>Feature sequence01 36 1253 gene locus_tag LOCUS_00010 36 1253 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_00010 3679 1328 gene locus_tag LOCUS_00020 3679 1328 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118806.1 protein_id gnl|my_center|LOCUS_00020 3861 5093 gene locus_tag LOCUS_00030 3861 5093 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_00030 5709 5065 gene locus_tag LOCUS_00040 5709 5065 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228785.1 protein_id gnl|my_center|LOCUS_00040 6281 5706 gene locus_tag LOCUS_00050 6281 5706 CDS product HTH-type transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMC3 protein_id gnl|my_center|LOCUS_00050 7000 6281 gene locus_tag LOCUS_00060 7000 6281 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389895.1 protein_id gnl|my_center|LOCUS_00060 7149 7331 gene locus_tag LOCUS_00070 7149 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7350 8315 gene locus_tag LOCUS_00080 7350 8315 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918315.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00080 9431 8352 gene locus_tag LOCUS_00090 9431 8352 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897309.1 protein_id gnl|my_center|LOCUS_00090 9583 10671 gene locus_tag LOCUS_00100 9583 10671 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090622.1 protein_id gnl|my_center|LOCUS_00100 11465 10686 gene locus_tag LOCUS_00110 11465 10686 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726748.1 protein_id gnl|my_center|LOCUS_00110 12455 11568 gene locus_tag LOCUS_00120 12455 11568 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083759.1 protein_id gnl|my_center|LOCUS_00120 12578 12649 gene locus_tag LOCUS_t00010 12578 12649 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13208 12855 gene locus_tag LOCUS_00130 13208 12855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13549 13208 gene locus_tag LOCUS_00140 13549 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14022 13546 gene locus_tag LOCUS_00150 gene mrpE 14022 13546 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 protein_id gnl|my_center|LOCUS_00150 15584 14019 gene locus_tag LOCUS_00160 gene mrpD 15584 14019 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 protein_id gnl|my_center|LOCUS_00160 15979 15581 gene locus_tag LOCUS_00170 15979 15581 CDS product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461653.1 protein_id gnl|my_center|LOCUS_00170 16401 15976 gene locus_tag LOCUS_00180 gene mrpB 16401 15976 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 protein_id gnl|my_center|LOCUS_00180 18890 16398 gene locus_tag LOCUS_00190 gene mrpA 18890 16398 CDS product Na(+)/H(+) antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 protein_id gnl|my_center|LOCUS_00190 19828 18956 gene locus_tag LOCUS_00200 19828 18956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19892 20890 gene locus_tag LOCUS_00210 19892 20890 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 protein_id gnl|my_center|LOCUS_00210 20887 21807 gene locus_tag LOCUS_00220 20887 21807 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709897.1 protein_id gnl|my_center|LOCUS_00220 23784 21817 gene locus_tag LOCUS_00230 23784 21817 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_00230 24724 23807 gene locus_tag LOCUS_00240 24724 23807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26037 24721 gene locus_tag LOCUS_00250 26037 24721 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225697.1 protein_id gnl|my_center|LOCUS_00250 27337 26048 gene locus_tag LOCUS_00260 27337 26048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 27404 28069 gene locus_tag LOCUS_00270 27404 28069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 28093 29433 gene locus_tag LOCUS_00280 gene paaK-2 28093 29433 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CD7 protein_id gnl|my_center|LOCUS_00280 30986 29430 gene locus_tag LOCUS_00290 gene glpA 30986 29430 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D6F1 protein_id gnl|my_center|LOCUS_00290 31132 33369 gene locus_tag LOCUS_00300 31132 33369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33371 36235 gene locus_tag LOCUS_00310 33371 36235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 37347 36256 gene locus_tag LOCUS_00320 37347 36256 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 protein_id gnl|my_center|LOCUS_00320 37627 37427 gene locus_tag LOCUS_00330 37627 37427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38959 37646 gene locus_tag LOCUS_00340 38959 37646 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM66 protein_id gnl|my_center|LOCUS_00340 40015 39569 gene locus_tag LOCUS_00350 gene rplI 40015 39569 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM68 protein_id gnl|my_center|LOCUS_00350 40539 40012 gene locus_tag LOCUS_00360 40539 40012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 41000 40539 gene locus_tag LOCUS_00370 41000 40539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 41383 41018 gene locus_tag LOCUS_00380 gene rpsF 41383 41018 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MB49 protein_id gnl|my_center|LOCUS_00380 42497 41646 gene locus_tag LOCUS_00390 gene panB2 42497 41646 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AMS0 protein_id gnl|my_center|LOCUS_00390 43028 42633 gene locus_tag LOCUS_00400 43028 42633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 44343 43072 gene locus_tag LOCUS_00410 44343 43072 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_00410 45374 44340 gene locus_tag LOCUS_00420 45374 44340 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_00420 45476 46270 gene locus_tag LOCUS_00430 45476 46270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 46267 48264 gene locus_tag LOCUS_00440 46267 48264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 48261 49097 gene locus_tag LOCUS_00450 48261 49097 CDS product DegV domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDL7 protein_id gnl|my_center|LOCUS_00450 49165 49983 gene locus_tag LOCUS_00460 49165 49983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 50080 50565 gene locus_tag LOCUS_00470 50080 50565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 50568 51665 gene locus_tag LOCUS_00480 50568 51665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 51709 52029 gene locus_tag LOCUS_00490 51709 52029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 52070 53026 gene locus_tag LOCUS_00500 gene trxB 52070 53026 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R7I9 protein_id gnl|my_center|LOCUS_00500 53161 53487 gene locus_tag LOCUS_00510 53161 53487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00510 53531 54559 gene locus_tag LOCUS_00520 53531 54559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 55887 54595 gene locus_tag LOCUS_00530 55887 54595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 56077 56457 gene locus_tag LOCUS_00540 56077 56457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 57162 56551 gene locus_tag LOCUS_00550 57162 56551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 58205 57171 gene locus_tag LOCUS_00560 58205 57171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 59501 58209 gene locus_tag LOCUS_00570 59501 58209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 59791 59489 gene locus_tag LOCUS_00580 59791 59489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 59691 60152 gene locus_tag LOCUS_00590 59691 60152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 60256 60122 gene locus_tag LOCUS_00600 gene rpmH 60256 60122 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBK4 protein_id gnl|my_center|LOCUS_00600 60771 62234 gene locus_tag LOCUS_00610 gene dnaA 60771 62234 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49991 protein_id gnl|my_center|LOCUS_00610 62432 63526 gene locus_tag LOCUS_00620 gene dnaN 62432 63526 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27903 protein_id gnl|my_center|LOCUS_00620 63540 64634 gene locus_tag LOCUS_00630 gene recF 63540 64634 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CUZ2 protein_id gnl|my_center|LOCUS_00630 64631 64954 gene locus_tag LOCUS_00640 64631 64954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 65172 67097 gene locus_tag LOCUS_00650 gene gyrB 65172 67097 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CT81 protein_id gnl|my_center|LOCUS_00650 67131 69647 gene locus_tag LOCUS_00660 gene gyrA 67131 69647 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CU92 protein_id gnl|my_center|LOCUS_00660 69784 70065 gene locus_tag LOCUS_00670 69784 70065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 70286 70975 gene locus_tag LOCUS_00680 70286 70975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 71013 71087 gene locus_tag LOCUS_t00020 71013 71087 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 71368 72360 gene locus_tag LOCUS_00690 71368 72360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 72347 72928 gene locus_tag LOCUS_00700 72347 72928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 73736 72963 gene locus_tag LOCUS_00710 73736 72963 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_00710 73904 77473 gene locus_tag LOCUS_00720 73904 77473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 77577 77501 gene locus_tag LOCUS_t00030 77577 77501 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 77724 77631 gene locus_tag LOCUS_t00040 77724 77631 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 77822 77909 gene locus_tag LOCUS_t00050 77822 77909 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 78895 77948 gene locus_tag LOCUS_00730 78895 77948 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_00730 78915 79658 gene locus_tag LOCUS_00740 78915 79658 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224946.1 protein_id gnl|my_center|LOCUS_00740 79703 80854 gene locus_tag LOCUS_00750 79703 80854 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GV3 protein_id gnl|my_center|LOCUS_00750 80876 81622 gene locus_tag LOCUS_00760 80876 81622 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_00760 81659 82645 gene locus_tag LOCUS_00770 81659 82645 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_00770 82656 83702 gene locus_tag LOCUS_00780 82656 83702 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_00780 83810 83725 gene locus_tag LOCUS_t00060 83810 83725 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 83898 84302 gene locus_tag LOCUS_00790 83898 84302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 84331 85212 gene locus_tag LOCUS_00800 84331 85212 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776167.1 protein_id gnl|my_center|LOCUS_00800 85283 87337 gene locus_tag LOCUS_00810 85283 87337 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 protein_id gnl|my_center|LOCUS_00810 87935 87357 gene locus_tag LOCUS_00820 87935 87357 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_00820 88022 88300 gene locus_tag LOCUS_00830 88022 88300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 88669 88418 gene locus_tag LOCUS_00840 88669 88418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 88741 89262 gene locus_tag LOCUS_00850 88741 89262 CDS product doxX subfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896605.1 protein_id gnl|my_center|LOCUS_00850 89263 90351 gene locus_tag LOCUS_00860 89263 90351 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730231.1 protein_id gnl|my_center|LOCUS_00860 90480 91379 gene locus_tag LOCUS_00870 gene aphA 90480 91379 CDS product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112424.1 protein_id gnl|my_center|LOCUS_00870 91784 91395 gene locus_tag LOCUS_00880 gene vapC11 91784 91395 CDS product ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WFA5 protein_id gnl|my_center|LOCUS_00880 91984 91781 gene locus_tag LOCUS_00890 91984 91781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64878 protein_id gnl|my_center|LOCUS_00890 93163 92039 gene locus_tag LOCUS_00900 93163 92039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_00900 93987 93250 gene locus_tag LOCUS_00910 93987 93250 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727098.1 protein_id gnl|my_center|LOCUS_00910 94017 94889 gene locus_tag LOCUS_00920 94017 94889 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_00920 94979 94904 gene locus_tag LOCUS_t00070 94979 94904 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 95004 95486 gene locus_tag LOCUS_00930 95004 95486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 96303 95509 gene locus_tag LOCUS_00940 96303 95509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 96544 96341 gene locus_tag LOCUS_00950 96544 96341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 97704 96559 gene locus_tag LOCUS_00960 gene xseA 97704 96559 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_00960 97597 97875 gene locus_tag LOCUS_00970 97597 97875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 97949 98146 gene locus_tag LOCUS_00980 97949 98146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 98281 98619 gene locus_tag LOCUS_00990 98281 98619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 98616 99425 gene locus_tag LOCUS_01000 gene crt 98616 99425 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_01000 99586 100188 gene locus_tag LOCUS_01010 99586 100188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 100619 100269 gene locus_tag LOCUS_01020 100619 100269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 100667 101059 gene locus_tag LOCUS_01030 100667 101059 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775840.1 protein_id gnl|my_center|LOCUS_01030 101192 101821 gene locus_tag LOCUS_01040 101192 101821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 101931 102725 gene locus_tag LOCUS_01050 101931 102725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_01050 102713 103513 gene locus_tag LOCUS_01060 102713 103513 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_01060 105985 103538 gene locus_tag LOCUS_01070 105985 103538 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975818.1 protein_id gnl|my_center|LOCUS_01070 106168 107538 gene locus_tag LOCUS_01080 gene argD 106168 107538 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226084.1 protein_id gnl|my_center|LOCUS_01080 107549 108442 gene locus_tag LOCUS_01090 107549 108442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 108455 109234 gene locus_tag LOCUS_01100 108455 109234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557414.1 protein_id gnl|my_center|LOCUS_01100 109271 109840 gene locus_tag LOCUS_01110 109271 109840 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110452.1 protein_id gnl|my_center|LOCUS_01110 109884 111401 gene locus_tag LOCUS_01120 109884 111401 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_01120 111415 114216 gene locus_tag LOCUS_01130 111415 114216 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_01130 114614 114525 gene locus_tag LOCUS_t00080 114614 114525 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 115108 114662 gene locus_tag LOCUS_01140 gene tadA 115108 114662 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MGL9 protein_id gnl|my_center|LOCUS_01140 115370 115456 gene locus_tag LOCUS_t00090 115370 115456 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 115518 117296 gene locus_tag LOCUS_01150 115518 117296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 117319 117921 gene locus_tag LOCUS_01160 gene recR 117319 117921 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI4 protein_id gnl|my_center|LOCUS_01160 118208 118624 gene locus_tag LOCUS_01170 gene mceE 118208 118624 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_01170 118684 119532 gene locus_tag LOCUS_01180 118684 119532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 119601 121142 gene locus_tag LOCUS_01190 119601 121142 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 protein_id gnl|my_center|LOCUS_01190 121149 121391 gene locus_tag LOCUS_01200 121149 121391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 122067 121384 gene locus_tag LOCUS_01210 gene aat 122067 121384 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BN2 protein_id gnl|my_center|LOCUS_01210 122800 122105 gene locus_tag LOCUS_01220 122800 122105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 122898 124208 gene locus_tag LOCUS_01230 122898 124208 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI7 protein_id gnl|my_center|LOCUS_01230 124232 125272 gene locus_tag LOCUS_01240 124232 125272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 125276 125986 gene locus_tag LOCUS_01250 125276 125986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 126237 126695 gene locus_tag LOCUS_01260 126237 126695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 126790 127773 gene locus_tag LOCUS_01270 gene asd 126790 127773 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1Z5 protein_id gnl|my_center|LOCUS_01270 128049 127798 gene locus_tag LOCUS_01280 128049 127798 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868393.1 protein_id gnl|my_center|LOCUS_01280 128154 128456 gene locus_tag LOCUS_01290 128154 128456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 129024 128509 gene locus_tag LOCUS_01300 129024 128509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_01300 129928 129032 gene locus_tag LOCUS_01310 129928 129032 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971315.1 protein_id gnl|my_center|LOCUS_01310 129984 131471 gene locus_tag LOCUS_01320 129984 131471 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_01320 131623 131862 gene locus_tag LOCUS_01330 131623 131862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 132006 132797 gene locus_tag LOCUS_01340 132006 132797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 134003 133539 gene locus_tag LOCUS_01350 134003 133539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703277.1 protein_id gnl|my_center|LOCUS_01350 134406 134330 gene locus_tag LOCUS_t00100 134406 134330 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 134810 134445 gene locus_tag LOCUS_01360 134810 134445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 134691 135308 gene locus_tag LOCUS_01370 134691 135308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 135437 136648 gene locus_tag LOCUS_01380 135437 136648 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_01380 136740 137000 gene locus_tag LOCUS_01390 136740 137000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 138746 137025 gene locus_tag LOCUS_01400 138746 137025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 140034 138763 gene locus_tag LOCUS_01410 gene selA 140034 138763 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D9C3 protein_id gnl|my_center|LOCUS_01410 140063 140614 gene locus_tag LOCUS_01420 140063 140614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 141741 140611 gene locus_tag LOCUS_01430 gene mrp 141741 140611 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX37 protein_id gnl|my_center|LOCUS_01430 >Feature sequence02 1764 1072 gene locus_tag LOCUS_01440 gene rplA 1764 1072 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFN6 protein_id gnl|my_center|LOCUS_01440 2329 1901 gene locus_tag LOCUS_01450 gene rplK 2329 1901 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EAK4 protein_id gnl|my_center|LOCUS_01450 3228 2467 gene locus_tag LOCUS_01460 gene nusG 3228 2467 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWV9 protein_id gnl|my_center|LOCUS_01460 3500 3228 gene locus_tag LOCUS_01470 3500 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 3715 3642 gene locus_tag LOCUS_t00110 3715 3642 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4007 3846 gene locus_tag LOCUS_01480 gene rpmG 4007 3846 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35871 protein_id gnl|my_center|LOCUS_01480 4153 4079 gene locus_tag LOCUS_t00120 4153 4079 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4230 4157 gene locus_tag LOCUS_t00130 4230 4157 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4366 4854 gene locus_tag LOCUS_01490 4366 4854 CDS product L-amino acid N-acyltransferase MnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027563.1 protein_id gnl|my_center|LOCUS_01490 5020 4938 gene locus_tag LOCUS_t00140 5020 4938 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5089 5586 gene locus_tag LOCUS_01500 5089 5586 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHA5 protein_id gnl|my_center|LOCUS_01500 6499 5618 gene locus_tag LOCUS_01510 6499 5618 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460068.1 protein_id gnl|my_center|LOCUS_01510 6752 6597 gene locus_tag LOCUS_01520 6752 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 7099 6857 gene locus_tag LOCUS_01530 7099 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 7775 7344 gene locus_tag LOCUS_01540 7775 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 9821 7827 gene locus_tag LOCUS_01550 gene acsA 9821 7827 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X928 protein_id gnl|my_center|LOCUS_01550 10471 9899 gene locus_tag LOCUS_01560 10471 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 11785 10664 gene locus_tag LOCUS_01570 11785 10664 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918379.1 protein_id gnl|my_center|LOCUS_01570 13232 11724 gene locus_tag LOCUS_01580 gene nuoN-1 13232 11724 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_01580 14873 13236 gene locus_tag LOCUS_01590 14873 13236 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_01590 17159 14886 gene locus_tag LOCUS_01600 17159 14886 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_01600 17463 17164 gene locus_tag LOCUS_01610 17463 17164 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902440.1 protein_id gnl|my_center|LOCUS_01610 18012 17467 gene locus_tag LOCUS_01620 18012 17467 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_01620 18515 18009 gene locus_tag LOCUS_01630 gene nuoI2 18515 18009 CDS product NADH-quinone oxidoreductase subunit I 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2V8 protein_id gnl|my_center|LOCUS_01630 19552 18515 gene locus_tag LOCUS_01640 gene nuoH 19552 18515 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2V9 protein_id gnl|my_center|LOCUS_01640 20721 19549 gene locus_tag LOCUS_01650 gene nuoD1 20721 19549 CDS product NADH-quinone oxidoreductase subunit D 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X853 protein_id gnl|my_center|LOCUS_01650 21407 20718 gene locus_tag LOCUS_01660 21407 20718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 21894 21394 gene locus_tag LOCUS_01670 21894 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 22282 21917 gene locus_tag LOCUS_01680 gene nuoA 22282 21917 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814W6 protein_id gnl|my_center|LOCUS_01680 23917 22427 gene locus_tag LOCUS_01690 23917 22427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 25503 23917 gene locus_tag LOCUS_01700 gene nuoM-1 25503 23917 CDS product NADH:ubiquinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_01700 27839 25500 gene locus_tag LOCUS_01710 27839 25500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 28185 27880 gene locus_tag LOCUS_01720 gene nuoK 28185 27880 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWD6 protein_id gnl|my_center|LOCUS_01720 28808 28185 gene locus_tag LOCUS_01730 28808 28185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 29293 28808 gene locus_tag LOCUS_01740 29293 28808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 30654 29431 gene locus_tag LOCUS_01750 30654 29431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 33134 30654 gene locus_tag LOCUS_01760 gene nuoG 33134 30654 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAR0 protein_id gnl|my_center|LOCUS_01760 34573 33131 gene locus_tag LOCUS_01770 34573 33131 CDS product NADH-quinone oxidoreductase, F subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702874.1 protein_id gnl|my_center|LOCUS_01770 35237 34566 gene locus_tag LOCUS_01780 35237 34566 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_01780 36544 35237 gene locus_tag LOCUS_01790 gene nuoD 36544 35237 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MPG7 protein_id gnl|my_center|LOCUS_01790 37056 36556 gene locus_tag LOCUS_01800 37056 36556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 37631 37053 gene locus_tag LOCUS_01810 gene nuoB1 37631 37053 CDS product NADH-quinone oxidoreductase subunit B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAQ5 protein_id gnl|my_center|LOCUS_01810 38137 37658 gene locus_tag LOCUS_01820 38137 37658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 39202 38192 gene locus_tag LOCUS_01830 39202 38192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 40413 39202 gene locus_tag LOCUS_01840 40413 39202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 41311 40439 gene locus_tag LOCUS_01850 41311 40439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 42096 41380 gene locus_tag LOCUS_01860 42096 41380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 42890 42111 gene locus_tag LOCUS_01870 42890 42111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 43356 42940 gene locus_tag LOCUS_01880 43356 42940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 43892 43353 gene locus_tag LOCUS_01890 43892 43353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 44218 44967 gene locus_tag LOCUS_01900 44218 44967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 45012 46301 gene locus_tag LOCUS_01910 45012 46301 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_01910 46301 47875 gene locus_tag LOCUS_01920 gene pgi2 46301 47875 CDS product glucose-6-phosphate isomerase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z523 protein_id gnl|my_center|LOCUS_01920 49150 47891 gene locus_tag LOCUS_01930 gene hemL 49150 47891 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P812 protein_id gnl|my_center|LOCUS_01930 50127 49147 gene locus_tag LOCUS_01940 gene hemB 50127 49147 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYF5 protein_id gnl|my_center|LOCUS_01940 50909 50166 gene locus_tag LOCUS_01950 50909 50166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 51820 50906 gene locus_tag LOCUS_01960 gene hemC 51820 50906 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIS3 protein_id gnl|my_center|LOCUS_01960 53093 51834 gene locus_tag LOCUS_01970 gene hemA 53093 51834 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ25 protein_id gnl|my_center|LOCUS_01970 53908 53222 gene locus_tag LOCUS_01980 gene rex 53908 53222 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WX14 protein_id gnl|my_center|LOCUS_01980 54967 54095 gene locus_tag LOCUS_01990 54967 54095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_01990 55763 54969 gene locus_tag LOCUS_02000 gene proC 55763 54969 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A50 protein_id gnl|my_center|LOCUS_02000 56951 55773 gene locus_tag LOCUS_02010 56951 55773 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405030.1 protein_id gnl|my_center|LOCUS_02010 57580 57104 gene locus_tag LOCUS_02020 57580 57104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 58851 57643 gene locus_tag LOCUS_02030 gene mshA 58851 57643 CDS product D-inositol 3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQZ8 protein_id gnl|my_center|LOCUS_02030 59090 58851 gene locus_tag LOCUS_02040 59090 58851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 59148 59729 gene locus_tag LOCUS_02050 gene gpm 59148 59729 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228468.1 protein_id gnl|my_center|LOCUS_02050 59906 59658 gene locus_tag LOCUS_02060 59906 59658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 60463 59915 gene locus_tag LOCUS_02070 60463 59915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 60532 61764 gene locus_tag LOCUS_02080 60532 61764 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969463.1 protein_id gnl|my_center|LOCUS_02080 63113 61731 gene locus_tag LOCUS_02090 63113 61731 CDS product FAD-linked oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_02090 64105 63086 gene locus_tag LOCUS_02100 64105 63086 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929812.1 protein_id gnl|my_center|LOCUS_02100 65344 64109 gene locus_tag LOCUS_02110 65344 64109 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703853.1 protein_id gnl|my_center|LOCUS_02110 67386 65416 gene locus_tag LOCUS_02120 67386 65416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 67715 67443 gene locus_tag LOCUS_02130 67715 67443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 67600 68484 gene locus_tag LOCUS_02140 67600 68484 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943314.1 protein_id gnl|my_center|LOCUS_02140 68887 68456 gene locus_tag LOCUS_02150 68887 68456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 68847 70040 gene locus_tag LOCUS_02160 68847 70040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 70214 71269 gene locus_tag LOCUS_02170 70214 71269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 72486 71299 gene locus_tag LOCUS_02180 72486 71299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 73404 72574 gene locus_tag LOCUS_02190 73404 72574 CDS product non-ribosomal peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525107.1 protein_id gnl|my_center|LOCUS_02190 74681 73401 gene locus_tag LOCUS_02200 74681 73401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 75807 74674 gene locus_tag LOCUS_02210 gene yeaW 75807 74674 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120432.1 protein_id gnl|my_center|LOCUS_02210 77009 75804 gene locus_tag LOCUS_02220 77009 75804 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_02220 77412 77041 gene locus_tag LOCUS_02230 77412 77041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 78524 77421 gene locus_tag LOCUS_02240 78524 77421 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_02240 78658 79872 gene locus_tag LOCUS_02250 78658 79872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 79915 80802 gene locus_tag LOCUS_02260 79915 80802 CDS product polyamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727102.1 protein_id gnl|my_center|LOCUS_02260 80799 81680 gene locus_tag LOCUS_02270 80799 81680 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714192.1 protein_id gnl|my_center|LOCUS_02270 82820 81708 gene locus_tag LOCUS_02280 82820 81708 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQ83 protein_id gnl|my_center|LOCUS_02280 82845 83471 gene locus_tag LOCUS_02290 82845 83471 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972222.1 protein_id gnl|my_center|LOCUS_02290 84329 83472 gene locus_tag LOCUS_02300 84329 83472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67773 protein_id gnl|my_center|LOCUS_02300 84472 85440 gene locus_tag LOCUS_02310 84472 85440 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405050.1 protein_id gnl|my_center|LOCUS_02310 86028 85483 gene locus_tag LOCUS_02320 86028 85483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090877.1 protein_id gnl|my_center|LOCUS_02320 87131 86025 gene locus_tag LOCUS_02330 87131 86025 CDS product gamma-butyrobetaine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 protein_id gnl|my_center|LOCUS_02330 87495 87214 gene locus_tag LOCUS_02340 87495 87214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726761.1 protein_id gnl|my_center|LOCUS_02340 87521 89725 gene locus_tag LOCUS_02350 87521 89725 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_02350 89722 89928 gene locus_tag LOCUS_02360 89722 89928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 89925 90827 gene locus_tag LOCUS_02370 89925 90827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 91836 90856 gene locus_tag LOCUS_02380 91836 90856 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257279.1 protein_id gnl|my_center|LOCUS_02380 92076 93095 gene locus_tag LOCUS_02390 92076 93095 CDS product aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898118.1 protein_id gnl|my_center|LOCUS_02390 93223 93642 gene locus_tag LOCUS_02400 93223 93642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 93718 94260 gene locus_tag LOCUS_02410 93718 94260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 94679 95332 gene locus_tag LOCUS_02420 94679 95332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 95325 96089 gene locus_tag LOCUS_02430 95325 96089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 96052 96127 gene locus_tag LOCUS_t00150 96052 96127 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 97115 96144 gene locus_tag LOCUS_02440 97115 96144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809641.1 protein_id gnl|my_center|LOCUS_02440 98040 97126 gene locus_tag LOCUS_02450 98040 97126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114464.1 protein_id gnl|my_center|LOCUS_02450 98825 98046 gene locus_tag LOCUS_02460 gene pca 98825 98046 CDS product 3-oxoadipate enol-lactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974484.1 protein_id gnl|my_center|LOCUS_02460 99888 98848 gene locus_tag LOCUS_02470 99888 98848 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_02470 100277 99897 gene locus_tag LOCUS_02480 100277 99897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 101170 100274 gene locus_tag LOCUS_02490 101170 100274 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229859.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02490 101584 102255 gene locus_tag LOCUS_02500 101584 102255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 102764 102252 gene locus_tag LOCUS_02510 102764 102252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 102810 103088 gene locus_tag LOCUS_02520 102810 103088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 103548 103111 gene locus_tag LOCUS_02530 gene dut 103548 103111 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2A4 protein_id gnl|my_center|LOCUS_02530 103615 104160 gene locus_tag LOCUS_02540 gene orn 103615 104160 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NG99 protein_id gnl|my_center|LOCUS_02540 104236 105339 gene locus_tag LOCUS_02550 104236 105339 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390379.1 protein_id gnl|my_center|LOCUS_02550 105412 105669 gene locus_tag LOCUS_02560 105412 105669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 105800 106135 gene locus_tag LOCUS_02570 105800 106135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 106317 106775 gene locus_tag LOCUS_02580 106317 106775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 106867 107961 gene locus_tag LOCUS_02590 106867 107961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705002.1 protein_id gnl|my_center|LOCUS_02590 107958 108608 gene locus_tag LOCUS_02600 107958 108608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 108807 109349 gene locus_tag LOCUS_02610 108807 109349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 109346 109741 gene locus_tag LOCUS_02620 109346 109741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 109810 111462 gene locus_tag LOCUS_02630 109810 111462 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728248.1 protein_id gnl|my_center|LOCUS_02630 112795 111488 gene locus_tag LOCUS_02640 gene serS 112795 111488 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66647 protein_id gnl|my_center|LOCUS_02640 113877 113038 gene locus_tag LOCUS_02650 113877 113038 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977616.1 protein_id gnl|my_center|LOCUS_02650 114263 113943 gene locus_tag LOCUS_02660 114263 113943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 114928 114281 gene locus_tag LOCUS_02670 114928 114281 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531504.1 protein_id gnl|my_center|LOCUS_02670 116921 114921 gene locus_tag LOCUS_02680 116921 114921 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819N3 protein_id gnl|my_center|LOCUS_02680 118200 116983 gene locus_tag LOCUS_02690 118200 116983 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLI2 protein_id gnl|my_center|LOCUS_02690 118991 118200 gene locus_tag LOCUS_02700 118991 118200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 119615 119022 gene locus_tag LOCUS_02710 119615 119022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 121210 119615 gene locus_tag LOCUS_02720 121210 119615 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDZ6 protein_id gnl|my_center|LOCUS_02720 122334 121450 gene locus_tag LOCUS_02730 gene ctaB 122334 121450 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MCQ0 protein_id gnl|my_center|LOCUS_02730 122324 122713 gene locus_tag LOCUS_02740 122324 122713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 123590 122748 gene locus_tag LOCUS_02750 123590 122748 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_02750 >Feature sequence03 243 509 gene locus_tag LOCUS_02760 243 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 538 951 gene locus_tag LOCUS_02770 538 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 986 3847 gene locus_tag LOCUS_02780 986 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 3819 5153 gene locus_tag LOCUS_02790 3819 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_02790 5356 5150 gene locus_tag LOCUS_02800 5356 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 5255 6658 gene locus_tag LOCUS_02810 gene leuC 5255 6658 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QUY9 protein_id gnl|my_center|LOCUS_02810 6671 7264 gene locus_tag LOCUS_02820 gene leuD 6671 7264 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86535 protein_id gnl|my_center|LOCUS_02820 7345 9828 gene locus_tag LOCUS_02830 7345 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 10284 10832 gene locus_tag LOCUS_02840 10284 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 12380 10833 gene locus_tag LOCUS_02850 gene leuA 12380 10833 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG97 protein_id gnl|my_center|LOCUS_02850 14232 12664 gene locus_tag LOCUS_02860 14232 12664 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z564 protein_id gnl|my_center|LOCUS_02860 16172 14274 gene locus_tag LOCUS_02870 16172 14274 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_02870 17376 16177 gene locus_tag LOCUS_02880 17376 16177 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0L5 protein_id gnl|my_center|LOCUS_02880 19003 17468 gene locus_tag LOCUS_02890 19003 17468 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728258.1 protein_id gnl|my_center|LOCUS_02890 19410 19024 gene locus_tag LOCUS_02900 19410 19024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 20526 19453 gene locus_tag LOCUS_02910 20526 19453 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090622.1 protein_id gnl|my_center|LOCUS_02910 21310 20609 gene locus_tag LOCUS_02920 gene hlyI 21310 20609 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229810.1 protein_id gnl|my_center|LOCUS_02920 21670 21374 gene locus_tag LOCUS_02930 21670 21374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 22341 21667 gene locus_tag LOCUS_02940 22341 21667 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973261.1 protein_id gnl|my_center|LOCUS_02940 22868 22338 gene locus_tag LOCUS_02950 gene ptpA 22868 22338 CDS product putative low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIA1 protein_id gnl|my_center|LOCUS_02950 23521 22865 gene locus_tag LOCUS_02960 23521 22865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 24583 23561 gene locus_tag LOCUS_02970 24583 23561 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225246.1 protein_id gnl|my_center|LOCUS_02970 25758 24598 gene locus_tag LOCUS_02980 25758 24598 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_02980 26840 25761 gene locus_tag LOCUS_02990 26840 25761 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225238.1 protein_id gnl|my_center|LOCUS_02990 27630 26863 gene locus_tag LOCUS_03000 27630 26863 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_03000 28505 27627 gene locus_tag LOCUS_03010 28505 27627 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_03010 28657 29457 gene locus_tag LOCUS_03020 28657 29457 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701359.1 protein_id gnl|my_center|LOCUS_03020 29466 29978 gene locus_tag LOCUS_03030 29466 29978 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570773.1 protein_id gnl|my_center|LOCUS_03030 30238 29975 gene locus_tag LOCUS_03040 30238 29975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 30415 31113 gene locus_tag LOCUS_03050 gene cysH 30415 31113 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADG3 protein_id gnl|my_center|LOCUS_03050 31110 31769 gene locus_tag LOCUS_03060 31110 31769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 31766 32560 gene locus_tag LOCUS_03070 31766 32560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 32548 34338 gene locus_tag LOCUS_03080 32548 34338 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_03080 34399 35352 gene locus_tag LOCUS_03090 34399 35352 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_03090 36136 35360 gene locus_tag LOCUS_03100 gene fabG 36136 35360 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_03100 37056 36133 gene locus_tag LOCUS_03110 37056 36133 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 protein_id gnl|my_center|LOCUS_03110 37172 37993 gene locus_tag LOCUS_03120 37172 37993 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730131.1 protein_id gnl|my_center|LOCUS_03120 38783 38010 gene locus_tag LOCUS_03130 38783 38010 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701581.1 protein_id gnl|my_center|LOCUS_03130 39894 38785 gene locus_tag LOCUS_03140 39894 38785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704906.1 protein_id gnl|my_center|LOCUS_03140 40305 39952 gene locus_tag LOCUS_03150 40305 39952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 40411 41325 gene locus_tag LOCUS_03160 40411 41325 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939109.1 protein_id gnl|my_center|LOCUS_03160 42589 41339 gene locus_tag LOCUS_03170 42589 41339 CDS product linalool 8-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_03170 42658 43098 gene locus_tag LOCUS_03180 42658 43098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893800.1 protein_id gnl|my_center|LOCUS_03180 43176 44363 gene locus_tag LOCUS_03190 43176 44363 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815840.1 protein_id gnl|my_center|LOCUS_03190 44360 45115 gene locus_tag LOCUS_03200 44360 45115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 45141 47402 gene locus_tag LOCUS_03210 45141 47402 CDS product magnesium-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028834.1 protein_id gnl|my_center|LOCUS_03210 47500 48768 gene locus_tag LOCUS_03220 gene gdhA 47500 48768 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96110 protein_id gnl|my_center|LOCUS_03220 48807 49460 gene locus_tag LOCUS_03230 48807 49460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 49457 50233 gene locus_tag LOCUS_03240 49457 50233 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084226.1 protein_id gnl|my_center|LOCUS_03240 50641 50270 gene locus_tag LOCUS_03250 50641 50270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 50841 51899 gene locus_tag LOCUS_03260 50841 51899 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726789.1 protein_id gnl|my_center|LOCUS_03260 53109 51904 gene locus_tag LOCUS_03270 gene mct 53109 51904 CDS product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC36 protein_id gnl|my_center|LOCUS_03270 53393 53115 gene locus_tag LOCUS_03280 53393 53115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 53582 53451 gene locus_tag LOCUS_03290 53582 53451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03290 56604 53650 gene locus_tag LOCUS_03300 56604 53650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 57023 56589 gene locus_tag LOCUS_03310 57023 56589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 58483 57020 gene locus_tag LOCUS_03320 58483 57020 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_03320 58569 59225 gene locus_tag LOCUS_03330 58569 59225 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087781.1 protein_id gnl|my_center|LOCUS_03330 59352 60554 gene locus_tag LOCUS_03340 59352 60554 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730434.1 protein_id gnl|my_center|LOCUS_03340 60691 61359 gene locus_tag LOCUS_03350 60691 61359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 62424 61393 gene locus_tag LOCUS_03360 gene ilvC 62424 61393 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS6 protein_id gnl|my_center|LOCUS_03360 62990 62481 gene locus_tag LOCUS_03370 gene ilvH 62990 62481 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_03370 64729 62987 gene locus_tag LOCUS_03380 64729 62987 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z567 protein_id gnl|my_center|LOCUS_03380 66667 64964 gene locus_tag LOCUS_03390 gene ilvD 66667 64964 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06069 protein_id gnl|my_center|LOCUS_03390 66727 68031 gene locus_tag LOCUS_03400 66727 68031 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029304.1 protein_id gnl|my_center|LOCUS_03400 68833 68051 gene locus_tag LOCUS_03410 68833 68051 CDS product putative aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703644.1 protein_id gnl|my_center|LOCUS_03410 70281 68836 gene locus_tag LOCUS_03420 gene gatB 70281 68836 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZH0 protein_id gnl|my_center|LOCUS_03420 71720 70278 gene locus_tag LOCUS_03430 gene gatA 71720 70278 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDP7 protein_id gnl|my_center|LOCUS_03430 72046 71717 gene locus_tag LOCUS_03440 72046 71717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 74002 72077 gene locus_tag LOCUS_03450 gene pknB 74002 72077 CDS product serine/threonine-protein kinase PknB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNG1 protein_id gnl|my_center|LOCUS_03450 74032 74469 gene locus_tag LOCUS_03460 74032 74469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 76545 74488 gene locus_tag LOCUS_03470 gene ligA 76545 74488 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCA1 protein_id gnl|my_center|LOCUS_03470 76651 77496 gene locus_tag LOCUS_03480 76651 77496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 78527 77493 gene locus_tag LOCUS_03490 gene mnmA 78527 77493 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFH2 protein_id gnl|my_center|LOCUS_03490 79660 78524 gene locus_tag LOCUS_03500 79660 78524 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728292.1 protein_id gnl|my_center|LOCUS_03500 79690 80469 gene locus_tag LOCUS_03510 79690 80469 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804409.1 protein_id gnl|my_center|LOCUS_03510 81198 80512 gene locus_tag LOCUS_03520 81198 80512 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228584.1 protein_id gnl|my_center|LOCUS_03520 81250 82035 gene locus_tag LOCUS_03530 81250 82035 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_03530 83148 82231 gene locus_tag LOCUS_03540 83148 82231 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_03540 83840 83190 gene locus_tag LOCUS_03550 83840 83190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 84662 83874 gene locus_tag LOCUS_03560 84662 83874 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_03560 85009 84707 gene locus_tag LOCUS_03570 85009 84707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 85070 85216 gene locus_tag LOCUS_03580 85070 85216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 86486 85221 gene locus_tag LOCUS_03590 gene murA 86486 85221 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DH73 protein_id gnl|my_center|LOCUS_03590 86558 88048 gene locus_tag LOCUS_03600 86558 88048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 88625 88065 gene locus_tag LOCUS_03610 88625 88065 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 protein_id gnl|my_center|LOCUS_03610 88702 89703 gene locus_tag LOCUS_03620 88702 89703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 89731 90351 gene locus_tag LOCUS_03630 89731 90351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 91162 90374 gene locus_tag LOCUS_03640 91162 90374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 91264 92265 gene locus_tag LOCUS_03650 gene glpX 91264 92265 CDS product fructose-1,6-bisphosphatase class 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN21 protein_id gnl|my_center|LOCUS_03650 92835 92311 gene locus_tag LOCUS_03660 92835 92311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 93287 92895 gene locus_tag LOCUS_03670 93287 92895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 93735 93337 gene locus_tag LOCUS_03680 93735 93337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 95165 93744 gene locus_tag LOCUS_03690 gene atpD 95165 93744 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DH77 protein_id gnl|my_center|LOCUS_03690 96143 95208 gene locus_tag LOCUS_03700 gene atpG 96143 95208 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R201 protein_id gnl|my_center|LOCUS_03700 97850 96222 gene locus_tag LOCUS_03710 gene atpA 97850 96222 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R202 protein_id gnl|my_center|LOCUS_03710 98411 97881 gene locus_tag LOCUS_03720 gene atpH 98411 97881 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWL8 protein_id gnl|my_center|LOCUS_03720 99114 98404 gene locus_tag LOCUS_03730 99114 98404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 99403 99146 gene locus_tag LOCUS_03740 99403 99146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 100270 99503 gene locus_tag LOCUS_03750 gene atpB 100270 99503 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDS8 protein_id gnl|my_center|LOCUS_03750 100767 100279 gene locus_tag LOCUS_03760 100767 100279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 101036 100764 gene locus_tag LOCUS_03770 101036 100764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 102375 101188 gene locus_tag LOCUS_03780 102375 101188 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775946.1 protein_id gnl|my_center|LOCUS_03780 103703 102459 gene locus_tag LOCUS_03790 gene glyA 103703 102459 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814V2 protein_id gnl|my_center|LOCUS_03790 >Feature sequence04 1481 252 gene locus_tag LOCUS_03800 1481 252 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_03800 4825 1550 gene locus_tag LOCUS_03810 gene dnaE2 4825 1550 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TWL9 protein_id gnl|my_center|LOCUS_03810 5858 4878 gene locus_tag LOCUS_03820 5858 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 6082 7473 gene locus_tag LOCUS_03830 6082 7473 CDS product pyridoxal-5'-phosphate-dependent protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_03830 7470 8660 gene locus_tag LOCUS_03840 7470 8660 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902360.1 protein_id gnl|my_center|LOCUS_03840 9589 8657 gene locus_tag LOCUS_03850 9589 8657 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564218.1 protein_id gnl|my_center|LOCUS_03850 10692 9586 gene locus_tag LOCUS_03860 10692 9586 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_03860 12206 10689 gene locus_tag LOCUS_03870 12206 10689 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_03870 13362 12265 gene locus_tag LOCUS_03880 13362 12265 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393451.1 protein_id gnl|my_center|LOCUS_03880 13669 13424 gene locus_tag LOCUS_03890 13669 13424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 14992 13703 gene locus_tag LOCUS_03900 14992 13703 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727577.1 protein_id gnl|my_center|LOCUS_03900 16013 15012 gene locus_tag LOCUS_03910 16013 15012 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_03910 17154 16042 gene locus_tag LOCUS_03920 17154 16042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 19676 17085 gene locus_tag LOCUS_03930 19676 17085 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_03930 20639 19689 gene locus_tag LOCUS_03940 20639 19689 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085362.1 protein_id gnl|my_center|LOCUS_03940 21895 20636 gene locus_tag LOCUS_03950 21895 20636 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_03950 24176 21897 gene locus_tag LOCUS_03960 24176 21897 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223814.1 protein_id gnl|my_center|LOCUS_03960 24670 24173 gene locus_tag LOCUS_03970 gene coxS 24670 24173 CDS product carbon-monoxide dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226423.1 protein_id gnl|my_center|LOCUS_03970 25530 24667 gene locus_tag LOCUS_03980 25530 24667 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030706.1 protein_id gnl|my_center|LOCUS_03980 25587 25946 gene locus_tag LOCUS_03990 25587 25946 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972719.1 protein_id gnl|my_center|LOCUS_03990 25973 27421 gene locus_tag LOCUS_04000 gene gatA 25973 27421 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136108.1 protein_id gnl|my_center|LOCUS_04000 27830 27435 gene locus_tag LOCUS_04010 gene vapC 27830 27435 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6P6 protein_id gnl|my_center|LOCUS_04010 28096 27827 gene locus_tag LOCUS_04020 28096 27827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 28661 28137 gene locus_tag LOCUS_04030 28661 28137 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230535.1 protein_id gnl|my_center|LOCUS_04030 30322 28721 gene locus_tag LOCUS_04040 30322 28721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222726.1 protein_id gnl|my_center|LOCUS_04040 31059 30319 gene locus_tag LOCUS_04050 31059 30319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222725.1 protein_id gnl|my_center|LOCUS_04050 31746 31099 gene locus_tag LOCUS_04060 31746 31099 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853622.1 protein_id gnl|my_center|LOCUS_04060 32072 31743 gene locus_tag LOCUS_04070 32072 31743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 32524 32084 gene locus_tag LOCUS_04080 32524 32084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 33204 32560 gene locus_tag LOCUS_04090 gene rnhB 33204 32560 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69989 protein_id gnl|my_center|LOCUS_04090 33283 33630 gene locus_tag LOCUS_04100 33283 33630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 35021 33627 gene locus_tag LOCUS_04110 35021 33627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 36019 35024 gene locus_tag LOCUS_04120 gene gpsA 36019 35024 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHA8 protein_id gnl|my_center|LOCUS_04120 36483 36190 gene locus_tag LOCUS_04130 36483 36190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 36834 37394 gene locus_tag LOCUS_04140 36834 37394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 37391 38125 gene locus_tag LOCUS_04150 37391 38125 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256262.1 protein_id gnl|my_center|LOCUS_04150 39039 38122 gene locus_tag LOCUS_04160 39039 38122 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731621.1 protein_id gnl|my_center|LOCUS_04160 39114 39701 gene locus_tag LOCUS_04170 39114 39701 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729004.1 protein_id gnl|my_center|LOCUS_04170 40621 39698 gene locus_tag LOCUS_04180 gene adh 40621 39698 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222782.1 protein_id gnl|my_center|LOCUS_04180 40716 41927 gene locus_tag LOCUS_04190 gene cyp142 40716 41927 CDS product putative cytochrome P450 142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPL5 protein_id gnl|my_center|LOCUS_04190 42781 41945 gene locus_tag LOCUS_04200 42781 41945 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900075.1 protein_id gnl|my_center|LOCUS_04200 43481 42834 gene locus_tag LOCUS_04210 43481 42834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 44000 43494 gene locus_tag LOCUS_04220 44000 43494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 44922 44011 gene locus_tag LOCUS_04230 44922 44011 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920181.1 protein_id gnl|my_center|LOCUS_04230 45058 45498 gene locus_tag LOCUS_04240 45058 45498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 45566 46813 gene locus_tag LOCUS_04250 45566 46813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 47433 46810 gene locus_tag LOCUS_04260 47433 46810 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728249.1 protein_id gnl|my_center|LOCUS_04260 49757 47442 gene locus_tag LOCUS_04270 49757 47442 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_04270 51079 49754 gene locus_tag LOCUS_04280 51079 49754 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727600.1 protein_id gnl|my_center|LOCUS_04280 51104 52012 gene locus_tag LOCUS_04290 51104 52012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_04290 52041 52757 gene locus_tag LOCUS_04300 52041 52757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223524.1 protein_id gnl|my_center|LOCUS_04300 54014 52821 gene locus_tag LOCUS_04310 54014 52821 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040046.1 protein_id gnl|my_center|LOCUS_04310 55447 54038 gene locus_tag LOCUS_04320 55447 54038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930739.1 protein_id gnl|my_center|LOCUS_04320 55550 56800 gene locus_tag LOCUS_04330 55550 56800 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_04330 57221 56826 gene locus_tag LOCUS_04340 57221 56826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 57520 57218 gene locus_tag LOCUS_04350 57520 57218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 57617 58810 gene locus_tag LOCUS_04360 57617 58810 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_04360 58817 59983 gene locus_tag LOCUS_04370 58817 59983 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_04370 59980 60525 gene locus_tag LOCUS_04380 59980 60525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702792.1 protein_id gnl|my_center|LOCUS_04380 60522 61016 gene locus_tag LOCUS_04390 60522 61016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 61016 62125 gene locus_tag LOCUS_04400 gene acd 61016 62125 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_04400 62396 62142 gene locus_tag LOCUS_04410 62396 62142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 63093 62449 gene locus_tag LOCUS_04420 gene msrA 63093 62449 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_04420 63926 63114 gene locus_tag LOCUS_04430 63926 63114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416111.1 protein_id gnl|my_center|LOCUS_04430 64638 63940 gene locus_tag LOCUS_04440 64638 63940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLE7 protein_id gnl|my_center|LOCUS_04440 66166 64631 gene locus_tag LOCUS_04450 66166 64631 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_04450 66271 67482 gene locus_tag LOCUS_04460 66271 67482 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089770.1 protein_id gnl|my_center|LOCUS_04460 67497 68120 gene locus_tag LOCUS_04470 67497 68120 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225313.1 protein_id gnl|my_center|LOCUS_04470 68144 68827 gene locus_tag LOCUS_04480 68144 68827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 70315 68849 gene locus_tag LOCUS_04490 70315 68849 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108631.1 protein_id gnl|my_center|LOCUS_04490 71567 70344 gene locus_tag LOCUS_04500 gene lldD 71567 70344 CDS product putative L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WND5 protein_id gnl|my_center|LOCUS_04500 71818 71567 gene locus_tag LOCUS_04510 71818 71567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 72109 71828 gene locus_tag LOCUS_04520 72109 71828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 72911 72279 gene locus_tag LOCUS_04530 72911 72279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04530 73777 72908 gene locus_tag LOCUS_04540 gene prmC 73777 72908 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QE9 protein_id gnl|my_center|LOCUS_04540 74831 73770 gene locus_tag LOCUS_04550 gene prfA 74831 73770 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97F68 protein_id gnl|my_center|LOCUS_04550 75867 74887 gene locus_tag LOCUS_04560 75867 74887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 76163 75909 gene locus_tag LOCUS_04570 gene rpmE2 76163 75909 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS12 protein_id gnl|my_center|LOCUS_04570 77946 76225 gene locus_tag LOCUS_04580 77946 76225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 79377 78214 gene locus_tag LOCUS_04590 79377 78214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 79739 79389 gene locus_tag LOCUS_04600 79739 79389 CDS product putative transcriptional regulator, ArsR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705563.1 protein_id gnl|my_center|LOCUS_04600 79796 80206 gene locus_tag LOCUS_04610 gene cadI 79796 80206 CDS product cadmium-induced protein CadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIR5 protein_id gnl|my_center|LOCUS_04610 80218 80544 gene locus_tag LOCUS_04620 80218 80544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 81690 80545 gene locus_tag LOCUS_04630 81690 80545 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_04630 83133 81757 gene locus_tag LOCUS_04640 83133 81757 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_04640 84447 83152 gene locus_tag LOCUS_04650 gene thrA 84447 83152 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DH93 protein_id gnl|my_center|LOCUS_04650 85771 84500 gene locus_tag LOCUS_04660 gene lysA 85771 84500 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X5M1 protein_id gnl|my_center|LOCUS_04660 87402 85771 gene locus_tag LOCUS_04670 gene argS 87402 85771 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFU7 protein_id gnl|my_center|LOCUS_04670 87295 87507 gene locus_tag LOCUS_04680 87295 87507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence05 538 1599 gene locus_tag LOCUS_04690 538 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_04690 2486 1638 gene locus_tag LOCUS_04700 2486 1638 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224371.1 protein_id gnl|my_center|LOCUS_04700 3418 2510 gene locus_tag LOCUS_04710 3418 2510 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660904.1 protein_id gnl|my_center|LOCUS_04710 4155 3415 gene locus_tag LOCUS_04720 4155 3415 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_04720 4248 4925 gene locus_tag LOCUS_04730 4248 4925 CDS product regulatory protein TetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525185.1 protein_id gnl|my_center|LOCUS_04730 4922 6067 gene locus_tag LOCUS_04740 4922 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204806.1 protein_id gnl|my_center|LOCUS_04740 6401 6093 gene locus_tag LOCUS_04750 6401 6093 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804583.1 protein_id gnl|my_center|LOCUS_04750 6542 8092 gene locus_tag LOCUS_04760 6542 8092 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_04760 8171 8740 gene locus_tag LOCUS_04770 8171 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 8898 10049 gene locus_tag LOCUS_04780 8898 10049 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_04780 10209 11732 gene locus_tag LOCUS_04790 10209 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 11733 13556 gene locus_tag LOCUS_04800 11733 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 13637 14431 gene locus_tag LOCUS_04810 13637 14431 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_04810 14484 15347 gene locus_tag LOCUS_04820 gene tauD 14484 15347 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114311.1 protein_id gnl|my_center|LOCUS_04820 16260 15382 gene locus_tag LOCUS_04830 16260 15382 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140207.1 protein_id gnl|my_center|LOCUS_04830 17275 16295 gene locus_tag LOCUS_04840 17275 16295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 17375 18307 gene locus_tag LOCUS_04850 17375 18307 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_04850 18390 19616 gene locus_tag LOCUS_04860 18390 19616 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_04860 20473 19658 gene locus_tag LOCUS_04870 gene czcD 20473 19658 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_04870 20635 21828 gene locus_tag LOCUS_04880 gene atoB 20635 21828 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225687.1 protein_id gnl|my_center|LOCUS_04880 21851 22921 gene locus_tag LOCUS_04890 gene adh 21851 22921 CDS product putative alcohol dehydrogenase adh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQC3 protein_id gnl|my_center|LOCUS_04890 23754 22918 gene locus_tag LOCUS_04900 23754 22918 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028906.1 protein_id gnl|my_center|LOCUS_04900 23935 23759 gene locus_tag LOCUS_04910 23935 23759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 24295 23999 gene locus_tag LOCUS_04920 24295 23999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 25356 24328 gene locus_tag LOCUS_04930 25356 24328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_04930 26330 25413 gene locus_tag LOCUS_04940 26330 25413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 27508 26405 gene locus_tag LOCUS_04950 27508 26405 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_04950 29178 27505 gene locus_tag LOCUS_04960 gene betA 29178 27505 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGN2 protein_id gnl|my_center|LOCUS_04960 29295 29582 gene locus_tag LOCUS_04970 29295 29582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 30687 29587 gene locus_tag LOCUS_04980 30687 29587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089323.1 protein_id gnl|my_center|LOCUS_04980 30752 31423 gene locus_tag LOCUS_04990 gene hlyI 30752 31423 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229810.1 protein_id gnl|my_center|LOCUS_04990 31420 32625 gene locus_tag LOCUS_05000 31420 32625 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730272.1 protein_id gnl|my_center|LOCUS_05000 32701 33714 gene locus_tag LOCUS_05010 gene ltaA 32701 33714 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943783.1 protein_id gnl|my_center|LOCUS_05010 34781 33747 gene locus_tag LOCUS_05020 34781 33747 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527716.1 protein_id gnl|my_center|LOCUS_05020 35476 34778 gene locus_tag LOCUS_05030 35476 34778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_05030 36520 35498 gene locus_tag LOCUS_05040 36520 35498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 37002 36574 gene locus_tag LOCUS_05050 37002 36574 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708231.1 protein_id gnl|my_center|LOCUS_05050 37082 37975 gene locus_tag LOCUS_05060 37082 37975 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706652.1 protein_id gnl|my_center|LOCUS_05060 38111 38893 gene locus_tag LOCUS_05070 38111 38893 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_05070 38918 41032 gene locus_tag LOCUS_05080 38918 41032 CDS product N-methylhydantoinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706373.1 protein_id gnl|my_center|LOCUS_05080 41029 42633 gene locus_tag LOCUS_05090 41029 42633 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706372.1 protein_id gnl|my_center|LOCUS_05090 42630 43826 gene locus_tag LOCUS_05100 42630 43826 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706369.1 protein_id gnl|my_center|LOCUS_05100 44634 43885 gene locus_tag LOCUS_05110 44634 43885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_05110 45419 44631 gene locus_tag LOCUS_05120 45419 44631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937856.1 protein_id gnl|my_center|LOCUS_05120 47290 45416 gene locus_tag LOCUS_05130 47290 45416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 48414 47287 gene locus_tag LOCUS_05140 48414 47287 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 protein_id gnl|my_center|LOCUS_05140 49698 48541 gene locus_tag LOCUS_05150 49698 48541 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028803.1 protein_id gnl|my_center|LOCUS_05150 51370 49760 gene locus_tag LOCUS_05160 51370 49760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 52124 51402 gene locus_tag LOCUS_05170 52124 51402 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_05170 52303 52217 gene locus_tag LOCUS_t00160 52303 52217 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 52672 52334 gene locus_tag LOCUS_05180 52672 52334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 52963 52709 gene locus_tag LOCUS_05190 52963 52709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 53396 53079 gene locus_tag LOCUS_05200 53396 53079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 53395 54405 gene locus_tag LOCUS_05210 53395 54405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 55720 54452 gene locus_tag LOCUS_05220 55720 54452 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_05220 55819 56592 gene locus_tag LOCUS_05230 55819 56592 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730027.1 protein_id gnl|my_center|LOCUS_05230 57215 56616 gene locus_tag LOCUS_05240 57215 56616 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_05240 58371 57277 gene locus_tag LOCUS_05250 58371 57277 CDS product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 protein_id gnl|my_center|LOCUS_05250 59861 58437 gene locus_tag LOCUS_05260 59861 58437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 60555 59881 gene locus_tag LOCUS_05270 60555 59881 CDS product carbon monoxide dehydrogenase subunit G family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727165.1 protein_id gnl|my_center|LOCUS_05270 61261 60704 gene locus_tag LOCUS_05280 61261 60704 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_05280 62091 61282 gene locus_tag LOCUS_05290 62091 61282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05290 62410 62096 gene locus_tag LOCUS_05300 62410 62096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 63385 62495 gene locus_tag LOCUS_05310 63385 62495 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MH96 protein_id gnl|my_center|LOCUS_05310 64557 63382 gene locus_tag LOCUS_05320 gene sucC 64557 63382 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MH95 protein_id gnl|my_center|LOCUS_05320 65490 64630 gene locus_tag LOCUS_05330 65490 64630 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709137.1 protein_id gnl|my_center|LOCUS_05330 65750 68491 gene locus_tag LOCUS_05340 gene ppc 65750 68491 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RNU9 protein_id gnl|my_center|LOCUS_05340 68578 69255 gene locus_tag LOCUS_05350 68578 69255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 70390 69272 gene locus_tag LOCUS_05360 70390 69272 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_05360 71356 70406 gene locus_tag LOCUS_05370 71356 70406 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_05370 72216 71392 gene locus_tag LOCUS_05380 gene cutM 72216 71392 CDS product carbon-monoxide dehydrogenase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_05380 72683 72213 gene locus_tag LOCUS_05390 gene coxS 72683 72213 CDS product carbon-monoxide dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_05390 73571 72783 gene locus_tag LOCUS_05400 73571 72783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 74380 73580 gene locus_tag LOCUS_05410 74380 73580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 75424 74441 gene locus_tag LOCUS_05420 75424 74441 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_05420 75827 75501 gene locus_tag LOCUS_05430 75827 75501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 77104 75824 gene locus_tag LOCUS_05440 gene eno 77104 75824 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT60 protein_id gnl|my_center|LOCUS_05440 78127 77276 gene locus_tag LOCUS_05450 78127 77276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 79023 78127 gene locus_tag LOCUS_05460 79023 78127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 82552 79088 gene locus_tag LOCUS_05470 gene mfd 82552 79088 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R3C5 protein_id gnl|my_center|LOCUS_05470 83192 82566 gene locus_tag LOCUS_05480 gene pth 83192 82566 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMC1 protein_id gnl|my_center|LOCUS_05480 83981 83208 gene locus_tag LOCUS_05490 83981 83208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 85019 84039 gene locus_tag LOCUS_05500 gene prs 85019 84039 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3U0 protein_id gnl|my_center|LOCUS_05500 <86969 85170 gene locus_tag LOCUS_05510 <86969 85170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III >Feature sequence06 1197 364 gene locus_tag LOCUS_05520 1197 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 1314 2822 gene locus_tag LOCUS_05530 1314 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 2841 3197 gene locus_tag LOCUS_05540 2841 3197 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_05540 3257 3445 gene locus_tag LOCUS_05550 3257 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 4162 3473 gene locus_tag LOCUS_05560 4162 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 5519 4176 gene locus_tag LOCUS_05570 5519 4176 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_05570 5715 6734 gene locus_tag LOCUS_05580 5715 6734 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKP2 protein_id gnl|my_center|LOCUS_05580 6831 8522 gene locus_tag LOCUS_05590 6831 8522 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028216.1 protein_id gnl|my_center|LOCUS_05590 8528 9055 gene locus_tag LOCUS_05600 8528 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 9262 10200 gene locus_tag LOCUS_05610 9262 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 10343 10248 gene locus_tag LOCUS_t00170 10343 10248 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 11305 10478 gene locus_tag LOCUS_05620 11305 10478 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230527.1 protein_id gnl|my_center|LOCUS_05620 11480 12142 gene locus_tag LOCUS_05630 11480 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 12139 13269 gene locus_tag LOCUS_05640 12139 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 13266 13940 gene locus_tag LOCUS_05650 13266 13940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 13940 14713 gene locus_tag LOCUS_05660 13940 14713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 14785 15057 gene locus_tag LOCUS_05670 14785 15057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 15058 15444 gene locus_tag LOCUS_05680 15058 15444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 15525 15866 gene locus_tag LOCUS_05690 gene rsbV 15525 15866 CDS product anti-sigma-B factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WVX8 protein_id gnl|my_center|LOCUS_05690 15863 16309 gene locus_tag LOCUS_05700 15863 16309 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257545.1 protein_id gnl|my_center|LOCUS_05700 16400 17776 gene locus_tag LOCUS_05710 gene nhaA 16400 17776 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTY3 protein_id gnl|my_center|LOCUS_05710 17895 20987 gene locus_tag LOCUS_05720 gene topA 17895 20987 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJV1 protein_id gnl|my_center|LOCUS_05720 21040 22485 gene locus_tag LOCUS_05730 21040 22485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05730 22482 23081 gene locus_tag LOCUS_05740 22482 23081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05740 23078 24130 gene locus_tag LOCUS_05750 23078 24130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 24929 24141 gene locus_tag LOCUS_05760 24929 24141 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_05760 26499 24964 gene locus_tag LOCUS_05770 26499 24964 CDS product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122835.1 protein_id gnl|my_center|LOCUS_05770 26764 26552 gene locus_tag LOCUS_05780 26764 26552 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813569.1 protein_id gnl|my_center|LOCUS_05780 27542 26829 gene locus_tag LOCUS_05790 27542 26829 CDS product alanyl-tRNA editing protein AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846184.1 protein_id gnl|my_center|LOCUS_05790 28029 27547 gene locus_tag LOCUS_05800 28029 27547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 28162 29322 gene locus_tag LOCUS_05810 gene sucC 28162 29322 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJJ0 protein_id gnl|my_center|LOCUS_05810 29319 30203 gene locus_tag LOCUS_05820 gene sucD 29319 30203 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51567 protein_id gnl|my_center|LOCUS_05820 30260 30853 gene locus_tag LOCUS_05830 gene purN 30260 30853 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJJ7 protein_id gnl|my_center|LOCUS_05830 30850 32394 gene locus_tag LOCUS_05840 gene purH 30850 32394 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU9 protein_id gnl|my_center|LOCUS_05840 32436 33293 gene locus_tag LOCUS_05850 gene folD 32436 33293 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3J6 protein_id gnl|my_center|LOCUS_05850 33454 34329 gene locus_tag LOCUS_05860 gene metF 33454 34329 CDS product 5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67422 protein_id gnl|my_center|LOCUS_05860 34375 35571 gene locus_tag LOCUS_05870 gene icd 34375 35571 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39126 protein_id gnl|my_center|LOCUS_05870 35558 37339 gene locus_tag LOCUS_05880 35558 37339 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 protein_id gnl|my_center|LOCUS_05880 37336 39201 gene locus_tag LOCUS_05890 37336 39201 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_05890 39330 40319 gene locus_tag LOCUS_05900 gene mdh 39330 40319 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3J3 protein_id gnl|my_center|LOCUS_05900 40781 40341 gene locus_tag LOCUS_05910 40781 40341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 41190 40801 gene locus_tag LOCUS_05920 41190 40801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 41255 41596 gene locus_tag LOCUS_05930 41255 41596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 41593 42726 gene locus_tag LOCUS_05940 41593 42726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 42731 43666 gene locus_tag LOCUS_05950 42731 43666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 44581 43673 gene locus_tag LOCUS_05960 44581 43673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05960 45003 44581 gene locus_tag LOCUS_05970 45003 44581 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228596.1 protein_id gnl|my_center|LOCUS_05970 44941 45894 gene locus_tag LOCUS_05980 44941 45894 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967701.1 protein_id gnl|my_center|LOCUS_05980 47116 46334 gene locus_tag LOCUS_05990 47116 46334 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_05990 49056 47137 gene locus_tag LOCUS_06000 gene sdhA 49056 47137 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_06000 49904 49059 gene locus_tag LOCUS_06010 49904 49059 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_06010 52095 49996 gene locus_tag LOCUS_06020 52095 49996 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259393.1 protein_id gnl|my_center|LOCUS_06020 52186 53679 gene locus_tag LOCUS_06030 gene chlI 52186 53679 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 protein_id gnl|my_center|LOCUS_06030 53923 54504 gene locus_tag LOCUS_06040 53923 54504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 54431 55543 gene locus_tag LOCUS_06050 54431 55543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 55623 55913 gene locus_tag LOCUS_06060 55623 55913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 57163 55946 gene locus_tag LOCUS_06070 57163 55946 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_06070 58029 57178 gene locus_tag LOCUS_06080 58029 57178 CDS product putative dehydrogenase/dehydratase, MaoC family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701373.1 protein_id gnl|my_center|LOCUS_06080 58126 59175 gene locus_tag LOCUS_06090 58126 59175 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730117.1 protein_id gnl|my_center|LOCUS_06090 59246 61255 gene locus_tag LOCUS_06100 59246 61255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_06100 61455 61730 gene locus_tag LOCUS_06110 61455 61730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 61858 62043 gene locus_tag LOCUS_06120 61858 62043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 62093 62371 gene locus_tag LOCUS_06130 62093 62371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 62798 62553 gene locus_tag LOCUS_06140 62798 62553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 63048 64190 gene locus_tag LOCUS_06150 63048 64190 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481386.1 protein_id gnl|my_center|LOCUS_06150 64270 64938 gene locus_tag LOCUS_06160 64270 64938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06160 64962 65711 gene locus_tag LOCUS_06170 gene surE 64962 65711 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229561.1 protein_id gnl|my_center|LOCUS_06170 65811 67163 gene locus_tag LOCUS_06180 65811 67163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 68418 67210 gene locus_tag LOCUS_06190 68418 67210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 68471 69523 gene locus_tag LOCUS_06200 68471 69523 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226131.1 protein_id gnl|my_center|LOCUS_06200 69664 70188 gene locus_tag LOCUS_06210 69664 70188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 70185 70454 gene locus_tag LOCUS_06220 70185 70454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 70456 71460 gene locus_tag LOCUS_06230 70456 71460 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976188.1 protein_id gnl|my_center|LOCUS_06230 72134 71457 gene locus_tag LOCUS_06240 72134 71457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 72563 72138 gene locus_tag LOCUS_06250 72563 72138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 72649 73635 gene locus_tag LOCUS_06260 72649 73635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 protein_id gnl|my_center|LOCUS_06260 73810 76677 gene locus_tag LOCUS_06270 73810 76677 CDS product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AM0 protein_id gnl|my_center|LOCUS_06270 77148 76756 gene locus_tag LOCUS_06280 77148 76756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 77402 78247 gene locus_tag LOCUS_06290 77402 78247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 78290 78940 gene locus_tag LOCUS_06300 gene pdxH 78290 78940 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLZ5 protein_id gnl|my_center|LOCUS_06300 80627 79068 gene locus_tag LOCUS_06310 80627 79068 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976326.1 protein_id gnl|my_center|LOCUS_06310 83132 80658 gene locus_tag LOCUS_06320 83132 80658 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533447.1 protein_id gnl|my_center|LOCUS_06320 83211 83984 gene locus_tag LOCUS_06330 83211 83984 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729617.1 protein_id gnl|my_center|LOCUS_06330 84458 84027 gene locus_tag LOCUS_06340 84458 84027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 84581 84952 gene locus_tag LOCUS_06350 84581 84952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 85153 84983 gene locus_tag LOCUS_06360 85153 84983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence07 <1 635 gene locus_tag LOCUS_06370 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389654.1:16S RNA G1207 methylase RsmC 632 1150 gene locus_tag LOCUS_06380 632 1150 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_06380 3040 1181 gene locus_tag LOCUS_06390 gene priA 3040 1181 CDS product putative primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWT9 protein_id gnl|my_center|LOCUS_06390 4250 3054 gene locus_tag LOCUS_06400 gene metK 4250 3054 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0Y3 protein_id gnl|my_center|LOCUS_06400 5488 4247 gene locus_tag LOCUS_06410 5488 4247 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027808.1 protein_id gnl|my_center|LOCUS_06410 5837 5493 gene locus_tag LOCUS_06420 5837 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 6583 5996 gene locus_tag LOCUS_06430 gene gmk 6583 5996 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ID0 protein_id gnl|my_center|LOCUS_06430 6935 6621 gene locus_tag LOCUS_06440 6935 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_06440 7749 6994 gene locus_tag LOCUS_06450 gene pyrF 7749 6994 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77888 protein_id gnl|my_center|LOCUS_06450 8693 7746 gene locus_tag LOCUS_06460 gene pyrD 8693 7746 CDS product dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TN0 protein_id gnl|my_center|LOCUS_06460 11980 8690 gene locus_tag LOCUS_06470 11980 8690 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJR3 protein_id gnl|my_center|LOCUS_06470 13095 11980 gene locus_tag LOCUS_06480 gene carA 13095 11980 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH03 protein_id gnl|my_center|LOCUS_06480 14384 13092 gene locus_tag LOCUS_06490 gene pyrC 14384 13092 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7U057 protein_id gnl|my_center|LOCUS_06490 15369 14419 gene locus_tag LOCUS_06500 gene pyrB 15369 14419 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXR2 protein_id gnl|my_center|LOCUS_06500 15970 15404 gene locus_tag LOCUS_06510 gene pyrR 15970 15404 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2K6 protein_id gnl|my_center|LOCUS_06510 16667 16092 gene locus_tag LOCUS_06520 16667 16092 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027890.1 protein_id gnl|my_center|LOCUS_06520 17124 16681 gene locus_tag LOCUS_06530 17124 16681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 17709 17146 gene locus_tag LOCUS_06540 gene efp 17709 17146 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI92 protein_id gnl|my_center|LOCUS_06540 18795 17728 gene locus_tag LOCUS_06550 18795 17728 CDS product putative cytoplasmic peptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703571.1 protein_id gnl|my_center|LOCUS_06550 19256 18813 gene locus_tag LOCUS_06560 gene aroQ 19256 18813 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52377 protein_id gnl|my_center|LOCUS_06560 20311 19292 gene locus_tag LOCUS_06570 gene rifG 20311 19292 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWY6 protein_id gnl|my_center|LOCUS_06570 20850 20308 gene locus_tag LOCUS_06580 gene aroK 20850 20308 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L67 protein_id gnl|my_center|LOCUS_06580 21434 20964 gene locus_tag LOCUS_06590 21434 20964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 22352 21450 gene locus_tag LOCUS_06600 gene aroE 22352 21450 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI72 protein_id gnl|my_center|LOCUS_06600 23763 22345 gene locus_tag LOCUS_06610 23763 22345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 24188 23760 gene locus_tag LOCUS_06620 24188 23760 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWQ5 protein_id gnl|my_center|LOCUS_06620 26772 24199 gene locus_tag LOCUS_06630 gene alaS 26772 24199 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHZ3 protein_id gnl|my_center|LOCUS_06630 27153 26812 gene locus_tag LOCUS_06640 27153 26812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 28454 27150 gene locus_tag LOCUS_06650 28454 27150 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894402.1 protein_id gnl|my_center|LOCUS_06650 29322 28465 gene locus_tag LOCUS_06660 29322 28465 CDS product IolI protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723365.1 protein_id gnl|my_center|LOCUS_06660 31073 29319 gene locus_tag LOCUS_06670 gene aspS 31073 29319 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHW1 protein_id gnl|my_center|LOCUS_06670 32329 31070 gene locus_tag LOCUS_06680 gene hisS 32329 31070 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWK7 protein_id gnl|my_center|LOCUS_06680 34597 32375 gene locus_tag LOCUS_06690 gene relA 34597 32375 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52560 protein_id gnl|my_center|LOCUS_06690 35828 34710 gene locus_tag LOCUS_06700 gene secF 35828 34710 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53956 protein_id gnl|my_center|LOCUS_06700 37339 35825 gene locus_tag LOCUS_06710 gene secD 37339 35825 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B608 protein_id gnl|my_center|LOCUS_06710 37691 37389 gene locus_tag LOCUS_06720 37691 37389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 38889 37780 gene locus_tag LOCUS_06730 gene tgt 38889 37780 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Y1 protein_id gnl|my_center|LOCUS_06730 39896 38886 gene locus_tag LOCUS_06740 gene queA 39896 38886 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CS92 protein_id gnl|my_center|LOCUS_06740 40973 39933 gene locus_tag LOCUS_06750 gene ruvB 40973 39933 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHT7 protein_id gnl|my_center|LOCUS_06750 41574 40978 gene locus_tag LOCUS_06760 gene ruvA 41574 40978 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51425 protein_id gnl|my_center|LOCUS_06760 42077 41571 gene locus_tag LOCUS_06770 gene ruvC 42077 41571 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MCB8 protein_id gnl|my_center|LOCUS_06770 42884 42135 gene locus_tag LOCUS_06780 42884 42135 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWH1 protein_id gnl|my_center|LOCUS_06780 43497 42907 gene locus_tag LOCUS_06790 gene pdxT 43497 42907 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCJ8 protein_id gnl|my_center|LOCUS_06790 44423 43533 gene locus_tag LOCUS_06800 gene pdxS 44423 43533 CDS product pyridoxal 5'-phosphate synthase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D8V6 protein_id gnl|my_center|LOCUS_06800 45728 44475 gene locus_tag LOCUS_06810 45728 44475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 46504 45728 gene locus_tag LOCUS_06820 46504 45728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 47647 46577 gene locus_tag LOCUS_06830 gene pimA 47647 46577 CDS product phosphatidyl-myo-inositol mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07147 protein_id gnl|my_center|LOCUS_06830 48575 47658 gene locus_tag LOCUS_06840 48575 47658 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_06840 49277 48585 gene locus_tag LOCUS_06850 49277 48585 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545889.1 protein_id gnl|my_center|LOCUS_06850 49947 49429 gene locus_tag LOCUS_06860 49947 49429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 50473 49958 gene locus_tag LOCUS_06870 50473 49958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 51254 50601 gene locus_tag LOCUS_06880 gene udk 51254 50601 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCC8 protein_id gnl|my_center|LOCUS_06880 52716 51274 gene locus_tag LOCUS_06890 gene ahcY 52716 51274 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DFN9 protein_id gnl|my_center|LOCUS_06890 53748 52831 gene locus_tag LOCUS_06900 53748 52831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 54925 53756 gene locus_tag LOCUS_06910 54925 53756 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_06910 55184 54948 gene locus_tag LOCUS_06920 55184 54948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895208.1 protein_id gnl|my_center|LOCUS_06920 56572 55208 gene locus_tag LOCUS_06930 gene manB 56572 55208 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_06930 57772 56597 gene locus_tag LOCUS_06940 57772 56597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 60387 57769 gene locus_tag LOCUS_06950 60387 57769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 61085 60378 gene locus_tag LOCUS_06960 61085 60378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 61177 63126 gene locus_tag LOCUS_06970 gene ftsH 61177 63126 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJQ4 protein_id gnl|my_center|LOCUS_06970 63142 63585 gene locus_tag LOCUS_06980 63142 63585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 65107 63638 gene locus_tag LOCUS_06990 65107 63638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 68151 65104 gene locus_tag LOCUS_07000 68151 65104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 68083 68304 gene locus_tag LOCUS_07010 68083 68304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 68334 69254 gene locus_tag LOCUS_07020 68334 69254 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_07020 69294 70268 gene locus_tag LOCUS_07030 gene gmd 69294 70268 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ72 protein_id gnl|my_center|LOCUS_07030 70287 71213 gene locus_tag LOCUS_07040 70287 71213 CDS product LPPG--FO 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_07040 71210 71917 gene locus_tag LOCUS_07050 71210 71917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07050 <72629 71914 gene locus_tag LOCUS_07060 <72629 71914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701256.1:putative UDP-glucose 4-epimerase GalE1 >Feature sequence08 1121 153 gene locus_tag LOCUS_07070 1121 153 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_07070 1921 1145 gene locus_tag LOCUS_07080 gene rhmA 1921 1145 CDS product 2-keto-3-deoxy-L-rhamnonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N5L0 protein_id gnl|my_center|LOCUS_07080 2357 2130 gene locus_tag LOCUS_07090 2357 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 3260 3185 gene locus_tag LOCUS_t00180 3260 3185 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3548 3312 gene locus_tag LOCUS_07100 3548 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 4040 3558 gene locus_tag LOCUS_07110 4040 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 5290 4106 gene locus_tag LOCUS_07120 5290 4106 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_07120 6530 5283 gene locus_tag LOCUS_07130 gene metX 6530 5283 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHP2 protein_id gnl|my_center|LOCUS_07130 8277 6766 gene locus_tag LOCUS_07140 8277 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 9586 8417 gene locus_tag LOCUS_07150 9586 8417 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029814.1 protein_id gnl|my_center|LOCUS_07150 10009 9743 gene locus_tag LOCUS_07160 10009 9743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 10561 10025 gene locus_tag LOCUS_07170 10561 10025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 11349 10558 gene locus_tag LOCUS_07180 gene lgt2 11349 10558 CDS product prolipoprotein diacylglyceryl transferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBW3 protein_id gnl|my_center|LOCUS_07180 13154 11346 gene locus_tag LOCUS_07190 gene mmgC 13154 11346 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 protein_id gnl|my_center|LOCUS_07190 13133 13360 gene locus_tag LOCUS_07200 13133 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 13357 15069 gene locus_tag LOCUS_07210 13357 15069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 15066 16016 gene locus_tag LOCUS_07220 15066 16016 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 protein_id gnl|my_center|LOCUS_07220 16013 16570 gene locus_tag LOCUS_07230 16013 16570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 16594 17580 gene locus_tag LOCUS_07240 16594 17580 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967766.1 protein_id gnl|my_center|LOCUS_07240 17593 18039 gene locus_tag LOCUS_07250 17593 18039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228531.1 protein_id gnl|my_center|LOCUS_07250 18690 18061 gene locus_tag LOCUS_07260 gene tdk 18690 18061 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50519 protein_id gnl|my_center|LOCUS_07260 22696 18719 gene locus_tag LOCUS_07270 22696 18719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 22846 23682 gene locus_tag LOCUS_07280 22846 23682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703708.1 protein_id gnl|my_center|LOCUS_07280 24094 23693 gene locus_tag LOCUS_07290 24094 23693 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056652.1 protein_id gnl|my_center|LOCUS_07290 24298 24930 gene locus_tag LOCUS_07300 gene lexA 24298 24930 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1N3 protein_id gnl|my_center|LOCUS_07300 26037 24964 gene locus_tag LOCUS_07310 26037 24964 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_07310 26915 26061 gene locus_tag LOCUS_07320 gene dapD 26915 26061 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_07320 28081 26945 gene locus_tag LOCUS_07330 28081 26945 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_07330 29472 28078 gene locus_tag LOCUS_07340 gene hflX 29472 28078 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69972 protein_id gnl|my_center|LOCUS_07340 30286 29465 gene locus_tag LOCUS_07350 gene dapF 30286 29465 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK34 protein_id gnl|my_center|LOCUS_07350 31247 30321 gene locus_tag LOCUS_07360 gene miaA 31247 30321 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69967 protein_id gnl|my_center|LOCUS_07360 32827 31265 gene locus_tag LOCUS_07370 gene miaB 32827 31265 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVX5 protein_id gnl|my_center|LOCUS_07370 34178 32895 gene locus_tag LOCUS_07380 gene recA 34178 32895 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9REV6 protein_id gnl|my_center|LOCUS_07380 34377 34784 gene locus_tag LOCUS_07390 gene msrB 34377 34784 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM0 protein_id gnl|my_center|LOCUS_07390 35276 34785 gene locus_tag LOCUS_07400 35276 34785 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S292 protein_id gnl|my_center|LOCUS_07400 36555 35299 gene locus_tag LOCUS_07410 36555 35299 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHU4 protein_id gnl|my_center|LOCUS_07410 37150 36578 gene locus_tag LOCUS_07420 37150 36578 CDS product putative PGP synthase PgsA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703803.1 protein_id gnl|my_center|LOCUS_07420 38397 37147 gene locus_tag LOCUS_07430 gene rimO 38397 37147 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJK1 protein_id gnl|my_center|LOCUS_07430 39398 38445 gene locus_tag LOCUS_07440 gene yrbG 39398 38445 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_07440 40466 39516 gene locus_tag LOCUS_07450 40466 39516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 41074 40469 gene locus_tag LOCUS_07460 41074 40469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 43643 41193 gene locus_tag LOCUS_07470 43643 41193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 45404 43749 gene locus_tag LOCUS_07480 gene rnj 45404 43749 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86842 protein_id gnl|my_center|LOCUS_07480 46269 45415 gene locus_tag LOCUS_07490 gene dapA 46269 45415 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJK7 protein_id gnl|my_center|LOCUS_07490 46943 46305 gene locus_tag LOCUS_07500 46943 46305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405892.1 protein_id gnl|my_center|LOCUS_07500 47778 46975 gene locus_tag LOCUS_07510 47778 46975 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC66 protein_id gnl|my_center|LOCUS_07510 48550 47759 gene locus_tag LOCUS_07520 gene dapB 48550 47759 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD52 protein_id gnl|my_center|LOCUS_07520 49846 48602 gene locus_tag LOCUS_07530 49846 48602 CDS product putative zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86835 protein_id gnl|my_center|LOCUS_07530 52407 49894 gene locus_tag LOCUS_07540 gene pnp 52407 49894 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVQ5 protein_id gnl|my_center|LOCUS_07540 52968 52699 gene locus_tag LOCUS_07550 gene rpsO 52968 52699 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT0 protein_id gnl|my_center|LOCUS_07550 53140 52928 gene locus_tag LOCUS_07560 53140 52928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 53158 53628 gene locus_tag LOCUS_07570 53158 53628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143438.1 protein_id gnl|my_center|LOCUS_07570 54095 53631 gene locus_tag LOCUS_07580 54095 53631 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811752.1 protein_id gnl|my_center|LOCUS_07580 55315 54092 gene locus_tag LOCUS_07590 gene ribA 55315 54092 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4W9 protein_id gnl|my_center|LOCUS_07590 55968 55315 gene locus_tag LOCUS_07600 55968 55315 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803670.1 protein_id gnl|my_center|LOCUS_07600 57070 56327 gene locus_tag LOCUS_07610 57070 56327 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_07610 58030 57074 gene locus_tag LOCUS_07620 58030 57074 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z530 protein_id gnl|my_center|LOCUS_07620 58947 58075 gene locus_tag LOCUS_07630 gene truB 58947 58075 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVP8 protein_id gnl|my_center|LOCUS_07630 59314 58940 gene locus_tag LOCUS_07640 gene rbfA 59314 58940 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV56 protein_id gnl|my_center|LOCUS_07640 62029 59321 gene locus_tag LOCUS_07650 62029 59321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 63743 62409 gene locus_tag LOCUS_07660 63743 62409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 64252 63740 gene locus_tag LOCUS_07670 gene rimP 64252 63740 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y4 protein_id gnl|my_center|LOCUS_07670 65715 64489 gene locus_tag LOCUS_07680 gene ispG 65715 64489 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NP12 protein_id gnl|my_center|LOCUS_07680 67201 65780 gene locus_tag LOCUS_07690 gene rip1 67201 65780 CDS product zinc metalloprotease Rip1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHS3 protein_id gnl|my_center|LOCUS_07690 68367 67198 gene locus_tag LOCUS_07700 gene dxr 68367 67198 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H0 protein_id gnl|my_center|LOCUS_07700 69709 68447 gene locus_tag LOCUS_07710 69709 68447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 70302 69733 gene locus_tag LOCUS_07720 gene frr 70302 69733 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEZ1 protein_id gnl|my_center|LOCUS_07720 71074 70343 gene locus_tag LOCUS_07730 gene pyrH 71074 70343 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q831V1 protein_id gnl|my_center|LOCUS_07730 71870 71079 gene locus_tag LOCUS_07740 gene tsf 71870 71079 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WUL4 protein_id gnl|my_center|LOCUS_07740 >Feature sequence09 130 903 gene locus_tag LOCUS_07750 130 903 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 protein_id gnl|my_center|LOCUS_07750 1711 908 gene locus_tag LOCUS_07760 1711 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406261.1 protein_id gnl|my_center|LOCUS_07760 5016 1708 gene locus_tag LOCUS_07770 5016 1708 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013390.1 protein_id gnl|my_center|LOCUS_07770 5069 5821 gene locus_tag LOCUS_07780 gene araC 5069 5821 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118984.1 protein_id gnl|my_center|LOCUS_07780 7045 5867 gene locus_tag LOCUS_07790 7045 5867 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226683.1 protein_id gnl|my_center|LOCUS_07790 7715 7071 gene locus_tag LOCUS_07800 gene ykwB 7715 7071 CDS product putative N-acetyltransferase YkwB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q796K9 protein_id gnl|my_center|LOCUS_07800 8817 7726 gene locus_tag LOCUS_07810 8817 7726 CDS product peptidase C45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257273.1 protein_id gnl|my_center|LOCUS_07810 9037 9882 gene locus_tag LOCUS_07820 gene psuG 9037 9882 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNP3 protein_id gnl|my_center|LOCUS_07820 10852 9872 gene locus_tag LOCUS_07830 10852 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 11571 10849 gene locus_tag LOCUS_07840 11571 10849 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_07840 12482 11568 gene locus_tag LOCUS_07850 gene ilvE2 12482 11568 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_07850 12672 12511 gene locus_tag LOCUS_07860 12672 12511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 14402 12720 gene locus_tag LOCUS_07870 14402 12720 CDS product thiamine pyrophosphate TPP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530395.1 protein_id gnl|my_center|LOCUS_07870 14501 15244 gene locus_tag LOCUS_07880 14501 15244 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538018.1 protein_id gnl|my_center|LOCUS_07880 15895 15266 gene locus_tag LOCUS_07890 15895 15266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07890 16530 15835 gene locus_tag LOCUS_07900 16530 15835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07900 18398 16593 gene locus_tag LOCUS_07910 18398 16593 CDS product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808155.1 protein_id gnl|my_center|LOCUS_07910 18773 19390 gene locus_tag LOCUS_07920 18773 19390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 19943 19350 gene locus_tag LOCUS_07930 19943 19350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530297.1 protein_id gnl|my_center|LOCUS_07930 20849 19989 gene locus_tag LOCUS_07940 20849 19989 CDS product D-alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339326.1 protein_id gnl|my_center|LOCUS_07940 21275 20883 gene locus_tag LOCUS_07950 gene vapc47 21275 20883 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P7Q7 protein_id gnl|my_center|LOCUS_07950 21550 21275 gene locus_tag LOCUS_07960 gene vapb46 21550 21275 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P8X4 protein_id gnl|my_center|LOCUS_07960 23073 21607 gene locus_tag LOCUS_07970 23073 21607 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888403.1 protein_id gnl|my_center|LOCUS_07970 23234 24226 gene locus_tag LOCUS_07980 23234 24226 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972697.1 protein_id gnl|my_center|LOCUS_07980 24223 24966 gene locus_tag LOCUS_07990 24223 24966 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975393.1 protein_id gnl|my_center|LOCUS_07990 24959 26842 gene locus_tag LOCUS_08000 24959 26842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969218.1 protein_id gnl|my_center|LOCUS_08000 26839 27789 gene locus_tag LOCUS_08010 26839 27789 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118295.1 protein_id gnl|my_center|LOCUS_08010 27789 29234 gene locus_tag LOCUS_08020 27789 29234 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_08020 29278 29754 gene locus_tag LOCUS_08030 29278 29754 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MXM7 protein_id gnl|my_center|LOCUS_08030 31344 29761 gene locus_tag LOCUS_08040 31344 29761 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706287.1 protein_id gnl|my_center|LOCUS_08040 32688 31447 gene locus_tag LOCUS_08050 32688 31447 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972472.1 protein_id gnl|my_center|LOCUS_08050 33175 32744 gene locus_tag LOCUS_08060 33175 32744 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224891.1 protein_id gnl|my_center|LOCUS_08060 34452 33232 gene locus_tag LOCUS_08070 34452 33232 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_08070 35959 34454 gene locus_tag LOCUS_08080 gene glgA1 35959 34454 CDS product glycogen synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ED9 protein_id gnl|my_center|LOCUS_08080 35992 37251 gene locus_tag LOCUS_08090 35992 37251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 37248 38474 gene locus_tag LOCUS_08100 37248 38474 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_08100 38474 39442 gene locus_tag LOCUS_08110 38474 39442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 39439 40584 gene locus_tag LOCUS_08120 39439 40584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 40597 41847 gene locus_tag LOCUS_08130 40597 41847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 41066 40978 gene locus_tag LOCUS_t00190 41066 40978 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 41844 42590 gene locus_tag LOCUS_08140 41844 42590 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074612.1 protein_id gnl|my_center|LOCUS_08140 42666 44666 gene locus_tag LOCUS_08150 42666 44666 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJR4 protein_id gnl|my_center|LOCUS_08150 44663 46720 gene locus_tag LOCUS_08160 gene glgX 44663 46720 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D5P6 protein_id gnl|my_center|LOCUS_08160 48108 46717 gene locus_tag LOCUS_08170 gene glgC 48108 46717 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D837 protein_id gnl|my_center|LOCUS_08170 48001 49881 gene locus_tag LOCUS_08180 gene glgB 48001 49881 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHB1 protein_id gnl|my_center|LOCUS_08180 49874 51787 gene locus_tag LOCUS_08190 gene malQ 49874 51787 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYI8 protein_id gnl|my_center|LOCUS_08190 52942 51809 gene locus_tag LOCUS_08200 52942 51809 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI3 protein_id gnl|my_center|LOCUS_08200 53733 52939 gene locus_tag LOCUS_08210 53733 52939 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390216.1 protein_id gnl|my_center|LOCUS_08210 53829 55343 gene locus_tag LOCUS_08220 53829 55343 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919225.1 protein_id gnl|my_center|LOCUS_08220 56654 55362 gene locus_tag LOCUS_08230 56654 55362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 57788 56844 gene locus_tag LOCUS_08240 gene kynA 57788 56844 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WP5 protein_id gnl|my_center|LOCUS_08240 58679 57798 gene locus_tag LOCUS_08250 58679 57798 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_08250 58960 58787 gene locus_tag LOCUS_08260 58960 58787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 59115 59288 gene locus_tag LOCUS_08270 59115 59288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 59413 60300 gene locus_tag LOCUS_08280 59413 60300 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_08280 60316 61161 gene locus_tag LOCUS_08290 60316 61161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 61581 61363 gene locus_tag LOCUS_08300 61581 61363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08300 62160 61585 gene locus_tag LOCUS_08310 62160 61585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08310 62119 62316 gene locus_tag LOCUS_08320 62119 62316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 63093 62647 gene locus_tag LOCUS_08330 gene rpiB 63093 62647 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120716.1 protein_id gnl|my_center|LOCUS_08330 64610 63138 gene locus_tag LOCUS_08340 gene rhaD 64610 63138 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226384.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08340 64826 64641 gene locus_tag LOCUS_08350 64826 64641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08350 64869 65822 gene locus_tag LOCUS_08360 64869 65822 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707171.1 protein_id gnl|my_center|LOCUS_08360 65819 66763 gene locus_tag LOCUS_08370 gene psuG 65819 66763 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNP3 protein_id gnl|my_center|LOCUS_08370 >Feature sequence10 233 493 gene locus_tag LOCUS_08380 233 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 759 971 gene locus_tag LOCUS_08390 759 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 974 1495 gene locus_tag LOCUS_08400 974 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1585 2355 gene locus_tag LOCUS_08410 1585 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 2360 3844 gene locus_tag LOCUS_08420 2360 3844 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550790.1 protein_id gnl|my_center|LOCUS_08420 4843 3851 gene locus_tag LOCUS_08430 gene rsgA 4843 3851 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBT9 protein_id gnl|my_center|LOCUS_08430 6074 4884 gene locus_tag LOCUS_08440 6074 4884 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225403.1 protein_id gnl|my_center|LOCUS_08440 6790 6071 gene locus_tag LOCUS_08450 6790 6071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 protein_id gnl|my_center|LOCUS_08450 10170 6787 gene locus_tag LOCUS_08460 10170 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 10987 10202 gene locus_tag LOCUS_08470 10987 10202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 11085 12329 gene locus_tag LOCUS_08480 11085 12329 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_08480 12425 12350 gene locus_tag LOCUS_t00200 12425 12350 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12941 12483 gene locus_tag LOCUS_08490 12941 12483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 13582 13079 gene locus_tag LOCUS_08500 gene moaC 13582 13079 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WV5 protein_id gnl|my_center|LOCUS_08500 14574 13591 gene locus_tag LOCUS_08510 gene moaA 14574 13591 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJ31 protein_id gnl|my_center|LOCUS_08510 15824 14619 gene locus_tag LOCUS_08520 15824 14619 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_08520 16506 15877 gene locus_tag LOCUS_08530 gene plsY 16506 15877 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60926 protein_id gnl|my_center|LOCUS_08530 16652 17005 gene locus_tag LOCUS_08540 16652 17005 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975630.1 protein_id gnl|my_center|LOCUS_08540 17088 17507 gene locus_tag LOCUS_08550 17088 17507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 18333 17518 gene locus_tag LOCUS_08560 gene uppP 18333 17518 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60938 protein_id gnl|my_center|LOCUS_08560 19698 18358 gene locus_tag LOCUS_08570 19698 18358 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_08570 21152 19734 gene locus_tag LOCUS_08580 21152 19734 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_08580 21246 21623 gene locus_tag LOCUS_08590 21246 21623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 21620 22468 gene locus_tag LOCUS_08600 21620 22468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 22547 24367 gene locus_tag LOCUS_08610 gene dxs 22547 24367 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4J3 protein_id gnl|my_center|LOCUS_08610 25077 24436 gene locus_tag LOCUS_08620 gene nfuA 25077 24436 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_08620 25147 25872 gene locus_tag LOCUS_08630 25147 25872 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_08630 25892 26920 gene locus_tag LOCUS_08640 gene hemH 25892 26920 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QX29 protein_id gnl|my_center|LOCUS_08640 26994 27302 gene locus_tag LOCUS_08650 26994 27302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 27480 29897 gene locus_tag LOCUS_08660 27480 29897 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50510 protein_id gnl|my_center|LOCUS_08660 29900 32008 gene locus_tag LOCUS_08670 29900 32008 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69998 protein_id gnl|my_center|LOCUS_08670 32041 32883 gene locus_tag LOCUS_08680 32041 32883 CDS product exonuclease RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908264.1 protein_id gnl|my_center|LOCUS_08680 33253 32900 gene locus_tag LOCUS_08690 33253 32900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 34032 33250 gene locus_tag LOCUS_08700 34032 33250 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_08700 34100 34912 gene locus_tag LOCUS_08710 gene mutM 34100 34912 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX22 protein_id gnl|my_center|LOCUS_08710 35010 36686 gene locus_tag LOCUS_08720 35010 36686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 37461 36715 gene locus_tag LOCUS_08730 gene map 37461 36715 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVI6 protein_id gnl|my_center|LOCUS_08730 38142 37687 gene locus_tag LOCUS_08740 38142 37687 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_08740 38250 39170 gene locus_tag LOCUS_08750 38250 39170 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_08750 40020 39178 gene locus_tag LOCUS_08760 40020 39178 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930638.1 protein_id gnl|my_center|LOCUS_08760 39944 40162 gene locus_tag LOCUS_08770 39944 40162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 40815 40123 gene locus_tag LOCUS_08780 40815 40123 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_08780 41675 40869 gene locus_tag LOCUS_08790 41675 40869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 41641 41889 gene locus_tag LOCUS_08800 41641 41889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 42042 44090 gene locus_tag LOCUS_08810 42042 44090 CDS product N-methylproline demethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532328.1 protein_id gnl|my_center|LOCUS_08810 45079 44102 gene locus_tag LOCUS_08820 45079 44102 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 protein_id gnl|my_center|LOCUS_08820 45066 47468 gene locus_tag LOCUS_08830 45066 47468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 48131 47457 gene locus_tag LOCUS_08840 48131 47457 CDS product MIP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_08840 49780 48152 gene locus_tag LOCUS_08850 gene cimA 49780 48152 CDS product (R)-citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86511 protein_id gnl|my_center|LOCUS_08850 50687 49770 gene locus_tag LOCUS_08860 50687 49770 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_08860 51729 50722 gene locus_tag LOCUS_08870 gene leuB 51729 50722 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94631 protein_id gnl|my_center|LOCUS_08870 51961 52434 gene locus_tag LOCUS_08880 gene greA 51961 52434 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DG08 protein_id gnl|my_center|LOCUS_08880 52446 53342 gene locus_tag LOCUS_08890 52446 53342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 53405 54307 gene locus_tag LOCUS_08900 53405 54307 CDS product epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGP7 protein_id gnl|my_center|LOCUS_08900 55991 54327 gene locus_tag LOCUS_08910 55991 54327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 56159 57106 gene locus_tag LOCUS_08920 56159 57106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 57103 58464 gene locus_tag LOCUS_08930 57103 58464 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972641.1 protein_id gnl|my_center|LOCUS_08930 58649 59917 gene locus_tag LOCUS_08940 gene gltA 58649 59917 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBF3 protein_id gnl|my_center|LOCUS_08940 60913 59930 gene locus_tag LOCUS_08950 60913 59930 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_08950 60996 61475 gene locus_tag LOCUS_08960 60996 61475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 62675 61482 gene locus_tag LOCUS_08970 62675 61482 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090523.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence11 1121 267 gene locus_tag LOCUS_08980 1121 267 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_08980 1271 2005 gene locus_tag LOCUS_08990 1271 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 3790 2045 gene locus_tag LOCUS_09000 3790 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 5008 3827 gene locus_tag LOCUS_09010 5008 3827 CDS product amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384563.1 protein_id gnl|my_center|LOCUS_09010 5119 6255 gene locus_tag LOCUS_09020 5119 6255 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975045.1 protein_id gnl|my_center|LOCUS_09020 6252 7184 gene locus_tag LOCUS_09030 6252 7184 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_09030 7519 7241 gene locus_tag LOCUS_09040 7519 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 7530 8336 gene locus_tag LOCUS_09050 7530 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 8429 9973 gene locus_tag LOCUS_09060 8429 9973 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_09060 12825 9970 gene locus_tag LOCUS_09070 12825 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 12812 13162 gene locus_tag LOCUS_09080 12812 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 14563 13175 gene locus_tag LOCUS_09090 gene pdhD 14563 13175 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21880 protein_id gnl|my_center|LOCUS_09090 15829 14567 gene locus_tag LOCUS_09100 15829 14567 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819K5 protein_id gnl|my_center|LOCUS_09100 16842 15862 gene locus_tag LOCUS_09110 gene pdhB 16842 15862 CDS product pyruvate dehydrogenase E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068166.1 protein_id gnl|my_center|LOCUS_09110 17849 16839 gene locus_tag LOCUS_09120 gene pdhA 17849 16839 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722679.1 protein_id gnl|my_center|LOCUS_09120 18233 18700 gene locus_tag LOCUS_09130 18233 18700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704026.1 protein_id gnl|my_center|LOCUS_09130 18803 19516 gene locus_tag LOCUS_09140 18803 19516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 19520 20002 gene locus_tag LOCUS_09150 19520 20002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 20002 20592 gene locus_tag LOCUS_09160 20002 20592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 21307 20612 gene locus_tag LOCUS_09170 21307 20612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 21850 21380 gene locus_tag LOCUS_09180 21850 21380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 22105 22962 gene locus_tag LOCUS_09190 22105 22962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 23555 23857 gene locus_tag LOCUS_09200 23555 23857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 23869 24897 gene locus_tag LOCUS_09210 gene trpD 23869 24897 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCF3 protein_id gnl|my_center|LOCUS_09210 26651 24939 gene locus_tag LOCUS_09220 gene dnaQ 26651 24939 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_09220 26774 27019 gene locus_tag LOCUS_09230 26774 27019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 27068 28168 gene locus_tag LOCUS_09240 gene queG 27068 28168 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HNR6 protein_id gnl|my_center|LOCUS_09240 28165 29304 gene locus_tag LOCUS_09250 28165 29304 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028156.1 protein_id gnl|my_center|LOCUS_09250 29310 29750 gene locus_tag LOCUS_09260 29310 29750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 29803 30261 gene locus_tag LOCUS_09270 29803 30261 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_09270 30332 31507 gene locus_tag LOCUS_09280 30332 31507 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIE3 protein_id gnl|my_center|LOCUS_09280 31519 32547 gene locus_tag LOCUS_09290 gene pfkA1 31519 32547 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O08333 protein_id gnl|my_center|LOCUS_09290 33204 32560 gene locus_tag LOCUS_09300 33204 32560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 34628 33201 gene locus_tag LOCUS_09310 gene mtrB 34628 33201 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_09310 35319 34630 gene locus_tag LOCUS_09320 gene regX 35319 34630 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_09320 36182 35391 gene locus_tag LOCUS_09330 gene suhB 36182 35391 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 protein_id gnl|my_center|LOCUS_09330 36504 36196 gene locus_tag LOCUS_09340 36504 36196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 36590 37075 gene locus_tag LOCUS_09350 36590 37075 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173948.1 protein_id gnl|my_center|LOCUS_09350 37168 38382 gene locus_tag LOCUS_09360 gene dinB 37168 38382 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAG1 protein_id gnl|my_center|LOCUS_09360 38460 38846 gene locus_tag LOCUS_09370 38460 38846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804692.1 protein_id gnl|my_center|LOCUS_09370 38865 39740 gene locus_tag LOCUS_09380 38865 39740 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_09380 39763 40056 gene locus_tag LOCUS_09390 39763 40056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 40066 40575 gene locus_tag LOCUS_09400 40066 40575 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_09400 40940 40542 gene locus_tag LOCUS_09410 40940 40542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 40845 41261 gene locus_tag LOCUS_09420 40845 41261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 41469 41903 gene locus_tag LOCUS_09430 gene mraZ 41469 41903 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R025 protein_id gnl|my_center|LOCUS_09430 41990 42997 gene locus_tag LOCUS_09440 gene rsmH 41990 42997 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2W4 protein_id gnl|my_center|LOCUS_09440 42994 43422 gene locus_tag LOCUS_09450 42994 43422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 43419 45308 gene locus_tag LOCUS_09460 43419 45308 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_09460 45310 46752 gene locus_tag LOCUS_09470 45310 46752 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272490.1 protein_id gnl|my_center|LOCUS_09470 46749 47792 gene locus_tag LOCUS_09480 gene mraY 46749 47792 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56833 protein_id gnl|my_center|LOCUS_09480 47789 49093 gene locus_tag LOCUS_09490 gene murD 47789 49093 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK81 protein_id gnl|my_center|LOCUS_09490 49090 50283 gene locus_tag LOCUS_09500 49090 50283 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_09500 50310 51404 gene locus_tag LOCUS_09510 gene murG 50310 51404 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBG5 protein_id gnl|my_center|LOCUS_09510 51397 52800 gene locus_tag LOCUS_09520 gene murC 51397 52800 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK78 protein_id gnl|my_center|LOCUS_09520 52793 53752 gene locus_tag LOCUS_09530 52793 53752 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_09530 53749 54492 gene locus_tag LOCUS_09540 53749 54492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 54713 55789 gene locus_tag LOCUS_09550 gene ftsZ 54713 55789 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45500 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09550 55835 56521 gene locus_tag LOCUS_09560 55835 56521 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PER9 protein_id gnl|my_center|LOCUS_09560 56518 57183 gene locus_tag LOCUS_09570 56518 57183 CDS product UPF0001 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44506 protein_id gnl|my_center|LOCUS_09570 57228 57767 gene locus_tag LOCUS_09580 57228 57767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 57792 58052 gene locus_tag LOCUS_09590 57792 58052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 58108 58890 gene locus_tag LOCUS_09600 58108 58890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 59146 59865 gene locus_tag LOCUS_09610 59146 59865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 59874 60338 gene locus_tag LOCUS_09620 59874 60338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 60335 61264 gene locus_tag LOCUS_09630 60335 61264 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y657 protein_id gnl|my_center|LOCUS_09630 61724 61284 gene locus_tag LOCUS_09640 61724 61284 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_09640 61771 62886 gene locus_tag LOCUS_09650 61771 62886 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_09650 62956 63465 gene locus_tag LOCUS_09660 62956 63465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700958.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence12 149 1210 gene locus_tag LOCUS_09670 149 1210 CDS product Rossman fold protein, TIGR00730 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122653.1 protein_id gnl|my_center|LOCUS_09670 1419 1207 gene locus_tag LOCUS_09680 1419 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2620 1409 gene locus_tag LOCUS_09690 2620 1409 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTN0 protein_id gnl|my_center|LOCUS_09690 3510 2617 gene locus_tag LOCUS_09700 3510 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 4883 3501 gene locus_tag LOCUS_09710 4883 3501 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 protein_id gnl|my_center|LOCUS_09710 5054 6802 gene locus_tag LOCUS_09720 5054 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 7030 6833 gene locus_tag LOCUS_09730 7030 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 8145 7114 gene locus_tag LOCUS_09740 gene rnd 8145 7114 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7M5 protein_id gnl|my_center|LOCUS_09740 8636 8316 gene locus_tag LOCUS_09750 8636 8316 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862931.1 protein_id gnl|my_center|LOCUS_09750 9321 8701 gene locus_tag LOCUS_09760 gene mobA 9321 8701 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R169 protein_id gnl|my_center|LOCUS_09760 9788 9318 gene locus_tag LOCUS_09770 9788 9318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 9818 10123 gene locus_tag LOCUS_09780 9818 10123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 11625 10186 gene locus_tag LOCUS_09790 gene pykA 11625 10186 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3S2 protein_id gnl|my_center|LOCUS_09790 12292 11708 gene locus_tag LOCUS_09800 12292 11708 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419374.1 protein_id gnl|my_center|LOCUS_09800 12367 13140 gene locus_tag LOCUS_09810 12367 13140 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_09810 13192 13605 gene locus_tag LOCUS_09820 13192 13605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 15566 14463 gene locus_tag LOCUS_09830 15566 14463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 17056 15563 gene locus_tag LOCUS_09840 17056 15563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 17210 18676 gene locus_tag LOCUS_09850 17210 18676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_09850 18688 20076 gene locus_tag LOCUS_09860 18688 20076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 20104 20988 gene locus_tag LOCUS_09870 20104 20988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 20988 22367 gene locus_tag LOCUS_09880 20988 22367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 23038 22334 gene locus_tag LOCUS_09890 23038 22334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 23182 23514 gene locus_tag LOCUS_09900 23182 23514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 23511 24428 gene locus_tag LOCUS_09910 23511 24428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 24484 25215 gene locus_tag LOCUS_09920 24484 25215 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230619.1 protein_id gnl|my_center|LOCUS_09920 25212 25559 gene locus_tag LOCUS_09930 25212 25559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 26764 25613 gene locus_tag LOCUS_09940 26764 25613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 26955 26764 gene locus_tag LOCUS_09950 26955 26764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 26972 27265 gene locus_tag LOCUS_09960 26972 27265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 27391 28131 gene locus_tag LOCUS_09970 27391 28131 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729763.1 protein_id gnl|my_center|LOCUS_09970 28154 28798 gene locus_tag LOCUS_09980 28154 28798 CDS product putative 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD41 protein_id gnl|my_center|LOCUS_09980 29606 28806 gene locus_tag LOCUS_09990 gene echA19 29606 28806 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419179.1 protein_id gnl|my_center|LOCUS_09990 30452 29616 gene locus_tag LOCUS_10000 30452 29616 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_10000 31213 30449 gene locus_tag LOCUS_10010 gene paaG 31213 30449 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 protein_id gnl|my_center|LOCUS_10010 32410 31223 gene locus_tag LOCUS_10020 32410 31223 CDS product putative lipid-transfer protein Ltp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703354.1 protein_id gnl|my_center|LOCUS_10020 32877 32410 gene locus_tag LOCUS_10030 32877 32410 CDS product benzoylsuccinyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729363.1 protein_id gnl|my_center|LOCUS_10030 33717 32950 gene locus_tag LOCUS_10040 33717 32950 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967182.1 protein_id gnl|my_center|LOCUS_10040 34141 37056 gene locus_tag LOCUS_10050 gene gcvP 34141 37056 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AK84 protein_id gnl|my_center|LOCUS_10050 37106 38353 gene locus_tag LOCUS_10060 37106 38353 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920336.1 protein_id gnl|my_center|LOCUS_10060 38361 39548 gene locus_tag LOCUS_10070 38361 39548 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_10070 39559 40674 gene locus_tag LOCUS_10080 39559 40674 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704886.1 protein_id gnl|my_center|LOCUS_10080 40682 42028 gene locus_tag LOCUS_10090 gene gor 40682 42028 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_10090 42051 42914 gene locus_tag LOCUS_10100 42051 42914 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950459.1 protein_id gnl|my_center|LOCUS_10100 43095 44183 gene locus_tag LOCUS_10110 gene aroC 43095 44183 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_10110 44235 45029 gene locus_tag LOCUS_10120 44235 45029 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_10120 46132 45080 gene locus_tag LOCUS_10130 gene gcvT 46132 45080 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64221 protein_id gnl|my_center|LOCUS_10130 46511 46164 gene locus_tag LOCUS_10140 46511 46164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 47008 46520 gene locus_tag LOCUS_10150 47008 46520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 47705 47205 gene locus_tag LOCUS_10160 47705 47205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_10160 48333 47725 gene locus_tag LOCUS_10170 48333 47725 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_10170 49055 48342 gene locus_tag LOCUS_10180 49055 48342 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226818.1 protein_id gnl|my_center|LOCUS_10180 49530 49066 gene locus_tag LOCUS_10190 49530 49066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 49916 49533 gene locus_tag LOCUS_10200 gene gcvH 49916 49533 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D905 protein_id gnl|my_center|LOCUS_10200 50534 49968 gene locus_tag LOCUS_10210 50534 49968 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977437.1 protein_id gnl|my_center|LOCUS_10210 50651 51070 gene locus_tag LOCUS_10220 50651 51070 CDS product diadenosine tetraphosphate (Ap4A) hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601801.1 protein_id gnl|my_center|LOCUS_10220 52631 51093 gene locus_tag LOCUS_10230 52631 51093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 53425 52628 gene locus_tag LOCUS_10240 53425 52628 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_10240 54618 53428 gene locus_tag LOCUS_10250 54618 53428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 55204 54785 gene locus_tag LOCUS_10260 55204 54785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence13 733 1935 gene locus_tag LOCUS_10270 733 1935 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10270 1998 2276 gene locus_tag LOCUS_10280 1998 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2276 2653 gene locus_tag LOCUS_10290 2276 2653 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980432.1 protein_id gnl|my_center|LOCUS_10290 2693 3364 gene locus_tag LOCUS_10300 2693 3364 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCH0 protein_id gnl|my_center|LOCUS_10300 3463 4353 gene locus_tag LOCUS_10310 3463 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 5048 4350 gene locus_tag LOCUS_10320 5048 4350 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103822.1 protein_id gnl|my_center|LOCUS_10320 5614 5051 gene locus_tag LOCUS_10330 5614 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 5639 6598 gene locus_tag LOCUS_10340 5639 6598 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_10340 7027 6605 gene locus_tag LOCUS_10350 7027 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 7392 8165 gene locus_tag LOCUS_10360 7392 8165 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770966.1 protein_id gnl|my_center|LOCUS_10360 8772 8191 gene locus_tag LOCUS_10370 8772 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 10040 8769 gene locus_tag LOCUS_10380 10040 8769 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713010.1 protein_id gnl|my_center|LOCUS_10380 10939 10118 gene locus_tag LOCUS_10390 10939 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 12910 11000 gene locus_tag LOCUS_10400 12910 11000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_10400 13895 12960 gene locus_tag LOCUS_10410 gene fabH 13895 12960 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HM07 protein_id gnl|my_center|LOCUS_10410 13999 14775 gene locus_tag LOCUS_10420 13999 14775 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_10420 15407 14787 gene locus_tag LOCUS_10430 15407 14787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 15658 16581 gene locus_tag LOCUS_10440 15658 16581 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_10440 16592 17668 gene locus_tag LOCUS_10450 16592 17668 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 protein_id gnl|my_center|LOCUS_10450 17727 18515 gene locus_tag LOCUS_10460 17727 18515 CDS product cobalamin/Fe3+-siderophore ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856445.1 protein_id gnl|my_center|LOCUS_10460 18512 19399 gene locus_tag LOCUS_10470 gene dhaA 18512 19399 CDS product haloalkane dehalogenase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMR9 protein_id gnl|my_center|LOCUS_10470 20193 19426 gene locus_tag LOCUS_10480 20193 19426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895390.1 protein_id gnl|my_center|LOCUS_10480 20298 21158 gene locus_tag LOCUS_10490 20298 21158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 22824 21172 gene locus_tag LOCUS_10500 22824 21172 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBN4 protein_id gnl|my_center|LOCUS_10500 23921 22887 gene locus_tag LOCUS_10510 23921 22887 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_10510 23985 24218 gene locus_tag LOCUS_10520 23985 24218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 24666 24499 gene locus_tag LOCUS_10530 24666 24499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 25033 25695 gene locus_tag LOCUS_10540 25033 25695 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_10540 27623 25692 gene locus_tag LOCUS_10550 27623 25692 CDS product acetoacetate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 protein_id gnl|my_center|LOCUS_10550 27667 28140 gene locus_tag LOCUS_10560 27667 28140 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887882.1 protein_id gnl|my_center|LOCUS_10560 28179 28649 gene locus_tag LOCUS_10570 28179 28649 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_10570 28655 29146 gene locus_tag LOCUS_10580 28655 29146 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973393.1 protein_id gnl|my_center|LOCUS_10580 29872 29279 gene locus_tag LOCUS_10590 29872 29279 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223021.1 protein_id gnl|my_center|LOCUS_10590 30222 29923 gene locus_tag LOCUS_10600 30222 29923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 31268 30219 gene locus_tag LOCUS_10610 31268 30219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 31252 32433 gene locus_tag LOCUS_10620 31252 32433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031701.1 protein_id gnl|my_center|LOCUS_10620 33051 32443 gene locus_tag LOCUS_10630 33051 32443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 33689 33063 gene locus_tag LOCUS_10640 33689 33063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 33670 34335 gene locus_tag LOCUS_10650 33670 34335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_10650 34332 35006 gene locus_tag LOCUS_10660 34332 35006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 35015 35818 gene locus_tag LOCUS_10670 35015 35818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 35853 36008 gene locus_tag LOCUS_10680 35853 36008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 36013 36537 gene locus_tag LOCUS_10690 36013 36537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 36574 38529 gene locus_tag LOCUS_10700 36574 38529 CDS product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_10700 38526 39056 gene locus_tag LOCUS_10710 38526 39056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 39053 40285 gene locus_tag LOCUS_10720 39053 40285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 40341 40973 gene locus_tag LOCUS_10730 40341 40973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 41122 41292 gene locus_tag LOCUS_10740 41122 41292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 41368 41910 gene locus_tag LOCUS_10750 41368 41910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 41828 42214 gene locus_tag LOCUS_10760 41828 42214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 42760 42266 gene locus_tag LOCUS_10770 42760 42266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 43872 42757 gene locus_tag LOCUS_10780 gene nifS 43872 42757 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066396.1 protein_id gnl|my_center|LOCUS_10780 44642 43923 gene locus_tag LOCUS_10790 44642 43923 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434123.1 protein_id gnl|my_center|LOCUS_10790 44739 45896 gene locus_tag LOCUS_10800 gene mrp 44739 45896 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX37 protein_id gnl|my_center|LOCUS_10800 45942 46169 gene locus_tag LOCUS_10810 45942 46169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 46276 47259 gene locus_tag LOCUS_10820 46276 47259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 47535 49040 gene locus_tag LOCUS_10830 47535 49040 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_10830 49088 49798 gene locus_tag LOCUS_10840 49088 49798 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887187.1 protein_id gnl|my_center|LOCUS_10840 50867 49881 gene locus_tag LOCUS_10850 50867 49881 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_10850 52214 50934 gene locus_tag LOCUS_10860 52214 50934 CDS product 6-aminohexanoate-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971260.1 protein_id gnl|my_center|LOCUS_10860 52060 51967 gene locus_tag LOCUS_t00210 52060 51967 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 52364 53143 gene locus_tag LOCUS_10870 gene fixA 52364 53143 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_10870 53153 54121 gene locus_tag LOCUS_10880 53153 54121 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence14 2066 1275 gene locus_tag LOCUS_10890 gene coaX 2066 1275 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8N6 protein_id gnl|my_center|LOCUS_10890 3030 2140 gene locus_tag LOCUS_10900 gene nadC 3030 2140 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973559.1 protein_id gnl|my_center|LOCUS_10900 4707 3127 gene locus_tag LOCUS_10910 gene nadB 4707 3127 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8N8 protein_id gnl|my_center|LOCUS_10910 5567 4704 gene locus_tag LOCUS_10920 gene panC 5567 4704 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RV66 protein_id gnl|my_center|LOCUS_10920 6283 5564 gene locus_tag LOCUS_10930 6283 5564 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230459.1 protein_id gnl|my_center|LOCUS_10930 6771 6295 gene locus_tag LOCUS_10940 6771 6295 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391686.1 protein_id gnl|my_center|LOCUS_10940 7139 6768 gene locus_tag LOCUS_10950 7139 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10950 7657 7136 gene locus_tag LOCUS_10960 7657 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 8494 7733 gene locus_tag LOCUS_10970 8494 7733 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCU6 protein_id gnl|my_center|LOCUS_10970 9147 8560 gene locus_tag LOCUS_10980 9147 8560 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211558.1 protein_id gnl|my_center|LOCUS_10980 9710 9144 gene locus_tag LOCUS_10990 gene hpt 9710 9144 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230473.1 protein_id gnl|my_center|LOCUS_10990 10612 9722 gene locus_tag LOCUS_11000 gene tilS 10612 9722 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MGT6 protein_id gnl|my_center|LOCUS_11000 11720 10647 gene locus_tag LOCUS_11010 11720 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_11010 11879 11745 gene locus_tag LOCUS_11020 11879 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 12025 11952 gene locus_tag LOCUS_t00220 12025 11952 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14436 12082 gene locus_tag LOCUS_11030 14436 12082 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KY67 protein_id gnl|my_center|LOCUS_11030 14498 15430 gene locus_tag LOCUS_11040 14498 15430 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728397.1 protein_id gnl|my_center|LOCUS_11040 16262 15456 gene locus_tag LOCUS_11050 16262 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 17171 16344 gene locus_tag LOCUS_11060 17171 16344 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084146.1 protein_id gnl|my_center|LOCUS_11060 17772 17182 gene locus_tag LOCUS_11070 17772 17182 CDS product TIGR03086 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224486.1 protein_id gnl|my_center|LOCUS_11070 19339 17777 gene locus_tag LOCUS_11080 gene guaA 19339 17777 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGP2 protein_id gnl|my_center|LOCUS_11080 20543 19380 gene locus_tag LOCUS_11090 20543 19380 CDS product guanosine monophosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_11090 22028 20616 gene locus_tag LOCUS_11100 22028 20616 CDS product aromatic-L-amino-acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_11100 22620 22021 gene locus_tag LOCUS_11110 22620 22021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 23018 22725 gene locus_tag LOCUS_11120 23018 22725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 24757 23111 gene locus_tag LOCUS_11130 gene groL2 24757 23111 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXU5 protein_id gnl|my_center|LOCUS_11130 25055 24765 gene locus_tag LOCUS_11140 gene groE 25055 24765 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVA7 protein_id gnl|my_center|LOCUS_11140 26270 25239 gene locus_tag LOCUS_11150 gene tsaD 26270 25239 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGJ3 protein_id gnl|my_center|LOCUS_11150 26815 26267 gene locus_tag LOCUS_11160 26815 26267 CDS product ribosomal-protein-alanine N-acetyltransferase RimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_11160 27513 26812 gene locus_tag LOCUS_11170 27513 26812 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_11170 28019 27507 gene locus_tag LOCUS_11180 28019 27507 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 protein_id gnl|my_center|LOCUS_11180 28591 28016 gene locus_tag LOCUS_11190 28591 28016 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_11190 29459 28614 gene locus_tag LOCUS_11200 29459 28614 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228182.1 protein_id gnl|my_center|LOCUS_11200 30604 29477 gene locus_tag LOCUS_11210 30604 29477 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_11210 31716 30622 gene locus_tag LOCUS_11220 31716 30622 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI3 protein_id gnl|my_center|LOCUS_11220 33068 31716 gene locus_tag LOCUS_11230 33068 31716 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSR4 protein_id gnl|my_center|LOCUS_11230 33437 33072 gene locus_tag LOCUS_11240 gene acpS 33437 33072 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W3 protein_id gnl|my_center|LOCUS_11240 36920 33492 gene locus_tag LOCUS_11250 36920 33492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 38324 36990 gene locus_tag LOCUS_11260 gene glmM 38324 36990 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CW62 protein_id gnl|my_center|LOCUS_11260 38772 38374 gene locus_tag LOCUS_11270 38772 38374 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814701.1 protein_id gnl|my_center|LOCUS_11270 39253 38801 gene locus_tag LOCUS_11280 gene rplM 39253 38801 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53874 protein_id gnl|my_center|LOCUS_11280 40157 39396 gene locus_tag LOCUS_11290 gene truA 40157 39396 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEW9 protein_id gnl|my_center|LOCUS_11290 40464 40171 gene locus_tag LOCUS_11300 40464 40171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 41467 40529 gene locus_tag LOCUS_11310 gene rpoA 41467 40529 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MG99 protein_id gnl|my_center|LOCUS_11310 42127 41510 gene locus_tag LOCUS_11320 gene rpsD 42127 41510 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSL7 protein_id gnl|my_center|LOCUS_11320 42527 42129 gene locus_tag LOCUS_11330 gene rpsK 42527 42129 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X7A0 protein_id gnl|my_center|LOCUS_11330 42904 42527 gene locus_tag LOCUS_11340 gene rpsM 42904 42527 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X7A1 protein_id gnl|my_center|LOCUS_11340 43469 43062 gene locus_tag LOCUS_11350 43469 43062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 44050 43466 gene locus_tag LOCUS_11360 gene adk 44050 43466 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY1 protein_id gnl|my_center|LOCUS_11360 45381 44059 gene locus_tag LOCUS_11370 gene secY 45381 44059 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGN3 protein_id gnl|my_center|LOCUS_11370 45900 45415 gene locus_tag LOCUS_11380 gene rplO 45900 45415 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88XW7 protein_id gnl|my_center|LOCUS_11380 46096 45902 gene locus_tag LOCUS_11390 gene rpmD 46096 45902 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NSX3 protein_id gnl|my_center|LOCUS_11390 46683 46099 gene locus_tag LOCUS_11400 gene rpsE 46683 46099 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSG6 protein_id gnl|my_center|LOCUS_11400 47045 46683 gene locus_tag LOCUS_11410 gene rplR 47045 46683 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEG8 protein_id gnl|my_center|LOCUS_11410 47581 47042 gene locus_tag LOCUS_11420 gene rplF 47581 47042 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CV34 protein_id gnl|my_center|LOCUS_11420 47998 47594 gene locus_tag LOCUS_11430 gene rpsH 47998 47594 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66626 protein_id gnl|my_center|LOCUS_11430 48197 48012 gene locus_tag LOCUS_11440 gene rpsZ 48197 48012 CDS product 30S ribosomal protein S14 type Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSG2 protein_id gnl|my_center|LOCUS_11440 48766 48197 gene locus_tag LOCUS_11450 gene rplE 48766 48197 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0C8 protein_id gnl|my_center|LOCUS_11450 49073 48759 gene locus_tag LOCUS_11460 gene rplX 49073 48759 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q034Z4 protein_id gnl|my_center|LOCUS_11460 49443 49075 gene locus_tag LOCUS_11470 gene rplN 49443 49075 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CV29 protein_id gnl|my_center|LOCUS_11470 49736 49443 gene locus_tag LOCUS_11480 gene rpsQ 49736 49443 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFQ6 protein_id gnl|my_center|LOCUS_11480 49969 49736 gene locus_tag LOCUS_11490 49969 49736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 50385 49969 gene locus_tag LOCUS_11500 gene rplP 50385 49969 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06049 protein_id gnl|my_center|LOCUS_11500 51317 50388 gene locus_tag LOCUS_11510 51317 50388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 52171 51317 gene locus_tag LOCUS_11520 52171 51317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 52449 52171 gene locus_tag LOCUS_11530 gene rpsS 52449 52171 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYY4 protein_id gnl|my_center|LOCUS_11530 53292 52456 gene locus_tag LOCUS_11540 gene rplB 53292 52456 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHA5 protein_id gnl|my_center|LOCUS_11540 53588 53298 gene locus_tag LOCUS_11550 53588 53298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence15 128 1861 gene locus_tag LOCUS_11560 128 1861 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_11560 1864 2334 gene locus_tag LOCUS_11570 1864 2334 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975651.1 protein_id gnl|my_center|LOCUS_11570 2403 2777 gene locus_tag LOCUS_11580 2403 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 3262 2801 gene locus_tag LOCUS_11590 3262 2801 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975746.1 protein_id gnl|my_center|LOCUS_11590 3375 3623 gene locus_tag LOCUS_11600 3375 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3742 4659 gene locus_tag LOCUS_11610 3742 4659 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974772.1 protein_id gnl|my_center|LOCUS_11610 4708 5607 gene locus_tag LOCUS_11620 4708 5607 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_11620 6059 5595 gene locus_tag LOCUS_11630 6059 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 6209 6547 gene locus_tag LOCUS_11640 6209 6547 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_11640 6609 7457 gene locus_tag LOCUS_11650 6609 7457 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815541.1 protein_id gnl|my_center|LOCUS_11650 7524 7832 gene locus_tag LOCUS_11660 7524 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 7914 8246 gene locus_tag LOCUS_11670 7914 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 8243 8722 gene locus_tag LOCUS_11680 8243 8722 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SX7 protein_id gnl|my_center|LOCUS_11680 9785 8727 gene locus_tag LOCUS_11690 9785 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031788.1 protein_id gnl|my_center|LOCUS_11690 10966 10115 gene locus_tag LOCUS_11700 10966 10115 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_11700 11029 12111 gene locus_tag LOCUS_11710 11029 12111 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729610.1 protein_id gnl|my_center|LOCUS_11710 12149 12598 gene locus_tag LOCUS_11720 12149 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11720 12595 13188 gene locus_tag LOCUS_11730 12595 13188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11730 13181 14248 gene locus_tag LOCUS_11740 13181 14248 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730896.1 protein_id gnl|my_center|LOCUS_11740 14251 15414 gene locus_tag LOCUS_11750 gene atoB 14251 15414 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_11750 15483 15674 gene locus_tag LOCUS_11760 15483 15674 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730111.1 protein_id gnl|my_center|LOCUS_11760 15716 16921 gene locus_tag LOCUS_11770 15716 16921 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727657.1 protein_id gnl|my_center|LOCUS_11770 16912 17421 gene locus_tag LOCUS_11780 16912 17421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 19908 17440 gene locus_tag LOCUS_11790 19908 17440 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140731.1 protein_id gnl|my_center|LOCUS_11790 19907 20392 gene locus_tag LOCUS_11800 19907 20392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 20577 21572 gene locus_tag LOCUS_11810 20577 21572 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968402.1 protein_id gnl|my_center|LOCUS_11810 21630 22490 gene locus_tag LOCUS_11820 21630 22490 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_11820 23171 22512 gene locus_tag LOCUS_11830 23171 22512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 23153 24382 gene locus_tag LOCUS_11840 23153 24382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_11840 25859 24399 gene locus_tag LOCUS_11850 25859 24399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11850 26497 25859 gene locus_tag LOCUS_11860 26497 25859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11860 27637 26531 gene locus_tag LOCUS_11870 gene add 27637 26531 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVL3 protein_id gnl|my_center|LOCUS_11870 27702 29009 gene locus_tag LOCUS_11880 27702 29009 CDS product ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230981.1 protein_id gnl|my_center|LOCUS_11880 29006 29461 gene locus_tag LOCUS_11890 29006 29461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227124.1 protein_id gnl|my_center|LOCUS_11890 30244 29489 gene locus_tag LOCUS_11900 30244 29489 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974911.1 protein_id gnl|my_center|LOCUS_11900 30355 31437 gene locus_tag LOCUS_11910 gene mtnA 30355 31437 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGQ8 protein_id gnl|my_center|LOCUS_11910 32999 31443 gene locus_tag LOCUS_11920 32999 31443 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256433.1 protein_id gnl|my_center|LOCUS_11920 33994 33005 gene locus_tag LOCUS_11930 33994 33005 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259763.1 protein_id gnl|my_center|LOCUS_11930 35040 33991 gene locus_tag LOCUS_11940 35040 33991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256434.1 protein_id gnl|my_center|LOCUS_11940 35589 35197 gene locus_tag LOCUS_11950 35589 35197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 35812 35645 gene locus_tag LOCUS_11960 35812 35645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 35870 36943 gene locus_tag LOCUS_11970 gene ychF 35870 36943 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9UTA5 protein_id gnl|my_center|LOCUS_11970 36977 37315 gene locus_tag LOCUS_11980 36977 37315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11980 37312 38136 gene locus_tag LOCUS_11990 gene rsmI 37312 38136 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR7 protein_id gnl|my_center|LOCUS_11990 38199 39869 gene locus_tag LOCUS_12000 gene metG 38199 39869 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKM1 protein_id gnl|my_center|LOCUS_12000 39866 40630 gene locus_tag LOCUS_12010 39866 40630 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_12010 40819 41604 gene locus_tag LOCUS_12020 40819 41604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 41614 42429 gene locus_tag LOCUS_12030 gene ksgA 41614 42429 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGV9 protein_id gnl|my_center|LOCUS_12030 42426 43169 gene locus_tag LOCUS_12040 gene ispE 42426 43169 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5K7 protein_id gnl|my_center|LOCUS_12040 43688 44098 gene locus_tag LOCUS_12050 43688 44098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12050 44158 45393 gene locus_tag LOCUS_12060 44158 45393 CDS product creatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 protein_id gnl|my_center|LOCUS_12060 45429 45504 gene locus_tag LOCUS_t00230 45429 45504 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 46525 45542 gene locus_tag LOCUS_12070 46525 45542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 46839 46588 gene locus_tag LOCUS_12080 46839 46588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 46861 47607 gene locus_tag LOCUS_12090 46861 47607 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 protein_id gnl|my_center|LOCUS_12090 48304 47633 gene locus_tag LOCUS_12100 48304 47633 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528032.1 protein_id gnl|my_center|LOCUS_12100 49236 48301 gene locus_tag LOCUS_12110 49236 48301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085509.1 protein_id gnl|my_center|LOCUS_12110 50146 50241 gene locus_tag LOCUS_t00240 50146 50241 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence16 383 1618 gene locus_tag LOCUS_12120 383 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1639 3717 gene locus_tag LOCUS_12130 1639 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3714 4490 gene locus_tag LOCUS_12140 3714 4490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938016.1 protein_id gnl|my_center|LOCUS_12140 4487 5203 gene locus_tag LOCUS_12150 4487 5203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228129.1 protein_id gnl|my_center|LOCUS_12150 5208 6059 gene locus_tag LOCUS_12160 gene tesB 5208 6059 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225695.1 protein_id gnl|my_center|LOCUS_12160 6056 7249 gene locus_tag LOCUS_12170 6056 7249 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730110.1 protein_id gnl|my_center|LOCUS_12170 7360 8721 gene locus_tag LOCUS_12180 7360 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 9950 8718 gene locus_tag LOCUS_12190 9950 8718 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089277.1 protein_id gnl|my_center|LOCUS_12190 12133 10001 gene locus_tag LOCUS_12200 12133 10001 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_12200 13715 12807 gene locus_tag LOCUS_12210 gene metF 13715 12807 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDM1 protein_id gnl|my_center|LOCUS_12210 15521 13824 gene locus_tag LOCUS_12220 gene fhs 15521 13824 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIW3 protein_id gnl|my_center|LOCUS_12220 17236 15695 gene locus_tag LOCUS_12230 17236 15695 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_12230 19239 17233 gene locus_tag LOCUS_12240 19239 17233 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531166.1 protein_id gnl|my_center|LOCUS_12240 20163 19267 gene locus_tag LOCUS_12250 20163 19267 CDS product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969617.1 protein_id gnl|my_center|LOCUS_12250 20526 20221 gene locus_tag LOCUS_12260 20526 20221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708372.1 protein_id gnl|my_center|LOCUS_12260 21198 20530 gene locus_tag LOCUS_12270 21198 20530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708368.1 protein_id gnl|my_center|LOCUS_12270 21920 21204 gene locus_tag LOCUS_12280 21920 21204 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708366.1 protein_id gnl|my_center|LOCUS_12280 22118 22870 gene locus_tag LOCUS_12290 22118 22870 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775990.1 protein_id gnl|my_center|LOCUS_12290 22912 23739 gene locus_tag LOCUS_12300 22912 23739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 23777 24604 gene locus_tag LOCUS_12310 23777 24604 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266698.1 protein_id gnl|my_center|LOCUS_12310 24813 27347 gene locus_tag LOCUS_12320 24813 27347 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775989.1 protein_id gnl|my_center|LOCUS_12320 27390 28157 gene locus_tag LOCUS_12330 27390 28157 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_12330 28192 29163 gene locus_tag LOCUS_12340 28192 29163 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228468.1 protein_id gnl|my_center|LOCUS_12340 30973 29198 gene locus_tag LOCUS_12350 30973 29198 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_12350 32300 31029 gene locus_tag LOCUS_12360 32300 31029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404277.1 protein_id gnl|my_center|LOCUS_12360 33578 32367 gene locus_tag LOCUS_12370 33578 32367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 33753 34649 gene locus_tag LOCUS_12380 33753 34649 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030805.1 protein_id gnl|my_center|LOCUS_12380 34711 36192 gene locus_tag LOCUS_12390 gene lcdH 34711 36192 CDS product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D3B2 protein_id gnl|my_center|LOCUS_12390 36208 37368 gene locus_tag LOCUS_12400 36208 37368 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528296.1 protein_id gnl|my_center|LOCUS_12400 37382 39406 gene locus_tag LOCUS_12410 37382 39406 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528297.1 protein_id gnl|my_center|LOCUS_12410 39403 40185 gene locus_tag LOCUS_12420 gene caiD 39403 40185 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y7N0 protein_id gnl|my_center|LOCUS_12420 40286 40543 gene locus_tag LOCUS_12430 40286 40543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12430 40721 42205 gene locus_tag LOCUS_12440 40721 42205 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972418.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12440 42198 43988 gene locus_tag LOCUS_12450 gene nuoF 42198 43988 CDS product NADH dehydrogenase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_12450 43985 44848 gene locus_tag LOCUS_12460 43985 44848 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226418.1 protein_id gnl|my_center|LOCUS_12460 45508 44873 gene locus_tag LOCUS_12470 45508 44873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 45597 46448 gene locus_tag LOCUS_12480 45597 46448 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529754.1 protein_id gnl|my_center|LOCUS_12480 46450 47211 gene locus_tag LOCUS_12490 46450 47211 CDS product amino acid ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938267.1 protein_id gnl|my_center|LOCUS_12490 47246 48541 gene locus_tag LOCUS_12500 47246 48541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709437.1 protein_id gnl|my_center|LOCUS_12500 48534 48965 gene locus_tag LOCUS_12510 48534 48965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709436.1 protein_id gnl|my_center|LOCUS_12510 49326 49021 gene locus_tag LOCUS_12520 49326 49021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12520 49584 49327 gene locus_tag LOCUS_12530 49584 49327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence17 109 1305 gene locus_tag LOCUS_12540 109 1305 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730097.1 protein_id gnl|my_center|LOCUS_12540 1387 2502 gene locus_tag LOCUS_12550 1387 2502 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730098.1 protein_id gnl|my_center|LOCUS_12550 3707 2499 gene locus_tag LOCUS_12560 3707 2499 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728246.1 protein_id gnl|my_center|LOCUS_12560 3827 4645 gene locus_tag LOCUS_12570 3827 4645 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216393.1 protein_id gnl|my_center|LOCUS_12570 5899 4679 gene locus_tag LOCUS_12580 5899 4679 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228936.1 protein_id gnl|my_center|LOCUS_12580 7388 5925 gene locus_tag LOCUS_12590 7388 5925 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728244.1 protein_id gnl|my_center|LOCUS_12590 8611 7409 gene locus_tag LOCUS_12600 8611 7409 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228930.1 protein_id gnl|my_center|LOCUS_12600 8813 8604 gene locus_tag LOCUS_12610 8813 8604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 10017 8827 gene locus_tag LOCUS_12620 10017 8827 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728743.1 protein_id gnl|my_center|LOCUS_12620 11353 10046 gene locus_tag LOCUS_12630 11353 10046 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 protein_id gnl|my_center|LOCUS_12630 12032 11418 gene locus_tag LOCUS_12640 12032 11418 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893694.1 protein_id gnl|my_center|LOCUS_12640 13267 12146 gene locus_tag LOCUS_12650 13267 12146 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383812.1 protein_id gnl|my_center|LOCUS_12650 14069 13278 gene locus_tag LOCUS_12660 14069 13278 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709003.1 protein_id gnl|my_center|LOCUS_12660 14845 14066 gene locus_tag LOCUS_12670 14845 14066 CDS product sulfonate ABC transporter ATP-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066592.1 protein_id gnl|my_center|LOCUS_12670 15708 14842 gene locus_tag LOCUS_12680 15708 14842 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969951.1 protein_id gnl|my_center|LOCUS_12680 16600 15713 gene locus_tag LOCUS_12690 16600 15713 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708258.1 protein_id gnl|my_center|LOCUS_12690 17181 16597 gene locus_tag LOCUS_12700 17181 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530297.1 protein_id gnl|my_center|LOCUS_12700 18268 17264 gene locus_tag LOCUS_12710 gene hmd 18268 17264 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228421.1 protein_id gnl|my_center|LOCUS_12710 19797 18310 gene locus_tag LOCUS_12720 19797 18310 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_12720 21232 19820 gene locus_tag LOCUS_12730 gene hydA 21232 19820 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895004.1 protein_id gnl|my_center|LOCUS_12730 22595 21306 gene locus_tag LOCUS_12740 22595 21306 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_12740 23484 22642 gene locus_tag LOCUS_12750 23484 22642 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972565.1 protein_id gnl|my_center|LOCUS_12750 23695 25338 gene locus_tag LOCUS_12760 23695 25338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730106.1 protein_id gnl|my_center|LOCUS_12760 25335 26603 gene locus_tag LOCUS_12770 25335 26603 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730096.1 protein_id gnl|my_center|LOCUS_12770 26605 27807 gene locus_tag LOCUS_12780 26605 27807 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730135.1 protein_id gnl|my_center|LOCUS_12780 27804 28751 gene locus_tag LOCUS_12790 27804 28751 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730134.1 protein_id gnl|my_center|LOCUS_12790 28760 29815 gene locus_tag LOCUS_12800 28760 29815 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730117.1 protein_id gnl|my_center|LOCUS_12800 29865 31172 gene locus_tag LOCUS_12810 29865 31172 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 protein_id gnl|my_center|LOCUS_12810 32397 31195 gene locus_tag LOCUS_12820 32397 31195 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064432.1 protein_id gnl|my_center|LOCUS_12820 33231 32401 gene locus_tag LOCUS_12830 33231 32401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 34454 33255 gene locus_tag LOCUS_12840 gene fadE17 34454 33255 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 protein_id gnl|my_center|LOCUS_12840 34522 35577 gene locus_tag LOCUS_12850 34522 35577 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_12850 35991 35581 gene locus_tag LOCUS_12860 35991 35581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 35990 37222 gene locus_tag LOCUS_12870 35990 37222 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225242.1 protein_id gnl|my_center|LOCUS_12870 38875 37238 gene locus_tag LOCUS_12880 38875 37238 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729090.1 protein_id gnl|my_center|LOCUS_12880 39107 40453 gene locus_tag LOCUS_12890 39107 40453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 40486 41319 gene locus_tag LOCUS_12900 40486 41319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 41622 41308 gene locus_tag LOCUS_12910 41622 41308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 42380 41673 gene locus_tag LOCUS_12920 42380 41673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 43305 42520 gene locus_tag LOCUS_12930 43305 42520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 43440 44423 gene locus_tag LOCUS_12940 43440 44423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 44839 44420 gene locus_tag LOCUS_12950 44839 44420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 45525 44836 gene locus_tag LOCUS_12960 45525 44836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 46910 45720 gene locus_tag LOCUS_12970 46910 45720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_12970 48345 46972 gene locus_tag LOCUS_12980 48345 46972 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225960.1 protein_id gnl|my_center|LOCUS_12980 49240 48362 gene locus_tag LOCUS_12990 49240 48362 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence18 337 2613 gene locus_tag LOCUS_13000 gene acnA 337 2613 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_13000 3357 2665 gene locus_tag LOCUS_13010 3357 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 3587 3384 gene locus_tag LOCUS_13020 3587 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 3985 5643 gene locus_tag LOCUS_13030 3985 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064619.1 protein_id gnl|my_center|LOCUS_13030 5686 6687 gene locus_tag LOCUS_13040 5686 6687 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038831.1 protein_id gnl|my_center|LOCUS_13040 7098 6730 gene locus_tag LOCUS_13050 7098 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 7270 10035 gene locus_tag LOCUS_13060 7270 10035 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KY19 protein_id gnl|my_center|LOCUS_13060 10083 10673 gene locus_tag LOCUS_13070 10083 10673 CDS product (Fe-S)-cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_13070 11648 10698 gene locus_tag LOCUS_13080 gene wcaG 11648 10698 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FX3 protein_id gnl|my_center|LOCUS_13080 12125 11658 gene locus_tag LOCUS_13090 12125 11658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 13318 12203 gene locus_tag LOCUS_13100 gene acd 13318 12203 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_13100 13641 14258 gene locus_tag LOCUS_13110 13641 14258 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_13110 14288 14698 gene locus_tag LOCUS_13120 14288 14698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 14811 15632 gene locus_tag LOCUS_13130 14811 15632 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805067.1 protein_id gnl|my_center|LOCUS_13130 15629 16861 gene locus_tag LOCUS_13140 15629 16861 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKN9 protein_id gnl|my_center|LOCUS_13140 16938 17411 gene locus_tag LOCUS_13150 gene iscU 16938 17411 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058819.1 protein_id gnl|my_center|LOCUS_13150 17710 17408 gene locus_tag LOCUS_13160 gene phhB 17710 17408 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7S9 protein_id gnl|my_center|LOCUS_13160 18539 17727 gene locus_tag LOCUS_13170 gene sufC 18539 17727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919728.1 protein_id gnl|my_center|LOCUS_13170 18862 18536 gene locus_tag LOCUS_13180 18862 18536 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_13180 20085 18859 gene locus_tag LOCUS_13190 20085 18859 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_13190 20618 20400 gene locus_tag LOCUS_13200 20618 20400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 20720 22018 gene locus_tag LOCUS_13210 20720 22018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 22015 23052 gene locus_tag LOCUS_13220 22015 23052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 23717 22956 gene locus_tag LOCUS_13230 23717 22956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 23796 24020 gene locus_tag LOCUS_13240 gene madF 23796 24020 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811628.1 protein_id gnl|my_center|LOCUS_13240 25668 24040 gene locus_tag LOCUS_13250 25668 24040 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_13250 26888 25665 gene locus_tag LOCUS_13260 26888 25665 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 protein_id gnl|my_center|LOCUS_13260 27037 27858 gene locus_tag LOCUS_13270 gene paaG 27037 27858 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228963.1 protein_id gnl|my_center|LOCUS_13270 29089 27881 gene locus_tag LOCUS_13280 29089 27881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 30086 29136 gene locus_tag LOCUS_13290 gene selD 30086 29136 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D9Y2 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13290 31402 30230 gene locus_tag LOCUS_13300 31402 30230 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_13300 31458 31907 gene locus_tag LOCUS_13310 31458 31907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 31904 32455 gene locus_tag LOCUS_13320 31904 32455 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225670.1 protein_id gnl|my_center|LOCUS_13320 32452 34293 gene locus_tag LOCUS_13330 gene aceK 32452 34293 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3W8 protein_id gnl|my_center|LOCUS_13330 34331 35002 gene locus_tag LOCUS_13340 34331 35002 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9K4 protein_id gnl|my_center|LOCUS_13340 35088 35708 gene locus_tag LOCUS_13350 gene clpP2 35088 35708 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NN01 protein_id gnl|my_center|LOCUS_13350 35746 35828 gene locus_tag LOCUS_t00250 35746 35828 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35943 38324 gene locus_tag LOCUS_13360 35943 38324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 38930 38340 gene locus_tag LOCUS_13370 gene rdgB 38930 38340 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3D3 protein_id gnl|my_center|LOCUS_13370 39658 38939 gene locus_tag LOCUS_13380 gene rph 39658 38939 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEJ1 protein_id gnl|my_center|LOCUS_13380 40699 39740 gene locus_tag LOCUS_13390 gene cysK 40699 39740 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_13390 41309 40791 gene locus_tag LOCUS_13400 gene mec 41309 40791 CDS product CysO-cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64814 protein_id gnl|my_center|LOCUS_13400 41354 41899 gene locus_tag LOCUS_13410 gene smpB 41354 41899 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM0 protein_id gnl|my_center|LOCUS_13410 42053 42439 gene locus_tag LOCUS_tm00010 42053 42439 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 42737 43609 gene locus_tag LOCUS_13420 42737 43609 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968071.1 protein_id gnl|my_center|LOCUS_13420 43613 44095 gene locus_tag LOCUS_13430 43613 44095 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_13430 44092 46314 gene locus_tag LOCUS_13440 44092 46314 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 protein_id gnl|my_center|LOCUS_13440 46325 46570 gene locus_tag LOCUS_13450 46325 46570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 47558 46734 gene locus_tag LOCUS_13460 47558 46734 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227569.1 protein_id gnl|my_center|LOCUS_13460 48781 48972 gene locus_tag LOCUS_13470 48781 48972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 49374 49060 gene locus_tag LOCUS_13480 49374 49060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence19 1033 179 gene locus_tag LOCUS_13490 1033 179 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z513 protein_id gnl|my_center|LOCUS_13490 3019 1130 gene locus_tag LOCUS_13500 gene uvrC 3019 1130 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4X3 protein_id gnl|my_center|LOCUS_13500 3252 4343 gene locus_tag LOCUS_13510 gene nadA 3252 4343 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NRI0 protein_id gnl|my_center|LOCUS_13510 7322 4395 gene locus_tag LOCUS_13520 gene uvrA 7322 4395 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z507 protein_id gnl|my_center|LOCUS_13520 9378 7354 gene locus_tag LOCUS_13530 gene uvrB 9378 7354 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WFC7 protein_id gnl|my_center|LOCUS_13530 10079 9432 gene locus_tag LOCUS_13540 gene coaE 10079 9432 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2K7 protein_id gnl|my_center|LOCUS_13540 11789 10128 gene locus_tag LOCUS_13550 11789 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 12677 11898 gene locus_tag LOCUS_13560 12677 11898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 15411 12712 gene locus_tag LOCUS_13570 gene polA 15411 12712 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A551 protein_id gnl|my_center|LOCUS_13570 16036 15449 gene locus_tag LOCUS_13580 16036 15449 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_13580 16328 16038 gene locus_tag LOCUS_13590 16328 16038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 16517 16433 gene locus_tag LOCUS_t00260 16517 16433 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16676 17854 gene locus_tag LOCUS_13600 gene fabD 16676 17854 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71019 protein_id gnl|my_center|LOCUS_13600 17924 18640 gene locus_tag LOCUS_13610 17924 18640 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_13610 18770 19006 gene locus_tag LOCUS_13620 gene acpP 18770 19006 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63439 protein_id gnl|my_center|LOCUS_13620 19006 20178 gene locus_tag LOCUS_13630 gene fabF 19006 20178 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67612 protein_id gnl|my_center|LOCUS_13630 20691 20242 gene locus_tag LOCUS_13640 gene fabZ 20691 20242 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLY7 protein_id gnl|my_center|LOCUS_13640 21200 20856 gene locus_tag LOCUS_13650 gene hup1 21200 20856 CDS product DNA-binding protein HU 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3H5 protein_id gnl|my_center|LOCUS_13650 22175 21396 gene locus_tag LOCUS_13660 gene trpA 22175 21396 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68816 protein_id gnl|my_center|LOCUS_13660 23341 22175 gene locus_tag LOCUS_13670 23341 22175 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877267.1 protein_id gnl|my_center|LOCUS_13670 23994 23332 gene locus_tag LOCUS_13680 gene trpF 23994 23332 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56320 protein_id gnl|my_center|LOCUS_13680 24819 24004 gene locus_tag LOCUS_13690 gene trpC 24819 24004 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MNZ4 protein_id gnl|my_center|LOCUS_13690 25717 24872 gene locus_tag LOCUS_13700 25717 24872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 27237 25714 gene locus_tag LOCUS_13710 gene trpE 27237 25714 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_13710 27628 27242 gene locus_tag LOCUS_13720 27628 27242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 28022 27687 gene locus_tag LOCUS_13730 28022 27687 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZQ4 protein_id gnl|my_center|LOCUS_13730 28793 28086 gene locus_tag LOCUS_13740 gene hisF 28793 28086 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW2 protein_id gnl|my_center|LOCUS_13740 29617 28859 gene locus_tag LOCUS_13750 gene hisA 29617 28859 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50936 protein_id gnl|my_center|LOCUS_13750 30264 29614 gene locus_tag LOCUS_13760 30264 29614 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_13760 30886 30287 gene locus_tag LOCUS_13770 30886 30287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 31997 30888 gene locus_tag LOCUS_13780 gene hisC 31997 30888 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16246 protein_id gnl|my_center|LOCUS_13780 33324 31990 gene locus_tag LOCUS_13790 gene hisD 33324 31990 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0P8 protein_id gnl|my_center|LOCUS_13790 33366 33653 gene locus_tag LOCUS_13800 33366 33653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 34611 33940 gene locus_tag LOCUS_13810 gene nth 34611 33940 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NTL4 protein_id gnl|my_center|LOCUS_13810 34649 35383 gene locus_tag LOCUS_13820 gene mshD 34649 35383 CDS product mycothiol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MI19 protein_id gnl|my_center|LOCUS_13820 35394 36482 gene locus_tag LOCUS_13830 gene rlmN 35394 36482 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFY6 protein_id gnl|my_center|LOCUS_13830 36487 36825 gene locus_tag LOCUS_13840 36487 36825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 36986 37624 gene locus_tag LOCUS_13850 gene ubiE 36986 37624 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU2 protein_id gnl|my_center|LOCUS_13850 38527 37658 gene locus_tag LOCUS_13860 gene menA 38527 37658 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QR52 protein_id gnl|my_center|LOCUS_13860 38599 40584 gene locus_tag LOCUS_13870 38599 40584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 41477 40719 gene locus_tag LOCUS_13880 41477 40719 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730386.1 protein_id gnl|my_center|LOCUS_13880 42744 41548 gene locus_tag LOCUS_13890 42744 41548 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811506.1 protein_id gnl|my_center|LOCUS_13890 43214 42807 gene locus_tag LOCUS_13900 43214 42807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 43924 43268 gene locus_tag LOCUS_13910 43924 43268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 44637 43969 gene locus_tag LOCUS_13920 44637 43969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 48361 44807 gene locus_tag LOCUS_13930 gene dnaE 48361 44807 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63978 protein_id gnl|my_center|LOCUS_13930 >Feature sequence20 559 2169 gene locus_tag LOCUS_13940 559 2169 CDS product fatty-acyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228885.1 protein_id gnl|my_center|LOCUS_13940 3654 2197 gene locus_tag LOCUS_13950 3654 2197 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814808.1 protein_id gnl|my_center|LOCUS_13950 4652 3666 gene locus_tag LOCUS_13960 gene fbpC 4652 3666 CDS product Fe(3+) ions import ATP-binding protein FbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86751 protein_id gnl|my_center|LOCUS_13960 6268 4649 gene locus_tag LOCUS_13970 6268 4649 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030361.1 protein_id gnl|my_center|LOCUS_13970 7427 6285 gene locus_tag LOCUS_13980 7427 6285 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030360.1 protein_id gnl|my_center|LOCUS_13980 10076 7527 gene locus_tag LOCUS_13990 10076 7527 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256961.1 protein_id gnl|my_center|LOCUS_13990 10152 11909 gene locus_tag LOCUS_14000 10152 11909 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_14000 13985 11925 gene locus_tag LOCUS_14010 gene fusA 13985 11925 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_14010 14382 14038 gene locus_tag LOCUS_14020 14382 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 14263 15552 gene locus_tag LOCUS_14030 gene phoH2 14263 15552 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405802.1 protein_id gnl|my_center|LOCUS_14030 15618 17210 gene locus_tag LOCUS_14040 15618 17210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 17243 19432 gene locus_tag LOCUS_14050 17243 19432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 20233 19457 gene locus_tag LOCUS_14060 20233 19457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 21521 20289 gene locus_tag LOCUS_14070 21521 20289 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_14070 21896 21561 gene locus_tag LOCUS_14080 21896 21561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 21919 22293 gene locus_tag LOCUS_14090 21919 22293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 22357 22494 gene locus_tag LOCUS_14100 22357 22494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 22457 23293 gene locus_tag LOCUS_14110 gene fadB 22457 23293 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085730.1 protein_id gnl|my_center|LOCUS_14110 23278 24213 gene locus_tag LOCUS_14120 23278 24213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 24329 25264 gene locus_tag LOCUS_14130 24329 25264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 25273 25884 gene locus_tag LOCUS_14140 25273 25884 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940338.1 protein_id gnl|my_center|LOCUS_14140 25881 26783 gene locus_tag LOCUS_14150 25881 26783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522101.1 protein_id gnl|my_center|LOCUS_14150 26840 27289 gene locus_tag LOCUS_14160 gene nodN 26840 27289 CDS product nodulation protein NodN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709399.1 protein_id gnl|my_center|LOCUS_14160 27259 28905 gene locus_tag LOCUS_14170 27259 28905 CDS product substrate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807754.1 protein_id gnl|my_center|LOCUS_14170 28932 29858 gene locus_tag LOCUS_14180 gene folD2 28932 29858 CDS product bifunctional protein FolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EU7 protein_id gnl|my_center|LOCUS_14180 29957 30169 gene locus_tag LOCUS_14190 29957 30169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 30166 30498 gene locus_tag LOCUS_14200 30166 30498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 30757 32154 gene locus_tag LOCUS_14210 30757 32154 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896012.1 protein_id gnl|my_center|LOCUS_14210 32306 32542 gene locus_tag LOCUS_14220 32306 32542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 32544 32690 gene locus_tag LOCUS_14230 32544 32690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 32710 33075 gene locus_tag LOCUS_14240 32710 33075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 33068 34255 gene locus_tag LOCUS_14250 33068 34255 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976232.1 protein_id gnl|my_center|LOCUS_14250 35621 34281 gene locus_tag LOCUS_14260 35621 34281 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053632.1 protein_id gnl|my_center|LOCUS_14260 36129 35710 gene locus_tag LOCUS_14270 36129 35710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 37569 36139 gene locus_tag LOCUS_14280 37569 36139 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762863.1 protein_id gnl|my_center|LOCUS_14280 38370 37582 gene locus_tag LOCUS_14290 gene fwdC 38370 37582 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973661.1 protein_id gnl|my_center|LOCUS_14290 39287 38358 gene locus_tag LOCUS_14300 39287 38358 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_14300 40771 39359 gene locus_tag LOCUS_14310 40771 39359 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731465.1 protein_id gnl|my_center|LOCUS_14310 40997 43360 gene locus_tag LOCUS_14320 40997 43360 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067519.1 protein_id gnl|my_center|LOCUS_14320 47280 43450 gene locus_tag LOCUS_14330 47280 43450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 48300 47290 gene locus_tag LOCUS_14340 48300 47290 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence21 2198 1269 gene locus_tag LOCUS_14350 2198 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14350 3918 2302 gene locus_tag LOCUS_14360 3918 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459733.1 protein_id gnl|my_center|LOCUS_14360 5197 3971 gene locus_tag LOCUS_14370 5197 3971 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_14370 7553 5223 gene locus_tag LOCUS_14380 7553 5223 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_14380 7620 8294 gene locus_tag LOCUS_14390 7620 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 9429 8326 gene locus_tag LOCUS_14400 gene ddlA 9429 8326 CDS product D-alanine--D-alanine ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDW3 protein_id gnl|my_center|LOCUS_14400 9504 10802 gene locus_tag LOCUS_14410 gene murF 9504 10802 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2W8 protein_id gnl|my_center|LOCUS_14410 11161 10820 gene locus_tag LOCUS_14420 11161 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 11482 11183 gene locus_tag LOCUS_14430 11482 11183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 11697 12326 gene locus_tag LOCUS_14440 11697 12326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 12317 12393 gene locus_tag LOCUS_t00270 12317 12393 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13487 12462 gene locus_tag LOCUS_14450 13487 12462 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865348.1 protein_id gnl|my_center|LOCUS_14450 14950 13688 gene locus_tag LOCUS_14460 14950 13688 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_14460 15208 16959 gene locus_tag LOCUS_14470 15208 16959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 18057 17047 gene locus_tag LOCUS_14480 18057 17047 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FJQ3 protein_id gnl|my_center|LOCUS_14480 18223 19398 gene locus_tag LOCUS_14490 18223 19398 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728246.1 protein_id gnl|my_center|LOCUS_14490 19547 19744 gene locus_tag LOCUS_14500 19547 19744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 19809 20420 gene locus_tag LOCUS_14510 19809 20420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 21296 20427 gene locus_tag LOCUS_14520 21296 20427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 21937 21293 gene locus_tag LOCUS_14530 21937 21293 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258927.1 protein_id gnl|my_center|LOCUS_14530 22716 21934 gene locus_tag LOCUS_14540 22716 21934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_14540 23469 22753 gene locus_tag LOCUS_14550 23469 22753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967724.1 protein_id gnl|my_center|LOCUS_14550 25400 23466 gene locus_tag LOCUS_14560 25400 23466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 protein_id gnl|my_center|LOCUS_14560 27316 25400 gene locus_tag LOCUS_14570 27316 25400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14570 27756 27313 gene locus_tag LOCUS_14580 27756 27313 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027124.1 protein_id gnl|my_center|LOCUS_14580 27841 28170 gene locus_tag LOCUS_14590 27841 28170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 28233 29135 gene locus_tag LOCUS_14600 28233 29135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 29175 30482 gene locus_tag LOCUS_14610 29175 30482 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_14610 30479 31525 gene locus_tag LOCUS_14620 30479 31525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 31588 32388 gene locus_tag LOCUS_14630 31588 32388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 33178 32411 gene locus_tag LOCUS_14640 33178 32411 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D7T0 protein_id gnl|my_center|LOCUS_14640 33301 35304 gene locus_tag LOCUS_14650 33301 35304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 35596 36252 gene locus_tag LOCUS_14660 35596 36252 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_14660 36322 38298 gene locus_tag LOCUS_14670 gene thrS 36322 38298 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L278 protein_id gnl|my_center|LOCUS_14670 38295 38822 gene locus_tag LOCUS_14680 38295 38822 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_14680 38822 40459 gene locus_tag LOCUS_14690 38822 40459 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776491.1 protein_id gnl|my_center|LOCUS_14690 40509 41384 gene locus_tag LOCUS_14700 40509 41384 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978391.1 protein_id gnl|my_center|LOCUS_14700 42415 41369 gene locus_tag LOCUS_14710 42415 41369 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228627.1 protein_id gnl|my_center|LOCUS_14710 43325 42477 gene locus_tag LOCUS_14720 43325 42477 CDS product periplasmic solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392447.1 protein_id gnl|my_center|LOCUS_14720 43364 43555 gene locus_tag LOCUS_14730 43364 43555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 43578 45185 gene locus_tag LOCUS_14740 43578 45185 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980660.1 protein_id gnl|my_center|LOCUS_14740 45245 46327 gene locus_tag LOCUS_14750 45245 46327 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_14750 <47242 46341 gene locus_tag LOCUS_14760 <47242 46341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DCP2:tryptophan synthase beta chain >Feature sequence22 864 2195 gene locus_tag LOCUS_14770 864 2195 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_14770 3065 2208 gene locus_tag LOCUS_14780 3065 2208 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_14780 4704 3127 gene locus_tag LOCUS_14790 4704 3127 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090531.1 protein_id gnl|my_center|LOCUS_14790 4786 7947 gene locus_tag LOCUS_14800 4786 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404549.1 protein_id gnl|my_center|LOCUS_14800 7940 11272 gene locus_tag LOCUS_14810 7940 11272 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404548.1 protein_id gnl|my_center|LOCUS_14810 11307 12128 gene locus_tag LOCUS_14820 11307 12128 CDS product citrate lyase subunit beta-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUZ0 protein_id gnl|my_center|LOCUS_14820 12194 13138 gene locus_tag LOCUS_14830 12194 13138 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728665.1 protein_id gnl|my_center|LOCUS_14830 13216 13980 gene locus_tag LOCUS_14840 13216 13980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 14002 14883 gene locus_tag LOCUS_14850 14002 14883 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_14850 14906 16480 gene locus_tag LOCUS_14860 14906 16480 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225243.1 protein_id gnl|my_center|LOCUS_14860 16542 17018 gene locus_tag LOCUS_14870 16542 17018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 17033 17830 gene locus_tag LOCUS_14880 gene tauD 17033 17830 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704533.1 protein_id gnl|my_center|LOCUS_14880 17853 19400 gene locus_tag LOCUS_14890 17853 19400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879694.1 protein_id gnl|my_center|LOCUS_14890 19462 22608 gene locus_tag LOCUS_14900 gene ileS 19462 22608 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D3M4 protein_id gnl|my_center|LOCUS_14900 22879 25311 gene locus_tag LOCUS_14910 22879 25311 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K496 protein_id gnl|my_center|LOCUS_14910 25311 26387 gene locus_tag LOCUS_14920 gene nrdB 25311 26387 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3C2 protein_id gnl|my_center|LOCUS_14920 26778 26485 gene locus_tag LOCUS_14930 26778 26485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 28581 26899 gene locus_tag LOCUS_14940 28581 26899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 29647 28661 gene locus_tag LOCUS_14950 29647 28661 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_14950 31808 29682 gene locus_tag LOCUS_14960 31808 29682 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_14960 33643 31805 gene locus_tag LOCUS_14970 33643 31805 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222825.1 protein_id gnl|my_center|LOCUS_14970 33686 35179 gene locus_tag LOCUS_14980 33686 35179 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727664.1 protein_id gnl|my_center|LOCUS_14980 35214 36251 gene locus_tag LOCUS_14990 35214 36251 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731394.1 protein_id gnl|my_center|LOCUS_14990 37073 36264 gene locus_tag LOCUS_15000 37073 36264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 37154 38305 gene locus_tag LOCUS_15010 37154 38305 CDS product microsomal epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_15010 38575 38994 gene locus_tag LOCUS_15020 38575 38994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 38991 39911 gene locus_tag LOCUS_15030 38991 39911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031741.1 protein_id gnl|my_center|LOCUS_15030 39929 41125 gene locus_tag LOCUS_15040 39929 41125 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKF6 protein_id gnl|my_center|LOCUS_15040 41118 41696 gene locus_tag LOCUS_15050 41118 41696 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A46 protein_id gnl|my_center|LOCUS_15050 42463 41681 gene locus_tag LOCUS_15060 gene yjkA 42463 41681 CDS product UPF0014 membrane protein YjkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34684 protein_id gnl|my_center|LOCUS_15060 42530 43612 gene locus_tag LOCUS_15070 42530 43612 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902649.1 protein_id gnl|my_center|LOCUS_15070 43682 44725 gene locus_tag LOCUS_15080 43682 44725 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_15080 44756 46360 gene locus_tag LOCUS_15090 44756 46360 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902650.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence23 1518 2558 gene locus_tag LOCUS_15100 gene xerC 1518 2558 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226556.1 protein_id gnl|my_center|LOCUS_15100 2555 3100 gene locus_tag LOCUS_15110 2555 3100 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1U6 protein_id gnl|my_center|LOCUS_15110 3725 3123 gene locus_tag LOCUS_15120 3725 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 3700 4059 gene locus_tag LOCUS_15130 3700 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 4658 4056 gene locus_tag LOCUS_15140 4658 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 4822 6027 gene locus_tag LOCUS_15150 4822 6027 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257464.1 protein_id gnl|my_center|LOCUS_15150 6715 6041 gene locus_tag LOCUS_15160 6715 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 7512 6712 gene locus_tag LOCUS_15170 7512 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 9057 7645 gene locus_tag LOCUS_15180 9057 7645 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_15180 9201 10379 gene locus_tag LOCUS_15190 9201 10379 CDS product putative glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705203.1 protein_id gnl|my_center|LOCUS_15190 10376 14656 gene locus_tag LOCUS_15200 gene aftD 10376 14656 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96419 protein_id gnl|my_center|LOCUS_15200 16026 14650 gene locus_tag LOCUS_15210 16026 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 16095 16781 gene locus_tag LOCUS_15220 16095 16781 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338973.1 protein_id gnl|my_center|LOCUS_15220 18265 16805 gene locus_tag LOCUS_15230 18265 16805 CDS product putative NADH-dependent glutamate synthase small subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700846.1 protein_id gnl|my_center|LOCUS_15230 22919 18276 gene locus_tag LOCUS_15240 22919 18276 CDS product putative ferredoxin-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700845.1 protein_id gnl|my_center|LOCUS_15240 23154 24404 gene locus_tag LOCUS_15250 gene apeB 23154 24404 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4G8 protein_id gnl|my_center|LOCUS_15250 25985 24408 gene locus_tag LOCUS_15260 25985 24408 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_15260 27493 25982 gene locus_tag LOCUS_15270 27493 25982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 28927 27521 gene locus_tag LOCUS_15280 28927 27521 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_15280 29476 28931 gene locus_tag LOCUS_15290 29476 28931 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXY7 protein_id gnl|my_center|LOCUS_15290 29743 31836 gene locus_tag LOCUS_15300 gene hppA1 29743 31836 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_15300 32558 31896 gene locus_tag LOCUS_15310 32558 31896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 33731 32571 gene locus_tag LOCUS_15320 33731 32571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057686.1 protein_id gnl|my_center|LOCUS_15320 33832 36228 gene locus_tag LOCUS_15330 33832 36228 CDS product putative CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95149 protein_id gnl|my_center|LOCUS_15330 37812 36253 gene locus_tag LOCUS_15340 37812 36253 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_15340 38405 37812 gene locus_tag LOCUS_15350 38405 37812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 38329 39249 gene locus_tag LOCUS_15360 gene menB 38329 39249 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHD8 protein_id gnl|my_center|LOCUS_15360 39270 39731 gene locus_tag LOCUS_15370 39270 39731 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_15370 40700 39738 gene locus_tag LOCUS_15380 40700 39738 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726719.1 protein_id gnl|my_center|LOCUS_15380 40792 41562 gene locus_tag LOCUS_15390 40792 41562 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888912.1 protein_id gnl|my_center|LOCUS_15390 42245 41598 gene locus_tag LOCUS_15400 42245 41598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 43084 42257 gene locus_tag LOCUS_15410 43084 42257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 43664 43095 gene locus_tag LOCUS_15420 43664 43095 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_15420 44670 43711 gene locus_tag LOCUS_15430 44670 43711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 45315 44677 gene locus_tag LOCUS_15440 gene upp 45315 44677 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBH2 protein_id gnl|my_center|LOCUS_15440 45443 46699 gene locus_tag LOCUS_15450 45443 46699 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143424.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence24 <1 1263 gene locus_tag LOCUS_15460 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P59385:indoleacetamide hydrolase 1932 1288 gene locus_tag LOCUS_15470 1932 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3068 1929 gene locus_tag LOCUS_15480 3068 1929 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_15480 4598 3081 gene locus_tag LOCUS_15490 gene yngE 4598 3081 CDS product putative carboxylase YngE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31825 protein_id gnl|my_center|LOCUS_15490 4763 5734 gene locus_tag LOCUS_15500 gene gbuA 4763 5734 CDS product guanidinobutyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3S3 protein_id gnl|my_center|LOCUS_15500 5715 6941 gene locus_tag LOCUS_15510 5715 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 6938 8143 gene locus_tag LOCUS_15520 6938 8143 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_15520 8631 8161 gene locus_tag LOCUS_15530 8631 8161 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030367.1 protein_id gnl|my_center|LOCUS_15530 9944 8637 gene locus_tag LOCUS_15540 9944 8637 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_15540 11185 10109 gene locus_tag LOCUS_15550 11185 10109 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257556.1 protein_id gnl|my_center|LOCUS_15550 12096 11242 gene locus_tag LOCUS_15560 12096 11242 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_15560 13009 12134 gene locus_tag LOCUS_15570 13009 12134 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 protein_id gnl|my_center|LOCUS_15570 14079 13009 gene locus_tag LOCUS_15580 gene potA 14079 13009 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBU2 protein_id gnl|my_center|LOCUS_15580 14250 15638 gene locus_tag LOCUS_15590 14250 15638 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_15590 15649 17025 gene locus_tag LOCUS_15600 15649 17025 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731301.1 protein_id gnl|my_center|LOCUS_15600 17270 16980 gene locus_tag LOCUS_15610 17270 16980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 17257 18042 gene locus_tag LOCUS_15620 17257 18042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 18889 18074 gene locus_tag LOCUS_15630 gene cutM 18889 18074 CDS product carbon-monoxide dehydrogenase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_15630 21063 18886 gene locus_tag LOCUS_15640 21063 18886 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_15640 21736 21284 gene locus_tag LOCUS_15650 gene coxS 21736 21284 CDS product carbon-monoxide dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_15650 22360 21851 gene locus_tag LOCUS_15660 22360 21851 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXU7 protein_id gnl|my_center|LOCUS_15660 22752 22357 gene locus_tag LOCUS_15670 gene vapC9 22752 22357 CDS product ribonuclease VapC9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WFA9 protein_id gnl|my_center|LOCUS_15670 22979 22749 gene locus_tag LOCUS_15680 22979 22749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 23637 23044 gene locus_tag LOCUS_15690 23637 23044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 23705 24856 gene locus_tag LOCUS_15700 23705 24856 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_15700 24868 25680 gene locus_tag LOCUS_15710 gene paaG 24868 25680 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225682.1 protein_id gnl|my_center|LOCUS_15710 25695 26375 gene locus_tag LOCUS_15720 25695 26375 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222235.1 protein_id gnl|my_center|LOCUS_15720 26372 27310 gene locus_tag LOCUS_15730 gene ssuD 26372 27310 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225079.1 protein_id gnl|my_center|LOCUS_15730 28217 27312 gene locus_tag LOCUS_15740 28217 27312 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803754.1 protein_id gnl|my_center|LOCUS_15740 30354 28261 gene locus_tag LOCUS_15750 gene cat5 30354 28261 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404999.1 protein_id gnl|my_center|LOCUS_15750 31393 30410 gene locus_tag LOCUS_15760 31393 30410 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029094.1 protein_id gnl|my_center|LOCUS_15760 31845 31393 gene locus_tag LOCUS_15770 31845 31393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 32063 31842 gene locus_tag LOCUS_15780 32063 31842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 33239 32118 gene locus_tag LOCUS_15790 33239 32118 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089770.1 protein_id gnl|my_center|LOCUS_15790 33303 33824 gene locus_tag LOCUS_15800 33303 33824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 33904 35226 gene locus_tag LOCUS_15810 33904 35226 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085724.1 protein_id gnl|my_center|LOCUS_15810 36180 35236 gene locus_tag LOCUS_15820 36180 35236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 38240 36177 gene locus_tag LOCUS_15830 38240 36177 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 protein_id gnl|my_center|LOCUS_15830 38383 40305 gene locus_tag LOCUS_15840 38383 40305 CDS product beta-lactamase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702054.1 protein_id gnl|my_center|LOCUS_15840 40414 41973 gene locus_tag LOCUS_15850 40414 41973 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532332.1 protein_id gnl|my_center|LOCUS_15850 41996 43009 gene locus_tag LOCUS_15860 gene dapA 41996 43009 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Q28 protein_id gnl|my_center|LOCUS_15860 43026 44522 gene locus_tag LOCUS_15870 43026 44522 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101377.1 protein_id gnl|my_center|LOCUS_15870 44526 45845 gene locus_tag LOCUS_15880 44526 45845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence25 2194 3360 gene locus_tag LOCUS_15890 2194 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 3429 3773 gene locus_tag LOCUS_15900 3429 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 4124 5248 gene locus_tag LOCUS_15910 4124 5248 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027384.1 protein_id gnl|my_center|LOCUS_15910 5262 5669 gene locus_tag LOCUS_15920 5262 5669 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895331.1 protein_id gnl|my_center|LOCUS_15920 6772 5909 gene locus_tag LOCUS_15930 6772 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_15930 8283 6769 gene locus_tag LOCUS_15940 8283 6769 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804095.1 protein_id gnl|my_center|LOCUS_15940 9139 8315 gene locus_tag LOCUS_15950 9139 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 9909 9232 gene locus_tag LOCUS_15960 9909 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 10698 10120 gene locus_tag LOCUS_15970 10698 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 11665 12336 gene locus_tag LOCUS_15980 11665 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 12463 12388 gene locus_tag LOCUS_t00280 12463 12388 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 13759 12509 gene locus_tag LOCUS_15990 13759 12509 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_15990 15539 13752 gene locus_tag LOCUS_16000 15539 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 16963 15644 gene locus_tag LOCUS_16010 gene glyQS 16963 15644 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D949 protein_id gnl|my_center|LOCUS_16010 17048 17599 gene locus_tag LOCUS_16020 17048 17599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 19048 18329 gene locus_tag LOCUS_16030 gene recO 19048 18329 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MD78 protein_id gnl|my_center|LOCUS_16030 19827 19105 gene locus_tag LOCUS_16040 19827 19105 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MN49 protein_id gnl|my_center|LOCUS_16040 19907 21838 gene locus_tag LOCUS_16050 19907 21838 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 protein_id gnl|my_center|LOCUS_16050 22750 21911 gene locus_tag LOCUS_16060 gene era 22750 21911 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYT3 protein_id gnl|my_center|LOCUS_16060 24060 22774 gene locus_tag LOCUS_16070 24060 22774 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895866.1 protein_id gnl|my_center|LOCUS_16070 24583 24095 gene locus_tag LOCUS_16080 24583 24095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 25590 24589 gene locus_tag LOCUS_16090 25590 24589 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_16090 25789 26391 gene locus_tag LOCUS_16100 25789 26391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 26402 26983 gene locus_tag LOCUS_16110 26402 26983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 27402 27013 gene locus_tag LOCUS_16120 27402 27013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 28855 27452 gene locus_tag LOCUS_16130 28855 27452 CDS product putative FeS assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703482.1 protein_id gnl|my_center|LOCUS_16130 29786 29022 gene locus_tag LOCUS_16140 29786 29022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 30329 29811 gene locus_tag LOCUS_16150 30329 29811 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_16150 30817 30329 gene locus_tag LOCUS_16160 gene mmyF 30817 30329 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_16160 31766 30900 gene locus_tag LOCUS_16170 31766 30900 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389564.1 protein_id gnl|my_center|LOCUS_16170 31888 32262 gene locus_tag LOCUS_16180 31888 32262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 32434 33360 gene locus_tag LOCUS_16190 32434 33360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_16190 33357 33653 gene locus_tag LOCUS_16200 33357 33653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 33675 33893 gene locus_tag LOCUS_16210 33675 33893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 34760 33906 gene locus_tag LOCUS_16220 34760 33906 CDS product adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804920.1 protein_id gnl|my_center|LOCUS_16220 35569 34757 gene locus_tag LOCUS_16230 35569 34757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 35563 36054 gene locus_tag LOCUS_16240 35563 36054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 36075 36977 gene locus_tag LOCUS_16250 36075 36977 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729146.1 protein_id gnl|my_center|LOCUS_16250 37078 37932 gene locus_tag LOCUS_16260 37078 37932 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861134.1 protein_id gnl|my_center|LOCUS_16260 37935 38315 gene locus_tag LOCUS_16270 37935 38315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 38423 40045 gene locus_tag LOCUS_16280 38423 40045 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225847.1 protein_id gnl|my_center|LOCUS_16280 41344 40100 gene locus_tag LOCUS_16290 41344 40100 CDS product linalool 8-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 protein_id gnl|my_center|LOCUS_16290 41494 42267 gene locus_tag LOCUS_16300 41494 42267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348683.1 protein_id gnl|my_center|LOCUS_16300 42330 42611 gene locus_tag LOCUS_16310 42330 42611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 43139 42765 gene locus_tag LOCUS_16320 43139 42765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 43190 44110 gene locus_tag LOCUS_16330 43190 44110 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_16330 44178 44390 gene locus_tag LOCUS_16340 44178 44390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence26 2288 372 gene locus_tag LOCUS_16350 2288 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 5294 2322 gene locus_tag LOCUS_16360 5294 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 7360 5291 gene locus_tag LOCUS_16370 7360 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 7409 9172 gene locus_tag LOCUS_16380 7409 9172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 10294 9188 gene locus_tag LOCUS_16390 gene serC 10294 9188 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHV7 protein_id gnl|my_center|LOCUS_16390 11662 10394 gene locus_tag LOCUS_16400 gene pgsA 11662 10394 CDS product poly-gamma-glutamate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223416.1 protein_id gnl|my_center|LOCUS_16400 13296 11659 gene locus_tag LOCUS_16410 13296 11659 CDS product D-glutamate deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384301.1 protein_id gnl|my_center|LOCUS_16410 13425 14441 gene locus_tag LOCUS_16420 13425 14441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 15143 14436 gene locus_tag LOCUS_16430 15143 14436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 15323 16840 gene locus_tag LOCUS_16440 15323 16840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 17626 16865 gene locus_tag LOCUS_16450 17626 16865 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013910.1 protein_id gnl|my_center|LOCUS_16450 17713 18588 gene locus_tag LOCUS_16460 17713 18588 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224885.1 protein_id gnl|my_center|LOCUS_16460 18641 19978 gene locus_tag LOCUS_16470 18641 19978 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272198.1 protein_id gnl|my_center|LOCUS_16470 20587 19988 gene locus_tag LOCUS_16480 20587 19988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 21606 20584 gene locus_tag LOCUS_16490 21606 20584 CDS product chloromuconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289275.1 protein_id gnl|my_center|LOCUS_16490 22403 21603 gene locus_tag LOCUS_16500 gene menH 22403 21603 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBD4 protein_id gnl|my_center|LOCUS_16500 24121 22400 gene locus_tag LOCUS_16510 24121 22400 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902775.1 protein_id gnl|my_center|LOCUS_16510 25431 24118 gene locus_tag LOCUS_16520 25431 24118 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_16520 26216 25422 gene locus_tag LOCUS_16530 26216 25422 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730069.1 protein_id gnl|my_center|LOCUS_16530 26261 27151 gene locus_tag LOCUS_16540 26261 27151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:26747..26749,aa:Sec) note codon on position 163 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_16540 27186 28112 gene locus_tag LOCUS_16550 gene lipI 27186 28112 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407279.1 protein_id gnl|my_center|LOCUS_16550 29326 28109 gene locus_tag LOCUS_16560 29326 28109 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_16560 29447 29992 gene locus_tag LOCUS_16570 29447 29992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 30010 31233 gene locus_tag LOCUS_16580 30010 31233 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225242.1 protein_id gnl|my_center|LOCUS_16580 31289 32440 gene locus_tag LOCUS_16590 gene atoB 31289 32440 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_16590 33430 32462 gene locus_tag LOCUS_16600 gene paaG 33430 32462 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228967.1 protein_id gnl|my_center|LOCUS_16600 34976 33462 gene locus_tag LOCUS_16610 34976 33462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 35330 35022 gene locus_tag LOCUS_16620 35330 35022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896282.1 protein_id gnl|my_center|LOCUS_16620 35464 36681 gene locus_tag LOCUS_16630 35464 36681 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228966.1 protein_id gnl|my_center|LOCUS_16630 36708 37376 gene locus_tag LOCUS_16640 36708 37376 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 protein_id gnl|my_center|LOCUS_16640 37412 38776 gene locus_tag LOCUS_16650 gene gltX 37412 38776 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0A6 protein_id gnl|my_center|LOCUS_16650 38890 38962 gene locus_tag LOCUS_t00290 38890 38962 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 39056 39129 gene locus_tag LOCUS_t00300 39056 39129 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 39809 39204 gene locus_tag LOCUS_16660 39809 39204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16660 40690 40106 gene locus_tag LOCUS_16670 40690 40106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 40773 41225 gene locus_tag LOCUS_16680 40773 41225 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709240.1 protein_id gnl|my_center|LOCUS_16680 41588 41268 gene locus_tag LOCUS_16690 41588 41268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 41719 41645 gene locus_tag LOCUS_t00310 41719 41645 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 41940 42998 gene locus_tag LOCUS_16700 41940 42998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16700 44123 43467 gene locus_tag LOCUS_16710 44123 43467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 45465 44365 gene locus_tag LOCUS_16720 45465 44365 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_16720 45566 45817 gene locus_tag LOCUS_16730 45566 45817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence27 273 1487 gene locus_tag LOCUS_16740 273 1487 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_16740 1606 2934 gene locus_tag LOCUS_16750 gene xylA 1606 2934 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7A9X4 protein_id gnl|my_center|LOCUS_16750 2943 4406 gene locus_tag LOCUS_16760 gene xylB 2943 4406 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222654.1 protein_id gnl|my_center|LOCUS_16760 4403 5191 gene locus_tag LOCUS_16770 4403 5191 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029144.1 protein_id gnl|my_center|LOCUS_16770 5193 6029 gene locus_tag LOCUS_16780 5193 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 7535 6051 gene locus_tag LOCUS_16790 7535 6051 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_16790 9979 7556 gene locus_tag LOCUS_16800 9979 7556 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082594.1 protein_id gnl|my_center|LOCUS_16800 10977 9976 gene locus_tag LOCUS_16810 gene xynA 10977 9976 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D9S3 protein_id gnl|my_center|LOCUS_16810 11552 10974 gene locus_tag LOCUS_16820 11552 10974 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974964.1 protein_id gnl|my_center|LOCUS_16820 14371 11549 gene locus_tag LOCUS_16830 14371 11549 CDS product branched-chain amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225675.1 protein_id gnl|my_center|LOCUS_16830 16632 14368 gene locus_tag LOCUS_16840 16632 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 17793 16642 gene locus_tag LOCUS_16850 17793 16642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 17894 18066 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtggtggtcgtgggtgcggtggt 18214 20673 gene locus_tag LOCUS_16860 18214 20673 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256961.1 protein_id gnl|my_center|LOCUS_16860 21520 20702 gene locus_tag LOCUS_16870 21520 20702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 22835 21672 gene locus_tag LOCUS_16880 22835 21672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 23206 22832 gene locus_tag LOCUS_16890 23206 22832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 25136 23286 gene locus_tag LOCUS_16900 25136 23286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 25929 25312 gene locus_tag LOCUS_16910 25929 25312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_16910 25998 26699 gene locus_tag LOCUS_16920 25998 26699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 26739 27350 gene locus_tag LOCUS_16930 26739 27350 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940338.1 protein_id gnl|my_center|LOCUS_16930 27352 28023 gene locus_tag LOCUS_16940 27352 28023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920931.1 protein_id gnl|my_center|LOCUS_16940 29417 28062 gene locus_tag LOCUS_16950 29417 28062 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053632.1 protein_id gnl|my_center|LOCUS_16950 30959 29427 gene locus_tag LOCUS_16960 30959 29427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16960 31985 30960 gene locus_tag LOCUS_16970 31985 30960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16970 33548 32025 gene locus_tag LOCUS_16980 33548 32025 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888403.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence28 716 240 gene locus_tag LOCUS_16990 716 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 715 1164 gene locus_tag LOCUS_17000 715 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031504.1 protein_id gnl|my_center|LOCUS_17000 1590 1186 gene locus_tag LOCUS_17010 1590 1186 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403909.1 protein_id gnl|my_center|LOCUS_17010 1714 2541 gene locus_tag LOCUS_17020 gene punA 1714 2541 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QT39 protein_id gnl|my_center|LOCUS_17020 2538 4229 gene locus_tag LOCUS_17030 2538 4229 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029947.1 protein_id gnl|my_center|LOCUS_17030 4226 5131 gene locus_tag LOCUS_17040 4226 5131 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_17040 5131 6630 gene locus_tag LOCUS_17050 5131 6630 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_17050 6630 7475 gene locus_tag LOCUS_17060 6630 7475 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_17060 7971 7486 gene locus_tag LOCUS_17070 7971 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 9255 7981 gene locus_tag LOCUS_17080 gene deoA 9255 7981 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222773.1 protein_id gnl|my_center|LOCUS_17080 9676 9275 gene locus_tag LOCUS_17090 gene cdd 9676 9275 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPH3 protein_id gnl|my_center|LOCUS_17090 9771 10679 gene locus_tag LOCUS_17100 9771 10679 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225966.1 protein_id gnl|my_center|LOCUS_17100 10840 11274 gene locus_tag LOCUS_17110 10840 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 11699 11271 gene locus_tag LOCUS_17120 11699 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 11775 12704 gene locus_tag LOCUS_17130 11775 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_17130 13399 12701 gene locus_tag LOCUS_17140 13399 12701 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935569.1 protein_id gnl|my_center|LOCUS_17140 15776 13458 gene locus_tag LOCUS_17150 gene glnD 15776 13458 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2P5 protein_id gnl|my_center|LOCUS_17150 16095 15784 gene locus_tag LOCUS_17160 16095 15784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 16910 16098 gene locus_tag LOCUS_17170 16910 16098 CDS product adenine nucleotide alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_17170 17619 16930 gene locus_tag LOCUS_17180 17619 16930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 18481 17681 gene locus_tag LOCUS_17190 gene fdhD 18481 17681 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMW5 protein_id gnl|my_center|LOCUS_17190 20210 18594 gene locus_tag LOCUS_17200 gene groL2 20210 18594 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXU5 protein_id gnl|my_center|LOCUS_17200 20761 20414 gene locus_tag LOCUS_17210 20761 20414 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_17210 21788 20793 gene locus_tag LOCUS_17220 21788 20793 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_17220 22511 21804 gene locus_tag LOCUS_17230 22511 21804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 22768 22511 gene locus_tag LOCUS_17240 22768 22511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 22871 22946 gene locus_tag LOCUS_t00320 22871 22946 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23685 22948 gene locus_tag LOCUS_17250 23685 22948 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_17250 23915 23622 gene locus_tag LOCUS_17260 23915 23622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 24395 23919 gene locus_tag LOCUS_17270 gene ispF 24395 23919 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F830 protein_id gnl|my_center|LOCUS_17270 25029 24388 gene locus_tag LOCUS_17280 gene ispD 25029 24388 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0Q8 protein_id gnl|my_center|LOCUS_17280 25102 25761 gene locus_tag LOCUS_17290 25102 25761 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908817.1 protein_id gnl|my_center|LOCUS_17290 26523 25867 gene locus_tag LOCUS_17300 26523 25867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 27902 26571 gene locus_tag LOCUS_17310 gene radA 27902 26571 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NMB3 protein_id gnl|my_center|LOCUS_17310 29586 28051 gene locus_tag LOCUS_17320 29586 28051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 32130 29635 gene locus_tag LOCUS_17330 32130 29635 CDS product ATP-dependent Clp protease ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_17330 32379 33350 gene locus_tag LOCUS_17340 32379 33350 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222468.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence29 2345 696 gene locus_tag LOCUS_17350 2345 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 protein_id gnl|my_center|LOCUS_17350 3056 2457 gene locus_tag LOCUS_17360 3056 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 3199 3405 gene locus_tag LOCUS_17370 3199 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3563 4264 gene locus_tag LOCUS_17380 3563 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17380 4393 5208 gene locus_tag LOCUS_17390 4393 5208 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083809.1 protein_id gnl|my_center|LOCUS_17390 5817 5446 gene locus_tag LOCUS_17400 5817 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 5871 6281 gene locus_tag LOCUS_17410 5871 6281 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230241.1 protein_id gnl|my_center|LOCUS_17410 6283 6969 gene locus_tag LOCUS_17420 6283 6969 CDS product molybdate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775841.1 protein_id gnl|my_center|LOCUS_17420 6966 7745 gene locus_tag LOCUS_17430 6966 7745 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_17430 7760 8776 gene locus_tag LOCUS_17440 7760 8776 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_17440 8788 9651 gene locus_tag LOCUS_17450 8788 9651 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_17450 11983 9857 gene locus_tag LOCUS_17460 11983 9857 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_17460 11982 12992 gene locus_tag LOCUS_17470 11982 12992 CDS product putative luciferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704893.1 protein_id gnl|my_center|LOCUS_17470 13028 14182 gene locus_tag LOCUS_17480 13028 14182 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 protein_id gnl|my_center|LOCUS_17480 14179 15405 gene locus_tag LOCUS_17490 14179 15405 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_17490 15488 16255 gene locus_tag LOCUS_17500 15488 16255 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_17500 16252 17781 gene locus_tag LOCUS_17510 16252 17781 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_17510 17828 20296 gene locus_tag LOCUS_17520 17828 20296 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_17520 20354 21679 gene locus_tag LOCUS_17530 20354 21679 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_17530 21772 22719 gene locus_tag LOCUS_17540 21772 22719 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_17540 24163 22817 gene locus_tag LOCUS_17550 24163 22817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063670.1 protein_id gnl|my_center|LOCUS_17550 25155 24163 gene locus_tag LOCUS_17560 25155 24163 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533002.1 protein_id gnl|my_center|LOCUS_17560 26061 25264 gene locus_tag LOCUS_17570 26061 25264 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_17570 26123 27175 gene locus_tag LOCUS_17580 26123 27175 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728239.1 protein_id gnl|my_center|LOCUS_17580 27175 28335 gene locus_tag LOCUS_17590 27175 28335 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728240.1 protein_id gnl|my_center|LOCUS_17590 28349 29167 gene locus_tag LOCUS_17600 28349 29167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 31279 29177 gene locus_tag LOCUS_17610 31279 29177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 32499 31276 gene locus_tag LOCUS_17620 32499 31276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810308.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence30 1016 3718 gene locus_tag LOCUS_17630 1016 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 3904 3827 gene locus_tag LOCUS_t00330 3904 3827 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4090 4968 gene locus_tag LOCUS_17640 4090 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 4392 4308 gene locus_tag LOCUS_t00340 4392 4308 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5196 4984 gene locus_tag LOCUS_17650 5196 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 6293 5220 gene locus_tag LOCUS_17660 6293 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 7703 6393 gene locus_tag LOCUS_17670 gene der 7703 6393 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EWW8 protein_id gnl|my_center|LOCUS_17670 9076 7700 gene locus_tag LOCUS_17680 9076 7700 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142769.1 protein_id gnl|my_center|LOCUS_17680 9202 10221 gene locus_tag LOCUS_17690 gene ispH 9202 10221 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MET9 protein_id gnl|my_center|LOCUS_17690 10942 10226 gene locus_tag LOCUS_17700 gene aas 10942 10226 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881346.1 protein_id gnl|my_center|LOCUS_17700 11618 10977 gene locus_tag LOCUS_17710 11618 10977 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_17710 12885 11623 gene locus_tag LOCUS_17720 gene aroA 12885 11623 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLT3 protein_id gnl|my_center|LOCUS_17720 13956 12889 gene locus_tag LOCUS_17730 13956 12889 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_17730 14801 14076 gene locus_tag LOCUS_17740 14801 14076 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS4 protein_id gnl|my_center|LOCUS_17740 15541 14828 gene locus_tag LOCUS_17750 15541 14828 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S231 protein_id gnl|my_center|LOCUS_17750 16318 15545 gene locus_tag LOCUS_17760 16318 15545 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027965.1 protein_id gnl|my_center|LOCUS_17760 16435 17415 gene locus_tag LOCUS_17770 gene trpS2 16435 17415 CDS product tryptophan--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZA7 protein_id gnl|my_center|LOCUS_17770 17956 17426 gene locus_tag LOCUS_17780 17956 17426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 18507 17953 gene locus_tag LOCUS_17790 18507 17953 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_17790 20147 18504 gene locus_tag LOCUS_17800 gene pyrG 20147 18504 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97F61 protein_id gnl|my_center|LOCUS_17800 21822 20206 gene locus_tag LOCUS_17810 gene recN 21822 20206 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S220 protein_id gnl|my_center|LOCUS_17810 22790 21981 gene locus_tag LOCUS_17820 22790 21981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 23599 22790 gene locus_tag LOCUS_17830 gene tlyA 23599 22790 CDS product 16S/23S rRNA (cytidine-2'-O)-methyltransferase TlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WJ63 protein_id gnl|my_center|LOCUS_17830 24350 23607 gene locus_tag LOCUS_17840 24350 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868725.1 protein_id gnl|my_center|LOCUS_17840 25419 24379 gene locus_tag LOCUS_17850 25419 24379 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_17850 27287 25419 gene locus_tag LOCUS_17860 27287 25419 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030783.1 protein_id gnl|my_center|LOCUS_17860 28337 27426 gene locus_tag LOCUS_17870 28337 27426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 29418 28366 gene locus_tag LOCUS_17880 gene fbaB 29418 28366 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120064.1 protein_id gnl|my_center|LOCUS_17880 29990 29553 gene locus_tag LOCUS_17890 29990 29553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 30825 30115 gene locus_tag LOCUS_17900 30825 30115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 31184 30882 gene locus_tag LOCUS_17910 31184 30882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence31 <1 622 gene locus_tag LOCUS_17920 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8G487:peptide deformylase 2 637 1503 gene locus_tag LOCUS_17930 gene fmt 637 1503 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8K0 protein_id gnl|my_center|LOCUS_17930 1500 2621 gene locus_tag LOCUS_17940 gene sunL 1500 2621 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DNR8 protein_id gnl|my_center|LOCUS_17940 3431 2637 gene locus_tag LOCUS_17950 3431 2637 CDS product putative dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704240.1 protein_id gnl|my_center|LOCUS_17950 3491 3997 gene locus_tag LOCUS_17960 gene moaB 3491 3997 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_17960 4029 5012 gene locus_tag LOCUS_17970 4029 5012 CDS product putative bifunctional riboflavin biosynthesis protein RibG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703541.1 protein_id gnl|my_center|LOCUS_17970 5073 5948 gene locus_tag LOCUS_17980 gene hisG 5073 5948 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_17980 5948 6172 gene locus_tag LOCUS_17990 5948 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 6718 6179 gene locus_tag LOCUS_18000 6718 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 7090 7818 gene locus_tag LOCUS_18010 7090 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 7857 8051 gene locus_tag LOCUS_18020 7857 8051 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_18020 8151 8513 gene locus_tag LOCUS_18030 gene rplT 8151 8513 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G4L1 protein_id gnl|my_center|LOCUS_18030 8545 9327 gene locus_tag LOCUS_18040 8545 9327 CDS product tRNA/rRNA methyltransferase SpoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 protein_id gnl|my_center|LOCUS_18040 9434 10432 gene locus_tag LOCUS_18050 gene pheS 9434 10432 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE3 protein_id gnl|my_center|LOCUS_18050 10446 12800 gene locus_tag LOCUS_18060 gene pheT 10446 12800 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ9 protein_id gnl|my_center|LOCUS_18060 12846 13820 gene locus_tag LOCUS_18070 12846 13820 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_18070 14062 15069 gene locus_tag LOCUS_18080 14062 15069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 15155 16201 gene locus_tag LOCUS_18090 gene argC 15155 16201 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748X6 protein_id gnl|my_center|LOCUS_18090 16198 17361 gene locus_tag LOCUS_18100 gene argJ 16198 17361 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CC14 protein_id gnl|my_center|LOCUS_18100 17373 18290 gene locus_tag LOCUS_18110 gene argB 17373 18290 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG64 protein_id gnl|my_center|LOCUS_18110 18287 19504 gene locus_tag LOCUS_18120 gene argD 18287 19504 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG65 protein_id gnl|my_center|LOCUS_18120 19501 20418 gene locus_tag LOCUS_18130 gene arcB 19501 20418 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB17 protein_id gnl|my_center|LOCUS_18130 20415 20876 gene locus_tag LOCUS_18140 gene argR 20415 20876 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MB01 protein_id gnl|my_center|LOCUS_18140 20919 22154 gene locus_tag LOCUS_18150 gene argG 20919 22154 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_18150 22165 23547 gene locus_tag LOCUS_18160 gene argH 22165 23547 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCL9 protein_id gnl|my_center|LOCUS_18160 23548 23931 gene locus_tag LOCUS_18170 23548 23931 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226776.1 protein_id gnl|my_center|LOCUS_18170 23928 24521 gene locus_tag LOCUS_18180 23928 24521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 25048 24518 gene locus_tag LOCUS_18190 25048 24518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 27585 25051 gene locus_tag LOCUS_18200 27585 25051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 27682 28971 gene locus_tag LOCUS_18210 gene tyrS 27682 28971 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM14 protein_id gnl|my_center|LOCUS_18210 >Feature sequence32 <1 621 gene locus_tag LOCUS_18220 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000954677.1:SnoK protein 2344 641 gene locus_tag LOCUS_18230 2344 641 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_18230 3203 2334 gene locus_tag LOCUS_18240 3203 2334 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411201.1 protein_id gnl|my_center|LOCUS_18240 3336 3665 gene locus_tag LOCUS_18250 3336 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 4650 3682 gene locus_tag LOCUS_18260 4650 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 5338 4661 gene locus_tag LOCUS_18270 5338 4661 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896555.1 protein_id gnl|my_center|LOCUS_18270 6517 5381 gene locus_tag LOCUS_18280 6517 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 7395 6565 gene locus_tag LOCUS_18290 7395 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701168.1 protein_id gnl|my_center|LOCUS_18290 7558 8280 gene locus_tag LOCUS_18300 7558 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 8767 8291 gene locus_tag LOCUS_18310 8767 8291 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225559.1 protein_id gnl|my_center|LOCUS_18310 8851 12360 gene locus_tag LOCUS_18320 8851 12360 CDS product pyruvate ferredoxin/flavodoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705082.1 protein_id gnl|my_center|LOCUS_18320 13685 12339 gene locus_tag LOCUS_18330 13685 12339 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532892.1 protein_id gnl|my_center|LOCUS_18330 14550 13765 gene locus_tag LOCUS_18340 14550 13765 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640174.1 protein_id gnl|my_center|LOCUS_18340 15992 14613 gene locus_tag LOCUS_18350 gene pntB 15992 14613 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F962 protein_id gnl|my_center|LOCUS_18350 16279 15989 gene locus_tag LOCUS_18360 16279 15989 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_18360 17406 16276 gene locus_tag LOCUS_18370 gene pntA 17406 16276 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_18370 17512 19179 gene locus_tag LOCUS_18380 17512 19179 CDS product phosphoenolpyruvate-utilizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272519.1 protein_id gnl|my_center|LOCUS_18380 21030 19198 gene locus_tag LOCUS_18390 21030 19198 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_18390 21072 21539 gene locus_tag LOCUS_18400 21072 21539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 22169 21630 gene locus_tag LOCUS_18410 22169 21630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 22817 22500 gene locus_tag LOCUS_18420 22817 22500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 22930 24138 gene locus_tag LOCUS_18430 22930 24138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 24139 24456 gene locus_tag LOCUS_18440 24139 24456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 24887 24591 gene locus_tag LOCUS_18450 24887 24591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 25519 24884 gene locus_tag LOCUS_18460 25519 24884 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804665.1 protein_id gnl|my_center|LOCUS_18460 25746 26426 gene locus_tag LOCUS_18470 25746 26426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 26436 27449 gene locus_tag LOCUS_18480 26436 27449 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_18480 27874 27665 gene locus_tag LOCUS_18490 27874 27665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence33 <1 965 gene locus_tag LOCUS_18500 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975103.1:desaturase 968 2137 gene locus_tag LOCUS_18510 968 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2218 3417 gene locus_tag LOCUS_18520 2218 3417 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970938.1 protein_id gnl|my_center|LOCUS_18520 3414 4202 gene locus_tag LOCUS_18530 3414 4202 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267659.1 protein_id gnl|my_center|LOCUS_18530 4199 5686 gene locus_tag LOCUS_18540 4199 5686 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527057.1 protein_id gnl|my_center|LOCUS_18540 5818 6999 gene locus_tag LOCUS_18550 5818 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 7076 8014 gene locus_tag LOCUS_18560 7076 8014 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_18560 8011 8856 gene locus_tag LOCUS_18570 8011 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 8872 11169 gene locus_tag LOCUS_18580 8872 11169 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_18580 11605 11183 gene locus_tag LOCUS_18590 11605 11183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 12380 11634 gene locus_tag LOCUS_18600 12380 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 12652 12377 gene locus_tag LOCUS_18610 12652 12377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 13125 12664 gene locus_tag LOCUS_18620 13125 12664 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173050.1 protein_id gnl|my_center|LOCUS_18620 14051 13122 gene locus_tag LOCUS_18630 gene paaA 14051 13122 CDS product phenylacetate-CoA oxygenase subunit PaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_18630 16090 14051 gene locus_tag LOCUS_18640 gene paaZ 16090 14051 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976331.1 protein_id gnl|my_center|LOCUS_18640 16162 17070 gene locus_tag LOCUS_18650 16162 17070 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041177.1 protein_id gnl|my_center|LOCUS_18650 17464 17114 gene locus_tag LOCUS_18660 17464 17114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 17544 18053 gene locus_tag LOCUS_18670 17544 18053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 18061 19278 gene locus_tag LOCUS_18680 18061 19278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804568.1 protein_id gnl|my_center|LOCUS_18680 19303 19581 gene locus_tag LOCUS_18690 19303 19581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385406.1 protein_id gnl|my_center|LOCUS_18690 20376 19588 gene locus_tag LOCUS_18700 20376 19588 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_18700 21755 20439 gene locus_tag LOCUS_18710 21755 20439 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 protein_id gnl|my_center|LOCUS_18710 22240 21752 gene locus_tag LOCUS_18720 22240 21752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 23774 22368 gene locus_tag LOCUS_18730 23774 22368 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_18730 24389 23814 gene locus_tag LOCUS_18740 24389 23814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 27240 24382 gene locus_tag LOCUS_18750 gene soxA 27240 24382 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524300.1 protein_id gnl|my_center|LOCUS_18750 27485 27237 gene locus_tag LOCUS_18760 gene soxD 27485 27237 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973656.1 protein_id gnl|my_center|LOCUS_18760 28774 27485 gene locus_tag LOCUS_18770 28774 27485 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267522.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence34 106 921 gene locus_tag LOCUS_18780 106 921 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_18780 953 1306 gene locus_tag LOCUS_18790 953 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 3117 1324 gene locus_tag LOCUS_18800 gene pckG 3117 1324 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93JL5 protein_id gnl|my_center|LOCUS_18800 3436 3212 gene locus_tag LOCUS_18810 3436 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 3662 3468 gene locus_tag LOCUS_18820 gene rpmB1 3662 3468 CDS product 50S ribosomal protein L28-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBR5 protein_id gnl|my_center|LOCUS_18820 3820 5472 gene locus_tag LOCUS_18830 3820 5472 CDS product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272451.1 protein_id gnl|my_center|LOCUS_18830 5476 7638 gene locus_tag LOCUS_18840 gene recG 5476 7638 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW6 protein_id gnl|my_center|LOCUS_18840 7635 8225 gene locus_tag LOCUS_18850 7635 8225 CDS product GCN5-like N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_18850 8448 8254 gene locus_tag LOCUS_18860 8448 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 8466 9053 gene locus_tag LOCUS_18870 8466 9053 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_18870 9050 9538 gene locus_tag LOCUS_18880 gene coaD 9050 9538 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJS9 protein_id gnl|my_center|LOCUS_18880 9535 10194 gene locus_tag LOCUS_18890 9535 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 10214 10771 gene locus_tag LOCUS_18900 10214 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 10836 11060 gene locus_tag LOCUS_18910 gene rpmF 10836 11060 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTT0 protein_id gnl|my_center|LOCUS_18910 11080 12078 gene locus_tag LOCUS_18920 11080 12078 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_18920 12256 12546 gene locus_tag LOCUS_18930 12256 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 12524 13303 gene locus_tag LOCUS_18940 gene rnc 12524 13303 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBQ7 protein_id gnl|my_center|LOCUS_18940 13300 14139 gene locus_tag LOCUS_18950 13300 14139 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_18950 14331 17825 gene locus_tag LOCUS_18960 gene smc 14331 17825 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYI4 protein_id gnl|my_center|LOCUS_18960 17877 18569 gene locus_tag LOCUS_18970 17877 18569 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224495.1 protein_id gnl|my_center|LOCUS_18970 18566 19753 gene locus_tag LOCUS_18980 gene cutS 18566 19753 CDS product sensor protein CutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4I7 protein_id gnl|my_center|LOCUS_18980 19777 21102 gene locus_tag LOCUS_18990 19777 21102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 21172 22062 gene locus_tag LOCUS_19000 21172 22062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 22073 23581 gene locus_tag LOCUS_19010 gene ffh 22073 23581 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QV32 protein_id gnl|my_center|LOCUS_19010 23751 24416 gene locus_tag LOCUS_19020 gene rpsP 23751 24416 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MB72 protein_id gnl|my_center|LOCUS_19020 24419 24667 gene locus_tag LOCUS_19030 24419 24667 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_19030 24750 25187 gene locus_tag LOCUS_19040 24750 25187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 25190 25945 gene locus_tag LOCUS_19050 gene trmD 25190 25945 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV4 protein_id gnl|my_center|LOCUS_19050 26062 26409 gene locus_tag LOCUS_19060 gene rplS 26062 26409 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33020 protein_id gnl|my_center|LOCUS_19060 26469 26858 gene locus_tag LOCUS_19070 26469 26858 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDG9 protein_id gnl|my_center|LOCUS_19070 27074 26883 gene locus_tag LOCUS_19080 27074 26883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 27320 27856 gene locus_tag LOCUS_19090 27320 27856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence35 4970 4380 gene locus_tag LOCUS_19100 4970 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 5104 5029 gene locus_tag LOCUS_t00350 5104 5029 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5135 5881 gene locus_tag LOCUS_19110 5135 5881 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020781.1 protein_id gnl|my_center|LOCUS_19110 6349 5897 gene locus_tag LOCUS_19120 6349 5897 CDS product putative phenylacetic acid degradation-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702780.1 protein_id gnl|my_center|LOCUS_19120 6900 6346 gene locus_tag LOCUS_19130 6900 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702776.1 protein_id gnl|my_center|LOCUS_19130 7010 8116 gene locus_tag LOCUS_19140 gene adh 7010 8116 CDS product putative alcohol dehydrogenase adh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQC3 protein_id gnl|my_center|LOCUS_19140 8113 8733 gene locus_tag LOCUS_19150 8113 8733 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_19150 8756 9187 gene locus_tag LOCUS_19160 8756 9187 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_19160 9693 9196 gene locus_tag LOCUS_19170 9693 9196 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223824.1 protein_id gnl|my_center|LOCUS_19170 11051 9690 gene locus_tag LOCUS_19180 gene metY 11051 9690 CDS product O-acetylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223825.1 protein_id gnl|my_center|LOCUS_19180 11089 11634 gene locus_tag LOCUS_19190 11089 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 11720 13381 gene locus_tag LOCUS_19200 11720 13381 CDS product putative acetyl/propionyl-CoA carboxylase beta subunit AccD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702802.1 protein_id gnl|my_center|LOCUS_19200 13378 15318 gene locus_tag LOCUS_19210 13378 15318 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 protein_id gnl|my_center|LOCUS_19210 15315 17078 gene locus_tag LOCUS_19220 15315 17078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702796.1 protein_id gnl|my_center|LOCUS_19220 17075 17731 gene locus_tag LOCUS_19230 17075 17731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 17749 18543 gene locus_tag LOCUS_19240 17749 18543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702795.1 protein_id gnl|my_center|LOCUS_19240 18543 19307 gene locus_tag LOCUS_19250 gene echA7 18543 19307 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404949.1 protein_id gnl|my_center|LOCUS_19250 19322 20962 gene locus_tag LOCUS_19260 19322 20962 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_19260 21782 20985 gene locus_tag LOCUS_19270 21782 20985 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804288.1 protein_id gnl|my_center|LOCUS_19270 23205 21823 gene locus_tag LOCUS_19280 23205 21823 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_19280 23981 23202 gene locus_tag LOCUS_19290 23981 23202 CDS product 2-hydroxycyclohexane-1-carbonyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_19290 25105 24002 gene locus_tag LOCUS_19300 25105 24002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 26205 25102 gene locus_tag LOCUS_19310 26205 25102 CDS product putative alcohol dehydrogenase, zinc-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701729.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence36 1348 395 gene locus_tag LOCUS_19320 1348 395 CDS product protein pafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_19320 2262 1345 gene locus_tag LOCUS_19330 2262 1345 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027895.1 protein_id gnl|my_center|LOCUS_19330 3723 2365 gene locus_tag LOCUS_19340 gene pafA 3723 2365 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ61 protein_id gnl|my_center|LOCUS_19340 4451 3774 gene locus_tag LOCUS_19350 gene psmA 4451 3774 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAT2 protein_id gnl|my_center|LOCUS_19350 5242 4448 gene locus_tag LOCUS_19360 gene prcB 5242 4448 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKQ5 protein_id gnl|my_center|LOCUS_19360 5482 5282 gene locus_tag LOCUS_19370 gene pup 5482 5282 CDS product prokaryotic ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MAI1 protein_id gnl|my_center|LOCUS_19370 7035 5515 gene locus_tag LOCUS_19380 7035 5515 CDS product proteasome accessory factor PafA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_19380 8780 7077 gene locus_tag LOCUS_19390 gene arc 8780 7077 CDS product proteasome-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ58 protein_id gnl|my_center|LOCUS_19390 9020 9256 gene locus_tag LOCUS_19400 9020 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 9848 9324 gene locus_tag LOCUS_19410 9848 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 10903 10130 gene locus_tag LOCUS_19420 10903 10130 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_19420 11868 10900 gene locus_tag LOCUS_19430 11868 10900 CDS product tRNA(Ile)-lysidine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584019.1 protein_id gnl|my_center|LOCUS_19430 12065 11865 gene locus_tag LOCUS_19440 12065 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 12298 12062 gene locus_tag LOCUS_19450 12298 12062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 12504 12298 gene locus_tag LOCUS_19460 12504 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 12788 12501 gene locus_tag LOCUS_19470 12788 12501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 13436 12801 gene locus_tag LOCUS_19480 13436 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704892.1 protein_id gnl|my_center|LOCUS_19480 14946 13483 gene locus_tag LOCUS_19490 14946 13483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 15034 15456 gene locus_tag LOCUS_19500 15034 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 15461 16573 gene locus_tag LOCUS_19510 15461 16573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKR9 protein_id gnl|my_center|LOCUS_19510 16676 18676 gene locus_tag LOCUS_19520 gene tkt 16676 18676 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_19520 18673 19764 gene locus_tag LOCUS_19530 gene tal1 18673 19764 CDS product transaldolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O88018 protein_id gnl|my_center|LOCUS_19530 19825 20304 gene locus_tag LOCUS_19540 19825 20304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090577.1 protein_id gnl|my_center|LOCUS_19540 20301 22721 gene locus_tag LOCUS_19550 20301 22721 CDS product putative 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702061.1 protein_id gnl|my_center|LOCUS_19550 23179 22964 gene locus_tag LOCUS_19560 23179 22964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 23340 23176 gene locus_tag LOCUS_19570 23340 23176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 24319 23774 gene locus_tag LOCUS_19580 24319 23774 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893908.1 protein_id gnl|my_center|LOCUS_19580 24385 25251 gene locus_tag LOCUS_19590 24385 25251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523946.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence37 1987 830 gene locus_tag LOCUS_19600 1987 830 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_19600 2982 2047 gene locus_tag LOCUS_19610 2982 2047 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730112.1 protein_id gnl|my_center|LOCUS_19610 3706 3002 gene locus_tag LOCUS_19620 3706 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 4192 3725 gene locus_tag LOCUS_19630 4192 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 5533 4313 gene locus_tag LOCUS_19640 5533 4313 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_19640 5607 7175 gene locus_tag LOCUS_19650 5607 7175 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368533.1 protein_id gnl|my_center|LOCUS_19650 7183 7614 gene locus_tag LOCUS_19660 7183 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 7645 8556 gene locus_tag LOCUS_19670 7645 8556 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224861.1 protein_id gnl|my_center|LOCUS_19670 9780 8581 gene locus_tag LOCUS_19680 9780 8581 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S281 protein_id gnl|my_center|LOCUS_19680 9958 11169 gene locus_tag LOCUS_19690 9958 11169 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_19690 11528 11103 gene locus_tag LOCUS_19700 11528 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 11608 12639 gene locus_tag LOCUS_19710 11608 12639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 13904 12687 gene locus_tag LOCUS_19720 13904 12687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 15178 13955 gene locus_tag LOCUS_19730 15178 13955 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222568.1 protein_id gnl|my_center|LOCUS_19730 15218 15799 gene locus_tag LOCUS_19740 15218 15799 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027107.1 protein_id gnl|my_center|LOCUS_19740 15844 16602 gene locus_tag LOCUS_19750 15844 16602 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731216.1 protein_id gnl|my_center|LOCUS_19750 17097 16609 gene locus_tag LOCUS_19760 17097 16609 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391432.1 protein_id gnl|my_center|LOCUS_19760 17227 18348 gene locus_tag LOCUS_19770 gene ald 17227 18348 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU16 protein_id gnl|my_center|LOCUS_19770 19853 18468 gene locus_tag LOCUS_19780 19853 18468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 19747 20112 gene locus_tag LOCUS_19790 19747 20112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 20109 21320 gene locus_tag LOCUS_19800 20109 21320 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029442.1 protein_id gnl|my_center|LOCUS_19800 22604 21327 gene locus_tag LOCUS_19810 gene kynU 22604 21327 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK35 protein_id gnl|my_center|LOCUS_19810 <24701 22630 gene locus_tag LOCUS_19820 <24701 22630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III >Feature sequence38 1054 143 gene locus_tag LOCUS_19830 1054 143 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964056.1 protein_id gnl|my_center|LOCUS_19830 3218 1407 gene locus_tag LOCUS_19840 3218 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 3768 4064 gene locus_tag LOCUS_19850 3768 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 4993 4109 gene locus_tag LOCUS_19860 4993 4109 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_19860 5119 5913 gene locus_tag LOCUS_19870 5119 5913 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816315.1 protein_id gnl|my_center|LOCUS_19870 5958 7550 gene locus_tag LOCUS_19880 gene glpD 5958 7550 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HMD4 protein_id gnl|my_center|LOCUS_19880 7540 8946 gene locus_tag LOCUS_19890 7540 8946 CDS product putative flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704612.1 protein_id gnl|my_center|LOCUS_19890 8993 10426 gene locus_tag LOCUS_19900 gene glpK 8993 10426 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RST6 protein_id gnl|my_center|LOCUS_19900 10473 10670 gene locus_tag LOCUS_19910 10473 10670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 10667 10975 gene locus_tag LOCUS_19920 10667 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 11034 11441 gene locus_tag LOCUS_19930 11034 11441 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383881.1 protein_id gnl|my_center|LOCUS_19930 12397 11465 gene locus_tag LOCUS_19940 12397 11465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_19940 12390 12581 gene locus_tag LOCUS_19950 12390 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 12603 13037 gene locus_tag LOCUS_19960 12603 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701975.1 protein_id gnl|my_center|LOCUS_19960 13068 13865 gene locus_tag LOCUS_19970 13068 13865 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L016 protein_id gnl|my_center|LOCUS_19970 13902 14648 gene locus_tag LOCUS_19980 13902 14648 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_19980 14707 14928 gene locus_tag LOCUS_19990 14707 14928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 14921 15094 gene locus_tag LOCUS_20000 14921 15094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 15091 15954 gene locus_tag LOCUS_20010 15091 15954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 15980 16852 gene locus_tag LOCUS_20020 15980 16852 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_20020 18470 16860 gene locus_tag LOCUS_20030 18470 16860 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 protein_id gnl|my_center|LOCUS_20030 18933 18487 gene locus_tag LOCUS_20040 18933 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 18994 19776 gene locus_tag LOCUS_20050 18994 19776 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976846.1 protein_id gnl|my_center|LOCUS_20050 20259 19786 gene locus_tag LOCUS_20060 20259 19786 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186487.1 protein_id gnl|my_center|LOCUS_20060 20876 20232 gene locus_tag LOCUS_20070 20876 20232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 21845 20886 gene locus_tag LOCUS_20080 21845 20886 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706670.1 protein_id gnl|my_center|LOCUS_20080 23017 21851 gene locus_tag LOCUS_20090 23017 21851 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence39 99 1541 gene locus_tag LOCUS_20100 99 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2636 1551 gene locus_tag LOCUS_20110 2636 1551 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085431.1 protein_id gnl|my_center|LOCUS_20110 3044 2691 gene locus_tag LOCUS_20120 3044 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 3943 3050 gene locus_tag LOCUS_20130 3943 3050 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLV9 protein_id gnl|my_center|LOCUS_20130 4693 3998 gene locus_tag LOCUS_20140 gene ftsE 4693 3998 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082104.1 protein_id gnl|my_center|LOCUS_20140 5910 4807 gene locus_tag LOCUS_20150 gene prfB 5910 4807 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS78 protein_id gnl|my_center|LOCUS_20150 8617 5927 gene locus_tag LOCUS_20160 gene secA1 8617 5927 CDS product protein translocase subunit SecA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71533 protein_id gnl|my_center|LOCUS_20160 9201 8695 gene locus_tag LOCUS_20170 9201 8695 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_20170 10052 9339 gene locus_tag LOCUS_20180 10052 9339 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDD9 protein_id gnl|my_center|LOCUS_20180 11182 10067 gene locus_tag LOCUS_20190 gene dnaJ 11182 10067 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEX0 protein_id gnl|my_center|LOCUS_20190 12224 11226 gene locus_tag LOCUS_20200 gene hrcA 12224 11226 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBK2 protein_id gnl|my_center|LOCUS_20200 14036 12252 gene locus_tag LOCUS_20210 gene lepA 14036 12252 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0Y9 protein_id gnl|my_center|LOCUS_20210 14228 14488 gene locus_tag LOCUS_20220 gene rpsT 14228 14488 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDA3 protein_id gnl|my_center|LOCUS_20220 15520 14501 gene locus_tag LOCUS_20230 15520 14501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 16431 15517 gene locus_tag LOCUS_20240 16431 15517 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MH13 protein_id gnl|my_center|LOCUS_20240 18176 16428 gene locus_tag LOCUS_20250 18176 16428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 18817 18173 gene locus_tag LOCUS_20260 18817 18173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 19617 18916 gene locus_tag LOCUS_20270 19617 18916 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_20270 19715 20743 gene locus_tag LOCUS_20280 19715 20743 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_20280 20740 21594 gene locus_tag LOCUS_20290 20740 21594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_20290 24096 21622 gene locus_tag LOCUS_20300 gene leuS 24096 21622 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ1 protein_id gnl|my_center|LOCUS_20300 24174 24247 gene locus_tag LOCUS_t00360 24174 24247 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence40 1410 2453 gene locus_tag LOCUS_20310 gene hemE 1410 2453 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69861 protein_id gnl|my_center|LOCUS_20310 2456 3841 gene locus_tag LOCUS_20320 gene hemY 2456 3841 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_20320 4015 4596 gene locus_tag LOCUS_20330 4015 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 4602 6134 gene locus_tag LOCUS_20340 gene lnt 4602 6134 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAD0 protein_id gnl|my_center|LOCUS_20340 6933 6157 gene locus_tag LOCUS_20350 6933 6157 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_20350 7337 6936 gene locus_tag LOCUS_20360 gene dtd 7337 6936 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHV8 protein_id gnl|my_center|LOCUS_20360 7434 8732 gene locus_tag LOCUS_20370 7434 8732 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_20370 8732 9580 gene locus_tag LOCUS_20380 8732 9580 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_20380 9567 10745 gene locus_tag LOCUS_20390 9567 10745 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_20390 11511 10873 gene locus_tag LOCUS_20400 11511 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028272.1 protein_id gnl|my_center|LOCUS_20400 11979 11515 gene locus_tag LOCUS_20410 11979 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 13006 12026 gene locus_tag LOCUS_20420 gene argK 13006 12026 CDS product LAO/AO transport system kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223478.1 protein_id gnl|my_center|LOCUS_20420 13448 12990 gene locus_tag LOCUS_20430 13448 12990 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_20430 15025 13448 gene locus_tag LOCUS_20440 15025 13448 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_20440 15114 15605 gene locus_tag LOCUS_20450 gene marR 15114 15605 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223498.1 protein_id gnl|my_center|LOCUS_20450 15719 16492 gene locus_tag LOCUS_20460 15719 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 17701 16523 gene locus_tag LOCUS_20470 17701 16523 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_20470 19208 17703 gene locus_tag LOCUS_20480 19208 17703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 21576 19216 gene locus_tag LOCUS_20490 21576 19216 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_20490 21733 23796 gene locus_tag LOCUS_20500 21733 23796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 23826 24020 gene locus_tag LOCUS_20510 23826 24020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence41 5676 4030 gene locus_tag LOCUS_20520 gene aruI 5676 4030 CDS product putative 2-ketoarginine decarboxylase AruI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUI8 protein_id gnl|my_center|LOCUS_20520 6747 5737 gene locus_tag LOCUS_20530 6747 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 8119 7025 gene locus_tag LOCUS_20540 8119 7025 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533458.1 protein_id gnl|my_center|LOCUS_20540 9228 8116 gene locus_tag LOCUS_20550 9228 8116 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533459.1 protein_id gnl|my_center|LOCUS_20550 11704 9281 gene locus_tag LOCUS_20560 11704 9281 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533447.1 protein_id gnl|my_center|LOCUS_20560 11783 12661 gene locus_tag LOCUS_20570 11783 12661 CDS product silent information regulator protein Sir2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533453.1 protein_id gnl|my_center|LOCUS_20570 12666 13772 gene locus_tag LOCUS_20580 12666 13772 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_20580 13821 14894 gene locus_tag LOCUS_20590 13821 14894 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533462.1 protein_id gnl|my_center|LOCUS_20590 14891 16228 gene locus_tag LOCUS_20600 14891 16228 CDS product MmgE/Prp family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_20600 16225 17040 gene locus_tag LOCUS_20610 16225 17040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 17096 17824 gene locus_tag LOCUS_20620 17096 17824 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_20620 18808 17855 gene locus_tag LOCUS_20630 18808 17855 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530045.1 protein_id gnl|my_center|LOCUS_20630 18807 19928 gene locus_tag LOCUS_20640 18807 19928 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403187.1 protein_id gnl|my_center|LOCUS_20640 20196 21407 gene locus_tag LOCUS_20650 20196 21407 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085873.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence42 422 739 gene locus_tag LOCUS_20660 422 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 1613 744 gene locus_tag LOCUS_20670 1613 744 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_20670 2557 1610 gene locus_tag LOCUS_20680 2557 1610 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_20680 3783 2554 gene locus_tag LOCUS_20690 3783 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 4257 3787 gene locus_tag LOCUS_20700 4257 3787 CDS product similarity with Glyoxalase/Bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705435.1 protein_id gnl|my_center|LOCUS_20700 4245 6653 gene locus_tag LOCUS_20710 4245 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_20710 6869 6669 gene locus_tag LOCUS_20720 gene cspLB 6869 6669 CDS product cold shock-like protein CspLB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A357 protein_id gnl|my_center|LOCUS_20720 7539 6970 gene locus_tag LOCUS_20730 7539 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 7656 8513 gene locus_tag LOCUS_20740 7656 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 9177 8500 gene locus_tag LOCUS_20750 9177 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 10454 9480 gene locus_tag LOCUS_20760 10454 9480 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531191.1 protein_id gnl|my_center|LOCUS_20760 10948 10694 gene locus_tag LOCUS_20770 10948 10694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 10992 14309 gene locus_tag LOCUS_20780 10992 14309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 14324 17875 gene locus_tag LOCUS_20790 14324 17875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 17872 19581 gene locus_tag LOCUS_20800 17872 19581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 20700 19591 gene locus_tag LOCUS_20810 20700 19591 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331277.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence43 1709 543 gene locus_tag LOCUS_20820 gene argE 1709 543 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CF54 protein_id gnl|my_center|LOCUS_20820 2890 1706 gene locus_tag LOCUS_20830 2890 1706 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974131.1 protein_id gnl|my_center|LOCUS_20830 2948 4099 gene locus_tag LOCUS_20840 2948 4099 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972145.1 protein_id gnl|my_center|LOCUS_20840 5779 4340 gene locus_tag LOCUS_20850 5779 4340 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088964.1 protein_id gnl|my_center|LOCUS_20850 5885 6316 gene locus_tag LOCUS_20860 5885 6316 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_20860 6364 6684 gene locus_tag LOCUS_20870 6364 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 7497 6688 gene locus_tag LOCUS_20880 7497 6688 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531194.1 protein_id gnl|my_center|LOCUS_20880 8992 7532 gene locus_tag LOCUS_20890 8992 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 10194 9031 gene locus_tag LOCUS_20900 gene hutI 10194 9031 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QRN6 protein_id gnl|my_center|LOCUS_20900 11555 10191 gene locus_tag LOCUS_20910 11555 10191 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_20910 12127 11552 gene locus_tag LOCUS_20920 gene def-2 12127 11552 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746R2 protein_id gnl|my_center|LOCUS_20920 13784 12132 gene locus_tag LOCUS_20930 gene hutU 13784 12132 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYC1 protein_id gnl|my_center|LOCUS_20930 13884 14564 gene locus_tag LOCUS_20940 13884 14564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 14561 16102 gene locus_tag LOCUS_20950 14561 16102 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MAU2 protein_id gnl|my_center|LOCUS_20950 16220 16441 gene locus_tag LOCUS_20960 16220 16441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 17033 16470 gene locus_tag LOCUS_20970 17033 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 17363 17097 gene locus_tag LOCUS_20980 17363 17097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 18560 17511 gene locus_tag LOCUS_20990 18560 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 18800 19585 gene locus_tag LOCUS_21000 18800 19585 CDS product recombinase RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027903.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence44 1645 2922 gene locus_tag LOCUS_21010 1645 2922 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224422.1 protein_id gnl|my_center|LOCUS_21010 3482 2976 gene locus_tag LOCUS_21020 3482 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 3423 3611 gene locus_tag LOCUS_21030 3423 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 5007 3754 gene locus_tag LOCUS_21040 5007 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 5095 6402 gene locus_tag LOCUS_21050 5095 6402 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_21050 6410 7588 gene locus_tag LOCUS_21060 6410 7588 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027220.1 protein_id gnl|my_center|LOCUS_21060 7616 7795 gene locus_tag LOCUS_21070 7616 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 7813 8121 gene locus_tag LOCUS_21080 7813 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 8179 8562 gene locus_tag LOCUS_21090 8179 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_21090 9182 8559 gene locus_tag LOCUS_21100 gene pcm 9182 8559 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJY2 protein_id gnl|my_center|LOCUS_21100 10415 9282 gene locus_tag LOCUS_21110 10415 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259226.1 protein_id gnl|my_center|LOCUS_21110 10690 10544 gene locus_tag LOCUS_21120 10690 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 11828 10782 gene locus_tag LOCUS_21130 11828 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566323.1 protein_id gnl|my_center|LOCUS_21130 12621 11863 gene locus_tag LOCUS_21140 12621 11863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816329.1 protein_id gnl|my_center|LOCUS_21140 12781 13659 gene locus_tag LOCUS_21150 12781 13659 CDS product syringomycin biosynthesis enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_21150 14864 13692 gene locus_tag LOCUS_21160 14864 13692 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031193.1 protein_id gnl|my_center|LOCUS_21160 15190 14912 gene locus_tag LOCUS_21170 15190 14912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 15487 15218 gene locus_tag LOCUS_21180 15487 15218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 15841 15569 gene locus_tag LOCUS_21190 15841 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 16765 15905 gene locus_tag LOCUS_21200 16765 15905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223235.1 protein_id gnl|my_center|LOCUS_21200 17642 16860 gene locus_tag LOCUS_21210 17642 16860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 17839 19383 gene locus_tag LOCUS_21220 gene betC 17839 19383 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence45 575 2047 gene locus_tag LOCUS_21230 575 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704555.1 protein_id gnl|my_center|LOCUS_21230 2086 3219 gene locus_tag LOCUS_21240 2086 3219 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06179 protein_id gnl|my_center|LOCUS_21240 4141 3245 gene locus_tag LOCUS_21250 gene rnz 4141 3245 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TYN1 protein_id gnl|my_center|LOCUS_21250 4889 4110 gene locus_tag LOCUS_21260 4889 4110 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_21260 6520 4961 gene locus_tag LOCUS_21270 6520 4961 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_21270 6852 6532 gene locus_tag LOCUS_21280 6852 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 6935 7969 gene locus_tag LOCUS_21290 6935 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 8020 8271 gene locus_tag LOCUS_21300 8020 8271 CDS product antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403381.1 protein_id gnl|my_center|LOCUS_21300 8258 8566 gene locus_tag LOCUS_21310 gene mazF2 8258 8566 CDS product putative endoribonuclease MazF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WII1 protein_id gnl|my_center|LOCUS_21310 8882 8580 gene locus_tag LOCUS_21320 8882 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 8992 9606 gene locus_tag LOCUS_21330 8992 9606 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974604.1 protein_id gnl|my_center|LOCUS_21330 9603 12140 gene locus_tag LOCUS_21340 9603 12140 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_21340 13147 12137 gene locus_tag LOCUS_21350 13147 12137 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031165.1 protein_id gnl|my_center|LOCUS_21350 13908 13144 gene locus_tag LOCUS_21360 13908 13144 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_21360 15101 13905 gene locus_tag LOCUS_21370 15101 13905 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_21370 16923 15199 gene locus_tag LOCUS_21380 16923 15199 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_21380 17074 18723 gene locus_tag LOCUS_21390 17074 18723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 18796 18987 gene locus_tag LOCUS_21400 18796 18987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence46 1483 197 gene locus_tag LOCUS_21410 1483 197 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027491.1 protein_id gnl|my_center|LOCUS_21410 3242 1575 gene locus_tag LOCUS_21420 gene aceB 3242 1575 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1S7 protein_id gnl|my_center|LOCUS_21420 3425 4888 gene locus_tag LOCUS_21430 3425 4888 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 protein_id gnl|my_center|LOCUS_21430 5864 5010 gene locus_tag LOCUS_21440 gene cpdA 5864 5010 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTD8 protein_id gnl|my_center|LOCUS_21440 6127 6055 gene locus_tag LOCUS_t00370 6127 6055 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6207 7568 gene locus_tag LOCUS_21450 6207 7568 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803953.1 protein_id gnl|my_center|LOCUS_21450 7666 9309 gene locus_tag LOCUS_21460 gene tig 7666 9309 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DE09 protein_id gnl|my_center|LOCUS_21460 9306 9953 gene locus_tag LOCUS_21470 gene clpP 9306 9953 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZF9 protein_id gnl|my_center|LOCUS_21470 10124 11386 gene locus_tag LOCUS_21480 gene clpX 10124 11386 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F316 protein_id gnl|my_center|LOCUS_21480 11419 12732 gene locus_tag LOCUS_21490 11419 12732 CDS product dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028454.1 protein_id gnl|my_center|LOCUS_21490 12899 13306 gene locus_tag LOCUS_21500 gene ndk 12899 13306 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50589 protein_id gnl|my_center|LOCUS_21500 13600 14649 gene locus_tag LOCUS_21510 13600 14649 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976188.1 protein_id gnl|my_center|LOCUS_21510 14653 15522 gene locus_tag LOCUS_21520 14653 15522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 15519 16037 gene locus_tag LOCUS_21530 15519 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence47 612 809 gene locus_tag LOCUS_21540 612 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 839 1261 gene locus_tag LOCUS_21550 839 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 1262 1663 gene locus_tag LOCUS_21560 1262 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 1719 1871 gene locus_tag LOCUS_21570 1719 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 1868 2128 gene locus_tag LOCUS_21580 1868 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2129 2623 gene locus_tag LOCUS_21590 2129 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 3052 2645 gene locus_tag LOCUS_21600 3052 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 4262 3081 gene locus_tag LOCUS_21610 4262 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 4888 4259 gene locus_tag LOCUS_21620 gene nadD 4888 4259 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCI6 protein_id gnl|my_center|LOCUS_21620 5172 6005 gene locus_tag LOCUS_21630 gene hrdD 5172 6005 CDS product RNA polymerase principal sigma factor HrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18249 protein_id gnl|my_center|LOCUS_21630 6100 7497 gene locus_tag LOCUS_21640 gene aroH 6100 7497 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80574 protein_id gnl|my_center|LOCUS_21640 9000 7525 gene locus_tag LOCUS_21650 9000 7525 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729941.1 protein_id gnl|my_center|LOCUS_21650 9916 9029 gene locus_tag LOCUS_21660 9916 9029 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_21660 11254 10001 gene locus_tag LOCUS_21670 gene proA 11254 10001 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ6 protein_id gnl|my_center|LOCUS_21670 11351 12955 gene locus_tag LOCUS_21680 gene mviN 11351 12955 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403272.1 protein_id gnl|my_center|LOCUS_21680 14067 12952 gene locus_tag LOCUS_21690 gene proB 14067 12952 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHU9 protein_id gnl|my_center|LOCUS_21690 15346 14105 gene locus_tag LOCUS_21700 gene obg 15346 14105 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ8 protein_id gnl|my_center|LOCUS_21700 >Feature sequence48 <1 1220 gene locus_tag LOCUS_21710 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021450.1:potassium channel protein 2225 1227 gene locus_tag LOCUS_21720 2225 1227 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_21720 2721 2248 gene locus_tag LOCUS_21730 2721 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2833 3780 gene locus_tag LOCUS_21740 gene mca 2833 3780 CDS product mycothiol S-conjugate amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DI54 protein_id gnl|my_center|LOCUS_21740 3780 4178 gene locus_tag LOCUS_21750 3780 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 5026 4196 gene locus_tag LOCUS_21760 5026 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 5589 5089 gene locus_tag LOCUS_21770 5589 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 5831 5598 gene locus_tag LOCUS_21780 5831 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 5971 6933 gene locus_tag LOCUS_21790 5971 6933 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_21790 7785 6943 gene locus_tag LOCUS_21800 7785 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 7804 7983 gene locus_tag LOCUS_21810 7804 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 8629 8003 gene locus_tag LOCUS_21820 8629 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 9882 8674 gene locus_tag LOCUS_21830 9882 8674 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893677.1 protein_id gnl|my_center|LOCUS_21830 10572 9901 gene locus_tag LOCUS_21840 gene nucS 10572 9901 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4C3 protein_id gnl|my_center|LOCUS_21840 11381 10605 gene locus_tag LOCUS_21850 11381 10605 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_21850 11443 12354 gene locus_tag LOCUS_21860 gene cysD 11443 12354 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1W4 protein_id gnl|my_center|LOCUS_21860 12354 13610 gene locus_tag LOCUS_21870 12354 13610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21870 13619 14221 gene locus_tag LOCUS_21880 13619 14221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21880 <15220 14226 gene locus_tag LOCUS_21890 <15220 14226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389280.1:energy-dependent translational throttle protein EttA >Feature sequence49 175 50 gene locus_tag LOCUS_21900 175 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 333 172 gene locus_tag LOCUS_21910 333 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 376 1668 gene locus_tag LOCUS_21920 gene cysD 376 1668 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_21920 1676 2476 gene locus_tag LOCUS_21930 1676 2476 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_21930 3755 2508 gene locus_tag LOCUS_21940 3755 2508 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703853.1 protein_id gnl|my_center|LOCUS_21940 3847 5562 gene locus_tag LOCUS_21950 gene proS 3847 5562 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CD8 protein_id gnl|my_center|LOCUS_21950 5634 6014 gene locus_tag LOCUS_21960 5634 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 6103 6582 gene locus_tag LOCUS_21970 6103 6582 CDS product putative CarD-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701320.1 protein_id gnl|my_center|LOCUS_21970 6691 7170 gene locus_tag LOCUS_21980 6691 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 7267 7848 gene locus_tag LOCUS_21990 7267 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 7950 8747 gene locus_tag LOCUS_22000 7950 8747 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064414.1 protein_id gnl|my_center|LOCUS_22000 10328 8772 gene locus_tag LOCUS_22010 10328 8772 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 protein_id gnl|my_center|LOCUS_22010 11174 10443 gene locus_tag LOCUS_22020 11174 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 <14901 11220 gene locus_tag LOCUS_22030 <14901 11220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837473.1:cell surface SD repeat-containing protein >Feature sequence50 <1 1637 gene locus_tag LOCUS_22040 <1 1637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227069.1:carbon-monoxide dehydrogenase large subunit 1634 3343 gene locus_tag LOCUS_22050 1634 3343 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_22050 3368 3694 gene locus_tag LOCUS_22060 3368 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 4403 3744 gene locus_tag LOCUS_22070 4403 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 5603 4554 gene locus_tag LOCUS_22080 gene metE 5603 4554 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088354.1 protein_id gnl|my_center|LOCUS_22080 5663 7033 gene locus_tag LOCUS_22090 5663 7033 CDS product carotenoid cleavage oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403360.1 protein_id gnl|my_center|LOCUS_22090 7030 7665 gene locus_tag LOCUS_22100 7030 7665 CDS product TIGR03085 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727132.1 protein_id gnl|my_center|LOCUS_22100 9747 7669 gene locus_tag LOCUS_22110 9747 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 9827 10903 gene locus_tag LOCUS_22120 9827 10903 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 protein_id gnl|my_center|LOCUS_22120 12335 10896 gene locus_tag LOCUS_22130 12335 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 13620 12367 gene locus_tag LOCUS_22140 13620 12367 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence51 222 1100 gene locus_tag LOCUS_22150 222 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 1434 1090 gene locus_tag LOCUS_22160 1434 1090 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168851.1 protein_id gnl|my_center|LOCUS_22160 1765 1445 gene locus_tag LOCUS_22170 1765 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_22170 2061 1765 gene locus_tag LOCUS_22180 2061 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088538.1 protein_id gnl|my_center|LOCUS_22180 3032 2127 gene locus_tag LOCUS_22190 3032 2127 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530665.1 protein_id gnl|my_center|LOCUS_22190 3111 3656 gene locus_tag LOCUS_22200 3111 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 3784 4854 gene locus_tag LOCUS_22210 3784 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 4898 5731 gene locus_tag LOCUS_22220 gene phnC 4898 5731 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CMU4 protein_id gnl|my_center|LOCUS_22220 5728 6522 gene locus_tag LOCUS_22230 5728 6522 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014378.1 protein_id gnl|my_center|LOCUS_22230 6524 7417 gene locus_tag LOCUS_22240 6524 7417 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014377.1 protein_id gnl|my_center|LOCUS_22240 7448 7738 gene locus_tag LOCUS_22250 7448 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 protein_id gnl|my_center|LOCUS_22250 7774 8706 gene locus_tag LOCUS_22260 7774 8706 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014942.1 protein_id gnl|my_center|LOCUS_22260 8786 10135 gene locus_tag LOCUS_22270 gene glnT 8786 10135 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897682.1 protein_id gnl|my_center|LOCUS_22270 11390 10149 gene locus_tag LOCUS_22280 11390 10149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 11515 11589 gene locus_tag LOCUS_t00380 11515 11589 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11647 12036 gene locus_tag LOCUS_22290 11647 12036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 12747 12058 gene locus_tag LOCUS_22300 12747 12058 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 protein_id gnl|my_center|LOCUS_22300 <13801 12809 gene locus_tag LOCUS_22310 <13801 12809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729463.1:oxidoreductase >Feature sequence52 456 1745 gene locus_tag LOCUS_22320 456 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 1798 2559 gene locus_tag LOCUS_22330 1798 2559 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728235.1 protein_id gnl|my_center|LOCUS_22330 2992 2570 gene locus_tag LOCUS_22340 2992 2570 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763493.1 protein_id gnl|my_center|LOCUS_22340 3459 2989 gene locus_tag LOCUS_22350 3459 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 3935 3489 gene locus_tag LOCUS_22360 3935 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 4957 4019 gene locus_tag LOCUS_22370 4957 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 6621 4969 gene locus_tag LOCUS_22380 6621 4969 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_22380 7866 6658 gene locus_tag LOCUS_22390 7866 6658 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228841.1 protein_id gnl|my_center|LOCUS_22390 8531 7920 gene locus_tag LOCUS_22400 8531 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 10642 8528 gene locus_tag LOCUS_22410 10642 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 11430 10651 gene locus_tag LOCUS_22420 gene tatC 11430 10651 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MAJ8 protein_id gnl|my_center|LOCUS_22420 11725 11420 gene locus_tag LOCUS_22430 11725 11420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 11798 12514 gene locus_tag LOCUS_22440 11798 12514 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_22440 <13308 12542 gene locus_tag LOCUS_22450 <13308 12542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NJ09:signal peptidase I >Feature sequence53 3075 3716 gene locus_tag LOCUS_22460 3075 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 3789 4718 gene locus_tag LOCUS_22470 3789 4718 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_22470 4715 5626 gene locus_tag LOCUS_22480 4715 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 5626 5991 gene locus_tag LOCUS_22490 5626 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_22490 7748 5988 gene locus_tag LOCUS_22500 7748 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 7805 8275 gene locus_tag LOCUS_22510 7805 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 9212 8280 gene locus_tag LOCUS_22520 9212 8280 CDS product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869316.1 protein_id gnl|my_center|LOCUS_22520 10112 9231 gene locus_tag LOCUS_22530 gene rbsK 10112 9231 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCE6 protein_id gnl|my_center|LOCUS_22530 10666 10109 gene locus_tag LOCUS_22540 10666 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 11174 10746 gene locus_tag LOCUS_22550 11174 10746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 12251 11304 gene locus_tag LOCUS_22560 12251 11304 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence54 428 1654 gene locus_tag LOCUS_22570 428 1654 CDS product gamma-butyrobetaine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 protein_id gnl|my_center|LOCUS_22570 2232 1651 gene locus_tag LOCUS_22580 2232 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2350 3066 gene locus_tag LOCUS_22590 2350 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 3416 3745 gene locus_tag LOCUS_22600 3416 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 3918 4946 gene locus_tag LOCUS_22610 3918 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 5053 5128 gene locus_tag LOCUS_t00390 5053 5128 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5506 5195 gene locus_tag LOCUS_22620 5506 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 5739 6083 gene locus_tag LOCUS_22630 5739 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 6990 6088 gene locus_tag LOCUS_22640 6990 6088 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728755.1 protein_id gnl|my_center|LOCUS_22640 7165 7395 gene locus_tag LOCUS_22650 7165 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 7412 7795 gene locus_tag LOCUS_22660 7412 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 7865 8332 gene locus_tag LOCUS_22670 7865 8332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 8763 8329 gene locus_tag LOCUS_22680 8763 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 8832 10286 gene locus_tag LOCUS_22690 gene gabD 8832 10286 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527051.1 protein_id gnl|my_center|LOCUS_22690 10408 11892 gene locus_tag LOCUS_22700 10408 11892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence55 986 1609 gene locus_tag LOCUS_22710 986 1609 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918133.1 protein_id gnl|my_center|LOCUS_22710 1629 2411 gene locus_tag LOCUS_22720 1629 2411 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_22720 2743 3393 gene locus_tag LOCUS_22730 2743 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 3418 3804 gene locus_tag LOCUS_22740 3418 3804 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230197.1 protein_id gnl|my_center|LOCUS_22740 6108 3808 gene locus_tag LOCUS_22750 gene uvrD2 6108 3808 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64321 protein_id gnl|my_center|LOCUS_22750 6194 6544 gene locus_tag LOCUS_22760 6194 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731270.1 protein_id gnl|my_center|LOCUS_22760 6871 6548 gene locus_tag LOCUS_22770 6871 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 6840 7766 gene locus_tag LOCUS_22780 6840 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 8273 7770 gene locus_tag LOCUS_22790 gene elaA 8273 7770 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223944.1 protein_id gnl|my_center|LOCUS_22790 8261 9106 gene locus_tag LOCUS_22800 8261 9106 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_22800 9121 10263 gene locus_tag LOCUS_22810 9121 10263 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence56 3738 4478 gene locus_tag LOCUS_22820 3738 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 4679 6196 gene locus_tag LOCUS_22830 4679 6196 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_22830 6183 7322 gene locus_tag LOCUS_22840 gene dprA 6183 7322 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_22840 7414 9078 gene locus_tag LOCUS_22850 7414 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 9203 8970 gene locus_tag LOCUS_22860 9203 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence57 130 1320 gene locus_tag LOCUS_22870 130 1320 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_22870 1334 2866 gene locus_tag LOCUS_22880 1334 2866 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXU3 protein_id gnl|my_center|LOCUS_22880 2988 4106 gene locus_tag LOCUS_22890 2988 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 5161 4151 gene locus_tag LOCUS_22900 5161 4151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_22900 6261 5161 gene locus_tag LOCUS_22910 6261 5161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_22910 7136 6276 gene locus_tag LOCUS_22920 7136 6276 CDS product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970051.1 protein_id gnl|my_center|LOCUS_22920 8166 7159 gene locus_tag LOCUS_22930 8166 7159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085651.1 protein_id gnl|my_center|LOCUS_22930 <9914 8217 gene locus_tag LOCUS_22940 <9914 8217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065068.1:peptide ABC transporter substrate-binding protein >Feature sequence58 1492 17 gene locus_tag LOCUS_22950 1492 17 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525159.1 protein_id gnl|my_center|LOCUS_22950 2639 1494 gene locus_tag LOCUS_22960 gene leuB 2639 1494 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV53 protein_id gnl|my_center|LOCUS_22960 2745 3932 gene locus_tag LOCUS_22970 2745 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 4823 3963 gene locus_tag LOCUS_22980 4823 3963 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404185.1 protein_id gnl|my_center|LOCUS_22980 5256 4840 gene locus_tag LOCUS_22990 5256 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 5927 5253 gene locus_tag LOCUS_23000 5927 5253 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_23000 5952 6593 gene locus_tag LOCUS_23010 5952 6593 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600286.1 protein_id gnl|my_center|LOCUS_23010 6648 7145 gene locus_tag LOCUS_23020 6648 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_23020 7135 7914 gene locus_tag LOCUS_23030 7135 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_23030 7922 8932 gene locus_tag LOCUS_23040 7922 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence59 406 221 gene locus_tag LOCUS_23050 406 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 958 491 gene locus_tag LOCUS_23060 958 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 1333 1091 gene locus_tag LOCUS_23070 1333 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2542 1754 gene locus_tag LOCUS_23080 2542 1754 CDS product dimethylargininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868883.1 protein_id gnl|my_center|LOCUS_23080 2669 3553 gene locus_tag LOCUS_23090 2669 3553 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_23090 3704 4426 gene locus_tag LOCUS_23100 3704 4426 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_23100 5222 4452 gene locus_tag LOCUS_23110 5222 4452 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268040.1 protein_id gnl|my_center|LOCUS_23110 6634 6894 gene locus_tag LOCUS_23120 6634 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 7285 7211 gene locus_tag LOCUS_t00400 7285 7211 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence60 <1 998 gene locus_tag LOCUS_23130 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393297.1:site-specific integrase 1152 1076 gene locus_tag LOCUS_t00410 1152 1076 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1286 1209 gene locus_tag LOCUS_t00420 1286 1209 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1378 2502 gene locus_tag LOCUS_23140 1378 2502 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061599.1 protein_id gnl|my_center|LOCUS_23140 2751 3296 gene locus_tag LOCUS_23150 2751 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 3430 3508 gene locus_tag LOCUS_t00430 3430 3508 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3974 3648 gene locus_tag LOCUS_23160 3974 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 4214 4345 gene locus_tag LOCUS_23170 4214 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 4406 4639 gene locus_tag LOCUS_23180 4406 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23180 6127 4661 gene locus_tag LOCUS_23190 6127 4661 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701275.1 protein_id gnl|my_center|LOCUS_23190 6229 6678 gene locus_tag LOCUS_23200 6229 6678 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776269.1 protein_id gnl|my_center|LOCUS_23200 8099 6858 gene locus_tag LOCUS_23210 8099 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence61 394 71 gene locus_tag LOCUS_23220 394 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 482 1729 gene locus_tag LOCUS_23230 482 1729 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_23230 2753 1899 gene locus_tag LOCUS_23240 2753 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 3722 2832 gene locus_tag LOCUS_23250 3722 2832 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896244.1 protein_id gnl|my_center|LOCUS_23250 3840 5027 gene locus_tag LOCUS_23260 3840 5027 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 protein_id gnl|my_center|LOCUS_23260 5054 6463 gene locus_tag LOCUS_23270 5054 6463 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896176.1 protein_id gnl|my_center|LOCUS_23270 6472 7485 gene locus_tag LOCUS_23280 6472 7485 CDS product threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228883.1 protein_id gnl|my_center|LOCUS_23280 7519 7983 gene locus_tag LOCUS_23290 7519 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence62 <1 1806 gene locus_tag LOCUS_23300 <1 1806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 1806 2954 gene locus_tag LOCUS_23310 1806 2954 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_23310 3020 5017 gene locus_tag LOCUS_23320 3020 5017 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028452.1 protein_id gnl|my_center|LOCUS_23320 5014 6042 gene locus_tag LOCUS_23330 5014 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 6702 6253 gene locus_tag LOCUS_23340 6702 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 6595 7860 gene locus_tag LOCUS_23350 6595 7860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23350 >Feature sequence63 <1 765 gene locus_tag LOCUS_23360 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028049.1:cytochrome b561 762 1070 gene locus_tag LOCUS_23370 gene clpS 762 1070 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DET2 protein_id gnl|my_center|LOCUS_23370 1128 1601 gene locus_tag LOCUS_23380 1128 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1683 1758 gene locus_tag LOCUS_t00440 1683 1758 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1807 1884 gene locus_tag LOCUS_t00450 1807 1884 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1916 1990 gene locus_tag LOCUS_t00460 1916 1990 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2058 2876 gene locus_tag LOCUS_23390 2058 2876 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086938.1 protein_id gnl|my_center|LOCUS_23390 2953 4662 gene locus_tag LOCUS_23400 2953 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 5653 4679 gene locus_tag LOCUS_23410 5653 4679 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950930.1 protein_id gnl|my_center|LOCUS_23410 5807 7234 gene locus_tag LOCUS_23420 5807 7234 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_23420 7309 7506 gene locus_tag LOCUS_23430 7309 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence64 2259 388 gene locus_tag LOCUS_23440 2259 388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_23440 2375 3610 gene locus_tag LOCUS_23450 2375 3610 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_23450 4475 3816 gene locus_tag LOCUS_23460 4475 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 5449 4484 gene locus_tag LOCUS_23470 5449 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 5588 6325 gene locus_tag LOCUS_23480 gene bdhA 5588 6325 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084310.1 protein_id gnl|my_center|LOCUS_23480 6870 6406 gene locus_tag LOCUS_23490 6870 6406 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence65 939 88 gene locus_tag LOCUS_23500 939 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2067 964 gene locus_tag LOCUS_23510 2067 964 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_23510 3713 2091 gene locus_tag LOCUS_23520 3713 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 4930 3713 gene locus_tag LOCUS_23530 4930 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 6330 4936 gene locus_tag LOCUS_23540 6330 4936 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2Q6 protein_id gnl|my_center|LOCUS_23540 6499 6714 gene locus_tag LOCUS_23550 6499 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence66 1597 605 gene locus_tag LOCUS_23560 1597 605 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388346.1 protein_id gnl|my_center|LOCUS_23560 2790 1597 gene locus_tag LOCUS_23570 2790 1597 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_23570 3748 2807 gene locus_tag LOCUS_23580 3748 2807 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975891.1 protein_id gnl|my_center|LOCUS_23580 4701 3748 gene locus_tag LOCUS_23590 gene dppB 4701 3748 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385051.1 protein_id gnl|my_center|LOCUS_23590 <6564 4837 gene locus_tag LOCUS_23600 <6564 4837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384739.1:ABC transporter substrate-binding protein >Feature sequence67 132 1187 gene locus_tag LOCUS_23610 gene gap 132 1187 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z518 protein_id gnl|my_center|LOCUS_23610 1205 2323 gene locus_tag LOCUS_23620 gene pgk 1205 2323 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU1 protein_id gnl|my_center|LOCUS_23620 2366 3151 gene locus_tag LOCUS_23630 gene tpiA 2366 3151 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z520 protein_id gnl|my_center|LOCUS_23630 3184 3408 gene locus_tag LOCUS_23640 gene secG 3184 3408 CDS product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z469 protein_id gnl|my_center|LOCUS_23640 4620 3712 gene locus_tag LOCUS_23650 4620 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 4688 6211 gene locus_tag LOCUS_23660 gene glpK 4688 6211 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXW1 protein_id gnl|my_center|LOCUS_23660 6310 6396 gene locus_tag LOCUS_t00470 6310 6396 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence68 267 3017 gene locus_tag LOCUS_23670 gene valS 267 3017 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MAR0 protein_id gnl|my_center|LOCUS_23670 3349 4146 gene locus_tag LOCUS_23680 gene crt 3349 4146 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_23680 5475 4174 gene locus_tag LOCUS_23690 5475 4174 CDS product amide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027006.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence69 1534 2709 gene locus_tag LOCUS_23700 1534 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2741 3403 gene locus_tag LOCUS_23710 2741 3403 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704421.1 protein_id gnl|my_center|LOCUS_23710 3874 3404 gene locus_tag LOCUS_23720 3874 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226024.1 protein_id gnl|my_center|LOCUS_23720 5684 3885 gene locus_tag LOCUS_23730 5684 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence70 1680 676 gene locus_tag LOCUS_23740 1680 676 CDS product putative sugar-phosphate nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704340.1 protein_id gnl|my_center|LOCUS_23740 2371 1691 gene locus_tag LOCUS_23750 2371 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 3653 2421 gene locus_tag LOCUS_23760 3653 2421 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081170.1 protein_id gnl|my_center|LOCUS_23760 4772 3660 gene locus_tag LOCUS_23770 4772 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 <5864 4780 gene locus_tag LOCUS_23780 <5864 4780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257167.1:glycosyl transferase family 1 >Feature sequence71 2587 1313 gene locus_tag LOCUS_23790 2587 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59985 protein_id gnl|my_center|LOCUS_23790 3807 2632 gene locus_tag LOCUS_23800 3807 2632 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_23800 4613 3822 gene locus_tag LOCUS_23810 gene cobB2 4613 3822 CDS product NAD-dependent protein deacetylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJM9 protein_id gnl|my_center|LOCUS_23810 >Feature sequence72 2104 1859 gene locus_tag LOCUS_23820 2104 1859 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230558.1 protein_id gnl|my_center|LOCUS_23820 3704 2217 gene locus_tag LOCUS_23830 3704 2217 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938166.1 protein_id gnl|my_center|LOCUS_23830 4594 3704 gene locus_tag LOCUS_23840 4594 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225794.1 protein_id gnl|my_center|LOCUS_23840 4706 4633 gene locus_tag LOCUS_t00480 4706 4633 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence73 214 1674 gene locus_tag LOCUS_23850 214 1674 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_23850 2522 1665 gene locus_tag LOCUS_23860 2522 1665 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_23860 3084 2557 gene locus_tag LOCUS_23870 3084 2557 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5A8 protein_id gnl|my_center|LOCUS_23870 3230 3448 gene locus_tag LOCUS_23880 3230 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 3547 3711 gene locus_tag LOCUS_23890 3547 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 4822 4112 gene locus_tag LOCUS_23900 4822 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence74 1691 135 gene locus_tag LOCUS_23910 1691 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 2958 1783 gene locus_tag LOCUS_23920 2958 1783 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404246.1 protein_id gnl|my_center|LOCUS_23920 3755 2955 gene locus_tag LOCUS_23930 3755 2955 CDS product Asp/Glu racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531948.1 protein_id gnl|my_center|LOCUS_23930 4627 3752 gene locus_tag LOCUS_23940 gene thpD 4627 3752 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895349.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence75 <1 772 gene locus_tag LOCUS_23950 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027531.1:ABC transporter ATP-binding protein 862 3564 gene locus_tag LOCUS_23960 862 3564 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence76 794 408 gene locus_tag LOCUS_23970 794 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 3003 937 gene locus_tag LOCUS_23980 3003 937 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXS5 protein_id gnl|my_center|LOCUS_23980 >Feature sequence77 2628 898 gene locus_tag LOCUS_23990 2628 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence78 356 1636 gene locus_tag LOCUS_24000 356 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 1959 2459 gene locus_tag LOCUS_24010 1959 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015609.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence79 339 878 gene locus_tag LOCUS_24020 339 878 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970094.1 protein_id gnl|my_center|LOCUS_24020 899 2356 gene locus_tag LOCUS_24030 gene pepA 899 2356 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67868 protein_id gnl|my_center|LOCUS_24030 >Feature sequence80 2112 868 gene locus_tag LOCUS_24040 2112 868 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence81 73 1299 gene locus_tag LOCUS_24050 73 1299 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKT7 protein_id gnl|my_center|LOCUS_24050 1629 1378 gene locus_tag LOCUS_24060 gene rpmA 1629 1378 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCJ5 protein_id gnl|my_center|LOCUS_24060 2065 1757 gene locus_tag LOCUS_24070 gene rplU 2065 1757 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDR4 protein_id gnl|my_center|LOCUS_24070 >Feature sequence82 <1 1129 gene locus_tag LOCUS_24080 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004419150.1:SAM-dependent methyltransferase <2194 1057 gene locus_tag LOCUS_24090 <2194 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000842681.1:glycosyl transferase >Feature sequence83 <1 538 gene locus_tag LOCUS_24100 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977279.1:4-amino-4-deoxychorismate lyase 1300 554 gene locus_tag LOCUS_24110 1300 554 CDS product putative biotin--acetyl-CoA-carboxylase ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704354.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence84 194 1627 gene locus_tag LOCUS_24120 194 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence85 219 737 gene locus_tag LOCUS_24130 219 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 734 1804 gene locus_tag LOCUS_24140 734 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence86 244 1041 gene locus_tag LOCUS_24150 244 1041 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088824.1 protein_id gnl|my_center|LOCUS_24150 1125 1382 gene locus_tag LOCUS_24160 1125 1382 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGE4 protein_id gnl|my_center|LOCUS_24160 1379 1777 gene locus_tag LOCUS_24170 1379 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence87 7 930 gene locus_tag LOCUS_24180 7 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence88 289 398 gene locus_tag LOCUS_r00010 289 398 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1334 471 gene locus_tag LOCUS_24190 1334 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence89 988 128 gene locus_tag LOCUS_24200 988 128 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GN7 protein_id gnl|my_center|LOCUS_24200 <1657 1068 gene locus_tag LOCUS_24210 <1657 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763227.1:group 1 glycosyl transferase >Feature sequence90 1243 257 gene locus_tag LOCUS_24220 1243 257 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546520.1 protein_id gnl|my_center|LOCUS_24220 >Feature sequence91