center|LOCUS_00010 2921 3454 gene locus_tag LOCUS_00020 2921 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3442 5325 gene locus_tag LOCUS_00030 gene sdhA 3442 5325 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_00030 5362 6171 gene locus_tag LOCUS_00040 gene sdhB 5362 6171 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_00040 7317 6163 gene locus_tag LOCUS_00050 7317 6163 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815466.1 protein_id gnl|my_center|LOCUS_00050 8950 7325 gene locus_tag LOCUS_00060 8950 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_00060 9013 10554 gene locus_tag LOCUS_00070 gene glyS 9013 10554 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2A9 protein_id gnl|my_center|LOCUS_00070 10555 11316 gene locus_tag LOCUS_00080 gene xth 10555 11316 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_00080 12446 11313 gene locus_tag LOCUS_00090 12446 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13714 12449 gene locus_tag LOCUS_00100 13714 12449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13902 15266 gene locus_tag LOCUS_00110 13902 15266 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_00110 15677 15267 gene locus_tag LOCUS_00120 gene yqiW 15677 15267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_00120 15779 16198 gene locus_tag LOCUS_00130 15779 16198 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_00130 16666 17643 gene locus_tag LOCUS_00140 gene nrdB 16666 17643 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_00140 17690 20164 gene locus_tag LOCUS_00150 gene nrdA 17690 20164 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_00150 20273 20572 gene locus_tag LOCUS_00160 20273 20572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962526.1 protein_id gnl|my_center|LOCUS_00160 22276 20678 gene locus_tag LOCUS_00170 22276 20678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22496 22795 gene locus_tag LOCUS_00180 22496 22795 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_00180 26338 22826 gene locus_tag LOCUS_00190 26338 22826 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 protein_id gnl|my_center|LOCUS_00190 29506 26384 gene locus_tag LOCUS_00200 29506 26384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_00200 29562 30818 gene locus_tag LOCUS_00210 gene erg3 29562 30818 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_00210 30896 30969 gene locus_tag LOCUS_t00010 30896 30969 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 31066 32298 gene locus_tag LOCUS_00220 gene nusA 31066 32298 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_00220 32313 34832 gene locus_tag LOCUS_00230 gene infB 32313 34832 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 protein_id gnl|my_center|LOCUS_00230 35216 34827 gene locus_tag LOCUS_00240 35216 34827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 35647 36891 gene locus_tag LOCUS_00250 gene actA 35647 36891 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_00250 36901 39954 gene locus_tag LOCUS_00260 gene actB 36901 39954 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_00260 39958 41346 gene locus_tag LOCUS_00270 gene actC 39958 41346 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_00270 41339 41875 gene locus_tag LOCUS_00280 gene actD 41339 41875 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_00280 41958 42413 gene locus_tag LOCUS_00290 gene actE 41958 42413 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_00290 42420 43757 gene locus_tag LOCUS_00300 gene actF 42420 43757 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_00300 43760 44827 gene locus_tag LOCUS_00310 gene ctaC 43760 44827 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_00310 44834 46621 gene locus_tag LOCUS_00320 gene ctaD 44834 46621 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_00320 46670 47668 gene locus_tag LOCUS_00330 gene ruvB 46670 47668 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_00330 47699 49972 gene locus_tag LOCUS_00340 gene maeB 47699 49972 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_00340 49980 50561 gene locus_tag LOCUS_00350 gene ruvA 49980 50561 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_00350 50563 50943 gene locus_tag LOCUS_00360 gene gcvH 50563 50943 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_00360 51021 51722 gene locus_tag LOCUS_00370 51021 51722 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_00370 51786 52643 gene locus_tag LOCUS_00380 gene ctaB 51786 52643 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_00380 52643 53257 gene locus_tag LOCUS_00390 gene ctaE 52643 53257 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_00390 53293 54276 gene locus_tag LOCUS_00400 53293 54276 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_00400 54278 54661 gene locus_tag LOCUS_00410 54278 54661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 54661 55317 gene locus_tag LOCUS_00420 54661 55317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964209.1 protein_id gnl|my_center|LOCUS_00420 55314 56015 gene locus_tag LOCUS_00430 gene ypmQ 55314 56015 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_00430 56008 56547 gene locus_tag LOCUS_00440 gene yozB 56008 56547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_00440 56804 57394 gene locus_tag LOCUS_00450 56804 57394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 57387 57668 gene locus_tag LOCUS_00460 57387 57668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 57726 58424 gene locus_tag LOCUS_00470 57726 58424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765150.1 protein_id gnl|my_center|LOCUS_00470 58417 59646 gene locus_tag LOCUS_00480 58417 59646 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763621.1 protein_id gnl|my_center|LOCUS_00480 59639 60913 gene locus_tag LOCUS_00490 59639 60913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_00490 60937 62076 gene locus_tag LOCUS_00500 60937 62076 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_00500 62094 63428 gene locus_tag LOCUS_00510 62094 63428 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_00510 63447 64103 gene locus_tag LOCUS_00520 63447 64103 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_00520 64637 64104 gene locus_tag LOCUS_00530 64637 64104 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964197.1 protein_id gnl|my_center|LOCUS_00530 67178 64692 gene locus_tag LOCUS_00540 gene bamA 67178 64692 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 protein_id gnl|my_center|LOCUS_00540 67929 67222 gene locus_tag LOCUS_00550 gene uppS 67929 67222 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_00550 68818 67934 gene locus_tag LOCUS_00560 gene nadK 68818 67934 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_00560 68887 69618 gene locus_tag LOCUS_00570 gene pdxJ 68887 69618 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 protein_id gnl|my_center|LOCUS_00570 69599 70375 gene locus_tag LOCUS_00580 69599 70375 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_00580 70377 70862 gene locus_tag LOCUS_00590 70377 70862 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_00590 72241 70883 gene locus_tag LOCUS_00600 gene mgtE 72241 70883 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_00600 73007 72228 gene locus_tag LOCUS_00610 gene rsmA 73007 72228 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_00610 74284 73010 gene locus_tag LOCUS_00620 gene serS 74284 73010 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_00620 75238 74312 gene locus_tag LOCUS_00630 gene ribF 75238 74312 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_00630 75857 75225 gene locus_tag LOCUS_00640 gene pth 75857 75225 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_00640 76606 75902 gene locus_tag LOCUS_00650 gene rplY 76606 75902 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 protein_id gnl|my_center|LOCUS_00650 77549 76617 gene locus_tag LOCUS_00660 gene prsA 77549 76617 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_00660 77651 77733 gene locus_tag LOCUS_t00020 77651 77733 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence02 267 184 gene locus_tag LOCUS_t00030 267 184 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 369 296 gene locus_tag LOCUS_t00040 369 296 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 451 978 gene locus_tag LOCUS_00670 gene aroK 451 978 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 protein_id gnl|my_center|LOCUS_00670 1467 970 gene locus_tag LOCUS_00680 gene pyrR2 1467 970 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_00680 1511 2422 gene locus_tag LOCUS_00690 1511 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963560.1 protein_id gnl|my_center|LOCUS_00690 3073 2426 gene locus_tag LOCUS_00700 3073 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 4026 3070 gene locus_tag LOCUS_00710 gene tktC 4026 3070 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_00710 4814 4029 gene locus_tag LOCUS_00720 gene tktA 4814 4029 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_00720 5058 6077 gene locus_tag LOCUS_00730 5058 6077 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_00730 6125 7078 gene locus_tag LOCUS_00740 gene accA 6125 7078 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_00740 7191 8675 gene locus_tag LOCUS_00750 gene dnaB 7191 8675 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_00750 9595 8672 gene locus_tag LOCUS_00760 gene prfB 9595 8672 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_00760 9821 12211 gene locus_tag LOCUS_00770 9821 12211 CDS product periplasmic metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070915.1 protein_id gnl|my_center|LOCUS_00770 12249 13286 gene locus_tag LOCUS_00780 12249 13286 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963027.1 protein_id gnl|my_center|LOCUS_00780 13290 14543 gene locus_tag LOCUS_00790 13290 14543 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_00790 15667 14546 gene locus_tag LOCUS_00800 gene dnaN 15667 14546 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_00800 16575 15748 gene locus_tag LOCUS_00810 gene fjo14 16575 15748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_00810 16656 17600 gene locus_tag LOCUS_00820 gene phoH 16656 17600 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_00820 17597 18547 gene locus_tag LOCUS_00830 gene purC 17597 18547 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A004 protein_id gnl|my_center|LOCUS_00830 20067 18544 gene locus_tag LOCUS_00840 20067 18544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_00840 20962 20060 gene locus_tag LOCUS_00850 gene miaA 20962 20060 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V8 protein_id gnl|my_center|LOCUS_00850 21773 20952 gene locus_tag LOCUS_00860 21773 20952 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_00860 22887 21766 gene locus_tag LOCUS_00870 22887 21766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 23534 22893 gene locus_tag LOCUS_00880 23534 22893 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_00880 24493 23531 gene locus_tag LOCUS_00890 24493 23531 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_00890 24557 25198 gene locus_tag LOCUS_00900 gene pcm 24557 25198 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_00900 25661 25200 gene locus_tag LOCUS_00910 gene smpB 25661 25200 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 protein_id gnl|my_center|LOCUS_00910 25709 26977 gene locus_tag LOCUS_00920 gene glyA 25709 26977 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_00920 26983 29163 gene locus_tag LOCUS_00930 26983 29163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 30218 29196 gene locus_tag LOCUS_00940 30218 29196 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_00940 30248 31051 gene locus_tag LOCUS_00950 30248 31051 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_00950 31060 31713 gene locus_tag LOCUS_00960 gene tal 31060 31713 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_00960 33110 31707 gene locus_tag LOCUS_00970 33110 31707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963192.1 protein_id gnl|my_center|LOCUS_00970 33123 34745 gene locus_tag LOCUS_00980 33123 34745 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_00980 37154 34746 gene locus_tag LOCUS_00990 gene pheT 37154 34746 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_00990 39301 37190 gene locus_tag LOCUS_01000 gene recG 39301 37190 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_01000 40538 39294 gene locus_tag LOCUS_01010 40538 39294 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640497.1 protein_id gnl|my_center|LOCUS_01010 40603 42858 gene locus_tag LOCUS_01020 gene uvrD 40603 42858 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_01020 43842 42916 gene locus_tag LOCUS_01030 43842 42916 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_01030 44895 43891 gene locus_tag LOCUS_01040 44895 43891 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_01040 45335 44892 gene locus_tag LOCUS_01050 45335 44892 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_01050 45351 46355 gene locus_tag LOCUS_01060 gene holA 45351 46355 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_01060 48739 46352 gene locus_tag LOCUS_01070 48739 46352 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_01070 49697 48861 gene locus_tag LOCUS_01080 49697 48861 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_01080 50968 49694 gene locus_tag LOCUS_01090 50968 49694 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109360.1 protein_id gnl|my_center|LOCUS_01090 52128 51031 gene locus_tag LOCUS_01100 52128 51031 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_01100 55084 52274 gene locus_tag LOCUS_01110 55084 52274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962879.1 protein_id gnl|my_center|LOCUS_01110 57924 55081 gene locus_tag LOCUS_01120 gene uvrA2 57924 55081 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX6 protein_id gnl|my_center|LOCUS_01120 59641 57932 gene locus_tag LOCUS_01130 gene ggt 59641 57932 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_01130 59688 61070 gene locus_tag LOCUS_01140 59688 61070 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_01140 61719 61063 gene locus_tag LOCUS_01150 61719 61063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 63057 61951 gene locus_tag LOCUS_01160 63057 61951 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_01160 63139 64518 gene locus_tag LOCUS_01170 63139 64518 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887266.1 protein_id gnl|my_center|LOCUS_01170 64547 65611 gene locus_tag LOCUS_01180 gene aroC 64547 65611 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_01180 65614 66891 gene locus_tag LOCUS_01190 gene gltP 65614 66891 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_01190 66875 67549 gene locus_tag LOCUS_01200 gene ung2 66875 67549 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_01200 67546 69525 gene locus_tag LOCUS_01210 gene bfmBA 67546 69525 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_01210 69528 69983 gene locus_tag LOCUS_01220 69528 69983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 70429 70115 gene locus_tag LOCUS_01230 70429 70115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_01230 71367 70552 gene locus_tag LOCUS_01240 71367 70552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 72127 71381 gene locus_tag LOCUS_01250 72127 71381 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_01250 73001 72129 gene locus_tag LOCUS_01260 gene sucD 73001 72129 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_01260 73589 73026 gene locus_tag LOCUS_01270 gene efp 73589 73026 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_01270 74379 73594 gene locus_tag LOCUS_01280 gene lpxA 74379 73594 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_01280 75785 74382 gene locus_tag LOCUS_01290 gene fabZ 75785 74382 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_01290 <76400 75782 gene locus_tag LOCUS_01300 <76400 75782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY99:UDP-3-O-acylglucosamine N-acyltransferase >Feature sequence03 96 21 gene locus_tag LOCUS_t00050 96 21 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 167 808 gene locus_tag LOCUS_01310 167 808 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_01310 1075 800 gene locus_tag LOCUS_01320 1075 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 1597 1097 gene locus_tag LOCUS_01330 1597 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 1873 1691 gene locus_tag LOCUS_01340 1873 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 2595 1870 gene locus_tag LOCUS_01350 2595 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 3363 2608 gene locus_tag LOCUS_01360 3363 2608 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ8 protein_id gnl|my_center|LOCUS_01360 4408 3377 gene locus_tag LOCUS_01370 4408 3377 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_01370 4985 4395 gene locus_tag LOCUS_01380 4985 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 5084 6058 gene locus_tag LOCUS_01390 gene ddl 5084 6058 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD5 protein_id gnl|my_center|LOCUS_01390 6080 6535 gene locus_tag LOCUS_01400 gene coaD 6080 6535 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_01400 7124 6528 gene locus_tag LOCUS_01410 7124 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 7137 7772 gene locus_tag LOCUS_01420 gene pyrE 7137 7772 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 protein_id gnl|my_center|LOCUS_01420 8508 7774 gene locus_tag LOCUS_01430 gene birA 8508 7774 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_01430 8548 8919 gene locus_tag LOCUS_01440 gene rsfS 8548 8919 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_01440 8923 10872 gene locus_tag LOCUS_01450 gene ftsH 8923 10872 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_01450 10875 11456 gene locus_tag LOCUS_01460 10875 11456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_01460 11449 12108 gene locus_tag LOCUS_01470 gene cdsA 11449 12108 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 protein_id gnl|my_center|LOCUS_01470 12111 12764 gene locus_tag LOCUS_01480 gene psd 12111 12764 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_01480 15391 12761 gene locus_tag LOCUS_01490 gene valS 15391 12761 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H092 protein_id gnl|my_center|LOCUS_01490 15465 16655 gene locus_tag LOCUS_01500 gene aspC2 15465 16655 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_01500 16663 17673 gene locus_tag LOCUS_01510 gene murB 16663 17673 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_01510 18128 17676 gene locus_tag LOCUS_01520 gene dtd 18128 17676 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 protein_id gnl|my_center|LOCUS_01520 19092 18103 gene locus_tag LOCUS_01530 gene rsgA 19092 18103 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 protein_id gnl|my_center|LOCUS_01530 19138 20658 gene locus_tag LOCUS_01540 gene gpmI 19138 20658 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_01540 20655 21155 gene locus_tag LOCUS_01550 20655 21155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 21158 21967 gene locus_tag LOCUS_01560 gene map 21158 21967 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_01560 21967 22728 gene locus_tag LOCUS_01570 21967 22728 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_01570 23715 22717 gene locus_tag LOCUS_01580 23715 22717 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_01580 25016 23715 gene locus_tag LOCUS_01590 gene nqrF 25016 23715 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_01590 25641 25024 gene locus_tag LOCUS_01600 gene nqrE 25641 25024 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR7 protein_id gnl|my_center|LOCUS_01600 26289 25642 gene locus_tag LOCUS_01610 gene nqrD 26289 25642 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 protein_id gnl|my_center|LOCUS_01610 26998 26282 gene locus_tag LOCUS_01620 gene nqrC 26998 26282 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 protein_id gnl|my_center|LOCUS_01620 28155 26998 gene locus_tag LOCUS_01630 gene nqrB 28155 26998 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K8 protein_id gnl|my_center|LOCUS_01630 29506 28157 gene locus_tag LOCUS_01640 gene nqrA 29506 28157 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_01640 29618 31243 gene locus_tag LOCUS_01650 gene pruA 29618 31243 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_01650 31856 31233 gene locus_tag LOCUS_01660 gene rsmG 31856 31233 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_01660 33031 31853 gene locus_tag LOCUS_01670 gene aspC1 33031 31853 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_01670 34119 33031 gene locus_tag LOCUS_01680 34119 33031 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_01680 34973 34125 gene locus_tag LOCUS_01690 34973 34125 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875617.1 protein_id gnl|my_center|LOCUS_01690 35780 34983 gene locus_tag LOCUS_01700 gene pheA 35780 34983 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_01700 36399 35968 gene locus_tag LOCUS_01710 36399 35968 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403972.1 protein_id gnl|my_center|LOCUS_01710 37375 36404 gene locus_tag LOCUS_01720 gene metX 37375 36404 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW98 protein_id gnl|my_center|LOCUS_01720 38739 37486 gene locus_tag LOCUS_01730 gene metK 38739 37486 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2T6 protein_id gnl|my_center|LOCUS_01730 38933 39535 gene locus_tag LOCUS_01740 38933 39535 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_01740 39614 41737 gene locus_tag LOCUS_01750 gene hppA1 39614 41737 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_01750 42709 41729 gene locus_tag LOCUS_01760 gene pdhB 42709 41729 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_01760 42812 43447 gene locus_tag LOCUS_01770 42812 43447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_01770 43454 44278 gene locus_tag LOCUS_01780 gene thyA 43454 44278 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 protein_id gnl|my_center|LOCUS_01780 44285 44779 gene locus_tag LOCUS_01790 gene dfrA 44285 44779 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_01790 44776 45660 gene locus_tag LOCUS_01800 gene fabD 44776 45660 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_01800 46934 45657 gene locus_tag LOCUS_01810 46934 45657 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918189.1 protein_id gnl|my_center|LOCUS_01810 48108 46972 gene locus_tag LOCUS_01820 gene porR 48108 46972 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_01820 48155 49390 gene locus_tag LOCUS_01830 gene kdtA 48155 49390 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_01830 49418 50506 gene locus_tag LOCUS_01840 49418 50506 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_01840 50503 52116 gene locus_tag LOCUS_01850 50503 52116 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_01850 52202 52120 gene locus_tag LOCUS_t00060 52202 52120 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 52244 53620 gene locus_tag LOCUS_01860 52244 53620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_01860 54181 53621 gene locus_tag LOCUS_01870 gene ruvC 54181 53621 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_01870 54660 54178 gene locus_tag LOCUS_01880 54660 54178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 54696 54893 gene locus_tag LOCUS_01890 54696 54893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 54895 56106 gene locus_tag LOCUS_01900 54895 56106 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263870.1 protein_id gnl|my_center|LOCUS_01900 56125 57045 gene locus_tag LOCUS_01910 gene lipA 56125 57045 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_01910 58067 57042 gene locus_tag LOCUS_01920 gene lpxK 58067 57042 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_01920 58111 58905 gene locus_tag LOCUS_01930 58111 58905 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97JI0 protein_id gnl|my_center|LOCUS_01930 58907 59680 gene locus_tag LOCUS_01940 58907 59680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_01940 60627 59677 gene locus_tag LOCUS_01950 gene aspG 60627 59677 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_01950 61860 60634 gene locus_tag LOCUS_01960 61860 60634 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_01960 62251 61943 gene locus_tag LOCUS_01970 62251 61943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 62958 62305 gene locus_tag LOCUS_01980 62958 62305 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070923.1 protein_id gnl|my_center|LOCUS_01980 63134 63670 gene locus_tag LOCUS_01990 63134 63670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020320.1 protein_id gnl|my_center|LOCUS_01990 63672 64622 gene locus_tag LOCUS_02000 63672 64622 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_02000 64877 66550 gene locus_tag LOCUS_02010 64877 66550 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074413.1 protein_id gnl|my_center|LOCUS_02010 66573 67901 gene locus_tag LOCUS_02020 66573 67901 CDS product putative aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702442.1 protein_id gnl|my_center|LOCUS_02020 68661 67912 gene locus_tag LOCUS_02030 68661 67912 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_02030 70312 68843 gene locus_tag LOCUS_02040 gene yobN 70312 68843 CDS product putative L-amino-acid oxidase YobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34363 protein_id gnl|my_center|LOCUS_02040 70523 71872 gene locus_tag LOCUS_02050 gene arsA 70523 71872 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_02050 71961 73310 gene locus_tag LOCUS_02060 71961 73310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 73312 74391 gene locus_tag LOCUS_02070 73312 74391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 75630 74416 gene locus_tag LOCUS_02080 75630 74416 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064862.1 protein_id gnl|my_center|LOCUS_02080 >Feature sequence04 980 1972 gene locus_tag LOCUS_02090 980 1972 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640575.1 protein_id gnl|my_center|LOCUS_02090 2932 1967 gene locus_tag LOCUS_02100 2932 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 4955 2952 gene locus_tag LOCUS_02110 4955 2952 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692046.1 protein_id gnl|my_center|LOCUS_02110 5850 4936 gene locus_tag LOCUS_02120 5850 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 5983 7467 gene locus_tag LOCUS_02130 gene iolA2 5983 7467 CDS product methylmalonate semialdehyde dehydrogenase [acylating] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HIK3 protein_id gnl|my_center|LOCUS_02130 7484 8803 gene locus_tag LOCUS_02140 7484 8803 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_02140 10574 8805 gene locus_tag LOCUS_02150 gene sglT 10574 8805 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_02150 10613 11266 gene locus_tag LOCUS_02160 10613 11266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 12393 11263 gene locus_tag LOCUS_02170 gene hisC 12393 11263 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185Y8 protein_id gnl|my_center|LOCUS_02170 12463 13809 gene locus_tag LOCUS_02180 12463 13809 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891467.1 protein_id gnl|my_center|LOCUS_02180 15239 13806 gene locus_tag LOCUS_02190 15239 13806 CDS product glutamate carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860725.1 protein_id gnl|my_center|LOCUS_02190 15300 15749 gene locus_tag LOCUS_02200 15300 15749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 16790 15750 gene locus_tag LOCUS_02210 16790 15750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_02210 17832 16783 gene locus_tag LOCUS_02220 17832 16783 CDS product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_02220 18192 17857 gene locus_tag LOCUS_02230 18192 17857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 18295 18792 gene locus_tag LOCUS_02240 18295 18792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 18805 19290 gene locus_tag LOCUS_02250 18805 19290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 19476 20321 gene locus_tag LOCUS_02260 19476 20321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 21386 20472 gene locus_tag LOCUS_02270 21386 20472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 21436 21942 gene locus_tag LOCUS_02280 21436 21942 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986394.1 protein_id gnl|my_center|LOCUS_02280 24119 21939 gene locus_tag LOCUS_02290 gene mrcA 24119 21939 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_02290 25264 24230 gene locus_tag LOCUS_02300 25264 24230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 26648 25317 gene locus_tag LOCUS_02310 26648 25317 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_02310 26703 27701 gene locus_tag LOCUS_02320 gene recA 26703 27701 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_02320 28218 27706 gene locus_tag LOCUS_02330 28218 27706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 28586 29554 gene locus_tag LOCUS_02340 gene trpS 28586 29554 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_02340 29578 30480 gene locus_tag LOCUS_02350 29578 30480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 protein_id gnl|my_center|LOCUS_02350 31698 30484 gene locus_tag LOCUS_02360 31698 30484 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404349.1 protein_id gnl|my_center|LOCUS_02360 32479 31682 gene locus_tag LOCUS_02370 32479 31682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 33485 32466 gene locus_tag LOCUS_02380 33485 32466 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_02380 34436 33543 gene locus_tag LOCUS_02390 gene atpG 34436 33543 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_02390 36011 34437 gene locus_tag LOCUS_02400 gene atpA 36011 34437 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_02400 36560 36021 gene locus_tag LOCUS_02410 gene atpH 36560 36021 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_02410 37063 36563 gene locus_tag LOCUS_02420 gene atpF 37063 36563 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_02420 37273 37079 gene locus_tag LOCUS_02430 37273 37079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 38376 37303 gene locus_tag LOCUS_02440 gene atpB 38376 37303 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_02440 38678 38466 gene locus_tag LOCUS_02450 38678 38466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 39063 38653 gene locus_tag LOCUS_02460 39063 38653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_02460 39154 39435 gene locus_tag LOCUS_02470 39154 39435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 40474 39416 gene locus_tag LOCUS_02480 40474 39416 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964556.1 protein_id gnl|my_center|LOCUS_02480 41084 40455 gene locus_tag LOCUS_02490 41084 40455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_02490 41298 41549 gene locus_tag LOCUS_02500 41298 41549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 42815 41544 gene locus_tag LOCUS_02510 gene purD 42815 41544 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_02510 43752 42817 gene locus_tag LOCUS_02520 43752 42817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 44527 43754 gene locus_tag LOCUS_02530 44527 43754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 46287 44800 gene locus_tag LOCUS_02540 46287 44800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_02540 47149 46292 gene locus_tag LOCUS_02550 47149 46292 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_02550 47248 47433 gene locus_tag LOCUS_02560 47248 47433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 48445 47447 gene locus_tag LOCUS_02570 48445 47447 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_02570 49631 48447 gene locus_tag LOCUS_02580 gene pgk 49631 48447 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_02580 49677 50774 gene locus_tag LOCUS_02590 gene holB 49677 50774 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_02590 51613 50771 gene locus_tag LOCUS_02600 51613 50771 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_02600 53494 51623 gene locus_tag LOCUS_02610 gene mnmG 53494 51623 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_02610 53921 53487 gene locus_tag LOCUS_02620 gene ybeY 53921 53487 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_02620 53994 55448 gene locus_tag LOCUS_02630 gene gltX 53994 55448 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 protein_id gnl|my_center|LOCUS_02630 55514 56440 gene locus_tag LOCUS_02640 55514 56440 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_02640 58121 56469 gene locus_tag LOCUS_02650 gene glnS 58121 56469 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_02650 58235 58534 gene locus_tag LOCUS_02660 58235 58534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 58566 58637 gene locus_tag LOCUS_t00070 58566 58637 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 60795 58636 gene locus_tag LOCUS_02670 gene rnr 60795 58636 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_02670 60923 61123 gene locus_tag LOCUS_02680 60923 61123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 61216 61647 gene locus_tag LOCUS_02690 gene rpiB 61216 61647 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_02690 61648 62118 gene locus_tag LOCUS_02700 61648 62118 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986713.1 protein_id gnl|my_center|LOCUS_02700 63276 62431 gene locus_tag LOCUS_02710 63276 62431 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_02710 64945 63278 gene locus_tag LOCUS_02720 gene lepA 64945 63278 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_02720 65165 66160 gene locus_tag LOCUS_02730 65165 66160 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_02730 67258 66152 gene locus_tag LOCUS_02740 67258 66152 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_02740 68886 67384 gene locus_tag LOCUS_02750 68886 67384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 69107 69883 gene locus_tag LOCUS_02760 69107 69883 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120554.1 protein_id gnl|my_center|LOCUS_02760 71607 69880 gene locus_tag LOCUS_02770 gene typA 71607 69880 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_02770 72976 71753 gene locus_tag LOCUS_02780 gene rhlE 72976 71753 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FY79 protein_id gnl|my_center|LOCUS_02780 73478 73116 gene locus_tag LOCUS_02790 gene rbfA 73478 73116 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 protein_id gnl|my_center|LOCUS_02790 >Feature sequence05 234 863 gene locus_tag LOCUS_02800 gene pnuC 234 863 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_02800 827 1384 gene locus_tag LOCUS_02810 827 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 1435 1704 gene locus_tag LOCUS_02820 1435 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 1756 3948 gene locus_tag LOCUS_02830 1756 3948 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_02830 4013 4486 gene locus_tag LOCUS_02840 gene greA 4013 4486 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_02840 4486 4875 gene locus_tag LOCUS_02850 4486 4875 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_02850 4875 5243 gene locus_tag LOCUS_02860 4875 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_02860 6065 5244 gene locus_tag LOCUS_02870 gene tsf 6065 5244 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_02870 6868 6086 gene locus_tag LOCUS_02880 gene rpsB 6868 6086 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_02880 7258 6872 gene locus_tag LOCUS_02890 gene rpsI 7258 6872 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU3 protein_id gnl|my_center|LOCUS_02890 7713 7258 gene locus_tag LOCUS_02900 gene rplM 7713 7258 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Z6 protein_id gnl|my_center|LOCUS_02900 10577 7788 gene locus_tag LOCUS_02910 gene polA 10577 7788 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_02910 10682 11119 gene locus_tag LOCUS_02920 gene tadA 10682 11119 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_02920 11373 11116 gene locus_tag LOCUS_02930 11373 11116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 13112 11373 gene locus_tag LOCUS_02940 gene aspS 13112 11373 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_02940 16559 13134 gene locus_tag LOCUS_02950 16559 13134 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_02950 17729 16569 gene locus_tag LOCUS_02960 17729 16569 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_02960 19039 17726 gene locus_tag LOCUS_02970 19039 17726 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_02970 19106 20080 gene locus_tag LOCUS_02980 19106 20080 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_02980 20362 20060 gene locus_tag LOCUS_02990 20362 20060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 20478 21293 gene locus_tag LOCUS_03000 20478 21293 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_03000 22340 21297 gene locus_tag LOCUS_03010 gene thiL 22340 21297 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_03010 22481 23926 gene locus_tag LOCUS_03020 gene sufB 22481 23926 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_03020 23937 24686 gene locus_tag LOCUS_03030 gene sufC 23937 24686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_03030 24690 26006 gene locus_tag LOCUS_03040 gene sufD 24690 26006 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_03040 26007 27221 gene locus_tag LOCUS_03050 gene sufS 26007 27221 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_03050 27232 27660 gene locus_tag LOCUS_03060 gene sufE 27232 27660 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_03060 27664 27990 gene locus_tag LOCUS_03070 27664 27990 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_03070 28149 29357 gene locus_tag LOCUS_03080 28149 29357 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_03080 29941 29360 gene locus_tag LOCUS_03090 gene nadD 29941 29360 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_03090 30511 29942 gene locus_tag LOCUS_03100 gene gmk 30511 29942 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A677 protein_id gnl|my_center|LOCUS_03100 31271 30558 gene locus_tag LOCUS_03110 31271 30558 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109262.1 protein_id gnl|my_center|LOCUS_03110 32326 31274 gene locus_tag LOCUS_03120 32326 31274 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919504.1 protein_id gnl|my_center|LOCUS_03120 33471 32329 gene locus_tag LOCUS_03130 33471 32329 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970271.1 protein_id gnl|my_center|LOCUS_03130 34738 33473 gene locus_tag LOCUS_03140 34738 33473 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859148.1 protein_id gnl|my_center|LOCUS_03140 35702 34752 gene locus_tag LOCUS_03150 35702 34752 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_03150 35797 37497 gene locus_tag LOCUS_03160 35797 37497 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_03160 37499 38044 gene locus_tag LOCUS_03170 37499 38044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 38922 38041 gene locus_tag LOCUS_03180 38922 38041 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_03180 39012 40190 gene locus_tag LOCUS_03190 39012 40190 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_03190 40194 40961 gene locus_tag LOCUS_03200 gene lpxH 40194 40961 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_03200 40954 42165 gene locus_tag LOCUS_03210 gene hflX 40954 42165 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 protein_id gnl|my_center|LOCUS_03210 42261 43256 gene locus_tag LOCUS_03220 42261 43256 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_03220 43265 44131 gene locus_tag LOCUS_03230 43265 44131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_03230 44131 45714 gene locus_tag LOCUS_03240 44131 45714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 protein_id gnl|my_center|LOCUS_03240 45711 46718 gene locus_tag LOCUS_03250 gene batA 45711 46718 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_03250 46721 47755 gene locus_tag LOCUS_03260 gene batB 46721 47755 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_03260 47745 48476 gene locus_tag LOCUS_03270 gene batC 47745 48476 CDS product BatC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962308.1 protein_id gnl|my_center|LOCUS_03270 48470 50215 gene locus_tag LOCUS_03280 gene batD 48470 50215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_03280 50219 50965 gene locus_tag LOCUS_03290 gene batE 50219 50965 CDS product BatE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_03290 51455 50958 gene locus_tag LOCUS_03300 51455 50958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 51551 52561 gene locus_tag LOCUS_03310 gene pheS 51551 52561 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_03310 54099 52564 gene locus_tag LOCUS_03320 gene pcd 54099 52564 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_03320 55534 54104 gene locus_tag LOCUS_03330 gene pykA 55534 54104 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_03330 55872 55531 gene locus_tag LOCUS_03340 55872 55531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 57255 56008 gene locus_tag LOCUS_03350 gene fabF 57255 56008 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_03350 57499 57266 gene locus_tag LOCUS_03360 gene acpP 57499 57266 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_03360 57636 58199 gene locus_tag LOCUS_03370 gene purN 57636 58199 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 protein_id gnl|my_center|LOCUS_03370 58201 58677 gene locus_tag LOCUS_03380 gene rnhA 58201 58677 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_03380 58677 59591 gene locus_tag LOCUS_03390 58677 59591 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_03390 59588 61408 gene locus_tag LOCUS_03400 gene purF 59588 61408 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_03400 62156 61551 gene locus_tag LOCUS_03410 gene sodA 62156 61551 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_03410 62240 66199 gene locus_tag LOCUS_03420 62240 66199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 66317 66880 gene locus_tag LOCUS_03430 66317 66880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 68567 66870 gene locus_tag LOCUS_03440 gene metG 68567 66870 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_03440 68641 72960 gene locus_tag LOCUS_03450 gene dnaE 68641 72960 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_03450 73020 73337 gene locus_tag LOCUS_03460 73020 73337 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_03460 73394 73468 gene locus_tag LOCUS_t00080 73394 73468 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence06 807 94 gene locus_tag LOCUS_03470 807 94 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_03470 1967 804 gene locus_tag LOCUS_03480 gene metC 1967 804 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391447.1 protein_id gnl|my_center|LOCUS_03480 2517 1957 gene locus_tag LOCUS_03490 gene bsaA 2517 1957 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH0 protein_id gnl|my_center|LOCUS_03490 3232 2558 gene locus_tag LOCUS_03500 gene tpiA 3232 2558 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI2 protein_id gnl|my_center|LOCUS_03500 3774 3235 gene locus_tag LOCUS_03510 3774 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_03510 3872 4642 gene locus_tag LOCUS_03520 gene folP 3872 4642 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_03520 6403 4634 gene locus_tag LOCUS_03530 6403 4634 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_03530 7158 6391 gene locus_tag LOCUS_03540 gene truA 7158 6391 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_03540 7306 8724 gene locus_tag LOCUS_03550 gene rho 7306 8724 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_03550 9001 8759 gene locus_tag LOCUS_03560 gene rpsT 9001 8759 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_03560 9086 9014 gene locus_tag LOCUS_t00090 9086 9014 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10599 9121 gene locus_tag LOCUS_03570 gene proS 10599 9121 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_03570 10766 11671 gene locus_tag LOCUS_03580 10766 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 11693 13186 gene locus_tag LOCUS_03590 11693 13186 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_03590 13224 13904 gene locus_tag LOCUS_03600 gene folE2 13224 13904 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_03600 13904 15340 gene locus_tag LOCUS_03610 gene cysS 13904 15340 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_03610 15667 16434 gene locus_tag LOCUS_03620 gene lgt 15667 16434 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG9 protein_id gnl|my_center|LOCUS_03620 19363 16427 gene locus_tag LOCUS_03630 gene secDF 19363 16427 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 protein_id gnl|my_center|LOCUS_03630 20358 19423 gene locus_tag LOCUS_03640 gene mdh 20358 19423 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX11 protein_id gnl|my_center|LOCUS_03640 22307 20361 gene locus_tag LOCUS_03650 gene gyrB 22307 20361 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX10 protein_id gnl|my_center|LOCUS_03650 24068 22401 gene locus_tag LOCUS_03660 gene asnB 24068 22401 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_03660 25706 24099 gene locus_tag LOCUS_03670 25706 24099 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_03670 25858 26532 gene locus_tag LOCUS_03680 gene ftsE 25858 26532 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_03680 26564 27364 gene locus_tag LOCUS_03690 26564 27364 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZQ5 protein_id gnl|my_center|LOCUS_03690 27413 27812 gene locus_tag LOCUS_tm00010 27413 27812 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 28017 29885 gene locus_tag LOCUS_03700 28017 29885 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_03700 29906 30133 gene locus_tag LOCUS_03710 29906 30133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 30479 30291 gene locus_tag LOCUS_03720 30479 30291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 31796 30564 gene locus_tag LOCUS_03730 31796 30564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 32787 31906 gene locus_tag LOCUS_03740 32787 31906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 32886 33638 gene locus_tag LOCUS_03750 32886 33638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 33696 34907 gene locus_tag LOCUS_03760 gene mscS2 33696 34907 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_03760 38172 34900 gene locus_tag LOCUS_03770 38172 34900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_03770 39102 38221 gene locus_tag LOCUS_03780 39102 38221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_03780 40042 39131 gene locus_tag LOCUS_03790 40042 39131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_03790 43110 40048 gene locus_tag LOCUS_03800 gene ccsBA 43110 40048 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_03800 43271 43774 gene locus_tag LOCUS_03810 gene kdsC 43271 43774 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_03810 43765 44361 gene locus_tag LOCUS_03820 43765 44361 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R56 protein_id gnl|my_center|LOCUS_03820 45731 44424 gene locus_tag LOCUS_03830 gene murA 45731 44424 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 protein_id gnl|my_center|LOCUS_03830 46366 45731 gene locus_tag LOCUS_03840 46366 45731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_03840 46716 46411 gene locus_tag LOCUS_03850 46716 46411 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_03850 46781 47335 gene locus_tag LOCUS_03860 46781 47335 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_03860 47325 48266 gene locus_tag LOCUS_03870 gene fmt 47325 48266 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIL6 protein_id gnl|my_center|LOCUS_03870 48391 48663 gene locus_tag LOCUS_03880 gene hupB 48391 48663 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_03880 48727 49251 gene locus_tag LOCUS_03890 48727 49251 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_03890 49644 49252 gene locus_tag LOCUS_03900 49644 49252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_03900 49760 49834 gene locus_tag LOCUS_t00100 49760 49834 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 49848 50465 gene locus_tag LOCUS_03910 49848 50465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 51517 50483 gene locus_tag LOCUS_03920 51517 50483 CDS product alkane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 protein_id gnl|my_center|LOCUS_03920 53771 51510 gene locus_tag LOCUS_03930 gene acnA 53771 51510 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_03930 54478 53804 gene locus_tag LOCUS_03940 gene cutC 54478 53804 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJF2 protein_id gnl|my_center|LOCUS_03940 54535 56250 gene locus_tag LOCUS_03950 54535 56250 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_03950 56250 56972 gene locus_tag LOCUS_03960 56250 56972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 57439 57152 gene locus_tag LOCUS_03970 57439 57152 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 protein_id gnl|my_center|LOCUS_03970 57727 57443 gene locus_tag LOCUS_03980 57727 57443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 57792 59471 gene locus_tag LOCUS_03990 57792 59471 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_03990 60612 59464 gene locus_tag LOCUS_04000 60612 59464 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_04000 61857 60616 gene locus_tag LOCUS_04010 gene rocD 61857 60616 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_04010 61915 62382 gene locus_tag LOCUS_04020 61915 62382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 protein_id gnl|my_center|LOCUS_04020 62348 63088 gene locus_tag LOCUS_04030 62348 63088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_04030 63211 63109 gene locus_tag LOCUS_r00010 63211 63109 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence07 965 225 gene locus_tag LOCUS_04040 gene aroE 965 225 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_04040 1860 943 gene locus_tag LOCUS_04050 1860 943 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_04050 3279 1924 gene locus_tag LOCUS_04060 3279 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_04060 4981 3368 gene locus_tag LOCUS_04070 4981 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_04070 6255 4978 gene locus_tag LOCUS_04080 gene purA 6255 4978 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_04080 6743 6258 gene locus_tag LOCUS_04090 gene fur 6743 6258 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_04090 8925 6721 gene locus_tag LOCUS_04100 gene relA 8925 6721 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_04100 10288 8996 gene locus_tag LOCUS_04110 10288 8996 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_04110 13295 10299 gene locus_tag LOCUS_04120 13295 10299 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_04120 14236 13322 gene locus_tag LOCUS_04130 14236 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_04130 15349 14393 gene locus_tag LOCUS_04140 gene ppiC 15349 14393 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_04140 16413 15412 gene locus_tag LOCUS_04150 gene fjo19 16413 15412 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_04150 16525 16923 gene locus_tag LOCUS_04160 gene ndk 16525 16923 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_04160 17227 16916 gene locus_tag LOCUS_04170 17227 16916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 18302 17220 gene locus_tag LOCUS_04180 gene recF 18302 17220 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_04180 18351 19118 gene locus_tag LOCUS_04190 18351 19118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_04190 19121 19594 gene locus_tag LOCUS_04200 gene ribH 19121 19594 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_04200 19595 19885 gene locus_tag LOCUS_04210 19595 19885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 19889 21655 gene locus_tag LOCUS_04220 gene mutL 19889 21655 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_04220 21648 22388 gene locus_tag LOCUS_04230 21648 22388 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_04230 22376 23194 gene locus_tag LOCUS_04240 22376 23194 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963287.1 protein_id gnl|my_center|LOCUS_04240 24896 23172 gene locus_tag LOCUS_04250 gene lepB 24896 23172 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP1 protein_id gnl|my_center|LOCUS_04250 25414 24899 gene locus_tag LOCUS_04260 25414 24899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_04260 26349 25459 gene locus_tag LOCUS_04270 gene parB 26349 25459 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_04270 27118 26342 gene locus_tag LOCUS_04280 gene parA 27118 26342 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_04280 27445 27131 gene locus_tag LOCUS_04290 27445 27131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 28631 27438 gene locus_tag LOCUS_04300 28631 27438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_04300 29743 28667 gene locus_tag LOCUS_04310 29743 28667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 29915 29840 gene locus_tag LOCUS_t00110 29915 29840 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 30909 29983 gene locus_tag LOCUS_04320 gene oxyR 30909 29983 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_04320 31026 31730 gene locus_tag LOCUS_04330 31026 31730 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_04330 32253 31723 gene locus_tag LOCUS_04340 gene sodC 32253 31723 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D0 protein_id gnl|my_center|LOCUS_04340 32377 33408 gene locus_tag LOCUS_04350 32377 33408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 33449 34885 gene locus_tag LOCUS_04360 33449 34885 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109263.1 protein_id gnl|my_center|LOCUS_04360 35322 35675 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccatcaccatcactatcaggacaacca 36265 37341 gene locus_tag LOCUS_04370 gene idh 36265 37341 CDS product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119305.1 protein_id gnl|my_center|LOCUS_04370 37641 38249 gene locus_tag LOCUS_04380 37641 38249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 38262 38783 gene locus_tag LOCUS_04390 38262 38783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 38879 39367 gene locus_tag LOCUS_04400 38879 39367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 40199 39417 gene locus_tag LOCUS_04410 40199 39417 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_04410 40249 41634 gene locus_tag LOCUS_04420 gene nagA 40249 41634 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_04420 41634 42725 gene locus_tag LOCUS_04430 gene galK 41634 42725 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D794 protein_id gnl|my_center|LOCUS_04430 42718 43548 gene locus_tag LOCUS_04440 42718 43548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 43553 44215 gene locus_tag LOCUS_04450 gene msrA 43553 44215 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3M7 protein_id gnl|my_center|LOCUS_04450 44202 44642 gene locus_tag LOCUS_04460 44202 44642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 44642 45154 gene locus_tag LOCUS_04470 44642 45154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 45147 45329 gene locus_tag LOCUS_04480 45147 45329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 45372 45773 gene locus_tag LOCUS_04490 45372 45773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 45773 46531 gene locus_tag LOCUS_04500 45773 46531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 46985 46524 gene locus_tag LOCUS_04510 46985 46524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 47238 47071 gene locus_tag LOCUS_04520 47238 47071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 47442 47370 gene locus_tag LOCUS_t00120 47442 47370 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 47564 48502 gene locus_tag LOCUS_04530 gene yrbG 47564 48502 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_04530 49516 48512 gene locus_tag LOCUS_04540 gene glnII 49516 48512 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_04540 49793 50959 gene locus_tag LOCUS_04550 gene purM 49793 50959 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_04550 50968 52044 gene locus_tag LOCUS_04560 gene prfA 50968 52044 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_04560 52044 52880 gene locus_tag LOCUS_04570 gene pyrF 52044 52880 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_04570 52877 53662 gene locus_tag LOCUS_04580 52877 53662 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 protein_id gnl|my_center|LOCUS_04580 55270 53666 gene locus_tag LOCUS_04590 55270 53666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 55648 55277 gene locus_tag LOCUS_04600 gene crcB 55648 55277 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J1 protein_id gnl|my_center|LOCUS_04600 >Feature sequence08 1184 288 gene locus_tag LOCUS_04610 gene xerD 1184 288 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_04610 1265 1693 gene locus_tag LOCUS_04620 gene aroQ 1265 1693 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_04620 3081 1690 gene locus_tag LOCUS_04630 gene lpdA2 3081 1690 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_04630 3572 3078 gene locus_tag LOCUS_04640 gene mrsB1 3572 3078 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963828.1 protein_id gnl|my_center|LOCUS_04640 3642 4952 gene locus_tag LOCUS_04650 3642 4952 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_04650 5071 7524 gene locus_tag LOCUS_04660 gene lon 5071 7524 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_04660 7540 8196 gene locus_tag LOCUS_04670 gene cmk 7540 8196 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RII8 protein_id gnl|my_center|LOCUS_04670 8257 10125 gene locus_tag LOCUS_04680 gene rpsA 8257 10125 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963900.1 protein_id gnl|my_center|LOCUS_04680 10203 10739 gene locus_tag LOCUS_04690 gene pyrR1 10203 10739 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_04690 10743 11672 gene locus_tag LOCUS_04700 gene pyrB 10743 11672 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_04700 11685 12326 gene locus_tag LOCUS_04710 gene pdxH 11685 12326 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 protein_id gnl|my_center|LOCUS_04710 12328 12816 gene locus_tag LOCUS_04720 12328 12816 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_04720 12806 14848 gene locus_tag LOCUS_04730 gene ppk 12806 14848 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY90 protein_id gnl|my_center|LOCUS_04730 14851 15756 gene locus_tag LOCUS_04740 gene ppx 14851 15756 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_04740 16014 15745 gene locus_tag LOCUS_04750 16014 15745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 17369 16305 gene locus_tag LOCUS_04760 17369 16305 CDS product DNA polymerase III, subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963113.1 protein_id gnl|my_center|LOCUS_04760 18276 17728 gene locus_tag LOCUS_04770 18276 17728 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_04770 18998 18273 gene locus_tag LOCUS_04780 18998 18273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 19638 18982 gene locus_tag LOCUS_04790 19638 18982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 19727 20434 gene locus_tag LOCUS_04800 gene kdsB 19727 20434 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_04800 20431 20958 gene locus_tag LOCUS_04810 20431 20958 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_04810 21330 20962 gene locus_tag LOCUS_04820 21330 20962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 22044 21337 gene locus_tag LOCUS_04830 22044 21337 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_04830 23132 22047 gene locus_tag LOCUS_04840 gene gcvT 23132 22047 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_04840 23228 24616 gene locus_tag LOCUS_04850 23228 24616 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703431.1 protein_id gnl|my_center|LOCUS_04850 25913 24609 gene locus_tag LOCUS_04860 25913 24609 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_04860 26836 25913 gene locus_tag LOCUS_04870 gene thrB 26836 25913 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Q0 protein_id gnl|my_center|LOCUS_04870 29274 26836 gene locus_tag LOCUS_04880 29274 26836 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_04880 31829 29271 gene locus_tag LOCUS_04890 gene clpA 31829 29271 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_04890 32014 34506 gene locus_tag LOCUS_04900 gene gyrA 32014 34506 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_04900 34507 35748 gene locus_tag LOCUS_04910 34507 35748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 35796 35880 gene locus_tag LOCUS_t00130 35796 35880 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 35885 35961 gene locus_tag LOCUS_t00140 35885 35961 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 36047 37531 gene locus_tag LOCUS_04920 36047 37531 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_04920 37653 37850 gene locus_tag LOCUS_04930 37653 37850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 37855 39474 gene locus_tag LOCUS_04940 37855 39474 CDS product N-acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109363.1 protein_id gnl|my_center|LOCUS_04940 39567 40118 gene locus_tag LOCUS_04950 39567 40118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 40120 40569 gene locus_tag LOCUS_04960 40120 40569 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_04960 40579 41556 gene locus_tag LOCUS_04970 40579 41556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_04970 41987 41553 gene locus_tag LOCUS_04980 41987 41553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 42679 41984 gene locus_tag LOCUS_04990 42679 41984 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_04990 43698 42676 gene locus_tag LOCUS_05000 gene tsaD 43698 42676 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_05000 43776 47411 gene locus_tag LOCUS_05010 43776 47411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 47485 48471 gene locus_tag LOCUS_05020 gene pfkA 47485 48471 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_05020 48482 49480 gene locus_tag LOCUS_05030 gene gapA3 48482 49480 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H007 protein_id gnl|my_center|LOCUS_05030 49487 50347 gene locus_tag LOCUS_05040 49487 50347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_05040 50727 50344 gene locus_tag LOCUS_05050 gene yjgF 50727 50344 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_05050 53336 50739 gene locus_tag LOCUS_05060 53336 50739 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence09 528 1052 gene locus_tag LOCUS_05070 528 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 1073 2020 gene locus_tag LOCUS_05080 1073 2020 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_05080 2020 3834 gene locus_tag LOCUS_05090 gene msbA 2020 3834 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_05090 3868 7515 gene locus_tag LOCUS_05100 gene purL 3868 7515 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXH5 protein_id gnl|my_center|LOCUS_05100 7614 9404 gene locus_tag LOCUS_05110 7614 9404 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_05110 9406 10749 gene locus_tag LOCUS_05120 9406 10749 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_05120 11729 10752 gene locus_tag LOCUS_05130 11729 10752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 13020 11734 gene locus_tag LOCUS_05140 13020 11734 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_05140 12977 14137 gene locus_tag LOCUS_05150 12977 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_05150 14152 14580 gene locus_tag LOCUS_05160 14152 14580 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_05160 15485 14610 gene locus_tag LOCUS_05170 gene folD 15485 14610 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 protein_id gnl|my_center|LOCUS_05170 17844 16063 gene locus_tag LOCUS_05180 gene argS 17844 16063 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 protein_id gnl|my_center|LOCUS_05180 19150 17858 gene locus_tag LOCUS_05190 gene gltA 19150 17858 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_05190 20516 19218 gene locus_tag LOCUS_05200 gene eno 20516 19218 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_05200 21617 20526 gene locus_tag LOCUS_05210 gene carA 21617 20526 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_05210 22107 21700 gene locus_tag LOCUS_05220 gene rplQ 22107 21700 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ72 protein_id gnl|my_center|LOCUS_05220 23112 22120 gene locus_tag LOCUS_05230 gene rpoA 23112 22120 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_05230 23725 23120 gene locus_tag LOCUS_05240 gene rpsD 23725 23120 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ74 protein_id gnl|my_center|LOCUS_05240 24123 23740 gene locus_tag LOCUS_05250 gene rpsK 24123 23740 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 protein_id gnl|my_center|LOCUS_05250 24503 24129 gene locus_tag LOCUS_05260 gene rpsM 24503 24129 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ76 protein_id gnl|my_center|LOCUS_05260 24849 24634 gene locus_tag LOCUS_05270 gene infA 24849 24634 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ78 protein_id gnl|my_center|LOCUS_05270 26215 24857 gene locus_tag LOCUS_05280 gene secY 26215 24857 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ79 protein_id gnl|my_center|LOCUS_05280 26670 26218 gene locus_tag LOCUS_05290 gene rplO 26670 26218 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM7 protein_id gnl|my_center|LOCUS_05290 26861 26676 gene locus_tag LOCUS_05300 gene rpmD 26861 26676 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM6 protein_id gnl|my_center|LOCUS_05300 27382 26858 gene locus_tag LOCUS_05310 gene rpsE 27382 26858 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ82 protein_id gnl|my_center|LOCUS_05310 27744 27385 gene locus_tag LOCUS_05320 gene rplR 27744 27385 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ83 protein_id gnl|my_center|LOCUS_05320 28288 27746 gene locus_tag LOCUS_05330 gene rplF 28288 27746 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 protein_id gnl|my_center|LOCUS_05330 28700 28299 gene locus_tag LOCUS_05340 gene rpsH 28700 28299 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_05340 28982 28713 gene locus_tag LOCUS_05350 gene rpsN 28982 28713 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_05350 29536 28985 gene locus_tag LOCUS_05360 gene rplE 29536 28985 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_05360 29850 29539 gene locus_tag LOCUS_05370 gene rplX 29850 29539 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A1W3 protein_id gnl|my_center|LOCUS_05370 30224 29856 gene locus_tag LOCUS_05380 gene rplN 30224 29856 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_05380 30534 30226 gene locus_tag LOCUS_05390 gene rpsQ 30534 30226 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_05390 30726 30535 gene locus_tag LOCUS_05400 gene rpmC 30726 30535 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ91 protein_id gnl|my_center|LOCUS_05400 31149 30733 gene locus_tag LOCUS_05410 gene rplP 31149 30733 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ92 protein_id gnl|my_center|LOCUS_05410 31870 31160 gene locus_tag LOCUS_05420 gene rpsC 31870 31160 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_05420 32272 31871 gene locus_tag LOCUS_05430 gene rplV 32272 31871 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 protein_id gnl|my_center|LOCUS_05430 32561 32292 gene locus_tag LOCUS_05440 gene rpsS 32561 32292 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ95 protein_id gnl|my_center|LOCUS_05440 33392 32568 gene locus_tag LOCUS_05450 gene rplB 33392 32568 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ96 protein_id gnl|my_center|LOCUS_05450 33685 33395 gene locus_tag LOCUS_05460 gene rplW 33685 33395 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ97 protein_id gnl|my_center|LOCUS_05460 34318 33692 gene locus_tag LOCUS_05470 gene rplD 34318 33692 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_05470 34932 34318 gene locus_tag LOCUS_05480 gene rplC 34932 34318 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ99 protein_id gnl|my_center|LOCUS_05480 35248 34943 gene locus_tag LOCUS_05490 gene rpsJ 35248 34943 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_05490 37383 35254 gene locus_tag LOCUS_05500 gene fusA 37383 35254 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 protein_id gnl|my_center|LOCUS_05500 37869 37393 gene locus_tag LOCUS_05510 gene rpsG 37869 37393 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_05510 38252 37866 gene locus_tag LOCUS_05520 gene rpsL 38252 37866 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 protein_id gnl|my_center|LOCUS_05520 39534 38359 gene locus_tag LOCUS_05530 gene mnmA 39534 38359 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_05530 41265 39541 gene locus_tag LOCUS_05540 gene yidC 41265 39541 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U2 protein_id gnl|my_center|LOCUS_05540 42948 41332 gene locus_tag LOCUS_05550 gene pyrG 42948 41332 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_05550 44408 43011 gene locus_tag LOCUS_05560 44408 43011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 44923 44405 gene locus_tag LOCUS_05570 44923 44405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 46591 45062 gene locus_tag LOCUS_05580 gene guaA 46591 45062 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_05580 48211 46613 gene locus_tag LOCUS_05590 gene bshC 48211 46613 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_05590 48267 51392 gene locus_tag LOCUS_05600 48267 51392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence10 1740 130 gene locus_tag LOCUS_05610 gene ggt 1740 130 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021415.1 protein_id gnl|my_center|LOCUS_05610 3215 1791 gene locus_tag LOCUS_05620 3215 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 6429 3220 gene locus_tag LOCUS_05630 6429 3220 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_05630 6507 6701 gene locus_tag LOCUS_05640 6507 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 8096 6696 gene locus_tag LOCUS_05650 8096 6696 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_05650 9752 8157 gene locus_tag LOCUS_05660 9752 8157 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919430.1 protein_id gnl|my_center|LOCUS_05660 11723 9807 gene locus_tag LOCUS_05670 11723 9807 CDS product putative glucosamine-6-phosphate deaminase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB53 protein_id gnl|my_center|LOCUS_05670 11813 12736 gene locus_tag LOCUS_05680 gene trxB1 11813 12736 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_05680 13866 12733 gene locus_tag LOCUS_05690 gene fjo29 13866 12733 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_05690 16313 13863 gene locus_tag LOCUS_05700 gene topA 16313 13863 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_05700 16445 17824 gene locus_tag LOCUS_05710 16445 17824 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_05710 17930 19273 gene locus_tag LOCUS_05720 gene miaB 17930 19273 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_05720 19275 20558 gene locus_tag LOCUS_05730 19275 20558 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_05730 20548 21060 gene locus_tag LOCUS_05740 20548 21060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_05740 21064 21666 gene locus_tag LOCUS_05750 21064 21666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_05750 21737 21994 gene locus_tag LOCUS_05760 21737 21994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 22070 22348 gene locus_tag LOCUS_05770 gene groS 22070 22348 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_05770 22365 24002 gene locus_tag LOCUS_05780 gene groL 22365 24002 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_05780 24074 25570 gene locus_tag LOCUS_05790 gene purH 24074 25570 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_05790 25621 26640 gene locus_tag LOCUS_05800 gene mreB 25621 26640 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_05800 26647 27447 gene locus_tag LOCUS_05810 gene mreC 26647 27447 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 protein_id gnl|my_center|LOCUS_05810 27519 27950 gene locus_tag LOCUS_05820 27519 27950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 27947 29806 gene locus_tag LOCUS_05830 gene pbpA 27947 29806 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_05830 29799 31058 gene locus_tag LOCUS_05840 gene rodA 29799 31058 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_05840 33184 31055 gene locus_tag LOCUS_05850 33184 31055 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_05850 33317 34087 gene locus_tag LOCUS_05860 gene surE 33317 34087 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_05860 34084 35184 gene locus_tag LOCUS_05870 gene lpxB 34084 35184 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_05870 36739 35189 gene locus_tag LOCUS_05880 36739 35189 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764544.1 protein_id gnl|my_center|LOCUS_05880 36818 38128 gene locus_tag LOCUS_05890 gene mvaA 36818 38128 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_05890 38133 39050 gene locus_tag LOCUS_05900 38133 39050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_05900 40803 39022 gene locus_tag LOCUS_05910 40803 39022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 42103 40850 gene locus_tag LOCUS_05920 42103 40850 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_05920 42834 42295 gene locus_tag LOCUS_05930 42834 42295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 44241 42835 gene locus_tag LOCUS_05940 44241 42835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 45512 44241 gene locus_tag LOCUS_05950 45512 44241 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_05950 46234 45512 gene locus_tag LOCUS_05960 gene coaX 46234 45512 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B4 protein_id gnl|my_center|LOCUS_05960 46319 46392 gene locus_tag LOCUS_t00150 46319 46392 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 47563 46424 gene locus_tag LOCUS_05970 47563 46424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 48979 48041 gene locus_tag LOCUS_05980 gene thrB 48979 48041 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AP1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence11 116 34 gene locus_tag LOCUS_t00160 116 34 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 209 135 gene locus_tag LOCUS_t00170 209 135 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1176 289 gene locus_tag LOCUS_05990 gene xerC 1176 289 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_05990 1412 1218 gene locus_tag LOCUS_06000 gene rpsU 1412 1218 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_06000 2958 1456 gene locus_tag LOCUS_06010 gene dagA 2958 1456 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_06010 3179 2961 gene locus_tag LOCUS_06020 3179 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_06020 3497 3183 gene locus_tag LOCUS_06030 3497 3183 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_06030 3700 5103 gene locus_tag LOCUS_06040 gene trpE 3700 5103 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_06040 5100 5666 gene locus_tag LOCUS_06050 gene pabA 5100 5666 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_06050 5663 6655 gene locus_tag LOCUS_06060 gene trpD 5663 6655 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_06060 6652 7443 gene locus_tag LOCUS_06070 gene trpC 6652 7443 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_06070 7433 8047 gene locus_tag LOCUS_06080 gene trpF 7433 8047 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_06080 8044 9225 gene locus_tag LOCUS_06090 gene trpB 8044 9225 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_06090 9225 9989 gene locus_tag LOCUS_06100 gene trpA 9225 9989 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_06100 10477 9986 gene locus_tag LOCUS_06110 10477 9986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 11917 10565 gene locus_tag LOCUS_06120 gene gnd 11917 10565 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CP47 protein_id gnl|my_center|LOCUS_06120 12402 11914 gene locus_tag LOCUS_06130 12402 11914 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QU5 protein_id gnl|my_center|LOCUS_06130 13285 12407 gene locus_tag LOCUS_06140 gene mvaK 13285 12407 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_06140 14357 13275 gene locus_tag LOCUS_06150 gene mvaD 14357 13275 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_06150 15426 14374 gene locus_tag LOCUS_06160 15426 14374 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_06160 15674 15438 gene locus_tag LOCUS_06170 15674 15438 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_06170 16816 15671 gene locus_tag LOCUS_06180 gene mrp 16816 15671 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 protein_id gnl|my_center|LOCUS_06180 17196 16879 gene locus_tag LOCUS_06190 gene ogt2 17196 16879 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_06190 18290 17235 gene locus_tag LOCUS_06200 gene phoR 18290 17235 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_06200 18979 18287 gene locus_tag LOCUS_06210 gene phoP 18979 18287 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_06210 20308 19016 gene locus_tag LOCUS_06220 gene tyrS 20308 19016 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 protein_id gnl|my_center|LOCUS_06220 20645 20319 gene locus_tag LOCUS_06230 20645 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 21982 20642 gene locus_tag LOCUS_06240 gene pyrC1 21982 20642 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_06240 22704 21979 gene locus_tag LOCUS_06250 22704 21979 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_06250 23406 24140 gene locus_tag LOCUS_06260 23406 24140 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_06260 24849 24142 gene locus_tag LOCUS_06270 24849 24142 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_06270 25157 24897 gene locus_tag LOCUS_06280 25157 24897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546808.1 protein_id gnl|my_center|LOCUS_06280 27970 25157 gene locus_tag LOCUS_06290 gene leuS 27970 25157 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H244 protein_id gnl|my_center|LOCUS_06290 28152 28952 gene locus_tag LOCUS_06300 gene ftsX 28152 28952 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_06300 28942 29193 gene locus_tag LOCUS_06310 gene fjo13 28942 29193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_06310 29208 29894 gene locus_tag LOCUS_06320 gene truB 29208 29894 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_06320 29942 30649 gene locus_tag LOCUS_06330 gene pyrH 29942 30649 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_06330 30660 31211 gene locus_tag LOCUS_06340 gene frr 30660 31211 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_06340 31219 32652 gene locus_tag LOCUS_06350 gene asnS 31219 32652 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_06350 32771 34141 gene locus_tag LOCUS_06360 gene rpoN 32771 34141 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_06360 34837 34136 gene locus_tag LOCUS_06370 34837 34136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_06370 35291 34809 gene locus_tag LOCUS_06380 35291 34809 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_06380 35913 35293 gene locus_tag LOCUS_06390 35913 35293 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_06390 36384 35917 gene locus_tag LOCUS_06400 36384 35917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 37213 36413 gene locus_tag LOCUS_06410 37213 36413 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_06410 38703 37294 gene locus_tag LOCUS_06420 gene pqaA 38703 37294 CDS product PhoPQ-activated pathogenicity-related protein PqaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_455941.1 protein_id gnl|my_center|LOCUS_06420 39595 38723 gene locus_tag LOCUS_06430 39595 38723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 42110 39684 gene locus_tag LOCUS_06440 gene celD 42110 39684 CDS product glucan 1,4-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637141.2 protein_id gnl|my_center|LOCUS_06440 42282 42890 gene locus_tag LOCUS_06450 42282 42890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 42887 44218 gene locus_tag LOCUS_06460 42887 44218 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_06460 44491 44402 gene locus_tag LOCUS_t00180 44491 44402 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 45268 44507 gene locus_tag LOCUS_06470 45268 44507 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_06470 46454 45273 gene locus_tag LOCUS_06480 gene sucB 46454 45273 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_06480 >Feature sequence12 <1 516 gene locus_tag LOCUS_06490 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009889166.1:allophanate hydrolase 513 1361 gene locus_tag LOCUS_06500 513 1361 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_06500 2191 1421 gene locus_tag LOCUS_06510 2191 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816329.1 protein_id gnl|my_center|LOCUS_06510 2875 2225 gene locus_tag LOCUS_06520 2875 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 3180 4220 gene locus_tag LOCUS_06530 3180 4220 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_06530 4229 4894 gene locus_tag LOCUS_06540 4229 4894 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_06540 4891 5271 gene locus_tag LOCUS_06550 4891 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 5297 6613 gene locus_tag LOCUS_06560 gene gntM 5297 6613 CDS product idonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174795.1 protein_id gnl|my_center|LOCUS_06560 6624 7088 gene locus_tag LOCUS_06570 6624 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_06570 7089 8201 gene locus_tag LOCUS_06580 7089 8201 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120946.1 protein_id gnl|my_center|LOCUS_06580 8236 9300 gene locus_tag LOCUS_06590 8236 9300 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_06590 10083 9328 gene locus_tag LOCUS_06600 gene madM 10083 9328 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765415.1 protein_id gnl|my_center|LOCUS_06600 10460 10086 gene locus_tag LOCUS_06610 10460 10086 CDS product malonate transporter MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112671.1 protein_id gnl|my_center|LOCUS_06610 11951 10473 gene locus_tag LOCUS_06620 11951 10473 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_06620 12148 12063 gene locus_tag LOCUS_t00190 12148 12063 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12239 13012 gene locus_tag LOCUS_06630 12239 13012 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_06630 14132 13002 gene locus_tag LOCUS_06640 gene ribBA 14132 13002 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_06640 15559 14132 gene locus_tag LOCUS_06650 15559 14132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963702.1 protein_id gnl|my_center|LOCUS_06650 16125 15556 gene locus_tag LOCUS_06660 16125 15556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 18370 16178 gene locus_tag LOCUS_06670 gene ftsK 18370 16178 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_06670 19807 18413 gene locus_tag LOCUS_06680 19807 18413 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_06680 19960 20889 gene locus_tag LOCUS_06690 19960 20889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 20889 22811 gene locus_tag LOCUS_06700 gene dsbD 20889 22811 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_06700 23536 22820 gene locus_tag LOCUS_06710 23536 22820 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107566.1 protein_id gnl|my_center|LOCUS_06710 24918 23539 gene locus_tag LOCUS_06720 gene aldH 24918 23539 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY15 protein_id gnl|my_center|LOCUS_06720 25118 26788 gene locus_tag LOCUS_06730 gene ilvD 25118 26788 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 protein_id gnl|my_center|LOCUS_06730 26790 28487 gene locus_tag LOCUS_06740 gene ilvB 26790 28487 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_06740 28489 29028 gene locus_tag LOCUS_06750 gene ilvH 28489 29028 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_06750 29031 30506 gene locus_tag LOCUS_06760 gene ilvC 29031 30506 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9D5 protein_id gnl|my_center|LOCUS_06760 31679 30615 gene locus_tag LOCUS_06770 gene leuB 31679 30615 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M0 protein_id gnl|my_center|LOCUS_06770 33195 31684 gene locus_tag LOCUS_06780 33195 31684 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_06780 33791 33195 gene locus_tag LOCUS_06790 33791 33195 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_06790 35185 33794 gene locus_tag LOCUS_06800 gene leuC 35185 33794 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QP1 protein_id gnl|my_center|LOCUS_06800 36338 35178 gene locus_tag LOCUS_06810 36338 35178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 36466 38037 gene locus_tag LOCUS_06820 36466 38037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 38686 37994 gene locus_tag LOCUS_06830 38686 37994 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_06830 39503 38688 gene locus_tag LOCUS_06840 gene panB 39503 38688 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_06840 >Feature sequence13 213 692 gene locus_tag LOCUS_06850 213 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 773 1519 gene locus_tag LOCUS_06860 773 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 1507 2784 gene locus_tag LOCUS_06870 gene kynU 1507 2784 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK35 protein_id gnl|my_center|LOCUS_06870 4232 2841 gene locus_tag LOCUS_06880 4232 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 4740 4285 gene locus_tag LOCUS_06890 4740 4285 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_06890 6529 4760 gene locus_tag LOCUS_06900 gene ftsZ 6529 4760 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H191 protein_id gnl|my_center|LOCUS_06900 7824 6541 gene locus_tag LOCUS_06910 gene ftsA 7824 6541 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_06910 8531 7830 gene locus_tag LOCUS_06920 8531 7830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 9855 8515 gene locus_tag LOCUS_06930 gene murC 9855 8515 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_06930 10942 9848 gene locus_tag LOCUS_06940 gene murG 10942 9848 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_06940 12084 10939 gene locus_tag LOCUS_06950 gene ftsW 12084 10939 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_06950 13411 12089 gene locus_tag LOCUS_06960 gene murD 13411 12089 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_06960 14628 13408 gene locus_tag LOCUS_06970 gene mraY 14628 13408 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_06970 16091 14634 gene locus_tag LOCUS_06980 gene murE 16091 14634 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_06980 17881 16088 gene locus_tag LOCUS_06990 gene ftsI 17881 16088 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_06990 18192 17884 gene locus_tag LOCUS_07000 18192 17884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 19082 18189 gene locus_tag LOCUS_07010 gene rsmH 19082 18189 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL4 protein_id gnl|my_center|LOCUS_07010 19539 19072 gene locus_tag LOCUS_07020 gene mraZ 19539 19072 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_07020 19709 20476 gene locus_tag LOCUS_07030 gene pcbD 19709 20476 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_07030 20489 21094 gene locus_tag LOCUS_07040 gene engB 20489 21094 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T4 protein_id gnl|my_center|LOCUS_07040 21426 21097 gene locus_tag LOCUS_07050 gene gldC 21426 21097 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_07050 21480 22265 gene locus_tag LOCUS_07060 gene nadE 21480 22265 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 protein_id gnl|my_center|LOCUS_07060 22290 22934 gene locus_tag LOCUS_07070 gene gacA 22290 22934 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208174.1 protein_id gnl|my_center|LOCUS_07070 24855 22918 gene locus_tag LOCUS_07080 gene dnaG 24855 22918 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_07080 25857 24886 gene locus_tag LOCUS_07090 25857 24886 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_07090 26918 25869 gene locus_tag LOCUS_07100 gene queA 26918 25869 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_07100 28210 26987 gene locus_tag LOCUS_07110 gene aroA 28210 26987 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW83 protein_id gnl|my_center|LOCUS_07110 28539 28210 gene locus_tag LOCUS_07120 28539 28210 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_07120 29548 28550 gene locus_tag LOCUS_07130 gene obg 29548 28550 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB7 protein_id gnl|my_center|LOCUS_07130 30126 29545 gene locus_tag LOCUS_07140 gene adk 30126 29545 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_07140 30205 31353 gene locus_tag LOCUS_07150 gene purK 30205 31353 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_07150 31367 31858 gene locus_tag LOCUS_07160 gene purE 31367 31858 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_07160 32199 31855 gene locus_tag LOCUS_07170 32199 31855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 32270 35098 gene locus_tag LOCUS_07180 gene gcvP 32270 35098 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_07180 35122 36195 gene locus_tag LOCUS_07190 gene fabH1 35122 36195 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_07190 36201 36938 gene locus_tag LOCUS_07200 36201 36938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_07200 36938 37702 gene locus_tag LOCUS_07210 36938 37702 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_07210 38390 37716 gene locus_tag LOCUS_07220 38390 37716 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_07220 <39378 38397 gene locus_tag LOCUS_07230 <39378 38397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZE4:dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex >Feature sequence14 405 223 gene locus_tag LOCUS_07240 gene rpmG 405 223 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_07240 643 407 gene locus_tag LOCUS_07250 gene rpmB 643 407 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_07250 1172 705 gene locus_tag LOCUS_07260 1172 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 1786 1175 gene locus_tag LOCUS_07270 1786 1175 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_07270 2561 1791 gene locus_tag LOCUS_07280 2561 1791 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_07280 3885 2566 gene locus_tag LOCUS_07290 gene bfmBB 3885 2566 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_07290 4539 3919 gene locus_tag LOCUS_07300 gene recR 4539 3919 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_07300 4594 6051 gene locus_tag LOCUS_07310 4594 6051 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_07310 6116 7984 gene locus_tag LOCUS_07320 gene htpG 6116 7984 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_07320 8749 7985 gene locus_tag LOCUS_07330 8749 7985 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_07330 8805 11024 gene locus_tag LOCUS_07340 8805 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 11027 11734 gene locus_tag LOCUS_07350 11027 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963060.1 protein_id gnl|my_center|LOCUS_07350 12149 11742 gene locus_tag LOCUS_07360 gene ygcM 12149 11742 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_07360 12664 12146 gene locus_tag LOCUS_07370 gene idi 12664 12146 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_07370 16986 12679 gene locus_tag LOCUS_07380 gene rpoC 16986 12679 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT9 protein_id gnl|my_center|LOCUS_07380 20822 17010 gene locus_tag LOCUS_07390 gene rpoB 20822 17010 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU0 protein_id gnl|my_center|LOCUS_07390 21291 20911 gene locus_tag LOCUS_07400 gene rplL 21291 20911 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU1 protein_id gnl|my_center|LOCUS_07400 21936 21343 gene locus_tag LOCUS_07410 gene rplJ 21936 21343 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU2 protein_id gnl|my_center|LOCUS_07410 22632 21943 gene locus_tag LOCUS_07420 gene rplA 22632 21943 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU3 protein_id gnl|my_center|LOCUS_07420 23078 22632 gene locus_tag LOCUS_07430 gene rplK 23078 22632 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU4 protein_id gnl|my_center|LOCUS_07430 23636 23085 gene locus_tag LOCUS_07440 gene nusG 23636 23085 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU5 protein_id gnl|my_center|LOCUS_07440 23833 23639 gene locus_tag LOCUS_07450 23833 23639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 23918 23845 gene locus_tag LOCUS_t00200 23918 23845 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 25180 23987 gene locus_tag LOCUS_07460 gene tuf 25180 23987 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU7 protein_id gnl|my_center|LOCUS_07460 25319 25663 gene locus_tag LOCUS_07470 25319 25663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 25707 27266 gene locus_tag LOCUS_07480 25707 27266 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_07480 28315 27272 gene locus_tag LOCUS_07490 gene rlmN 28315 27272 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_07490 28357 29154 gene locus_tag LOCUS_07500 gene dltE 28357 29154 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_07500 29936 29151 gene locus_tag LOCUS_07510 29936 29151 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_07510 30247 29939 gene locus_tag LOCUS_07520 30247 29939 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_07520 31433 30285 gene locus_tag LOCUS_07530 31433 30285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482679.1 protein_id gnl|my_center|LOCUS_07530 32079 31402 gene locus_tag LOCUS_07540 32079 31402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_07540 33229 32096 gene locus_tag LOCUS_07550 33229 32096 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_07550 34536 33313 gene locus_tag LOCUS_07560 34536 33313 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_07560 35282 34533 gene locus_tag LOCUS_07570 35282 34533 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_07570 35379 37067 gene locus_tag LOCUS_07580 gene yidK 35379 37067 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_07580 37162 37353 gene locus_tag LOCUS_07590 37162 37353 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence15 307 504 gene locus_tag LOCUS_07600 307 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 1109 534 gene locus_tag LOCUS_07610 1109 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 2554 1157 gene locus_tag LOCUS_07620 gene mnmE 2554 1157 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_07620 3690 2557 gene locus_tag LOCUS_07630 gene yghO 3690 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_07630 3754 6090 gene locus_tag LOCUS_07640 3754 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 6124 7332 gene locus_tag LOCUS_07650 6124 7332 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_07650 7322 7570 gene locus_tag LOCUS_07660 7322 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 7554 9953 gene locus_tag LOCUS_07670 7554 9953 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_07670 9950 11410 gene locus_tag LOCUS_07680 9950 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 14188 11411 gene locus_tag LOCUS_07690 gene uvrA1 14188 11411 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_07690 14859 14212 gene locus_tag LOCUS_07700 gene nth 14859 14212 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_07700 14887 15339 gene locus_tag LOCUS_07710 14887 15339 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_07710 16770 15340 gene locus_tag LOCUS_07720 16770 15340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_07720 16838 17617 gene locus_tag LOCUS_07730 gene phnP 16838 17617 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_07730 18252 17614 gene locus_tag LOCUS_07740 18252 17614 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_07740 19505 18243 gene locus_tag LOCUS_07750 gene pyrC2 19505 18243 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_07750 20335 19571 gene locus_tag LOCUS_07760 20335 19571 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_07760 20997 20335 gene locus_tag LOCUS_07770 gene lolD 20997 20335 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_07770 21036 21563 gene locus_tag LOCUS_07780 gene mrsA 21036 21563 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB5 protein_id gnl|my_center|LOCUS_07780 22801 21851 gene locus_tag LOCUS_07790 gene serA 22801 21851 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_07790 23874 22798 gene locus_tag LOCUS_07800 gene serC 23874 22798 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 protein_id gnl|my_center|LOCUS_07800 23996 24343 gene locus_tag LOCUS_07810 gene fdx1 23996 24343 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_07810 24348 25439 gene locus_tag LOCUS_07820 gene engD 24348 25439 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC6 protein_id gnl|my_center|LOCUS_07820 25455 27314 gene locus_tag LOCUS_07830 gene parE 25455 27314 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_07830 27315 29396 gene locus_tag LOCUS_07840 27315 29396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 29764 29393 gene locus_tag LOCUS_07850 29764 29393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962882.1 protein_id gnl|my_center|LOCUS_07850 30158 29769 gene locus_tag LOCUS_07860 30158 29769 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_07860 30421 30675 gene locus_tag LOCUS_07870 30421 30675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07870 30675 30866 gene locus_tag LOCUS_07880 30675 30866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07880 31895 30867 gene locus_tag LOCUS_07890 gene aroB 31895 30867 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_07890 31943 33073 gene locus_tag LOCUS_07900 gene putA 31943 33073 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_07900 33360 33070 gene locus_tag LOCUS_07910 33360 33070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 33827 33420 gene locus_tag LOCUS_07920 33827 33420 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence16 723 22 gene locus_tag LOCUS_07930 gene rprY 723 22 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_07930 2275 728 gene locus_tag LOCUS_07940 gene rprX 2275 728 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_07940 2960 2376 gene locus_tag LOCUS_07950 gene coaE 2960 2376 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_07950 3772 2957 gene locus_tag LOCUS_07960 3772 2957 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 protein_id gnl|my_center|LOCUS_07960 5447 3795 gene locus_tag LOCUS_07970 gene recN 5447 3795 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_07970 6640 5432 gene locus_tag LOCUS_07980 gene coaBC 6640 5432 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_07980 6988 6653 gene locus_tag LOCUS_07990 6988 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_07990 7788 7003 gene locus_tag LOCUS_08000 gene bamD 7788 7003 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_08000 9840 7840 gene locus_tag LOCUS_08010 gene ligA 9840 7840 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 protein_id gnl|my_center|LOCUS_08010 10684 9842 gene locus_tag LOCUS_08020 gene prmC 10684 9842 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_08020 11161 10685 gene locus_tag LOCUS_08030 gene yjgM 11161 10685 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_08030 11216 12265 gene locus_tag LOCUS_08040 gene ribD 11216 12265 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_08040 12641 12240 gene locus_tag LOCUS_08050 12641 12240 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_08050 12819 14246 gene locus_tag LOCUS_08060 gene dnaA 12819 14246 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_08060 15285 14251 gene locus_tag LOCUS_08070 gene pabC 15285 14251 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_08070 15800 15282 gene locus_tag LOCUS_08080 15800 15282 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_08080 15864 17012 gene locus_tag LOCUS_08090 15864 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 17012 17689 gene locus_tag LOCUS_08100 gene trmD 17012 17689 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_08100 17753 18097 gene locus_tag LOCUS_08110 gene rplS 17753 18097 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_08110 18107 19339 gene locus_tag LOCUS_08120 gene icd 18107 19339 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R4 protein_id gnl|my_center|LOCUS_08120 19341 20156 gene locus_tag LOCUS_08130 gene murQ 19341 20156 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_08130 20149 20376 gene locus_tag LOCUS_08140 20149 20376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 20400 22349 gene locus_tag LOCUS_08150 gene thrS 20400 22349 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 protein_id gnl|my_center|LOCUS_08150 22928 23125 gene locus_tag LOCUS_08160 gene rpmI 22928 23125 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_08160 23135 23479 gene locus_tag LOCUS_08170 gene rplT 23135 23479 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_08170 23709 26237 gene locus_tag LOCUS_08180 23709 26237 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_08180 26439 27836 gene locus_tag LOCUS_08190 gene fumC 26439 27836 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_08190 27826 28296 gene locus_tag LOCUS_08200 27826 28296 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279106.1 protein_id gnl|my_center|LOCUS_08200 29181 28282 gene locus_tag LOCUS_08210 gene yyaK 29181 28282 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_08210 30518 29181 gene locus_tag LOCUS_08220 30518 29181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 31004 30591 gene locus_tag LOCUS_08230 31004 30591 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence17 726 22 gene locus_tag LOCUS_08240 gene ywaF 726 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25149 protein_id gnl|my_center|LOCUS_08240 1338 787 gene locus_tag LOCUS_08250 1338 787 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693800.1 protein_id gnl|my_center|LOCUS_08250 2251 1325 gene locus_tag LOCUS_08260 2251 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2315 2869 gene locus_tag LOCUS_08270 2315 2869 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_08270 3019 4191 gene locus_tag LOCUS_08280 3019 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 4193 4471 gene locus_tag LOCUS_08290 4193 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 5546 4482 gene locus_tag LOCUS_08300 5546 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405107.1 protein_id gnl|my_center|LOCUS_08300 7565 5547 gene locus_tag LOCUS_08310 7565 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405108.1 protein_id gnl|my_center|LOCUS_08310 7919 7716 gene locus_tag LOCUS_08320 7919 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 7933 8184 gene locus_tag LOCUS_08330 7933 8184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 8264 10609 gene locus_tag LOCUS_08340 8264 10609 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529751.1 protein_id gnl|my_center|LOCUS_08340 11598 10606 gene locus_tag LOCUS_08350 gene iaaA 11598 10606 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_08350 11655 12659 gene locus_tag LOCUS_08360 11655 12659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 12796 13740 gene locus_tag LOCUS_08370 12796 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 13745 14281 gene locus_tag LOCUS_08380 13745 14281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 16976 14403 gene locus_tag LOCUS_08390 gene ppc 16976 14403 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8N7 protein_id gnl|my_center|LOCUS_08390 17090 17659 gene locus_tag LOCUS_08400 17090 17659 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_08400 17670 18041 gene locus_tag LOCUS_08410 17670 18041 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143408.1 protein_id gnl|my_center|LOCUS_08410 18362 18643 gene locus_tag LOCUS_08420 18362 18643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 18731 19183 gene locus_tag LOCUS_08430 18731 19183 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_08430 19180 20043 gene locus_tag LOCUS_08440 19180 20043 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435109.1 protein_id gnl|my_center|LOCUS_08440 20431 20045 gene locus_tag LOCUS_08450 20431 20045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107464.1 protein_id gnl|my_center|LOCUS_08450 21851 20445 gene locus_tag LOCUS_08460 21851 20445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 22128 21832 gene locus_tag LOCUS_08470 gene pcbD 22128 21832 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L66 protein_id gnl|my_center|LOCUS_08470 22386 22823 gene locus_tag LOCUS_08480 22386 22823 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967525.1 protein_id gnl|my_center|LOCUS_08480 22842 23102 gene locus_tag LOCUS_08490 22842 23102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 23402 25447 gene locus_tag LOCUS_08500 gene yyaL 23402 25447 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_08500 25449 25853 gene locus_tag LOCUS_08510 25449 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 26935 25850 gene locus_tag LOCUS_08520 26935 25850 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_08520 29456 26973 gene locus_tag LOCUS_08530 gene chb 29456 26973 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403147.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence18 5 646 gene locus_tag LOCUS_08540 5 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 665 1771 gene locus_tag LOCUS_08550 665 1771 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108338.1 protein_id gnl|my_center|LOCUS_08550 1789 2157 gene locus_tag LOCUS_08560 1789 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 2577 2173 gene locus_tag LOCUS_08570 2577 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 4849 2612 gene locus_tag LOCUS_08580 4849 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_08580 6205 4883 gene locus_tag LOCUS_08590 6205 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 6662 6207 gene locus_tag LOCUS_08600 6662 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 6994 6662 gene locus_tag LOCUS_08610 6994 6662 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_08610 7251 8750 gene locus_tag LOCUS_08620 gene hutH 7251 8750 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4M1 protein_id gnl|my_center|LOCUS_08620 8747 10747 gene locus_tag LOCUS_08630 gene hutU 8747 10747 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_08630 10822 11988 gene locus_tag LOCUS_08640 gene hutI 10822 11988 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_08640 11985 12962 gene locus_tag LOCUS_08650 gene hutG 11985 12962 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI04 protein_id gnl|my_center|LOCUS_08650 13994 13038 gene locus_tag LOCUS_08660 13994 13038 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_08660 14349 14131 gene locus_tag LOCUS_08670 14349 14131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 14440 15648 gene locus_tag LOCUS_08680 gene nifS 14440 15648 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035651.1 protein_id gnl|my_center|LOCUS_08680 15733 16188 gene locus_tag LOCUS_08690 15733 16188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 16492 18723 gene locus_tag LOCUS_08700 16492 18723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_08700 18783 18986 gene locus_tag LOCUS_08710 18783 18986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 19439 18987 gene locus_tag LOCUS_08720 19439 18987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 19702 20199 gene locus_tag LOCUS_08730 19702 20199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 20881 20399 gene locus_tag LOCUS_08740 20881 20399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 20967 21836 gene locus_tag LOCUS_08750 20967 21836 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_08750 22363 21833 gene locus_tag LOCUS_08760 22363 21833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 22950 22363 gene locus_tag LOCUS_08770 22950 22363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 23096 24184 gene locus_tag LOCUS_08780 23096 24184 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_08780 24174 25475 gene locus_tag LOCUS_08790 24174 25475 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461637.1 protein_id gnl|my_center|LOCUS_08790 25604 26911 gene locus_tag LOCUS_08800 25604 26911 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 protein_id gnl|my_center|LOCUS_08800 27870 26908 gene locus_tag LOCUS_08810 27870 26908 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_08810 27922 28392 gene locus_tag LOCUS_08820 27922 28392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263212.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence19 2370 1795 gene locus_tag LOCUS_08830 gene def 2370 1795 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_08830 2780 2373 gene locus_tag LOCUS_08840 2780 2373 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_08840 2674 3390 gene locus_tag LOCUS_08850 2674 3390 CDS product translation factor Sua5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_08850 3387 4808 gene locus_tag LOCUS_08860 gene cca 3387 4808 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_08860 4811 5842 gene locus_tag LOCUS_08870 gene ctaA 4811 5842 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880041.1 protein_id gnl|my_center|LOCUS_08870 5826 6281 gene locus_tag LOCUS_08880 5826 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_08880 6291 8273 gene locus_tag LOCUS_08890 gene uvrB 6291 8273 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY25 protein_id gnl|my_center|LOCUS_08890 8726 8304 gene locus_tag LOCUS_08900 8726 8304 CDS product molecular chaperone Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087408.1 protein_id gnl|my_center|LOCUS_08900 10054 8864 gene locus_tag LOCUS_08910 gene sucC 10054 8864 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_08910 10133 11338 gene locus_tag LOCUS_08920 gene lysA 10133 11338 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL42 protein_id gnl|my_center|LOCUS_08920 11410 12117 gene locus_tag LOCUS_08930 11410 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 12321 15524 gene locus_tag LOCUS_08940 12321 15524 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_08940 15549 17144 gene locus_tag LOCUS_08950 15549 17144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 17158 18030 gene locus_tag LOCUS_08960 17158 18030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 18087 18824 gene locus_tag LOCUS_08970 18087 18824 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_08970 18892 21390 gene locus_tag LOCUS_08980 18892 21390 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_08980 21457 22485 gene locus_tag LOCUS_08990 gene fbaA 21457 22485 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_08990 22497 23360 gene locus_tag LOCUS_09000 gene accD 22497 23360 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_09000 23422 23685 gene locus_tag LOCUS_09010 gene rpsO 23422 23685 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT6 protein_id gnl|my_center|LOCUS_09010 23754 25865 gene locus_tag LOCUS_09020 gene pnp 23754 25865 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H185 protein_id gnl|my_center|LOCUS_09020 25927 26790 gene locus_tag LOCUS_09030 gene rpoD 25927 26790 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_09030 26793 27440 gene locus_tag LOCUS_09040 gene rpe 26793 27440 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_09040 >Feature sequence20 1357 2805 gene locus_tag LOCUS_09050 1357 2805 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_09050 2808 3554 gene locus_tag LOCUS_09060 gene etfB 2808 3554 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_09060 3566 4519 gene locus_tag LOCUS_09070 gene etfA 3566 4519 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_09070 6500 4662 gene locus_tag LOCUS_09080 6500 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 7313 6504 gene locus_tag LOCUS_09090 7313 6504 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_09090 7407 8243 gene locus_tag LOCUS_09100 gene panC 7407 8243 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 protein_id gnl|my_center|LOCUS_09100 8253 9203 gene locus_tag LOCUS_09110 8253 9203 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_09110 9205 10545 gene locus_tag LOCUS_09120 gene gdhA 9205 10545 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_09120 10552 11274 gene locus_tag LOCUS_09130 10552 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 11258 13744 gene locus_tag LOCUS_09140 11258 13744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_09140 13811 17203 gene locus_tag LOCUS_09150 gene ileS 13811 17203 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_09150 17205 17588 gene locus_tag LOCUS_09160 gene dksA 17205 17588 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_09160 17609 18247 gene locus_tag LOCUS_09170 gene lspA 17609 18247 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_09170 18822 18244 gene locus_tag LOCUS_09180 gene ygfA 18822 18244 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_09180 18871 20601 gene locus_tag LOCUS_09190 gene uvrC 18871 20601 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_09190 20628 21419 gene locus_tag LOCUS_09200 20628 21419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_09200 21421 22644 gene locus_tag LOCUS_09210 21421 22644 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_09210 22644 24200 gene locus_tag LOCUS_09220 gene pgi 22644 24200 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ0 protein_id gnl|my_center|LOCUS_09220 >Feature sequence21 459 76 gene locus_tag LOCUS_09230 459 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1850 510 gene locus_tag LOCUS_09240 1850 510 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119046.1 protein_id gnl|my_center|LOCUS_09240 2581 1862 gene locus_tag LOCUS_09250 2581 1862 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_09250 2895 2599 gene locus_tag LOCUS_09260 2895 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 3056 3727 gene locus_tag LOCUS_09270 3056 3727 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_09270 4425 4006 gene locus_tag LOCUS_09280 4425 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 4675 4496 gene locus_tag LOCUS_09290 4675 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 5647 4733 gene locus_tag LOCUS_09300 5647 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 7434 5806 gene locus_tag LOCUS_09310 gene gatA 7434 5806 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759455.1 protein_id gnl|my_center|LOCUS_09310 8305 7565 gene locus_tag LOCUS_09320 8305 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 8789 8400 gene locus_tag LOCUS_09330 8789 8400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 9485 8799 gene locus_tag LOCUS_09340 9485 8799 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_09340 9646 10218 gene locus_tag LOCUS_09350 9646 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 10377 10547 gene locus_tag LOCUS_09360 10377 10547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 12099 10552 gene locus_tag LOCUS_09370 12099 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 12470 12255 gene locus_tag LOCUS_09380 12470 12255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 12661 12467 gene locus_tag LOCUS_09390 12661 12467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 12738 12917 gene locus_tag LOCUS_09400 12738 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 12966 14615 gene locus_tag LOCUS_09410 12966 14615 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_09410 15601 14825 gene locus_tag LOCUS_09420 15601 14825 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_09420 15833 15594 gene locus_tag LOCUS_09430 15833 15594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 16720 15947 gene locus_tag LOCUS_09440 16720 15947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 19056 16960 gene locus_tag LOCUS_09450 19056 16960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 20374 19235 gene locus_tag LOCUS_09460 gene pbpE 20374 19235 CDS product penicillin-binding protein 4* inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P32959 protein_id gnl|my_center|LOCUS_09460 21288 20371 gene locus_tag LOCUS_09470 21288 20371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEU8 protein_id gnl|my_center|LOCUS_09470 21454 21296 gene locus_tag LOCUS_09480 21454 21296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 <22788 21534 gene locus_tag LOCUS_09490 <22788 21534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122710.1:MFS transporter >Feature sequence22 2233 626 gene locus_tag LOCUS_09500 2233 626 CDS product aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_09500 2364 2921 gene locus_tag LOCUS_09510 2364 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2974 4188 gene locus_tag LOCUS_09520 2974 4188 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_09520 5153 4185 gene locus_tag LOCUS_09530 5153 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003607.1 protein_id gnl|my_center|LOCUS_09530 5372 5175 gene locus_tag LOCUS_09540 5372 5175 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496448.1 protein_id gnl|my_center|LOCUS_09540 6092 5484 gene locus_tag LOCUS_09550 6092 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 6590 6096 gene locus_tag LOCUS_09560 6590 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 7305 6601 gene locus_tag LOCUS_09570 7305 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258597.1 protein_id gnl|my_center|LOCUS_09570 8319 7339 gene locus_tag LOCUS_09580 8319 7339 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121362.1 protein_id gnl|my_center|LOCUS_09580 8399 9148 gene locus_tag LOCUS_09590 8399 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 9192 10340 gene locus_tag LOCUS_09600 9192 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 11314 10466 gene locus_tag LOCUS_09610 gene udp 11314 10466 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_09610 11648 11325 gene locus_tag LOCUS_09620 11648 11325 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963176.1 protein_id gnl|my_center|LOCUS_09620 12598 11648 gene locus_tag LOCUS_09630 12598 11648 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_09630 13185 12598 gene locus_tag LOCUS_09640 gene ribE 13185 12598 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_09640 13228 14238 gene locus_tag LOCUS_09650 gene pdxA 13228 14238 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_09650 14281 14799 gene locus_tag LOCUS_09660 14281 14799 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_09660 14800 14985 gene locus_tag LOCUS_09670 gene rpmF 14800 14985 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_09670 15045 16052 gene locus_tag LOCUS_09680 gene fabH3 15045 16052 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_09680 16065 16544 gene locus_tag LOCUS_09690 gene accB 16065 16544 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_09690 16554 17888 gene locus_tag LOCUS_09700 gene accC 16554 17888 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_09700 18881 17892 gene locus_tag LOCUS_09710 gene asd 18881 17892 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_09710 19468 18878 gene locus_tag LOCUS_09720 gene tdk 19468 18878 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_09720 19540 20220 gene locus_tag LOCUS_09730 gene rsmI 19540 20220 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YL7 protein_id gnl|my_center|LOCUS_09730 20225 21901 gene locus_tag LOCUS_09740 gene recJ 20225 21901 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence23 3715 2036 gene locus_tag LOCUS_09750 3715 2036 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705768.1 protein_id gnl|my_center|LOCUS_09750 3964 4740 gene locus_tag LOCUS_09760 3964 4740 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533327.1 protein_id gnl|my_center|LOCUS_09760 4750 5238 gene locus_tag LOCUS_09770 gene nodN 4750 5238 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086244.1 protein_id gnl|my_center|LOCUS_09770 5272 6456 gene locus_tag LOCUS_09780 gene acd 5272 6456 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_09780 6457 7536 gene locus_tag LOCUS_09790 6457 7536 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267697.1 protein_id gnl|my_center|LOCUS_09790 7654 9168 gene locus_tag LOCUS_09800 gene atpD 7654 9168 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_09800 9169 9444 gene locus_tag LOCUS_09810 9169 9444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_09810 9825 9433 gene locus_tag LOCUS_09820 gene recX 9825 9433 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_09820 11495 9945 gene locus_tag LOCUS_09830 gene cafA 11495 9945 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_09830 12023 11733 gene locus_tag LOCUS_09840 gene hupA 12023 11733 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_09840 12229 12669 gene locus_tag LOCUS_09850 gene ssb 12229 12669 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H058 protein_id gnl|my_center|LOCUS_09850 12970 12722 gene locus_tag LOCUS_09860 12970 12722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 13167 13988 gene locus_tag LOCUS_09870 13167 13988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 13997 14875 gene locus_tag LOCUS_09880 gene fjo11 13997 14875 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_09880 17006 14895 gene locus_tag LOCUS_09890 gene ymxG 17006 14895 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403997.1 protein_id gnl|my_center|LOCUS_09890 18330 17011 gene locus_tag LOCUS_09900 18330 17011 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_09900 18404 19063 gene locus_tag LOCUS_09910 18404 19063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 19074 19937 gene locus_tag LOCUS_09920 gene tesB 19074 19937 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105107.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence24 1967 1314 gene locus_tag LOCUS_09930 1967 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_09930 2028 3107 gene locus_tag LOCUS_09940 2028 3107 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_09940 5217 3100 gene locus_tag LOCUS_09950 5217 3100 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_09950 6245 5235 gene locus_tag LOCUS_09960 gene pyrD 6245 5235 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_09960 6504 6238 gene locus_tag LOCUS_09970 gene yajC 6504 6238 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_09970 6946 6509 gene locus_tag LOCUS_09980 6946 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 7885 6968 gene locus_tag LOCUS_09990 gene nusB 7885 6968 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_09990 7965 9716 gene locus_tag LOCUS_10000 7965 9716 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_10000 9736 10209 gene locus_tag LOCUS_10010 9736 10209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 10220 12724 gene locus_tag LOCUS_10020 10220 12724 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_10020 14647 12725 gene locus_tag LOCUS_10030 gene recQ1 14647 12725 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 protein_id gnl|my_center|LOCUS_10030 14913 15887 gene locus_tag LOCUS_10040 gene kdsD 14913 15887 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_10040 15880 16680 gene locus_tag LOCUS_10050 gene tatC 15880 16680 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_10050 16691 17425 gene locus_tag LOCUS_10060 gene lptB 16691 17425 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence25 932 2218 gene locus_tag LOCUS_10070 932 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 2250 3977 gene locus_tag LOCUS_10080 2250 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_10080 4362 4192 gene locus_tag LOCUS_10090 4362 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 4549 5604 gene locus_tag LOCUS_10100 4549 5604 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181621.1 protein_id gnl|my_center|LOCUS_10100 6874 5642 gene locus_tag LOCUS_10110 6874 5642 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434922.1 protein_id gnl|my_center|LOCUS_10110 6996 7634 gene locus_tag LOCUS_10120 6996 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 7826 7653 gene locus_tag LOCUS_10130 7826 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 7859 9184 gene locus_tag LOCUS_10140 7859 9184 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_10140 9326 9252 gene locus_tag LOCUS_t00210 9326 9252 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 10738 9419 gene locus_tag LOCUS_10150 10738 9419 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A685 protein_id gnl|my_center|LOCUS_10150 10809 11474 gene locus_tag LOCUS_10160 10809 11474 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_10160 11513 11737 gene locus_tag LOCUS_10170 gene feoA 11513 11737 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_10170 11742 13838 gene locus_tag LOCUS_10180 gene feoB 11742 13838 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_10180 15201 13963 gene locus_tag LOCUS_10190 gene pepP 15201 13963 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence26 140 571 gene locus_tag LOCUS_10200 140 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_10200 1627 578 gene locus_tag LOCUS_10210 1627 578 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_10210 1658 2593 gene locus_tag LOCUS_10220 1658 2593 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_10220 2640 3152 gene locus_tag LOCUS_10230 gene grpE 2640 3152 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_10230 3162 4274 gene locus_tag LOCUS_10240 gene dnaJ 3162 4274 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_10240 4298 5461 gene locus_tag LOCUS_10250 4298 5461 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_10250 5464 6849 gene locus_tag LOCUS_10260 5464 6849 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_10260 6853 8244 gene locus_tag LOCUS_10270 gene norM 6853 8244 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_10270 8237 8830 gene locus_tag LOCUS_10280 8237 8830 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_10280 9922 8798 gene locus_tag LOCUS_10290 9922 8798 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_10290 13300 9941 gene locus_tag LOCUS_10300 gene secA 13300 9941 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_10300 13576 13355 gene locus_tag LOCUS_10310 13576 13355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_10310 15204 13633 gene locus_tag LOCUS_10320 gene lnt 15204 13633 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_10320 15320 16060 gene locus_tag LOCUS_10330 gene pssA 15320 16060 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence27 261 2693 gene locus_tag LOCUS_10340 261 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3393 2686 gene locus_tag LOCUS_10350 gene lipB 3393 2686 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_10350 3464 5155 gene locus_tag LOCUS_10360 gene lysS 3464 5155 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 protein_id gnl|my_center|LOCUS_10360 5686 5138 gene locus_tag LOCUS_10370 5686 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 5700 6230 gene locus_tag LOCUS_10380 5700 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_10380 8790 6217 gene locus_tag LOCUS_10390 gene alaS 8790 6217 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 protein_id gnl|my_center|LOCUS_10390 8853 9842 gene locus_tag LOCUS_10400 8853 9842 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_10400 9835 10176 gene locus_tag LOCUS_10410 9835 10176 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_10410 11478 10177 gene locus_tag LOCUS_10420 gene der 11478 10177 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_10420 12383 11493 gene locus_tag LOCUS_10430 gene era 12383 11493 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_10430 12458 12530 gene locus_tag LOCUS_t00220 12458 12530 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15290 12621 gene locus_tag LOCUS_10440 15290 12621 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence28 223 295 gene locus_tag LOCUS_t00230 223 295 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 300 386 gene locus_tag LOCUS_t00240 300 386 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 745 593 gene locus_tag LOCUS_10450 745 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1956 820 gene locus_tag LOCUS_10460 gene prpc 1956 820 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P2G4 protein_id gnl|my_center|LOCUS_10460 2875 1970 gene locus_tag LOCUS_10470 gene prpB 2875 1970 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1ML42 protein_id gnl|my_center|LOCUS_10470 4481 2952 gene locus_tag LOCUS_10480 4481 2952 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390071.1 protein_id gnl|my_center|LOCUS_10480 5215 4667 gene locus_tag LOCUS_10490 gene yfiT 5215 4667 CDS product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 protein_id gnl|my_center|LOCUS_10490 6209 5220 gene locus_tag LOCUS_10500 6209 5220 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 protein_id gnl|my_center|LOCUS_10500 6829 6500 gene locus_tag LOCUS_10510 6829 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 6880 9267 gene locus_tag LOCUS_10520 6880 9267 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_10520 9270 10439 gene locus_tag LOCUS_10530 9270 10439 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_10530 10870 10436 gene locus_tag LOCUS_10540 10870 10436 CDS product SOS-response transcriptional regulator UmuD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202621.1 protein_id gnl|my_center|LOCUS_10540 12134 10875 gene locus_tag LOCUS_10550 gene umuC 12134 10875 CDS product SOS mutagenesis and repair protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_10550 12257 14968 gene locus_tag LOCUS_10560 gene sucA 12257 14968 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_10560 15064 15237 gene locus_tag LOCUS_10570 15064 15237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence29 1346 345 gene locus_tag LOCUS_10580 gene pdhA 1346 345 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_10580 1423 2700 gene locus_tag LOCUS_10590 gene murF 1423 2700 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_10590 4585 2693 gene locus_tag LOCUS_10600 gene acsA 4585 2693 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_10600 6255 4588 gene locus_tag LOCUS_10610 6255 4588 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232332.2 protein_id gnl|my_center|LOCUS_10610 6580 6257 gene locus_tag LOCUS_10620 6580 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 7060 6587 gene locus_tag LOCUS_10630 7060 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 7508 7080 gene locus_tag LOCUS_10640 7508 7080 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788959.1 protein_id gnl|my_center|LOCUS_10640 7742 9226 gene locus_tag LOCUS_10650 gene glpK 7742 9226 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51257 protein_id gnl|my_center|LOCUS_10650 9226 10776 gene locus_tag LOCUS_10660 gene glpA 9226 10776 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404213.1 protein_id gnl|my_center|LOCUS_10660 10773 11516 gene locus_tag LOCUS_10670 gene glpF 10773 11516 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189870.1 protein_id gnl|my_center|LOCUS_10670 11524 12288 gene locus_tag LOCUS_10680 11524 12288 CDS product L-allo-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017148.1 protein_id gnl|my_center|LOCUS_10680 12656 12285 gene locus_tag LOCUS_10690 12656 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 13260 12715 gene locus_tag LOCUS_10700 13260 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 13346 13852 gene locus_tag LOCUS_10710 13346 13852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence30 199 1539 gene locus_tag LOCUS_10720 199 1539 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_10720 1834 1541 gene locus_tag LOCUS_10730 1834 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2419 1904 gene locus_tag LOCUS_10740 2419 1904 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 protein_id gnl|my_center|LOCUS_10740 2739 5588 gene locus_tag LOCUS_10750 gene carB 2739 5588 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_10750 7056 5593 gene locus_tag LOCUS_10760 7056 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 8404 7061 gene locus_tag LOCUS_10770 gene purB 8404 7061 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_10770 9200 8433 gene locus_tag LOCUS_10780 9200 8433 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 protein_id gnl|my_center|LOCUS_10780 9242 11692 gene locus_tag LOCUS_10790 gene priA 9242 11692 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 protein_id gnl|my_center|LOCUS_10790 11772 12113 gene locus_tag LOCUS_10800 gene rpsF 11772 12113 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 protein_id gnl|my_center|LOCUS_10800 12114 12407 gene locus_tag LOCUS_10810 gene rpsR 12114 12407 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_10810 >Feature sequence31 258 467 gene locus_tag LOCUS_10820 258 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 971 1855 gene locus_tag LOCUS_10830 gene mmuM 971 1855 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966620.1 protein_id gnl|my_center|LOCUS_10830 1865 2701 gene locus_tag LOCUS_10840 gene yfhH 1865 2701 CDS product steroid 5-alpha reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905448.1 protein_id gnl|my_center|LOCUS_10840 3780 2698 gene locus_tag LOCUS_10850 3780 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3820 5061 gene locus_tag LOCUS_10860 3820 5061 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405434.1 protein_id gnl|my_center|LOCUS_10860 5313 5080 gene locus_tag LOCUS_10870 5313 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 6075 5362 gene locus_tag LOCUS_10880 6075 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 7264 6068 gene locus_tag LOCUS_10890 gene folC 7264 6068 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_10890 8596 7274 gene locus_tag LOCUS_10900 8596 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883648.1 protein_id gnl|my_center|LOCUS_10900 9306 8608 gene locus_tag LOCUS_10910 9306 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 10413 9355 gene locus_tag LOCUS_10920 10413 9355 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_10920 12403 10418 gene locus_tag LOCUS_10930 12403 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence32 1248 1320 gene locus_tag LOCUS_t00250 1248 1320 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1463 3595 gene locus_tag LOCUS_10940 gene pvdQ 1463 3595 CDS product acyl-homoserine lactone acylase PvdQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV08 protein_id gnl|my_center|LOCUS_10940 4725 3604 gene locus_tag LOCUS_10950 4725 3604 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_10950 7592 4725 gene locus_tag LOCUS_10960 7592 4725 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_10960 8079 7594 gene locus_tag LOCUS_10970 8079 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_10970 8856 8083 gene locus_tag LOCUS_10980 8856 8083 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_10980 9308 8856 gene locus_tag LOCUS_10990 9308 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_10990 10532 9318 gene locus_tag LOCUS_11000 10532 9318 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_11000 11559 10624 gene locus_tag LOCUS_11010 11559 10624 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759761.1 protein_id gnl|my_center|LOCUS_11010 <12525 11616 gene locus_tag LOCUS_11020 <12525 11616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962911.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence33 2191 326 gene locus_tag LOCUS_11030 2191 326 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140180.1 protein_id gnl|my_center|LOCUS_11030 2405 2632 gene locus_tag LOCUS_11040 2405 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 2706 4988 gene locus_tag LOCUS_11050 2706 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_11050 5132 5755 gene locus_tag LOCUS_11060 5132 5755 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_11060 6054 6467 gene locus_tag LOCUS_11070 gene queF 6054 6467 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKP6 protein_id gnl|my_center|LOCUS_11070 6898 6719 gene locus_tag LOCUS_11080 6898 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 7051 8220 gene locus_tag LOCUS_11090 gene metZ 7051 8220 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV5 protein_id gnl|my_center|LOCUS_11090 8222 9226 gene locus_tag LOCUS_11100 8222 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11100 9219 11903 gene locus_tag LOCUS_11110 9219 11903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11110 >Feature sequence34 <1 953 gene locus_tag LOCUS_11120 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117742.1:cysteine proteinase 977 1903 gene locus_tag LOCUS_11130 977 1903 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228724.1 protein_id gnl|my_center|LOCUS_11130 1967 2578 gene locus_tag LOCUS_11140 1967 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_11140 2589 3620 gene locus_tag LOCUS_11150 gene tas 2589 3620 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962241.1 protein_id gnl|my_center|LOCUS_11150 3988 3623 gene locus_tag LOCUS_11160 3988 3623 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 protein_id gnl|my_center|LOCUS_11160 4036 5820 gene locus_tag LOCUS_11170 4036 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11170 5881 6183 gene locus_tag LOCUS_11180 5881 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11180 6278 7048 gene locus_tag LOCUS_11190 6278 7048 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_11190 7052 7999 gene locus_tag LOCUS_11200 7052 7999 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 protein_id gnl|my_center|LOCUS_11200 8116 9240 gene locus_tag LOCUS_11210 8116 9240 CDS product saccharopine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_11210 9247 10380 gene locus_tag LOCUS_11220 9247 10380 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476530.1 protein_id gnl|my_center|LOCUS_11220 10443 11759 gene locus_tag LOCUS_11230 10443 11759 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392414.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence35 232 1593 gene locus_tag LOCUS_11240 gene hisS 232 1593 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H160 protein_id gnl|my_center|LOCUS_11240 2398 1586 gene locus_tag LOCUS_11250 2398 1586 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_11250 3981 2404 gene locus_tag LOCUS_11260 3981 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 4086 7463 gene locus_tag LOCUS_11270 4086 7463 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918005.1 protein_id gnl|my_center|LOCUS_11270 7469 9985 gene locus_tag LOCUS_11280 7469 9985 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence36 2769 208 gene locus_tag LOCUS_11290 gene mutS 2769 208 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWN3 protein_id gnl|my_center|LOCUS_11290 2845 3384 gene locus_tag LOCUS_11300 2845 3384 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_11300 3864 3370 gene locus_tag LOCUS_11310 3864 3370 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783639.1 protein_id gnl|my_center|LOCUS_11310 3880 4584 gene locus_tag LOCUS_11320 3880 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_11320 4588 5274 gene locus_tag LOCUS_11330 4588 5274 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_11330 6033 5266 gene locus_tag LOCUS_11340 6033 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_11340 6091 7590 gene locus_tag LOCUS_11350 6091 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_11350 8816 7587 gene locus_tag LOCUS_11360 gene clpX 8816 7587 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_11360 9476 8823 gene locus_tag LOCUS_11370 gene clpP 9476 8823 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_11370 >Feature sequence37 108 182 gene locus_tag LOCUS_t00260 108 182 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 225 656 gene locus_tag LOCUS_11380 225 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2032 833 gene locus_tag LOCUS_11390 2032 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_11390 2525 2034 gene locus_tag LOCUS_11400 2525 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 3585 2590 gene locus_tag LOCUS_11410 3585 2590 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_11410 3662 4258 gene locus_tag LOCUS_11420 3662 4258 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 protein_id gnl|my_center|LOCUS_11420 4312 5787 gene locus_tag LOCUS_11430 gene guaB 4312 5787 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_11430 5799 6635 gene locus_tag LOCUS_11440 5799 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 6655 7986 gene locus_tag LOCUS_11450 gene surA 6655 7986 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT1 protein_id gnl|my_center|LOCUS_11450 9263 8073 gene locus_tag LOCUS_11460 9263 8073 CDS product L-methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RDT4 protein_id gnl|my_center|LOCUS_11460 >Feature sequence38 225 737 gene locus_tag LOCUS_11470 225 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 776 1951 gene locus_tag LOCUS_11480 gene gcdH 776 1951 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_11480 1969 3603 gene locus_tag LOCUS_11490 1969 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 6092 3744 gene locus_tag LOCUS_11500 6092 3744 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 protein_id gnl|my_center|LOCUS_11500 7012 6110 gene locus_tag LOCUS_11510 7012 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 7087 7743 gene locus_tag LOCUS_11520 7087 7743 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056165.1 protein_id gnl|my_center|LOCUS_11520 7835 7753 gene locus_tag LOCUS_t00270 7835 7753 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence39 189 662 gene locus_tag LOCUS_11530 189 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 665 1738 gene locus_tag LOCUS_11540 665 1738 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640575.1 protein_id gnl|my_center|LOCUS_11540 2698 1733 gene locus_tag LOCUS_11550 2698 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence40 <1 654 gene locus_tag LOCUS_11560 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121855.1:manganese transporter 654 1373 gene locus_tag LOCUS_11570 654 1373 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HH05 protein_id gnl|my_center|LOCUS_11570 1354 2070 gene locus_tag LOCUS_11580 1354 2070 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889166.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence41 191 595 gene locus_tag LOCUS_11590 gene yuxK 191 595 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_11590 553 759 gene locus_tag LOCUS_11600 553 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600