>Feature sequence001 1281 823 gene locus_tag LOCUS_00010 gene coxS 1281 823 CDS product carbon-monoxide dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_00010 2034 1495 gene locus_tag LOCUS_00020 2034 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2154 3305 gene locus_tag LOCUS_00030 2154 3305 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_00030 3343 4152 gene locus_tag LOCUS_00040 gene paaG 3343 4152 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225682.1 protein_id gnl|my_center|LOCUS_00040 4167 4829 gene locus_tag LOCUS_00050 4167 4829 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222235.1 protein_id gnl|my_center|LOCUS_00050 4864 5787 gene locus_tag LOCUS_00060 4864 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7905 5806 gene locus_tag LOCUS_00070 gene cat5 7905 5806 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404999.1 protein_id gnl|my_center|LOCUS_00070 8929 7946 gene locus_tag LOCUS_00080 8929 7946 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029094.1 protein_id gnl|my_center|LOCUS_00080 9375 8950 gene locus_tag LOCUS_00090 9375 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9625 9407 gene locus_tag LOCUS_00100 9625 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11303 9654 gene locus_tag LOCUS_00110 11303 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12505 11384 gene locus_tag LOCUS_00120 12505 11384 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089770.1 protein_id gnl|my_center|LOCUS_00120 12629 13951 gene locus_tag LOCUS_00130 12629 13951 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085724.1 protein_id gnl|my_center|LOCUS_00130 13986 15908 gene locus_tag LOCUS_00140 13986 15908 CDS product beta-lactamase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702054.1 protein_id gnl|my_center|LOCUS_00140 15979 17538 gene locus_tag LOCUS_00150 15979 17538 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532332.1 protein_id gnl|my_center|LOCUS_00150 17557 18585 gene locus_tag LOCUS_00160 17557 18585 CDS product putative dihydrodipicolinate synthetase DapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701791.1 protein_id gnl|my_center|LOCUS_00160 18635 20131 gene locus_tag LOCUS_00170 gene dhaL 18635 20131 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973458.1 protein_id gnl|my_center|LOCUS_00170 20136 21455 gene locus_tag LOCUS_00180 20136 21455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 protein_id gnl|my_center|LOCUS_00180 21468 22217 gene locus_tag LOCUS_00190 21468 22217 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967027.1 protein_id gnl|my_center|LOCUS_00190 22214 23017 gene locus_tag LOCUS_00200 22214 23017 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 protein_id gnl|my_center|LOCUS_00200 23709 23038 gene locus_tag LOCUS_00210 23709 23038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23620 23994 gene locus_tag LOCUS_00220 23620 23994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25611 24016 gene locus_tag LOCUS_00230 25611 24016 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227966.1 protein_id gnl|my_center|LOCUS_00230 26785 25601 gene locus_tag LOCUS_00240 26785 25601 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226683.1 protein_id gnl|my_center|LOCUS_00240 27454 26810 gene locus_tag LOCUS_00250 gene ykwB 27454 26810 CDS product putative N-acetyltransferase YkwB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q796K9 protein_id gnl|my_center|LOCUS_00250 28591 27458 gene locus_tag LOCUS_00260 28591 27458 CDS product peptidase C45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257273.1 protein_id gnl|my_center|LOCUS_00260 28712 29620 gene locus_tag LOCUS_00270 gene psuG 28712 29620 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNP3 protein_id gnl|my_center|LOCUS_00270 29753 29610 gene locus_tag LOCUS_00280 29753 29610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 30469 29750 gene locus_tag LOCUS_00290 30469 29750 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_00290 31409 30486 gene locus_tag LOCUS_00300 gene ilvE2 31409 30486 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_00300 31609 31448 gene locus_tag LOCUS_00310 31609 31448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33418 31739 gene locus_tag LOCUS_00320 33418 31739 CDS product thiamine pyrophosphate TPP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530395.1 protein_id gnl|my_center|LOCUS_00320 33511 34254 gene locus_tag LOCUS_00330 33511 34254 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968528.1 protein_id gnl|my_center|LOCUS_00330 36097 34298 gene locus_tag LOCUS_00340 36097 34298 CDS product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808155.1 protein_id gnl|my_center|LOCUS_00340 36155 36328 gene locus_tag LOCUS_00350 36155 36328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36504 37085 gene locus_tag LOCUS_00360 36504 37085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 37370 37095 gene locus_tag LOCUS_00370 37370 37095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 37326 38306 gene locus_tag LOCUS_00380 37326 38306 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972697.1 protein_id gnl|my_center|LOCUS_00380 38306 39046 gene locus_tag LOCUS_00390 38306 39046 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969220.1 protein_id gnl|my_center|LOCUS_00390 39039 40913 gene locus_tag LOCUS_00400 39039 40913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975395.1 protein_id gnl|my_center|LOCUS_00400 40913 41863 gene locus_tag LOCUS_00410 40913 41863 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118295.1 protein_id gnl|my_center|LOCUS_00410 41863 43305 gene locus_tag LOCUS_00420 41863 43305 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_00420 43341 43817 gene locus_tag LOCUS_00430 43341 43817 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MXM7 protein_id gnl|my_center|LOCUS_00430 44726 43899 gene locus_tag LOCUS_00440 gene tauD 44726 43899 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230665.1 protein_id gnl|my_center|LOCUS_00440 46306 44723 gene locus_tag LOCUS_00450 46306 44723 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976198.1 protein_id gnl|my_center|LOCUS_00450 46554 46369 gene locus_tag LOCUS_00460 46554 46369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 47792 46551 gene locus_tag LOCUS_00470 47792 46551 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088366.1 protein_id gnl|my_center|LOCUS_00470 47876 49351 gene locus_tag LOCUS_00480 47876 49351 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919225.1 protein_id gnl|my_center|LOCUS_00480 49259 49187 gene locus_tag LOCUS_t00010 49259 49187 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 49383 50192 gene locus_tag LOCUS_00490 49383 50192 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_00490 50315 50917 gene locus_tag LOCUS_00500 50315 50917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528738.1 protein_id gnl|my_center|LOCUS_00500 51086 50901 gene locus_tag LOCUS_00510 51086 50901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 51022 51741 gene locus_tag LOCUS_00520 51022 51741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 51875 51799 gene locus_tag LOCUS_t00020 51875 51799 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 53319 52141 gene locus_tag LOCUS_00530 gene argE 53319 52141 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CF54 protein_id gnl|my_center|LOCUS_00530 54500 53316 gene locus_tag LOCUS_00540 54500 53316 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974131.1 protein_id gnl|my_center|LOCUS_00540 54598 55422 gene locus_tag LOCUS_00550 54598 55422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 55487 56638 gene locus_tag LOCUS_00560 55487 56638 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976382.1 protein_id gnl|my_center|LOCUS_00560 58129 56690 gene locus_tag LOCUS_00570 58129 56690 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088964.1 protein_id gnl|my_center|LOCUS_00570 58990 58181 gene locus_tag LOCUS_00580 58990 58181 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531194.1 protein_id gnl|my_center|LOCUS_00580 60485 59025 gene locus_tag LOCUS_00590 60485 59025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 60664 62991 gene locus_tag LOCUS_00600 gene atsD 60664 62991 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_00600 63011 64417 gene locus_tag LOCUS_00610 63011 64417 CDS product putative flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704612.1 protein_id gnl|my_center|LOCUS_00610 64436 65872 gene locus_tag LOCUS_00620 gene glpK 64436 65872 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U940 protein_id gnl|my_center|LOCUS_00620 65869 67605 gene locus_tag LOCUS_00630 65869 67605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 68311 67616 gene locus_tag LOCUS_00640 68311 67616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 68868 68308 gene locus_tag LOCUS_00650 68868 68308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 69800 69057 gene locus_tag LOCUS_00660 gene pcaR 69800 69057 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_00660 69881 72331 gene locus_tag LOCUS_00670 69881 72331 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533447.1 protein_id gnl|my_center|LOCUS_00670 72345 73928 gene locus_tag LOCUS_00680 72345 73928 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527999.1 protein_id gnl|my_center|LOCUS_00680 74330 73947 gene locus_tag LOCUS_00690 74330 73947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 75301 74327 gene locus_tag LOCUS_00700 75301 74327 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNY3 protein_id gnl|my_center|LOCUS_00700 75284 75763 gene locus_tag LOCUS_00710 75284 75763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 75760 76086 gene locus_tag LOCUS_00720 75760 76086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 76106 77746 gene locus_tag LOCUS_00730 76106 77746 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728248.1 protein_id gnl|my_center|LOCUS_00730 79052 77766 gene locus_tag LOCUS_00740 gene serS 79052 77766 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66647 protein_id gnl|my_center|LOCUS_00740 79983 79138 gene locus_tag LOCUS_00750 79983 79138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 80387 80049 gene locus_tag LOCUS_00760 80387 80049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 81012 80413 gene locus_tag LOCUS_00770 81012 80413 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531504.1 protein_id gnl|my_center|LOCUS_00770 83011 81005 gene locus_tag LOCUS_00780 83011 81005 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819N3 protein_id gnl|my_center|LOCUS_00780 84204 83011 gene locus_tag LOCUS_00790 84204 83011 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLI2 protein_id gnl|my_center|LOCUS_00790 84995 84204 gene locus_tag LOCUS_00800 84995 84204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 85619 85026 gene locus_tag LOCUS_00810 gene ctaE 85619 85026 CDS product putative cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X809 protein_id gnl|my_center|LOCUS_00810 87202 85619 gene locus_tag LOCUS_00820 87202 85619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 88244 87396 gene locus_tag LOCUS_00830 gene ctaB 88244 87396 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MCQ0 protein_id gnl|my_center|LOCUS_00830 89174 88347 gene locus_tag LOCUS_00840 89174 88347 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_00840 89253 90164 gene locus_tag LOCUS_00850 89253 90164 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028049.1 protein_id gnl|my_center|LOCUS_00850 90161 90463 gene locus_tag LOCUS_00860 gene clpS 90161 90463 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DET2 protein_id gnl|my_center|LOCUS_00860 90466 90942 gene locus_tag LOCUS_00870 90466 90942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 91012 91087 gene locus_tag LOCUS_t00030 91012 91087 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 91134 91211 gene locus_tag LOCUS_t00040 91134 91211 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 91242 91316 gene locus_tag LOCUS_t00050 91242 91316 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 91384 92202 gene locus_tag LOCUS_00880 91384 92202 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972225.1 protein_id gnl|my_center|LOCUS_00880 92277 93986 gene locus_tag LOCUS_00890 92277 93986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 94985 94011 gene locus_tag LOCUS_00900 94985 94011 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703703.1 protein_id gnl|my_center|LOCUS_00900 95141 96568 gene locus_tag LOCUS_00910 95141 96568 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_00910 96601 96834 gene locus_tag LOCUS_00920 96601 96834 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085690.1 protein_id gnl|my_center|LOCUS_00920 96845 97234 gene locus_tag LOCUS_00930 96845 97234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 97361 98077 gene locus_tag LOCUS_00940 97361 98077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00940 99079 98309 gene locus_tag LOCUS_00950 99079 98309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 100470 99067 gene locus_tag LOCUS_00960 100470 99067 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404528.1 protein_id gnl|my_center|LOCUS_00960 101113 100556 gene locus_tag LOCUS_00970 gene pyrE 101113 100556 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NM11 protein_id gnl|my_center|LOCUS_00970 102155 101124 gene locus_tag LOCUS_00980 gene purM 102155 101124 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J517 protein_id gnl|my_center|LOCUS_00980 103716 102163 gene locus_tag LOCUS_00990 gene purF 103716 102163 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DLZ9 protein_id gnl|my_center|LOCUS_00990 105956 103758 gene locus_tag LOCUS_01000 gene purL 105956 103758 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHY1 protein_id gnl|my_center|LOCUS_01000 106239 106625 gene locus_tag LOCUS_01010 106239 106625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 107303 106641 gene locus_tag LOCUS_01020 gene purQ 107303 106641 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S567 protein_id gnl|my_center|LOCUS_01020 107554 107303 gene locus_tag LOCUS_01030 107554 107303 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875808.1 protein_id gnl|my_center|LOCUS_01030 108451 107558 gene locus_tag LOCUS_01040 gene purC 108451 107558 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHQ9 protein_id gnl|my_center|LOCUS_01040 109916 108501 gene locus_tag LOCUS_01050 109916 108501 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHW2 protein_id gnl|my_center|LOCUS_01050 110404 109937 gene locus_tag LOCUS_01060 gene purE 110404 109937 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G587 protein_id gnl|my_center|LOCUS_01060 111661 110438 gene locus_tag LOCUS_01070 gene purD 111661 110438 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP5 protein_id gnl|my_center|LOCUS_01070 112961 111675 gene locus_tag LOCUS_01080 gene purA 112961 111675 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8P6 protein_id gnl|my_center|LOCUS_01080 113742 113347 gene locus_tag LOCUS_01090 113742 113347 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230871.1 protein_id gnl|my_center|LOCUS_01090 114863 113748 gene locus_tag LOCUS_01100 gene dnaJ1 114863 113748 CDS product chaperone protein DnaJ 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A549 protein_id gnl|my_center|LOCUS_01100 115445 114891 gene locus_tag LOCUS_01110 115445 114891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 117271 115442 gene locus_tag LOCUS_01120 gene dnaK 117271 115442 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q05558 protein_id gnl|my_center|LOCUS_01120 117501 118247 gene locus_tag LOCUS_01130 gene gpmA 117501 118247 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QR00 protein_id gnl|my_center|LOCUS_01130 >Feature sequence002 3448 62 gene locus_tag LOCUS_01140 3448 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 3372 3758 gene locus_tag LOCUS_01150 3372 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 3882 4136 gene locus_tag LOCUS_01160 3882 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 4137 4439 gene locus_tag LOCUS_01170 4137 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01170 5009 4590 gene locus_tag LOCUS_01180 5009 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709436.1 protein_id gnl|my_center|LOCUS_01180 6231 5002 gene locus_tag LOCUS_01190 6231 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709437.1 protein_id gnl|my_center|LOCUS_01190 7043 6309 gene locus_tag LOCUS_01200 7043 6309 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860947.1 protein_id gnl|my_center|LOCUS_01200 7809 7045 gene locus_tag LOCUS_01210 7809 7045 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529754.1 protein_id gnl|my_center|LOCUS_01210 7949 8629 gene locus_tag LOCUS_01220 7949 8629 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528866.1 protein_id gnl|my_center|LOCUS_01220 9521 8652 gene locus_tag LOCUS_01230 9521 8652 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226418.1 protein_id gnl|my_center|LOCUS_01230 11308 9518 gene locus_tag LOCUS_01240 gene nuoF 11308 9518 CDS product NADH dehydrogenase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_01240 12828 11338 gene locus_tag LOCUS_01250 12828 11338 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972418.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01250 13239 13000 gene locus_tag LOCUS_01260 13239 13000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01260 14113 13331 gene locus_tag LOCUS_01270 gene caiD 14113 13331 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31551 protein_id gnl|my_center|LOCUS_01270 16143 14113 gene locus_tag LOCUS_01280 16143 14113 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528297.1 protein_id gnl|my_center|LOCUS_01280 17329 16169 gene locus_tag LOCUS_01290 17329 16169 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528296.1 protein_id gnl|my_center|LOCUS_01290 18878 17388 gene locus_tag LOCUS_01300 gene lcdH 18878 17388 CDS product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NF5 protein_id gnl|my_center|LOCUS_01300 19803 18907 gene locus_tag LOCUS_01310 19803 18907 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030805.1 protein_id gnl|my_center|LOCUS_01310 20002 21213 gene locus_tag LOCUS_01320 20002 21213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 21210 22481 gene locus_tag LOCUS_01330 21210 22481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404277.1 protein_id gnl|my_center|LOCUS_01330 22591 24369 gene locus_tag LOCUS_01340 22591 24369 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 protein_id gnl|my_center|LOCUS_01340 25382 24402 gene locus_tag LOCUS_01350 25382 24402 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_01350 25972 25379 gene locus_tag LOCUS_01360 25972 25379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 28731 26197 gene locus_tag LOCUS_01370 28731 26197 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775989.1 protein_id gnl|my_center|LOCUS_01370 29717 28926 gene locus_tag LOCUS_01380 29717 28926 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266698.1 protein_id gnl|my_center|LOCUS_01380 30654 29827 gene locus_tag LOCUS_01390 30654 29827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 31444 30692 gene locus_tag LOCUS_01400 31444 30692 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775990.1 protein_id gnl|my_center|LOCUS_01400 31666 32367 gene locus_tag LOCUS_01410 31666 32367 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 protein_id gnl|my_center|LOCUS_01410 32375 33025 gene locus_tag LOCUS_01420 32375 33025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708368.1 protein_id gnl|my_center|LOCUS_01420 33029 33334 gene locus_tag LOCUS_01430 33029 33334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337732.1 protein_id gnl|my_center|LOCUS_01430 33391 34287 gene locus_tag LOCUS_01440 33391 34287 CDS product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719921.1 protein_id gnl|my_center|LOCUS_01440 34322 36316 gene locus_tag LOCUS_01450 34322 36316 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531166.1 protein_id gnl|my_center|LOCUS_01450 36313 37854 gene locus_tag LOCUS_01460 36313 37854 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_01460 37998 39695 gene locus_tag LOCUS_01470 gene fhs 37998 39695 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIW3 protein_id gnl|my_center|LOCUS_01470 39799 40701 gene locus_tag LOCUS_01480 39799 40701 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDX6 protein_id gnl|my_center|LOCUS_01480 40833 42908 gene locus_tag LOCUS_01490 40833 42908 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_01490 42954 44177 gene locus_tag LOCUS_01500 42954 44177 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089277.1 protein_id gnl|my_center|LOCUS_01500 45707 44274 gene locus_tag LOCUS_01510 45707 44274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 46371 45757 gene locus_tag LOCUS_01520 46371 45757 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893694.1 protein_id gnl|my_center|LOCUS_01520 47611 46490 gene locus_tag LOCUS_01530 47611 46490 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383812.1 protein_id gnl|my_center|LOCUS_01530 48411 47629 gene locus_tag LOCUS_01540 48411 47629 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709003.1 protein_id gnl|my_center|LOCUS_01540 49184 48408 gene locus_tag LOCUS_01550 49184 48408 CDS product sulfonate ABC transporter ATP-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530913.1 protein_id gnl|my_center|LOCUS_01550 50050 49181 gene locus_tag LOCUS_01560 50050 49181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 51014 50142 gene locus_tag LOCUS_01570 51014 50142 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531708.1 protein_id gnl|my_center|LOCUS_01570 51634 51041 gene locus_tag LOCUS_01580 51634 51041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969298.1 protein_id gnl|my_center|LOCUS_01580 52693 51692 gene locus_tag LOCUS_01590 52693 51692 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729474.1 protein_id gnl|my_center|LOCUS_01590 54223 52736 gene locus_tag LOCUS_01600 54223 52736 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_01600 55720 54308 gene locus_tag LOCUS_01610 gene hydA 55720 54308 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895004.1 protein_id gnl|my_center|LOCUS_01610 57110 55821 gene locus_tag LOCUS_01620 57110 55821 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_01620 57978 57139 gene locus_tag LOCUS_01630 57978 57139 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972565.1 protein_id gnl|my_center|LOCUS_01630 58147 59502 gene locus_tag LOCUS_01640 58147 59502 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728155.1 protein_id gnl|my_center|LOCUS_01640 59510 60862 gene locus_tag LOCUS_01650 59510 60862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 60903 61745 gene locus_tag LOCUS_01660 60903 61745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 62922 62050 gene locus_tag LOCUS_01670 62922 62050 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_01670 62970 64373 gene locus_tag LOCUS_01680 gene bam 62970 64373 CDS product indoleacetamide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59385 protein_id gnl|my_center|LOCUS_01680 65013 64381 gene locus_tag LOCUS_01690 65013 64381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 64984 66063 gene locus_tag LOCUS_01700 gene gbuA 64984 66063 CDS product guanidinobutyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3S3 protein_id gnl|my_center|LOCUS_01700 66125 67267 gene locus_tag LOCUS_01710 66125 67267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 67264 68469 gene locus_tag LOCUS_01720 67264 68469 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_01720 68956 68486 gene locus_tag LOCUS_01730 68956 68486 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893070.1 protein_id gnl|my_center|LOCUS_01730 70370 69000 gene locus_tag LOCUS_01740 gene argD 70370 69000 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226084.1 protein_id gnl|my_center|LOCUS_01740 71583 70486 gene locus_tag LOCUS_01750 71583 70486 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257556.1 protein_id gnl|my_center|LOCUS_01750 72491 71628 gene locus_tag LOCUS_01760 72491 71628 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_01760 73398 72523 gene locus_tag LOCUS_01770 73398 72523 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 protein_id gnl|my_center|LOCUS_01770 74536 73433 gene locus_tag LOCUS_01780 gene potA 74536 73433 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBU2 protein_id gnl|my_center|LOCUS_01780 74695 76083 gene locus_tag LOCUS_01790 74695 76083 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_01790 76094 77470 gene locus_tag LOCUS_01800 76094 77470 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530465.1 protein_id gnl|my_center|LOCUS_01800 >Feature sequence003 1318 488 gene locus_tag LOCUS_01810 1318 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 3134 1380 gene locus_tag LOCUS_01820 gene aspS 3134 1380 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHW1 protein_id gnl|my_center|LOCUS_01820 4441 3167 gene locus_tag LOCUS_01830 gene hisS 4441 3167 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCI0 protein_id gnl|my_center|LOCUS_01830 6670 4520 gene locus_tag LOCUS_01840 gene relA 6670 4520 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227116.1 protein_id gnl|my_center|LOCUS_01840 7956 6850 gene locus_tag LOCUS_01850 gene secF 7956 6850 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53956 protein_id gnl|my_center|LOCUS_01850 9479 7953 gene locus_tag LOCUS_01860 gene secD 9479 7953 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B608 protein_id gnl|my_center|LOCUS_01860 9797 9510 gene locus_tag LOCUS_01870 9797 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 11028 9919 gene locus_tag LOCUS_01880 gene tgt 11028 9919 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Y1 protein_id gnl|my_center|LOCUS_01880 12082 11063 gene locus_tag LOCUS_01890 gene queA 12082 11063 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CS92 protein_id gnl|my_center|LOCUS_01890 13171 12131 gene locus_tag LOCUS_01900 gene ruvB 13171 12131 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHT7 protein_id gnl|my_center|LOCUS_01900 13776 13180 gene locus_tag LOCUS_01910 gene ruvA 13776 13180 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51425 protein_id gnl|my_center|LOCUS_01910 14296 13796 gene locus_tag LOCUS_01920 gene ruvC 14296 13796 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MCB8 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01920 15102 14353 gene locus_tag LOCUS_01930 15102 14353 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L288 protein_id gnl|my_center|LOCUS_01930 15703 15107 gene locus_tag LOCUS_01940 gene pdxT 15703 15107 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCJ8 protein_id gnl|my_center|LOCUS_01940 16623 15733 gene locus_tag LOCUS_01950 gene pdxS 16623 15733 CDS product pyridoxal 5'-phosphate synthase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D8V6 protein_id gnl|my_center|LOCUS_01950 17954 16698 gene locus_tag LOCUS_01960 17954 16698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 18718 17954 gene locus_tag LOCUS_01970 18718 17954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 19863 18793 gene locus_tag LOCUS_01980 gene pimA 19863 18793 CDS product phosphatidyl-myo-inositol mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07147 protein_id gnl|my_center|LOCUS_01980 20785 19874 gene locus_tag LOCUS_01990 20785 19874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 21487 20795 gene locus_tag LOCUS_02000 21487 20795 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545889.1 protein_id gnl|my_center|LOCUS_02000 22175 21624 gene locus_tag LOCUS_02010 22175 21624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 22809 22186 gene locus_tag LOCUS_02020 22809 22186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 23471 22842 gene locus_tag LOCUS_02030 gene udk 23471 22842 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCC8 protein_id gnl|my_center|LOCUS_02030 24933 23491 gene locus_tag LOCUS_02040 gene ahcY 24933 23491 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZM1 protein_id gnl|my_center|LOCUS_02040 26261 25041 gene locus_tag LOCUS_02050 26261 25041 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_02050 26516 26280 gene locus_tag LOCUS_02060 26516 26280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895208.1 protein_id gnl|my_center|LOCUS_02060 27896 26538 gene locus_tag LOCUS_02070 gene manB 27896 26538 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_02070 29095 27908 gene locus_tag LOCUS_02080 29095 27908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 31767 29092 gene locus_tag LOCUS_02090 31767 29092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 32474 31758 gene locus_tag LOCUS_02100 32474 31758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 32590 34542 gene locus_tag LOCUS_02110 gene ftsH 32590 34542 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CK5 protein_id gnl|my_center|LOCUS_02110 34545 34988 gene locus_tag LOCUS_02120 34545 34988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 36513 35008 gene locus_tag LOCUS_02130 36513 35008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 39665 36510 gene locus_tag LOCUS_02140 39665 36510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 39764 40675 gene locus_tag LOCUS_02150 39764 40675 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_02150 40713 41687 gene locus_tag LOCUS_02160 gene gmd 40713 41687 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ72 protein_id gnl|my_center|LOCUS_02160 41695 42621 gene locus_tag LOCUS_02170 41695 42621 CDS product LPPG--FO 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_02170 42618 43325 gene locus_tag LOCUS_02180 42618 43325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 44272 43322 gene locus_tag LOCUS_02190 gene galE1 44272 43322 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN67 protein_id gnl|my_center|LOCUS_02190 45289 44288 gene locus_tag LOCUS_02200 45289 44288 CDS product GDP-mannose pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_02200 45881 45300 gene locus_tag LOCUS_02210 45881 45300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 47253 46027 gene locus_tag LOCUS_02220 47253 46027 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081170.1 protein_id gnl|my_center|LOCUS_02220 48372 47260 gene locus_tag LOCUS_02230 48372 47260 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02230 49474 48380 gene locus_tag LOCUS_02240 49474 48380 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_02240 48673 48584 gene locus_tag LOCUS_t00060 48673 48584 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 51111 49471 gene locus_tag LOCUS_02250 51111 49471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 51167 52015 gene locus_tag LOCUS_02260 51167 52015 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_02260 52754 52020 gene locus_tag LOCUS_02270 52754 52020 CDS product putative biotin--acetyl-CoA-carboxylase ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704354.1 protein_id gnl|my_center|LOCUS_02270 52851 54578 gene locus_tag LOCUS_02280 52851 54578 CDS product carbamoyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903116.1 protein_id gnl|my_center|LOCUS_02280 54623 55735 gene locus_tag LOCUS_02290 54623 55735 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_02290 55814 56671 gene locus_tag LOCUS_02300 55814 56671 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021200.1 protein_id gnl|my_center|LOCUS_02300 56681 57868 gene locus_tag LOCUS_02310 gene wzt 56681 57868 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096884.1 protein_id gnl|my_center|LOCUS_02310 57981 58958 gene locus_tag LOCUS_02320 57981 58958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 58997 60919 gene locus_tag LOCUS_02330 58997 60919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 61077 62177 gene locus_tag LOCUS_02340 61077 62177 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222158.1 protein_id gnl|my_center|LOCUS_02340 63497 62190 gene locus_tag LOCUS_02350 63497 62190 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776106.1 protein_id gnl|my_center|LOCUS_02350 63704 64681 gene locus_tag LOCUS_02360 gene mviM 63704 64681 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140212.1 protein_id gnl|my_center|LOCUS_02360 67250 64707 gene locus_tag LOCUS_02370 67250 64707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 68521 67247 gene locus_tag LOCUS_02380 68521 67247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 68644 69126 gene locus_tag LOCUS_02390 68644 69126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 69200 70405 gene locus_tag LOCUS_02400 69200 70405 CDS product hexosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_02400 70785 70411 gene locus_tag LOCUS_02410 70785 70411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 70750 71055 gene locus_tag LOCUS_02420 70750 71055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 71212 71349 gene locus_tag LOCUS_02430 71212 71349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 71913 71365 gene locus_tag LOCUS_02440 71913 71365 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868278.1 protein_id gnl|my_center|LOCUS_02440 72969 71953 gene locus_tag LOCUS_02450 72969 71953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 >Feature sequence004 1106 159 gene locus_tag LOCUS_02460 1106 159 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730112.1 protein_id gnl|my_center|LOCUS_02460 1866 1084 gene locus_tag LOCUS_02470 1866 1084 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730131.1 protein_id gnl|my_center|LOCUS_02470 1990 2748 gene locus_tag LOCUS_02480 1990 2748 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730054.1 protein_id gnl|my_center|LOCUS_02480 3316 2849 gene locus_tag LOCUS_02490 3316 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 4201 3371 gene locus_tag LOCUS_02500 4201 3371 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893604.1 protein_id gnl|my_center|LOCUS_02500 5505 4198 gene locus_tag LOCUS_02510 5505 4198 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705633.1 protein_id gnl|my_center|LOCUS_02510 6646 5594 gene locus_tag LOCUS_02520 6646 5594 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730117.1 protein_id gnl|my_center|LOCUS_02520 7595 6630 gene locus_tag LOCUS_02530 7595 6630 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730134.1 protein_id gnl|my_center|LOCUS_02530 8590 7592 gene locus_tag LOCUS_02540 8590 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 8513 8815 gene locus_tag LOCUS_02550 8513 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 10043 8841 gene locus_tag LOCUS_02560 10043 8841 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064432.1 protein_id gnl|my_center|LOCUS_02560 10906 10040 gene locus_tag LOCUS_02570 10906 10040 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896244.1 protein_id gnl|my_center|LOCUS_02570 12103 10919 gene locus_tag LOCUS_02580 gene fadE17 12103 10919 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 protein_id gnl|my_center|LOCUS_02580 12173 13213 gene locus_tag LOCUS_02590 12173 13213 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731380.1 protein_id gnl|my_center|LOCUS_02590 14292 13231 gene locus_tag LOCUS_02600 14292 13231 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254711.1 protein_id gnl|my_center|LOCUS_02600 15698 14289 gene locus_tag LOCUS_02610 gene ydiD 15698 14289 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553652.1 protein_id gnl|my_center|LOCUS_02610 16128 15733 gene locus_tag LOCUS_02620 16128 15733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 16218 17402 gene locus_tag LOCUS_02630 16218 17402 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225716.1 protein_id gnl|my_center|LOCUS_02630 19045 17387 gene locus_tag LOCUS_02640 19045 17387 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729090.1 protein_id gnl|my_center|LOCUS_02640 20254 19067 gene locus_tag LOCUS_02650 20254 19067 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 protein_id gnl|my_center|LOCUS_02650 20369 21202 gene locus_tag LOCUS_02660 20369 21202 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896244.1 protein_id gnl|my_center|LOCUS_02660 22423 21227 gene locus_tag LOCUS_02670 22423 21227 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730110.1 protein_id gnl|my_center|LOCUS_02670 23252 22431 gene locus_tag LOCUS_02680 gene tesB 23252 22431 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036345.1 protein_id gnl|my_center|LOCUS_02680 23670 23257 gene locus_tag LOCUS_02690 23670 23257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 24833 23667 gene locus_tag LOCUS_02700 24833 23667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 25549 24830 gene locus_tag LOCUS_02710 25549 24830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086141.1 protein_id gnl|my_center|LOCUS_02710 26316 25546 gene locus_tag LOCUS_02720 26316 25546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537473.1 protein_id gnl|my_center|LOCUS_02720 28379 26313 gene locus_tag LOCUS_02730 28379 26313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 29588 28398 gene locus_tag LOCUS_02740 29588 28398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 29605 29964 gene locus_tag LOCUS_02750 29605 29964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 30084 31280 gene locus_tag LOCUS_02760 30084 31280 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730097.1 protein_id gnl|my_center|LOCUS_02760 31285 32409 gene locus_tag LOCUS_02770 gene acd 31285 32409 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225727.1 protein_id gnl|my_center|LOCUS_02770 32429 33247 gene locus_tag LOCUS_02780 32429 33247 CDS product 3-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730142.1 protein_id gnl|my_center|LOCUS_02780 34460 33288 gene locus_tag LOCUS_02790 34460 33288 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727045.1 protein_id gnl|my_center|LOCUS_02790 36042 34561 gene locus_tag LOCUS_02800 36042 34561 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897260.1 protein_id gnl|my_center|LOCUS_02800 37288 36065 gene locus_tag LOCUS_02810 gene cyp143 37288 36065 CDS product putative cytochrome P450 143 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPL3 protein_id gnl|my_center|LOCUS_02810 37511 37281 gene locus_tag LOCUS_02820 37511 37281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 38789 37605 gene locus_tag LOCUS_02830 38789 37605 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728743.1 protein_id gnl|my_center|LOCUS_02830 40110 38821 gene locus_tag LOCUS_02840 40110 38821 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 protein_id gnl|my_center|LOCUS_02840 40256 41518 gene locus_tag LOCUS_02850 40256 41518 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730096.1 protein_id gnl|my_center|LOCUS_02850 42336 41644 gene locus_tag LOCUS_02860 42336 41644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 42692 42351 gene locus_tag LOCUS_02870 42692 42351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 43924 42761 gene locus_tag LOCUS_02880 43924 42761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 44027 44100 gene locus_tag LOCUS_t00070 44027 44100 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 44823 45059 gene locus_tag LOCUS_02890 44823 45059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 45383 45859 gene locus_tag LOCUS_02900 45383 45859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 46855 45860 gene locus_tag LOCUS_02910 46855 45860 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814720.1 protein_id gnl|my_center|LOCUS_02910 48830 46842 gene locus_tag LOCUS_02920 48830 46842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 50301 48820 gene locus_tag LOCUS_02930 50301 48820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 50831 50298 gene locus_tag LOCUS_02940 50831 50298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 51222 53366 gene locus_tag LOCUS_02950 51222 53366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 53363 54070 gene locus_tag LOCUS_02960 53363 54070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 54184 54627 gene locus_tag LOCUS_02970 54184 54627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 54802 55221 gene locus_tag LOCUS_02980 54802 55221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 55297 55839 gene locus_tag LOCUS_02990 55297 55839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 56055 57308 gene locus_tag LOCUS_03000 56055 57308 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728260.1 protein_id gnl|my_center|LOCUS_03000 57343 58440 gene locus_tag LOCUS_03010 57343 58440 CDS product putative 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704889.1 protein_id gnl|my_center|LOCUS_03010 58639 58899 gene locus_tag LOCUS_03020 58639 58899 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230558.1 protein_id gnl|my_center|LOCUS_03020 58963 60726 gene locus_tag LOCUS_03030 58963 60726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 60741 61199 gene locus_tag LOCUS_03040 60741 61199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899475.1 protein_id gnl|my_center|LOCUS_03040 61874 61215 gene locus_tag LOCUS_03050 61874 61215 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704421.1 protein_id gnl|my_center|LOCUS_03050 63040 61871 gene locus_tag LOCUS_03060 63040 61871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 63686 63105 gene locus_tag LOCUS_03070 63686 63105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 63806 64567 gene locus_tag LOCUS_03080 63806 64567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 64580 64655 gene locus_tag LOCUS_t00080 64580 64655 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 65158 66246 gene locus_tag LOCUS_03090 gene aspC 65158 66246 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0Y2 protein_id gnl|my_center|LOCUS_03090 67058 66243 gene locus_tag LOCUS_03100 67058 66243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 67804 68463 gene locus_tag LOCUS_03110 67804 68463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 68460 69416 gene locus_tag LOCUS_03120 68460 69416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065050.1 protein_id gnl|my_center|LOCUS_03120 69453 70178 gene locus_tag LOCUS_03130 69453 70178 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089099.1 protein_id gnl|my_center|LOCUS_03130 70219 71094 gene locus_tag LOCUS_03140 70219 71094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 71559 71239 gene locus_tag LOCUS_03150 71559 71239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 71799 72206 gene locus_tag LOCUS_03160 71799 72206 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089796.1 protein_id gnl|my_center|LOCUS_03160 >Feature sequence005 145 1098 gene locus_tag LOCUS_03170 gene selD 145 1098 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D9Y2 protein_id gnl|my_center|LOCUS_03170 1110 2312 gene locus_tag LOCUS_03180 1110 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 3770 2430 gene locus_tag LOCUS_03190 3770 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 4731 3919 gene locus_tag LOCUS_03200 gene paaG 4731 3919 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228963.1 protein_id gnl|my_center|LOCUS_03200 4796 6028 gene locus_tag LOCUS_03210 4796 6028 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 protein_id gnl|my_center|LOCUS_03210 6025 7632 gene locus_tag LOCUS_03220 6025 7632 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_03220 7901 7671 gene locus_tag LOCUS_03230 7901 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 7969 8511 gene locus_tag LOCUS_03240 7969 8511 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_03240 8770 8967 gene locus_tag LOCUS_03250 8770 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 9128 10405 gene locus_tag LOCUS_03260 9128 10405 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_03260 10402 10752 gene locus_tag LOCUS_03270 10402 10752 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_03270 10749 11576 gene locus_tag LOCUS_03280 gene sufC 10749 11576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919728.1 protein_id gnl|my_center|LOCUS_03280 11591 11908 gene locus_tag LOCUS_03290 11591 11908 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC0 protein_id gnl|my_center|LOCUS_03290 12378 11905 gene locus_tag LOCUS_03300 12378 11905 CDS product iron-sulfur cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722439.1 protein_id gnl|my_center|LOCUS_03300 13669 12428 gene locus_tag LOCUS_03310 13669 12428 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKN9 protein_id gnl|my_center|LOCUS_03310 14457 13666 gene locus_tag LOCUS_03320 14457 13666 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929160.1 protein_id gnl|my_center|LOCUS_03320 14977 14552 gene locus_tag LOCUS_03330 14977 14552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 15666 14974 gene locus_tag LOCUS_03340 15666 14974 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895255.1 protein_id gnl|my_center|LOCUS_03340 15821 16936 gene locus_tag LOCUS_03350 gene acd 15821 16936 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_03350 17023 17496 gene locus_tag LOCUS_03360 17023 17496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 17493 18443 gene locus_tag LOCUS_03370 gene fcl 17493 18443 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 protein_id gnl|my_center|LOCUS_03370 19122 18526 gene locus_tag LOCUS_03380 19122 18526 CDS product (Fe-S)-cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_03380 21922 19160 gene locus_tag LOCUS_03390 21922 19160 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KY19 protein_id gnl|my_center|LOCUS_03390 21943 22530 gene locus_tag LOCUS_03400 21943 22530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 23513 22566 gene locus_tag LOCUS_03410 23513 22566 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064618.1 protein_id gnl|my_center|LOCUS_03410 25216 23552 gene locus_tag LOCUS_03420 25216 23552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064619.1 protein_id gnl|my_center|LOCUS_03420 25309 25521 gene locus_tag LOCUS_03430 25309 25521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 25536 26198 gene locus_tag LOCUS_03440 25536 26198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 28511 26235 gene locus_tag LOCUS_03450 gene acnA 28511 26235 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_03450 29573 28644 gene locus_tag LOCUS_03460 29573 28644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 31200 29587 gene locus_tag LOCUS_03470 31200 29587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459733.1 protein_id gnl|my_center|LOCUS_03470 32423 31197 gene locus_tag LOCUS_03480 32423 31197 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_03480 34750 32420 gene locus_tag LOCUS_03490 34750 32420 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776688.1 protein_id gnl|my_center|LOCUS_03490 34817 35503 gene locus_tag LOCUS_03500 34817 35503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 36630 35527 gene locus_tag LOCUS_03510 gene ddlA 36630 35527 CDS product D-alanine--D-alanine ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDW3 protein_id gnl|my_center|LOCUS_03510 36705 38003 gene locus_tag LOCUS_03520 gene murF 36705 38003 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2W8 protein_id gnl|my_center|LOCUS_03520 38496 38023 gene locus_tag LOCUS_03530 38496 38023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 38392 38988 gene locus_tag LOCUS_03540 38392 38988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 39058 40809 gene locus_tag LOCUS_03550 39058 40809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 40877 40952 gene locus_tag LOCUS_t00090 40877 40952 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 41427 41008 gene locus_tag LOCUS_03560 41427 41008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 41600 42772 gene locus_tag LOCUS_03570 gene cyp158a2 41600 42772 CDS product biflaviolin synthase CYP158A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FCA6 protein_id gnl|my_center|LOCUS_03570 43627 42983 gene locus_tag LOCUS_03580 43627 42983 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258927.1 protein_id gnl|my_center|LOCUS_03580 44415 43624 gene locus_tag LOCUS_03590 44415 43624 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_03590 45157 44441 gene locus_tag LOCUS_03600 45157 44441 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731052.1 protein_id gnl|my_center|LOCUS_03600 47097 45154 gene locus_tag LOCUS_03610 47097 45154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03610 48968 47097 gene locus_tag LOCUS_03620 48968 47097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 49378 48965 gene locus_tag LOCUS_03630 49378 48965 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027124.1 protein_id gnl|my_center|LOCUS_03630 49550 50836 gene locus_tag LOCUS_03640 49550 50836 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_03640 50833 51879 gene locus_tag LOCUS_03650 50833 51879 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777114.1 protein_id gnl|my_center|LOCUS_03650 51943 52701 gene locus_tag LOCUS_03660 51943 52701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 53509 52742 gene locus_tag LOCUS_03670 53509 52742 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D7T0 protein_id gnl|my_center|LOCUS_03670 53680 54336 gene locus_tag LOCUS_03680 53680 54336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_03680 54406 56373 gene locus_tag LOCUS_03690 gene thrS 54406 56373 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L278 protein_id gnl|my_center|LOCUS_03690 56370 56897 gene locus_tag LOCUS_03700 56370 56897 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_03700 57230 58531 gene locus_tag LOCUS_03710 57230 58531 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776491.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03710 58602 59474 gene locus_tag LOCUS_03720 58602 59474 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978391.1 protein_id gnl|my_center|LOCUS_03720 60505 59459 gene locus_tag LOCUS_03730 60505 59459 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228627.1 protein_id gnl|my_center|LOCUS_03730 61674 60559 gene locus_tag LOCUS_03740 61674 60559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 61771 61923 gene locus_tag LOCUS_03750 61771 61923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 62119 63513 gene locus_tag LOCUS_03760 62119 63513 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980660.1 protein_id gnl|my_center|LOCUS_03760 63590 64672 gene locus_tag LOCUS_03770 63590 64672 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_03770 66062 64698 gene locus_tag LOCUS_03780 gene trpB 66062 64698 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCP2 protein_id gnl|my_center|LOCUS_03780 66132 66449 gene locus_tag LOCUS_03790 66132 66449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 67323 66454 gene locus_tag LOCUS_03800 67323 66454 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_03800 68275 67334 gene locus_tag LOCUS_03810 68275 67334 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_03810 69471 68272 gene locus_tag LOCUS_03820 69471 68272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224715.1 protein_id gnl|my_center|LOCUS_03820 69926 69525 gene locus_tag LOCUS_03830 69926 69525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085641.1 protein_id gnl|my_center|LOCUS_03830 70263 70063 gene locus_tag LOCUS_03840 gene cspLB 70263 70063 CDS product cold shock-like protein CspLB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A357 protein_id gnl|my_center|LOCUS_03840 71003 70362 gene locus_tag LOCUS_03850 71003 70362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 71048 71902 gene locus_tag LOCUS_03860 71048 71902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 >Feature sequence006 <1 994 gene locus_tag LOCUS_03870 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888715.1:glycerophosphoryl diester phosphodiesterase 1633 998 gene locus_tag LOCUS_03880 1633 998 CDS product TIGR03085 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_03880 3089 1638 gene locus_tag LOCUS_03890 3089 1638 CDS product carotenoid cleavage oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403360.1 protein_id gnl|my_center|LOCUS_03890 3055 3246 gene locus_tag LOCUS_03900 3055 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 3265 4107 gene locus_tag LOCUS_03910 gene metE 3265 4107 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088354.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03910 5837 4152 gene locus_tag LOCUS_03920 5837 4152 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_03920 7019 5862 gene locus_tag LOCUS_03930 7019 5862 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_03930 7423 9000 gene locus_tag LOCUS_03940 7423 9000 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368533.1 protein_id gnl|my_center|LOCUS_03940 9041 9418 gene locus_tag LOCUS_03950 9041 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 9442 10353 gene locus_tag LOCUS_03960 9442 10353 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224861.1 protein_id gnl|my_center|LOCUS_03960 10529 11740 gene locus_tag LOCUS_03970 10529 11740 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_03970 12108 11674 gene locus_tag LOCUS_03980 12108 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 12224 13183 gene locus_tag LOCUS_03990 12224 13183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 14406 13201 gene locus_tag LOCUS_04000 14406 13201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 15669 14455 gene locus_tag LOCUS_04010 gene ddhC 15669 14455 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261040.1 protein_id gnl|my_center|LOCUS_04010 15731 16363 gene locus_tag LOCUS_04020 15731 16363 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027107.1 protein_id gnl|my_center|LOCUS_04020 16383 17153 gene locus_tag LOCUS_04030 16383 17153 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705635.1 protein_id gnl|my_center|LOCUS_04030 17611 17195 gene locus_tag LOCUS_04040 17611 17195 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391432.1 protein_id gnl|my_center|LOCUS_04040 17829 18950 gene locus_tag LOCUS_04050 gene ald 17829 18950 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEW0 protein_id gnl|my_center|LOCUS_04050 20619 19060 gene locus_tag LOCUS_04060 20619 19060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 20671 21879 gene locus_tag LOCUS_04070 20671 21879 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029442.1 protein_id gnl|my_center|LOCUS_04070 24265 21950 gene locus_tag LOCUS_04080 24265 21950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 27982 24311 gene locus_tag LOCUS_04090 27982 24311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 28266 29789 gene locus_tag LOCUS_04100 28266 29789 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974636.1 protein_id gnl|my_center|LOCUS_04100 29828 32302 gene locus_tag LOCUS_04110 29828 32302 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_04110 32393 33718 gene locus_tag LOCUS_04120 32393 33718 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053632.1 protein_id gnl|my_center|LOCUS_04120 34420 33758 gene locus_tag LOCUS_04130 34420 33758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703805.1 protein_id gnl|my_center|LOCUS_04130 35021 34422 gene locus_tag LOCUS_04140 35021 34422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 35771 35076 gene locus_tag LOCUS_04150 35771 35076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 35770 36432 gene locus_tag LOCUS_04160 35770 36432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_04160 36680 36829 gene locus_tag LOCUS_04170 36680 36829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 38224 39540 gene locus_tag LOCUS_04180 38224 39540 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528520.1 protein_id gnl|my_center|LOCUS_04180 40835 39555 gene locus_tag LOCUS_04190 40835 39555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 41148 41384 gene locus_tag LOCUS_04200 41148 41384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 41514 41816 gene locus_tag LOCUS_04210 41514 41816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 42455 41787 gene locus_tag LOCUS_04220 42455 41787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085745.1 protein_id gnl|my_center|LOCUS_04220 42805 42452 gene locus_tag LOCUS_04230 42805 42452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 44050 42809 gene locus_tag LOCUS_04240 44050 42809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 45602 44055 gene locus_tag LOCUS_04250 45602 44055 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112648.1 protein_id gnl|my_center|LOCUS_04250 45966 45586 gene locus_tag LOCUS_04260 45966 45586 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_04260 46246 46605 gene locus_tag LOCUS_04270 46246 46605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 47951 46962 gene locus_tag LOCUS_04280 47951 46962 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_04280 49751 48831 gene locus_tag LOCUS_04290 49751 48831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969955.1 protein_id gnl|my_center|LOCUS_04290 51446 49860 gene locus_tag LOCUS_04300 51446 49860 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969959.1 protein_id gnl|my_center|LOCUS_04300 52194 51784 gene locus_tag LOCUS_04310 52194 51784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975016.1 protein_id gnl|my_center|LOCUS_04310 53431 52184 gene locus_tag LOCUS_04320 53431 52184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 54169 53450 gene locus_tag LOCUS_04330 54169 53450 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729568.1 protein_id gnl|my_center|LOCUS_04330 55584 54166 gene locus_tag LOCUS_04340 55584 54166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_04340 57062 55590 gene locus_tag LOCUS_04350 gene hpaB 57062 55590 CDS product 4-hydroxyphenylacetate 3-monooxygenase oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWT7 protein_id gnl|my_center|LOCUS_04350 57333 58472 gene locus_tag LOCUS_04360 57333 58472 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941411.1 protein_id gnl|my_center|LOCUS_04360 59041 58547 gene locus_tag LOCUS_04370 gene ubiX 59041 58547 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNP2 protein_id gnl|my_center|LOCUS_04370 60605 59391 gene locus_tag LOCUS_04380 60605 59391 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_04380 62053 60692 gene locus_tag LOCUS_04390 62053 60692 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015415.1 protein_id gnl|my_center|LOCUS_04390 62110 64779 gene locus_tag LOCUS_04400 gene valS 62110 64779 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MAR0 protein_id gnl|my_center|LOCUS_04400 64815 65651 gene locus_tag LOCUS_04410 64815 65651 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_04410 67005 65710 gene locus_tag LOCUS_04420 67005 65710 CDS product amide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027006.1 protein_id gnl|my_center|LOCUS_04420 67943 66987 gene locus_tag LOCUS_04430 67943 66987 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038831.1 protein_id gnl|my_center|LOCUS_04430 69564 67936 gene locus_tag LOCUS_04440 69564 67936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 protein_id gnl|my_center|LOCUS_04440 70172 69561 gene locus_tag LOCUS_04450 70172 69561 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730455.1 protein_id gnl|my_center|LOCUS_04450 70108 70377 gene locus_tag LOCUS_04460 70108 70377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 >Feature sequence007 1360 593 gene locus_tag LOCUS_04470 1360 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_04470 1844 1350 gene locus_tag LOCUS_04480 1844 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_04480 2526 1885 gene locus_tag LOCUS_04490 2526 1885 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600286.1 protein_id gnl|my_center|LOCUS_04490 2477 3271 gene locus_tag LOCUS_04500 2477 3271 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_04500 3296 3646 gene locus_tag LOCUS_04510 3296 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 3663 4520 gene locus_tag LOCUS_04520 3663 4520 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404185.1 protein_id gnl|my_center|LOCUS_04520 5694 4528 gene locus_tag LOCUS_04530 5694 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 5745 6428 gene locus_tag LOCUS_04540 5745 6428 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 protein_id gnl|my_center|LOCUS_04540 6976 6902 gene locus_tag LOCUS_t00100 6976 6902 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7247 7392 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgtccacgaccacgtccacgaccacg 7552 8418 gene locus_tag LOCUS_04550 7552 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 9777 8428 gene locus_tag LOCUS_04560 gene glnT 9777 8428 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897682.1 protein_id gnl|my_center|LOCUS_04560 10816 9866 gene locus_tag LOCUS_04570 10816 9866 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942346.1 protein_id gnl|my_center|LOCUS_04570 11149 10859 gene locus_tag LOCUS_04580 11149 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970104.1 protein_id gnl|my_center|LOCUS_04580 12067 11177 gene locus_tag LOCUS_04590 12067 11177 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014377.1 protein_id gnl|my_center|LOCUS_04590 12857 12069 gene locus_tag LOCUS_04600 12857 12069 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576383.1 protein_id gnl|my_center|LOCUS_04600 13642 12854 gene locus_tag LOCUS_04610 gene phnC 13642 12854 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CMU4 protein_id gnl|my_center|LOCUS_04610 14825 13743 gene locus_tag LOCUS_04620 14825 13743 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832012.1 protein_id gnl|my_center|LOCUS_04620 14943 15836 gene locus_tag LOCUS_04630 14943 15836 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530665.1 protein_id gnl|my_center|LOCUS_04630 15901 16197 gene locus_tag LOCUS_04640 15901 16197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088538.1 protein_id gnl|my_center|LOCUS_04640 16251 16571 gene locus_tag LOCUS_04650 16251 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_04650 17496 16552 gene locus_tag LOCUS_04660 17496 16552 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028960.1 protein_id gnl|my_center|LOCUS_04660 18688 17489 gene locus_tag LOCUS_04670 18688 17489 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528700.1 protein_id gnl|my_center|LOCUS_04670 18841 20490 gene locus_tag LOCUS_04680 gene argS 18841 20490 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46906 protein_id gnl|my_center|LOCUS_04680 20490 21761 gene locus_tag LOCUS_04690 gene lysA 20490 21761 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADB5 protein_id gnl|my_center|LOCUS_04690 21817 23133 gene locus_tag LOCUS_04700 gene thrA 21817 23133 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DH93 protein_id gnl|my_center|LOCUS_04700 23147 24529 gene locus_tag LOCUS_04710 23147 24529 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_04710 24641 25801 gene locus_tag LOCUS_04720 24641 25801 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_04720 26242 25820 gene locus_tag LOCUS_04730 26242 25820 CDS product cadmium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727472.1 protein_id gnl|my_center|LOCUS_04730 26295 27473 gene locus_tag LOCUS_04740 26295 27473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 27729 29375 gene locus_tag LOCUS_04750 27729 29375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 29478 29732 gene locus_tag LOCUS_04760 gene rpmE2 29478 29732 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5U9 protein_id gnl|my_center|LOCUS_04760 29773 30753 gene locus_tag LOCUS_04770 29773 30753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 30809 31870 gene locus_tag LOCUS_04780 gene prfA 30809 31870 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFW0 protein_id gnl|my_center|LOCUS_04780 31863 32756 gene locus_tag LOCUS_04790 gene prmC 31863 32756 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2B7 protein_id gnl|my_center|LOCUS_04790 32753 33385 gene locus_tag LOCUS_04800 32753 33385 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973635.1 protein_id gnl|my_center|LOCUS_04800 33396 33836 gene locus_tag LOCUS_04810 33396 33836 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393869.1 protein_id gnl|my_center|LOCUS_04810 33848 34099 gene locus_tag LOCUS_04820 33848 34099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 34099 35325 gene locus_tag LOCUS_04830 gene lldD 34099 35325 CDS product putative L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WND5 protein_id gnl|my_center|LOCUS_04830 35328 36794 gene locus_tag LOCUS_04840 35328 36794 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108631.1 protein_id gnl|my_center|LOCUS_04840 37491 36808 gene locus_tag LOCUS_04850 37491 36808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 38138 37515 gene locus_tag LOCUS_04860 38138 37515 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701583.1 protein_id gnl|my_center|LOCUS_04860 39362 38151 gene locus_tag LOCUS_04870 39362 38151 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_04870 39453 40979 gene locus_tag LOCUS_04880 39453 40979 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_04880 40972 41667 gene locus_tag LOCUS_04890 40972 41667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLE7 protein_id gnl|my_center|LOCUS_04890 41697 42509 gene locus_tag LOCUS_04900 41697 42509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416111.1 protein_id gnl|my_center|LOCUS_04900 42723 43370 gene locus_tag LOCUS_04910 gene msrA 42723 43370 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_04910 44494 43385 gene locus_tag LOCUS_04920 44494 43385 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_04920 44991 44494 gene locus_tag LOCUS_04930 44991 44494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701369.1 protein_id gnl|my_center|LOCUS_04930 45527 44988 gene locus_tag LOCUS_04940 45527 44988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702792.1 protein_id gnl|my_center|LOCUS_04940 46690 45524 gene locus_tag LOCUS_04950 46690 45524 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_04950 47892 46699 gene locus_tag LOCUS_04960 47892 46699 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_04960 49224 47974 gene locus_tag LOCUS_04970 49224 47974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 49319 50722 gene locus_tag LOCUS_04980 49319 50722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930739.1 protein_id gnl|my_center|LOCUS_04980 50744 51937 gene locus_tag LOCUS_04990 50744 51937 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040046.1 protein_id gnl|my_center|LOCUS_04990 52894 52100 gene locus_tag LOCUS_05000 52894 52100 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027752.1 protein_id gnl|my_center|LOCUS_05000 53598 52897 gene locus_tag LOCUS_05010 53598 52897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892101.1 protein_id gnl|my_center|LOCUS_05010 54595 53627 gene locus_tag LOCUS_05020 54595 53627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_05020 54537 55871 gene locus_tag LOCUS_05030 54537 55871 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727600.1 protein_id gnl|my_center|LOCUS_05030 55868 58189 gene locus_tag LOCUS_05040 55868 58189 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_05040 58205 58819 gene locus_tag LOCUS_05050 58205 58819 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728249.1 protein_id gnl|my_center|LOCUS_05050 60082 58838 gene locus_tag LOCUS_05060 60082 58838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 60564 60139 gene locus_tag LOCUS_05070 60564 60139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 60756 61604 gene locus_tag LOCUS_05080 60756 61604 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920181.1 protein_id gnl|my_center|LOCUS_05080 61682 62188 gene locus_tag LOCUS_05090 61682 62188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 62215 62871 gene locus_tag LOCUS_05100 62215 62871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 62922 63758 gene locus_tag LOCUS_05110 62922 63758 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900075.1 protein_id gnl|my_center|LOCUS_05110 64988 63777 gene locus_tag LOCUS_05120 gene cyp142 64988 63777 CDS product putative cytochrome P450 142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WPL5 protein_id gnl|my_center|LOCUS_05120 65065 66006 gene locus_tag LOCUS_05130 gene adh 65065 66006 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222782.1 protein_id gnl|my_center|LOCUS_05130 66551 66003 gene locus_tag LOCUS_05140 66551 66003 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729004.1 protein_id gnl|my_center|LOCUS_05140 66695 67633 gene locus_tag LOCUS_05150 66695 67633 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731621.1 protein_id gnl|my_center|LOCUS_05150 68355 67630 gene locus_tag LOCUS_05160 68355 67630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 >Feature sequence008 665 1507 gene locus_tag LOCUS_05170 665 1507 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 protein_id gnl|my_center|LOCUS_05170 2444 1512 gene locus_tag LOCUS_05180 2444 1512 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_05180 2544 2999 gene locus_tag LOCUS_05190 2544 2999 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_05190 3070 3996 gene locus_tag LOCUS_05200 gene map 3070 3996 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKR2 protein_id gnl|my_center|LOCUS_05200 5646 4018 gene locus_tag LOCUS_05210 5646 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 6566 5754 gene locus_tag LOCUS_05220 gene mutM 6566 5754 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX22 protein_id gnl|my_center|LOCUS_05220 6636 7421 gene locus_tag LOCUS_05230 6636 7421 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_05230 7456 7836 gene locus_tag LOCUS_05240 7456 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 8696 7854 gene locus_tag LOCUS_05250 8696 7854 CDS product recombinase RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027903.1 protein_id gnl|my_center|LOCUS_05250 10818 8704 gene locus_tag LOCUS_05260 10818 8704 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69998 protein_id gnl|my_center|LOCUS_05260 13238 10821 gene locus_tag LOCUS_05270 13238 10821 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MCG7 protein_id gnl|my_center|LOCUS_05270 13788 13468 gene locus_tag LOCUS_05280 13788 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 14892 13870 gene locus_tag LOCUS_05290 gene hemH 14892 13870 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QX29 protein_id gnl|my_center|LOCUS_05290 15647 14910 gene locus_tag LOCUS_05300 15647 14910 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267293.1 protein_id gnl|my_center|LOCUS_05300 15719 16342 gene locus_tag LOCUS_05310 gene nfuA 15719 16342 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_05310 18210 16390 gene locus_tag LOCUS_05320 gene dxs 18210 16390 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4J3 protein_id gnl|my_center|LOCUS_05320 19161 18307 gene locus_tag LOCUS_05330 19161 18307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 19535 19158 gene locus_tag LOCUS_05340 19535 19158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 19652 21073 gene locus_tag LOCUS_05350 19652 21073 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_05350 21124 22464 gene locus_tag LOCUS_05360 21124 22464 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393050.1 protein_id gnl|my_center|LOCUS_05360 22486 23301 gene locus_tag LOCUS_05370 gene uppP 22486 23301 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60938 protein_id gnl|my_center|LOCUS_05370 23728 23309 gene locus_tag LOCUS_05380 23728 23309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 24181 23792 gene locus_tag LOCUS_05390 24181 23792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 24327 24950 gene locus_tag LOCUS_05400 gene plsY 24327 24950 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60926 protein_id gnl|my_center|LOCUS_05400 24988 26193 gene locus_tag LOCUS_05410 24988 26193 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_05410 26240 27223 gene locus_tag LOCUS_05420 gene moaA 26240 27223 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJ31 protein_id gnl|my_center|LOCUS_05420 27232 27729 gene locus_tag LOCUS_05430 gene moaC 27232 27729 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGL3 protein_id gnl|my_center|LOCUS_05430 27875 28333 gene locus_tag LOCUS_05440 27875 28333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 28402 28477 gene locus_tag LOCUS_t00110 28402 28477 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 29763 28534 gene locus_tag LOCUS_05450 29763 28534 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_05450 29923 30897 gene locus_tag LOCUS_05460 29923 30897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 30925 34299 gene locus_tag LOCUS_05470 30925 34299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 34328 35023 gene locus_tag LOCUS_05480 34328 35023 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225402.1 protein_id gnl|my_center|LOCUS_05480 35020 36210 gene locus_tag LOCUS_05490 35020 36210 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225403.1 protein_id gnl|my_center|LOCUS_05490 36263 37255 gene locus_tag LOCUS_05500 gene rsgA 36263 37255 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBT9 protein_id gnl|my_center|LOCUS_05500 38760 37276 gene locus_tag LOCUS_05510 38760 37276 CDS product substrate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929863.1 protein_id gnl|my_center|LOCUS_05510 39334 38804 gene locus_tag LOCUS_05520 39334 38804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 39783 40253 gene locus_tag LOCUS_05530 39783 40253 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975651.1 protein_id gnl|my_center|LOCUS_05530 40797 40318 gene locus_tag LOCUS_05540 40797 40318 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975746.1 protein_id gnl|my_center|LOCUS_05540 40892 41128 gene locus_tag LOCUS_05550 40892 41128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 41201 42154 gene locus_tag LOCUS_05560 41201 42154 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971182.1 protein_id gnl|my_center|LOCUS_05560 42217 43116 gene locus_tag LOCUS_05570 42217 43116 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_05570 43583 43104 gene locus_tag LOCUS_05580 43583 43104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 43752 44090 gene locus_tag LOCUS_05590 gene glnB 43752 44090 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64250 protein_id gnl|my_center|LOCUS_05590 44172 45011 gene locus_tag LOCUS_05600 44172 45011 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919717.1 protein_id gnl|my_center|LOCUS_05600 45061 45369 gene locus_tag LOCUS_05610 45061 45369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 45464 45790 gene locus_tag LOCUS_05620 45464 45790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 45793 46284 gene locus_tag LOCUS_05630 45793 46284 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SX7 protein_id gnl|my_center|LOCUS_05630 47354 46281 gene locus_tag LOCUS_05640 47354 46281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031788.1 protein_id gnl|my_center|LOCUS_05640 48412 47591 gene locus_tag LOCUS_05650 48412 47591 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_05650 48519 49601 gene locus_tag LOCUS_05660 48519 49601 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729610.1 protein_id gnl|my_center|LOCUS_05660 49641 50087 gene locus_tag LOCUS_05670 49641 50087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05670 50084 50689 gene locus_tag LOCUS_05680 50084 50689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05680 50682 51737 gene locus_tag LOCUS_05690 50682 51737 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730896.1 protein_id gnl|my_center|LOCUS_05690 51740 52903 gene locus_tag LOCUS_05700 gene atoB 51740 52903 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_05700 52995 53186 gene locus_tag LOCUS_05710 52995 53186 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897302.1 protein_id gnl|my_center|LOCUS_05710 53235 54440 gene locus_tag LOCUS_05720 53235 54440 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228991.1 protein_id gnl|my_center|LOCUS_05720 54431 54937 gene locus_tag LOCUS_05730 54431 54937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 57428 54966 gene locus_tag LOCUS_05740 57428 54966 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140731.1 protein_id gnl|my_center|LOCUS_05740 57713 57895 gene locus_tag LOCUS_05750 57713 57895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 58070 59065 gene locus_tag LOCUS_05760 58070 59065 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387910.1 protein_id gnl|my_center|LOCUS_05760 59902 59228 gene locus_tag LOCUS_05770 59902 59228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 60008 60859 gene locus_tag LOCUS_05780 60008 60859 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 protein_id gnl|my_center|LOCUS_05780 61490 60888 gene locus_tag LOCUS_05790 61490 60888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 61566 62768 gene locus_tag LOCUS_05800 61566 62768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_05800 64232 62772 gene locus_tag LOCUS_05810 64232 62772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 64879 64232 gene locus_tag LOCUS_05820 64879 64232 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064212.1 protein_id gnl|my_center|LOCUS_05820 66031 64940 gene locus_tag LOCUS_05830 gene add 66031 64940 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVL3 protein_id gnl|my_center|LOCUS_05830 66106 67404 gene locus_tag LOCUS_05840 66106 67404 CDS product ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230981.1 protein_id gnl|my_center|LOCUS_05840 67401 67880 gene locus_tag LOCUS_05850 67401 67880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227124.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence009 858 1619 gene locus_tag LOCUS_05860 858 1619 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804409.1 protein_id gnl|my_center|LOCUS_05860 2328 1642 gene locus_tag LOCUS_05870 2328 1642 CDS product thioredoxin-like reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O53193 protein_id gnl|my_center|LOCUS_05870 2389 3174 gene locus_tag LOCUS_05880 2389 3174 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_05880 4131 3208 gene locus_tag LOCUS_05890 4131 3208 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_05890 4837 4193 gene locus_tag LOCUS_05900 4837 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 5689 4883 gene locus_tag LOCUS_05910 5689 4883 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_05910 6039 5734 gene locus_tag LOCUS_05920 6039 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 6038 6274 gene locus_tag LOCUS_05930 6038 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 7602 6271 gene locus_tag LOCUS_05940 gene murA 7602 6271 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R1Z6 protein_id gnl|my_center|LOCUS_05940 7725 9125 gene locus_tag LOCUS_05950 7725 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 9704 9144 gene locus_tag LOCUS_05960 9704 9144 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 protein_id gnl|my_center|LOCUS_05960 9770 10765 gene locus_tag LOCUS_05970 9770 10765 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921251.1 protein_id gnl|my_center|LOCUS_05970 11072 10782 gene locus_tag LOCUS_05980 11072 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 11951 11163 gene locus_tag LOCUS_05990 11951 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 12062 13063 gene locus_tag LOCUS_06000 gene glpX 12062 13063 CDS product fructose-1,6-bisphosphatase class 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN21 protein_id gnl|my_center|LOCUS_06000 13596 13198 gene locus_tag LOCUS_06010 13596 13198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 15026 13605 gene locus_tag LOCUS_06020 gene atpD 15026 13605 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DH77 protein_id gnl|my_center|LOCUS_06020 15989 15060 gene locus_tag LOCUS_06030 gene atpG 15989 15060 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4D4 protein_id gnl|my_center|LOCUS_06030 17687 16068 gene locus_tag LOCUS_06040 gene atpA 17687 16068 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R202 protein_id gnl|my_center|LOCUS_06040 18248 17718 gene locus_tag LOCUS_06050 gene atpH 18248 17718 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK5 protein_id gnl|my_center|LOCUS_06050 18945 18241 gene locus_tag LOCUS_06060 18945 18241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 19234 18977 gene locus_tag LOCUS_06070 19234 18977 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6C1 protein_id gnl|my_center|LOCUS_06070 20096 19329 gene locus_tag LOCUS_06080 gene atpB 20096 19329 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDS8 protein_id gnl|my_center|LOCUS_06080 20593 20105 gene locus_tag LOCUS_06090 20593 20105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 20862 20593 gene locus_tag LOCUS_06100 20862 20593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 22175 21048 gene locus_tag LOCUS_06110 22175 21048 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_06110 23574 22330 gene locus_tag LOCUS_06120 gene glyA 23574 22330 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAW9 protein_id gnl|my_center|LOCUS_06120 24561 23653 gene locus_tag LOCUS_06130 24561 23653 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943443.1 protein_id gnl|my_center|LOCUS_06130 24622 25950 gene locus_tag LOCUS_06140 24622 25950 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_06140 26818 25964 gene locus_tag LOCUS_06150 26818 25964 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_06150 28522 26948 gene locus_tag LOCUS_06160 28522 26948 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090531.1 protein_id gnl|my_center|LOCUS_06160 28616 31786 gene locus_tag LOCUS_06170 28616 31786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 31779 35111 gene locus_tag LOCUS_06180 31779 35111 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404548.1 protein_id gnl|my_center|LOCUS_06180 35201 36025 gene locus_tag LOCUS_06190 35201 36025 CDS product citrate lyase subunit beta-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUZ0 protein_id gnl|my_center|LOCUS_06190 36115 37059 gene locus_tag LOCUS_06200 36115 37059 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728665.1 protein_id gnl|my_center|LOCUS_06200 37128 37685 gene locus_tag LOCUS_06210 37128 37685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 37702 38601 gene locus_tag LOCUS_06220 37702 38601 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_06220 38612 40183 gene locus_tag LOCUS_06230 38612 40183 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225243.1 protein_id gnl|my_center|LOCUS_06230 40207 40698 gene locus_tag LOCUS_06240 40207 40698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 40718 41494 gene locus_tag LOCUS_06250 gene tauD 40718 41494 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706738.1 protein_id gnl|my_center|LOCUS_06250 41517 43070 gene locus_tag LOCUS_06260 41517 43070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879694.1 protein_id gnl|my_center|LOCUS_06260 43120 46302 gene locus_tag LOCUS_06270 gene ileS 43120 46302 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D3M4 protein_id gnl|my_center|LOCUS_06270 46571 49012 gene locus_tag LOCUS_06280 46571 49012 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K496 protein_id gnl|my_center|LOCUS_06280 49012 50091 gene locus_tag LOCUS_06290 gene nrdB 49012 50091 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3C2 protein_id gnl|my_center|LOCUS_06290 51799 50186 gene locus_tag LOCUS_06300 51799 50186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 52871 51891 gene locus_tag LOCUS_06310 52871 51891 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_06310 55041 52906 gene locus_tag LOCUS_06320 55041 52906 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_06320 56876 55038 gene locus_tag LOCUS_06330 56876 55038 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222825.1 protein_id gnl|my_center|LOCUS_06330 56914 57951 gene locus_tag LOCUS_06340 56914 57951 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731394.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence010 1156 683 gene locus_tag LOCUS_06350 1156 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3163 1169 gene locus_tag LOCUS_06360 gene acsA 3163 1169 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X928 protein_id gnl|my_center|LOCUS_06360 4099 3230 gene locus_tag LOCUS_06370 4099 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 5768 4260 gene locus_tag LOCUS_06380 gene nuoN-1 5768 4260 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_06380 7430 5772 gene locus_tag LOCUS_06390 7430 5772 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_06390 9701 7443 gene locus_tag LOCUS_06400 9701 7443 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_06400 10002 9703 gene locus_tag LOCUS_06410 gene ndhE 10002 9703 CDS product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMW3 protein_id gnl|my_center|LOCUS_06410 10548 10006 gene locus_tag LOCUS_06420 10548 10006 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_06420 11057 10545 gene locus_tag LOCUS_06430 gene nuoI2 11057 10545 CDS product NADH-quinone oxidoreductase subunit I 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2V8 protein_id gnl|my_center|LOCUS_06430 12094 11057 gene locus_tag LOCUS_06440 gene nuoH 12094 11057 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2V9 protein_id gnl|my_center|LOCUS_06440 13277 12105 gene locus_tag LOCUS_06450 gene nuoD1 13277 12105 CDS product NADH-quinone oxidoreductase subunit D 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X853 protein_id gnl|my_center|LOCUS_06450 13975 13274 gene locus_tag LOCUS_06460 13975 13274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 14462 13962 gene locus_tag LOCUS_06470 14462 13962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 14847 14482 gene locus_tag LOCUS_06480 gene nuoA 14847 14482 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814W6 protein_id gnl|my_center|LOCUS_06480 16496 14994 gene locus_tag LOCUS_06490 gene nuoN-1 16496 14994 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_06490 18112 16496 gene locus_tag LOCUS_06500 gene nuoM-1 18112 16496 CDS product NADH:ubiquinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_06500 20472 18109 gene locus_tag LOCUS_06510 20472 18109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 20817 20512 gene locus_tag LOCUS_06520 gene nuoK 20817 20512 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWD6 protein_id gnl|my_center|LOCUS_06520 21449 20817 gene locus_tag LOCUS_06530 21449 20817 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_06530 22078 21449 gene locus_tag LOCUS_06540 22078 21449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 23286 22078 gene locus_tag LOCUS_06550 23286 22078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 25766 23286 gene locus_tag LOCUS_06560 gene nuoG 25766 23286 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAR0 protein_id gnl|my_center|LOCUS_06560 27172 25763 gene locus_tag LOCUS_06570 27172 25763 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258753.1 protein_id gnl|my_center|LOCUS_06570 27857 27198 gene locus_tag LOCUS_06580 27857 27198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 29218 27857 gene locus_tag LOCUS_06590 gene nuoD 29218 27857 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVN5 protein_id gnl|my_center|LOCUS_06590 29745 29215 gene locus_tag LOCUS_06600 29745 29215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 30155 29742 gene locus_tag LOCUS_06610 30155 29742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 30805 30323 gene locus_tag LOCUS_06620 30805 30323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 31881 30859 gene locus_tag LOCUS_06630 31881 30859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 33092 31881 gene locus_tag LOCUS_06640 33092 31881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 33998 33123 gene locus_tag LOCUS_06650 33998 33123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 34768 34058 gene locus_tag LOCUS_06660 34768 34058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 35571 34783 gene locus_tag LOCUS_06670 35571 34783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 36037 35621 gene locus_tag LOCUS_06680 36037 35621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 36489 36034 gene locus_tag LOCUS_06690 36489 36034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 36872 37618 gene locus_tag LOCUS_06700 36872 37618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 37665 38951 gene locus_tag LOCUS_06710 37665 38951 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_06710 39009 40610 gene locus_tag LOCUS_06720 gene pgi 39009 40610 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64193 protein_id gnl|my_center|LOCUS_06720 41898 40627 gene locus_tag LOCUS_06730 gene hemL 41898 40627 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HV8 protein_id gnl|my_center|LOCUS_06730 42886 41906 gene locus_tag LOCUS_06740 gene hemB 42886 41906 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYF5 protein_id gnl|my_center|LOCUS_06740 43665 42925 gene locus_tag LOCUS_06750 43665 42925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 44555 43662 gene locus_tag LOCUS_06760 gene hemC 44555 43662 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKN2 protein_id gnl|my_center|LOCUS_06760 45848 44589 gene locus_tag LOCUS_06770 gene hemA 45848 44589 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ25 protein_id gnl|my_center|LOCUS_06770 46651 45974 gene locus_tag LOCUS_06780 gene rex 46651 45974 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WX14 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06780 47710 46826 gene locus_tag LOCUS_06790 47710 46826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_06790 48470 47712 gene locus_tag LOCUS_06800 gene proC 48470 47712 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A50 protein_id gnl|my_center|LOCUS_06800 49691 48513 gene locus_tag LOCUS_06810 49691 48513 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939181.1 protein_id gnl|my_center|LOCUS_06810 50308 49832 gene locus_tag LOCUS_06820 50308 49832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 51540 50332 gene locus_tag LOCUS_06830 gene mshA 51540 50332 CDS product D-inositol 3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FCG5 protein_id gnl|my_center|LOCUS_06830 51839 51540 gene locus_tag LOCUS_06840 51839 51540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence011 453 3623 gene locus_tag LOCUS_06850 453 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 3753 4934 gene locus_tag LOCUS_06860 3753 4934 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_06860 5024 5437 gene locus_tag LOCUS_06870 5024 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 5454 7727 gene locus_tag LOCUS_06880 gene cutL 5454 7727 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_06880 7762 8556 gene locus_tag LOCUS_06890 7762 8556 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ90 protein_id gnl|my_center|LOCUS_06890 8553 9293 gene locus_tag LOCUS_06900 8553 9293 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529743.1 protein_id gnl|my_center|LOCUS_06900 9303 10121 gene locus_tag LOCUS_06910 9303 10121 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726700.1 protein_id gnl|my_center|LOCUS_06910 10547 10233 gene locus_tag LOCUS_06920 10547 10233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 11595 10666 gene locus_tag LOCUS_06930 11595 10666 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727427.1 protein_id gnl|my_center|LOCUS_06930 12157 11750 gene locus_tag LOCUS_06940 12157 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 13476 12301 gene locus_tag LOCUS_06950 13476 12301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 13411 14406 gene locus_tag LOCUS_06960 13411 14406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 14411 15172 gene locus_tag LOCUS_06970 14411 15172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 15169 16188 gene locus_tag LOCUS_06980 15169 16188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 16185 17060 gene locus_tag LOCUS_06990 16185 17060 CDS product syringomycin biosynthesis enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_06990 17057 17842 gene locus_tag LOCUS_07000 17057 17842 CDS product Asp/Glu racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531948.1 protein_id gnl|my_center|LOCUS_07000 17839 19005 gene locus_tag LOCUS_07010 17839 19005 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259193.1 protein_id gnl|my_center|LOCUS_07010 19338 20312 gene locus_tag LOCUS_07020 19338 20312 CDS product desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975103.1 protein_id gnl|my_center|LOCUS_07020 20309 21463 gene locus_tag LOCUS_07030 gene yeaW 20309 21463 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067835.1 protein_id gnl|my_center|LOCUS_07030 21496 22668 gene locus_tag LOCUS_07040 21496 22668 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970938.1 protein_id gnl|my_center|LOCUS_07040 22665 23255 gene locus_tag LOCUS_07050 22665 23255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531333.1 protein_id gnl|my_center|LOCUS_07050 23287 24072 gene locus_tag LOCUS_07060 23287 24072 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246008.1 protein_id gnl|my_center|LOCUS_07060 24069 25565 gene locus_tag LOCUS_07070 24069 25565 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527057.1 protein_id gnl|my_center|LOCUS_07070 25612 27909 gene locus_tag LOCUS_07080 25612 27909 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_07080 28340 27918 gene locus_tag LOCUS_07090 28340 27918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 29114 28362 gene locus_tag LOCUS_07100 29114 28362 CDS product phenylacetate-CoA oxygenase subunit PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889010.1 protein_id gnl|my_center|LOCUS_07100 29386 29111 gene locus_tag LOCUS_07110 29386 29111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 29813 29403 gene locus_tag LOCUS_07120 29813 29403 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889009.1 protein_id gnl|my_center|LOCUS_07120 30793 29864 gene locus_tag LOCUS_07130 gene paaA 30793 29864 CDS product phenylacetate-CoA oxygenase subunit PaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_07130 32918 30831 gene locus_tag LOCUS_07140 gene paaZ 32918 30831 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976331.1 protein_id gnl|my_center|LOCUS_07140 32925 33848 gene locus_tag LOCUS_07150 gene paaX 32925 33848 CDS product phenylacetic acid degradation operon negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813301.1 protein_id gnl|my_center|LOCUS_07150 34183 33845 gene locus_tag LOCUS_07160 34183 33845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 34281 34796 gene locus_tag LOCUS_07170 34281 34796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 34855 36120 gene locus_tag LOCUS_07180 34855 36120 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 protein_id gnl|my_center|LOCUS_07180 36938 36150 gene locus_tag LOCUS_07190 36938 36150 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_07190 38329 36980 gene locus_tag LOCUS_07200 38329 36980 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 protein_id gnl|my_center|LOCUS_07200 38814 38326 gene locus_tag LOCUS_07210 38814 38326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 40336 38942 gene locus_tag LOCUS_07220 40336 38942 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_07220 40950 40381 gene locus_tag LOCUS_07230 40950 40381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 43813 40943 gene locus_tag LOCUS_07240 gene soxA 43813 40943 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524300.1 protein_id gnl|my_center|LOCUS_07240 44058 43810 gene locus_tag LOCUS_07250 gene soxD 44058 43810 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87387 protein_id gnl|my_center|LOCUS_07250 45347 44058 gene locus_tag LOCUS_07260 gene soxB 45347 44058 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148382.1 protein_id gnl|my_center|LOCUS_07260 46669 45401 gene locus_tag LOCUS_07270 46669 45401 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727100.1 protein_id gnl|my_center|LOCUS_07270 46799 47437 gene locus_tag LOCUS_07280 gene upp 46799 47437 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ06 protein_id gnl|my_center|LOCUS_07280 47447 48409 gene locus_tag LOCUS_07290 47447 48409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 48402 49013 gene locus_tag LOCUS_07300 48402 49013 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_07300 49036 49848 gene locus_tag LOCUS_07310 49036 49848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence012 <1 792 gene locus_tag LOCUS_07320 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013231067.1:SpoIIIJ-associated protein 838 1446 gene locus_tag LOCUS_07330 838 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1933 1553 gene locus_tag LOCUS_07340 1933 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 2550 3695 gene locus_tag LOCUS_07350 2550 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 4755 3727 gene locus_tag LOCUS_07360 4755 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 5117 4791 gene locus_tag LOCUS_07370 5117 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07370 6228 5263 gene locus_tag LOCUS_07380 gene trxB 6228 5263 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ75 protein_id gnl|my_center|LOCUS_07380 6594 6280 gene locus_tag LOCUS_07390 6594 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 7732 6638 gene locus_tag LOCUS_07400 7732 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 8301 7735 gene locus_tag LOCUS_07410 8301 7735 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_07410 9132 8314 gene locus_tag LOCUS_07420 9132 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 10029 9193 gene locus_tag LOCUS_07430 10029 9193 CDS product DegV domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y637 protein_id gnl|my_center|LOCUS_07430 12092 10026 gene locus_tag LOCUS_07440 12092 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 12874 12089 gene locus_tag LOCUS_07450 12874 12089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 12864 13982 gene locus_tag LOCUS_07460 12864 13982 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_07460 13979 15238 gene locus_tag LOCUS_07470 gene pcnB 13979 15238 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231051.1 protein_id gnl|my_center|LOCUS_07470 15306 15701 gene locus_tag LOCUS_07480 15306 15701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230992.1 protein_id gnl|my_center|LOCUS_07480 15856 16731 gene locus_tag LOCUS_07490 gene panB2 15856 16731 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AMS0 protein_id gnl|my_center|LOCUS_07490 16985 17344 gene locus_tag LOCUS_07500 gene rpsF 16985 17344 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MB49 protein_id gnl|my_center|LOCUS_07500 17362 17805 gene locus_tag LOCUS_07510 gene ssb 17362 17805 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJE6 protein_id gnl|my_center|LOCUS_07510 17805 18299 gene locus_tag LOCUS_07520 17805 18299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 18296 18742 gene locus_tag LOCUS_07530 gene rplI 18296 18742 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM68 protein_id gnl|my_center|LOCUS_07530 19021 20499 gene locus_tag LOCUS_07540 19021 20499 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8U7 protein_id gnl|my_center|LOCUS_07540 20578 20778 gene locus_tag LOCUS_07550 20578 20778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 20869 21960 gene locus_tag LOCUS_07560 20869 21960 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 protein_id gnl|my_center|LOCUS_07560 24856 22001 gene locus_tag LOCUS_07570 24856 22001 CDS product branched-chain amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225675.1 protein_id gnl|my_center|LOCUS_07570 27110 24858 gene locus_tag LOCUS_07580 27110 24858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 27206 28804 gene locus_tag LOCUS_07590 gene glpD2 27206 28804 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QT70 protein_id gnl|my_center|LOCUS_07590 30120 28801 gene locus_tag LOCUS_07600 gene paaK-2 30120 28801 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CD7 protein_id gnl|my_center|LOCUS_07600 30823 30143 gene locus_tag LOCUS_07610 30823 30143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 30879 32168 gene locus_tag LOCUS_07620 30879 32168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 32180 33499 gene locus_tag LOCUS_07630 32180 33499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 33496 34413 gene locus_tag LOCUS_07640 33496 34413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 34435 36402 gene locus_tag LOCUS_07650 34435 36402 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 protein_id gnl|my_center|LOCUS_07650 37329 36409 gene locus_tag LOCUS_07660 37329 36409 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_07660 38324 37326 gene locus_tag LOCUS_07670 38324 37326 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 protein_id gnl|my_center|LOCUS_07670 38387 39259 gene locus_tag LOCUS_07680 38387 39259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 39317 41806 gene locus_tag LOCUS_07690 gene mrpA 39317 41806 CDS product Na(+)/H(+) antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 protein_id gnl|my_center|LOCUS_07690 41803 42240 gene locus_tag LOCUS_07700 41803 42240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 42275 42667 gene locus_tag LOCUS_07710 42275 42667 CDS product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461653.1 protein_id gnl|my_center|LOCUS_07710 42664 44217 gene locus_tag LOCUS_07720 42664 44217 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404437.1 protein_id gnl|my_center|LOCUS_07720 44214 44690 gene locus_tag LOCUS_07730 44214 44690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 44687 45010 gene locus_tag LOCUS_07740 44687 45010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 45010 45360 gene locus_tag LOCUS_07750 gene phaG 45010 45360 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208229.1 protein_id gnl|my_center|LOCUS_07750 45432 45361 gene locus_tag LOCUS_t00120 45432 45361 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 45732 46475 gene locus_tag LOCUS_07760 45732 46475 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937650.1 protein_id gnl|my_center|LOCUS_07760 46499 47476 gene locus_tag LOCUS_07770 46499 47476 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence013 <1 552 gene locus_tag LOCUS_07780 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_600285.1:Mg-chelatase subunit ChlI 1790 573 gene locus_tag LOCUS_07790 gene bglB 1790 573 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0W0 protein_id gnl|my_center|LOCUS_07790 2655 1804 gene locus_tag LOCUS_07800 2655 1804 CDS product 3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224387.1 protein_id gnl|my_center|LOCUS_07800 2761 3783 gene locus_tag LOCUS_07810 2761 3783 CDS product putative aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705632.1 protein_id gnl|my_center|LOCUS_07810 3838 5847 gene locus_tag LOCUS_07820 3838 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_07820 5866 6285 gene locus_tag LOCUS_07830 5866 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 6345 6548 gene locus_tag LOCUS_07840 6345 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 6680 6961 gene locus_tag LOCUS_07850 6680 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 7334 7107 gene locus_tag LOCUS_07860 7334 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 7513 9651 gene locus_tag LOCUS_07870 gene ppk 7513 9651 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHV9 protein_id gnl|my_center|LOCUS_07870 9648 10094 gene locus_tag LOCUS_07880 9648 10094 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029461.1 protein_id gnl|my_center|LOCUS_07880 10206 11348 gene locus_tag LOCUS_07890 10206 11348 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481386.1 protein_id gnl|my_center|LOCUS_07890 11424 12092 gene locus_tag LOCUS_07900 11424 12092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 12171 12938 gene locus_tag LOCUS_07910 gene surE 12171 12938 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229561.1 protein_id gnl|my_center|LOCUS_07910 12911 14044 gene locus_tag LOCUS_07920 12911 14044 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07920 14041 14757 gene locus_tag LOCUS_07930 gene regX3 14041 14757 CDS product sensory transduction protein regX3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGL9 protein_id gnl|my_center|LOCUS_07930 14793 16151 gene locus_tag LOCUS_07940 14793 16151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 17485 16145 gene locus_tag LOCUS_07950 17485 16145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 17469 18515 gene locus_tag LOCUS_07960 17469 18515 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_07960 18595 19134 gene locus_tag LOCUS_07970 18595 19134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 19131 19388 gene locus_tag LOCUS_07980 19131 19388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 19390 20400 gene locus_tag LOCUS_07990 19390 20400 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976188.1 protein_id gnl|my_center|LOCUS_07990 21066 20407 gene locus_tag LOCUS_08000 21066 20407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 21537 21070 gene locus_tag LOCUS_08010 21537 21070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 21620 22657 gene locus_tag LOCUS_08020 21620 22657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 protein_id gnl|my_center|LOCUS_08020 22669 25638 gene locus_tag LOCUS_08030 22669 25638 CDS product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FCI4 protein_id gnl|my_center|LOCUS_08030 26065 25661 gene locus_tag LOCUS_08040 26065 25661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 26142 26972 gene locus_tag LOCUS_08050 26142 26972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 27018 27668 gene locus_tag LOCUS_08060 gene pdxH 27018 27668 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S544 protein_id gnl|my_center|LOCUS_08060 28357 27719 gene locus_tag LOCUS_08070 28357 27719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 29451 28354 gene locus_tag LOCUS_08080 29451 28354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705002.1 protein_id gnl|my_center|LOCUS_08080 29956 29468 gene locus_tag LOCUS_08090 29956 29468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 30549 30214 gene locus_tag LOCUS_08100 30549 30214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 32082 30991 gene locus_tag LOCUS_08110 32082 30991 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258336.1 protein_id gnl|my_center|LOCUS_08110 32676 32131 gene locus_tag LOCUS_08120 gene orn 32676 32131 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L01 protein_id gnl|my_center|LOCUS_08120 32752 33189 gene locus_tag LOCUS_08130 gene dut 32752 33189 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2A4 protein_id gnl|my_center|LOCUS_08130 33549 33214 gene locus_tag LOCUS_08140 33549 33214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 33548 34069 gene locus_tag LOCUS_08150 33548 34069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 34731 34066 gene locus_tag LOCUS_08160 34731 34066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 35107 34754 gene locus_tag LOCUS_08170 35107 34754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 35106 36035 gene locus_tag LOCUS_08180 35106 36035 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229859.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08180 36032 36406 gene locus_tag LOCUS_08190 36032 36406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 36484 37521 gene locus_tag LOCUS_08200 36484 37521 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525191.1 protein_id gnl|my_center|LOCUS_08200 37566 37751 gene locus_tag LOCUS_08210 37566 37751 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230573.1 protein_id gnl|my_center|LOCUS_08210 37763 38542 gene locus_tag LOCUS_08220 gene pca 37763 38542 CDS product 3-oxoadipate enol-lactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974484.1 protein_id gnl|my_center|LOCUS_08220 38574 39479 gene locus_tag LOCUS_08230 38574 39479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114464.1 protein_id gnl|my_center|LOCUS_08230 39560 39487 gene locus_tag LOCUS_t00130 39560 39487 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 39652 40431 gene locus_tag LOCUS_08240 gene paaG 39652 40431 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229505.1 protein_id gnl|my_center|LOCUS_08240 40651 40457 gene locus_tag LOCUS_08250 40651 40457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 41476 40724 gene locus_tag LOCUS_08260 41476 40724 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257279.1 protein_id gnl|my_center|LOCUS_08260 41788 41603 gene locus_tag LOCUS_08270 41788 41603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 41776 42633 gene locus_tag LOCUS_08280 41776 42633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 43028 44029 gene locus_tag LOCUS_08290 43028 44029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08290 44026 44856 gene locus_tag LOCUS_08300 44026 44856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 46175 44967 gene locus_tag LOCUS_08310 46175 44967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 47395 46202 gene locus_tag LOCUS_08320 47395 46202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence014 1582 614 gene locus_tag LOCUS_08330 1582 614 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_08330 2371 1592 gene locus_tag LOCUS_08340 gene fixA 2371 1592 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_08340 2926 2468 gene locus_tag LOCUS_08350 2926 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706415.1 protein_id gnl|my_center|LOCUS_08350 2981 3958 gene locus_tag LOCUS_08360 2981 3958 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_08360 4669 3977 gene locus_tag LOCUS_08370 4669 3977 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887187.1 protein_id gnl|my_center|LOCUS_08370 6227 4722 gene locus_tag LOCUS_08380 6227 4722 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_08380 6531 6301 gene locus_tag LOCUS_08390 6531 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 7697 6555 gene locus_tag LOCUS_08400 gene mrp 7697 6555 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX37 protein_id gnl|my_center|LOCUS_08400 7775 8494 gene locus_tag LOCUS_08410 7775 8494 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434123.1 protein_id gnl|my_center|LOCUS_08410 8544 8738 gene locus_tag LOCUS_08420 8544 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 8767 9243 gene locus_tag LOCUS_08430 8767 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 10469 9240 gene locus_tag LOCUS_08440 10469 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 10993 10466 gene locus_tag LOCUS_08450 10993 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 12945 10990 gene locus_tag LOCUS_08460 12945 10990 CDS product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_08460 13494 12970 gene locus_tag LOCUS_08470 13494 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 13655 13500 gene locus_tag LOCUS_08480 13655 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 14499 13696 gene locus_tag LOCUS_08490 gene ccmC 14499 13696 CDS product heme exporter C (cytochrome C-type biogenesis protein) transmembrane inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970511.1 protein_id gnl|my_center|LOCUS_08490 15182 14508 gene locus_tag LOCUS_08500 15182 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 15868 15179 gene locus_tag LOCUS_08510 gene ccmA 15868 15179 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGQ9 protein_id gnl|my_center|LOCUS_08510 15956 16528 gene locus_tag LOCUS_08520 15956 16528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 17732 16536 gene locus_tag LOCUS_08530 17732 16536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031701.1 protein_id gnl|my_center|LOCUS_08530 17716 18762 gene locus_tag LOCUS_08540 17716 18762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 18759 19028 gene locus_tag LOCUS_08550 18759 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 19117 19680 gene locus_tag LOCUS_08560 19117 19680 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223021.1 protein_id gnl|my_center|LOCUS_08560 20205 19714 gene locus_tag LOCUS_08570 20205 19714 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973393.1 protein_id gnl|my_center|LOCUS_08570 20710 20252 gene locus_tag LOCUS_08580 20710 20252 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227808.1 protein_id gnl|my_center|LOCUS_08580 21244 20735 gene locus_tag LOCUS_08590 21244 20735 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887882.1 protein_id gnl|my_center|LOCUS_08590 21282 23216 gene locus_tag LOCUS_08600 21282 23216 CDS product acetoacetate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 protein_id gnl|my_center|LOCUS_08600 23860 23213 gene locus_tag LOCUS_08610 23860 23213 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_08610 23965 24999 gene locus_tag LOCUS_08620 23965 24999 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_08620 25064 26716 gene locus_tag LOCUS_08630 25064 26716 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBN4 protein_id gnl|my_center|LOCUS_08630 27395 26742 gene locus_tag LOCUS_08640 27395 26742 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728081.1 protein_id gnl|my_center|LOCUS_08640 27703 27987 gene locus_tag LOCUS_08650 27703 27987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 29361 28492 gene locus_tag LOCUS_08660 gene dhaA 29361 28492 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XB14 protein_id gnl|my_center|LOCUS_08660 30167 29358 gene locus_tag LOCUS_08670 30167 29358 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967921.1 protein_id gnl|my_center|LOCUS_08670 31222 30164 gene locus_tag LOCUS_08680 31222 30164 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 protein_id gnl|my_center|LOCUS_08680 32180 31248 gene locus_tag LOCUS_08690 32180 31248 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_08690 32433 33050 gene locus_tag LOCUS_08700 gene coaE 32433 33050 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2K7 protein_id gnl|my_center|LOCUS_08700 33814 33062 gene locus_tag LOCUS_08710 33814 33062 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_08710 33920 34855 gene locus_tag LOCUS_08720 gene fabH1 33920 34855 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81GM0 protein_id gnl|my_center|LOCUS_08720 34893 36797 gene locus_tag LOCUS_08730 34893 36797 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_08730 36794 37372 gene locus_tag LOCUS_08740 36794 37372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 38160 37390 gene locus_tag LOCUS_08750 gene yxbG 38160 37390 CDS product putative oxidoreductase YxbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46331 protein_id gnl|my_center|LOCUS_08750 38411 38160 gene locus_tag LOCUS_08760 38411 38160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 38519 38941 gene locus_tag LOCUS_08770 38519 38941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 39838 38957 gene locus_tag LOCUS_08780 39838 38957 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_08780 39938 40501 gene locus_tag LOCUS_08790 39938 40501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 40498 41217 gene locus_tag LOCUS_08800 40498 41217 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103822.1 protein_id gnl|my_center|LOCUS_08800 42110 41214 gene locus_tag LOCUS_08810 42110 41214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082333.1 protein_id gnl|my_center|LOCUS_08810 42836 42168 gene locus_tag LOCUS_08820 42836 42168 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCH0 protein_id gnl|my_center|LOCUS_08820 43233 42856 gene locus_tag LOCUS_08830 43233 42856 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980432.1 protein_id gnl|my_center|LOCUS_08830 43484 43233 gene locus_tag LOCUS_08840 43484 43233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 44806 43526 gene locus_tag LOCUS_08850 44806 43526 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_08850 45283 44810 gene locus_tag LOCUS_08860 45283 44810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence015 956 3052 gene locus_tag LOCUS_08870 956 3052 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259393.1 protein_id gnl|my_center|LOCUS_08870 3141 3980 gene locus_tag LOCUS_08880 3141 3980 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_08880 3992 5920 gene locus_tag LOCUS_08890 gene sdhA 3992 5920 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_08890 5947 6729 gene locus_tag LOCUS_08900 5947 6729 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_08900 8123 7296 gene locus_tag LOCUS_08910 8123 7296 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967701.1 protein_id gnl|my_center|LOCUS_08910 8181 8609 gene locus_tag LOCUS_08920 8181 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 8609 9517 gene locus_tag LOCUS_08930 8609 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08930 10449 9520 gene locus_tag LOCUS_08940 10449 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 11568 10453 gene locus_tag LOCUS_08950 11568 10453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 11909 11565 gene locus_tag LOCUS_08960 11909 11565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 11984 12370 gene locus_tag LOCUS_08970 11984 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 13356 12367 gene locus_tag LOCUS_08980 gene mdh 13356 12367 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3J3 protein_id gnl|my_center|LOCUS_08980 15342 13393 gene locus_tag LOCUS_08990 15342 13393 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_08990 17120 15339 gene locus_tag LOCUS_09000 17120 15339 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09000 18303 17107 gene locus_tag LOCUS_09010 gene icd 18303 17107 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39126 protein_id gnl|my_center|LOCUS_09010 19206 18349 gene locus_tag LOCUS_09020 gene folD 19206 18349 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MG21 protein_id gnl|my_center|LOCUS_09020 20802 19273 gene locus_tag LOCUS_09030 gene purH 20802 19273 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU9 protein_id gnl|my_center|LOCUS_09030 21374 20799 gene locus_tag LOCUS_09040 gene purN 21374 20799 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJJ7 protein_id gnl|my_center|LOCUS_09040 22317 21433 gene locus_tag LOCUS_09050 gene sucD 22317 21433 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKI2 protein_id gnl|my_center|LOCUS_09050 23474 22314 gene locus_tag LOCUS_09060 gene sucC 23474 22314 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJJ0 protein_id gnl|my_center|LOCUS_09060 23641 24117 gene locus_tag LOCUS_09070 23641 24117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 24131 24844 gene locus_tag LOCUS_09080 24131 24844 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403895.1 protein_id gnl|my_center|LOCUS_09080 24906 26489 gene locus_tag LOCUS_09090 24906 26489 CDS product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122835.1 protein_id gnl|my_center|LOCUS_09090 26509 27282 gene locus_tag LOCUS_09100 26509 27282 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223704.1 protein_id gnl|my_center|LOCUS_09100 28338 27295 gene locus_tag LOCUS_09110 gene holB 28338 27295 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_09110 28934 28335 gene locus_tag LOCUS_09120 28934 28335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09120 30376 28931 gene locus_tag LOCUS_09130 30376 28931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09130 33509 30432 gene locus_tag LOCUS_09140 33509 30432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 34914 33538 gene locus_tag LOCUS_09150 gene nhaA 34914 33538 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTY3 protein_id gnl|my_center|LOCUS_09150 35505 35059 gene locus_tag LOCUS_09160 35505 35059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 35843 35502 gene locus_tag LOCUS_09170 gene rsbV 35843 35502 CDS product anti-sigma-B factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WVX8 protein_id gnl|my_center|LOCUS_09170 36081 36905 gene locus_tag LOCUS_09180 36081 36905 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230527.1 protein_id gnl|my_center|LOCUS_09180 37047 37142 gene locus_tag LOCUS_t00140 37047 37142 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 38114 37176 gene locus_tag LOCUS_09190 gene sigA 38114 37176 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGV1 protein_id gnl|my_center|LOCUS_09190 38803 38333 gene locus_tag LOCUS_09200 38803 38333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 40497 38806 gene locus_tag LOCUS_09210 40497 38806 CDS product NAD+ synthase (glutamine-hydrolysing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223119.1 protein_id gnl|my_center|LOCUS_09210 41624 40608 gene locus_tag LOCUS_09220 41624 40608 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKP2 protein_id gnl|my_center|LOCUS_09220 41782 43158 gene locus_tag LOCUS_09230 41782 43158 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_09230 43172 43852 gene locus_tag LOCUS_09240 43172 43852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 44059 43871 gene locus_tag LOCUS_09250 44059 43871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 44515 44141 gene locus_tag LOCUS_09260 44515 44141 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869964.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence016 3097 278 gene locus_tag LOCUS_09270 3097 278 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228917.1 protein_id gnl|my_center|LOCUS_09270 3693 4184 gene locus_tag LOCUS_09280 3693 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 5163 6050 gene locus_tag LOCUS_09290 5163 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 7826 6678 gene locus_tag LOCUS_09300 7826 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 8739 10223 gene locus_tag LOCUS_09310 8739 10223 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730815.1 protein_id gnl|my_center|LOCUS_09310 10278 11516 gene locus_tag LOCUS_09320 10278 11516 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064263.1 protein_id gnl|my_center|LOCUS_09320 12942 11536 gene locus_tag LOCUS_09330 gene ggt-1 12942 11536 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189272.1 protein_id gnl|my_center|LOCUS_09330 14390 14836 gene locus_tag LOCUS_09340 14390 14836 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892844.1 protein_id gnl|my_center|LOCUS_09340 14919 15395 gene locus_tag LOCUS_09350 14919 15395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461636.1 protein_id gnl|my_center|LOCUS_09350 15795 16958 gene locus_tag LOCUS_09360 15795 16958 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_09360 18102 19007 gene locus_tag LOCUS_09370 18102 19007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55567 protein_id gnl|my_center|LOCUS_09370 19079 20299 gene locus_tag LOCUS_09380 19079 20299 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730096.1 protein_id gnl|my_center|LOCUS_09380 20353 21513 gene locus_tag LOCUS_09390 20353 21513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 21529 21831 gene locus_tag LOCUS_09400 21529 21831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 22108 22299 gene locus_tag LOCUS_09410 22108 22299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 22489 23712 gene locus_tag LOCUS_09420 22489 23712 CDS product glycine/betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939574.1 protein_id gnl|my_center|LOCUS_09420 23709 25829 gene locus_tag LOCUS_09430 23709 25829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 26799 25900 gene locus_tag LOCUS_09440 26799 25900 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090003.1 protein_id gnl|my_center|LOCUS_09440 27919 26759 gene locus_tag LOCUS_09450 27919 26759 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728240.1 protein_id gnl|my_center|LOCUS_09450 28986 27919 gene locus_tag LOCUS_09460 28986 27919 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728239.1 protein_id gnl|my_center|LOCUS_09460 29057 29881 gene locus_tag LOCUS_09470 gene paaG 29057 29881 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_09470 31064 30117 gene locus_tag LOCUS_09480 31064 30117 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_09480 32476 31157 gene locus_tag LOCUS_09490 32476 31157 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_09490 34977 32524 gene locus_tag LOCUS_09500 34977 32524 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_09500 36560 35031 gene locus_tag LOCUS_09510 36560 35031 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_09510 37375 36557 gene locus_tag LOCUS_09520 37375 36557 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392694.1 protein_id gnl|my_center|LOCUS_09520 38644 37418 gene locus_tag LOCUS_09530 38644 37418 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_09530 39765 38641 gene locus_tag LOCUS_09540 39765 38641 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_09540 40844 39798 gene locus_tag LOCUS_09550 40844 39798 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730894.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence017 1256 174 gene locus_tag LOCUS_09560 1256 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_09560 1416 1282 gene locus_tag LOCUS_09570 1416 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1560 1487 gene locus_tag LOCUS_t00150 1560 1487 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3954 1639 gene locus_tag LOCUS_09580 3954 1639 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KY67 protein_id gnl|my_center|LOCUS_09580 4016 4948 gene locus_tag LOCUS_09590 4016 4948 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728397.1 protein_id gnl|my_center|LOCUS_09590 5770 4955 gene locus_tag LOCUS_09600 5770 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 6675 5848 gene locus_tag LOCUS_09610 6675 5848 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084146.1 protein_id gnl|my_center|LOCUS_09610 7267 6686 gene locus_tag LOCUS_09620 7267 6686 CDS product TIGR03086 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_09620 8840 7278 gene locus_tag LOCUS_09630 gene guaA 8840 7278 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGP2 protein_id gnl|my_center|LOCUS_09630 10037 8874 gene locus_tag LOCUS_09640 10037 8874 CDS product guanosine monophosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_09640 11597 10167 gene locus_tag LOCUS_09650 11597 10167 CDS product aromatic-L-amino-acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_09650 12297 11584 gene locus_tag LOCUS_09660 12297 11584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 12625 12332 gene locus_tag LOCUS_09670 12625 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 14361 12721 gene locus_tag LOCUS_09680 gene groL1 14361 12721 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40171 protein_id gnl|my_center|LOCUS_09680 14659 14369 gene locus_tag LOCUS_09690 gene groS 14659 14369 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSS3 protein_id gnl|my_center|LOCUS_09690 15852 14821 gene locus_tag LOCUS_09700 gene tsaD 15852 14821 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGJ3 protein_id gnl|my_center|LOCUS_09700 16388 15849 gene locus_tag LOCUS_09710 16388 15849 CDS product ribosomal-protein-alanine N-acetyltransferase RimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_09710 17086 16385 gene locus_tag LOCUS_09720 17086 16385 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_09720 17580 17080 gene locus_tag LOCUS_09730 17580 17080 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_09730 18161 17577 gene locus_tag LOCUS_09740 18161 17577 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_09740 19050 18184 gene locus_tag LOCUS_09750 19050 18184 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228182.1 protein_id gnl|my_center|LOCUS_09750 20174 19047 gene locus_tag LOCUS_09760 20174 19047 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_09760 21283 20189 gene locus_tag LOCUS_09770 21283 20189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 22635 21283 gene locus_tag LOCUS_09780 22635 21283 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSR4 protein_id gnl|my_center|LOCUS_09780 23005 22640 gene locus_tag LOCUS_09790 23005 22640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 26479 23054 gene locus_tag LOCUS_09800 26479 23054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 27949 26603 gene locus_tag LOCUS_09810 gene glmM 27949 26603 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CW62 protein_id gnl|my_center|LOCUS_09810 28371 27973 gene locus_tag LOCUS_09820 28371 27973 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814701.1 protein_id gnl|my_center|LOCUS_09820 28838 28386 gene locus_tag LOCUS_09830 gene rplM 28838 28386 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53874 protein_id gnl|my_center|LOCUS_09830 29778 28990 gene locus_tag LOCUS_09840 gene truA 29778 28990 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEW9 protein_id gnl|my_center|LOCUS_09840 30085 29792 gene locus_tag LOCUS_09850 30085 29792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 31088 30150 gene locus_tag LOCUS_09860 gene rpoA 31088 30150 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X798 protein_id gnl|my_center|LOCUS_09860 31749 31132 gene locus_tag LOCUS_09870 gene rpsD 31749 31132 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CV49 protein_id gnl|my_center|LOCUS_09870 32149 31751 gene locus_tag LOCUS_09880 gene rpsK 32149 31751 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72403 protein_id gnl|my_center|LOCUS_09880 32526 32149 gene locus_tag LOCUS_09890 gene rpsM 32526 32149 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5U9 protein_id gnl|my_center|LOCUS_09890 32860 32666 gene locus_tag LOCUS_09900 gene infA 32860 32666 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD14 protein_id gnl|my_center|LOCUS_09900 33654 33061 gene locus_tag LOCUS_09910 gene adk 33654 33061 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWT7 protein_id gnl|my_center|LOCUS_09910 35002 33680 gene locus_tag LOCUS_09920 gene secY 35002 33680 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGN3 protein_id gnl|my_center|LOCUS_09920 35519 35034 gene locus_tag LOCUS_09930 gene rplO 35519 35034 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46787 protein_id gnl|my_center|LOCUS_09930 35718 35521 gene locus_tag LOCUS_09940 gene rpmD 35718 35521 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSG7 protein_id gnl|my_center|LOCUS_09940 36293 35715 gene locus_tag LOCUS_09950 gene rpsE 36293 35715 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSG6 protein_id gnl|my_center|LOCUS_09950 36652 36293 gene locus_tag LOCUS_09960 gene rplR 36652 36293 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J26 protein_id gnl|my_center|LOCUS_09960 37188 36649 gene locus_tag LOCUS_09970 gene rplF 37188 36649 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFE0 protein_id gnl|my_center|LOCUS_09970 37604 37200 gene locus_tag LOCUS_09980 gene rpsH 37604 37200 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSG3 protein_id gnl|my_center|LOCUS_09980 37803 37618 gene locus_tag LOCUS_09990 gene rpsZ 37803 37618 CDS product 30S ribosomal protein S14 type Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSG2 protein_id gnl|my_center|LOCUS_09990 38372 37803 gene locus_tag LOCUS_10000 gene rplE 38372 37803 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0C8 protein_id gnl|my_center|LOCUS_10000 38679 38365 gene locus_tag LOCUS_10010 gene rplX 38679 38365 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q034Z4 protein_id gnl|my_center|LOCUS_10010 39049 38681 gene locus_tag LOCUS_10020 gene rplN 39049 38681 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CV29 protein_id gnl|my_center|LOCUS_10020 39321 39049 gene locus_tag LOCUS_10030 gene rpsQ 39321 39049 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYY9 protein_id gnl|my_center|LOCUS_10030 39554 39321 gene locus_tag LOCUS_10040 39554 39321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 39970 39554 gene locus_tag LOCUS_10050 gene rplP 39970 39554 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSD8 protein_id gnl|my_center|LOCUS_10050 <40748 39973 gene locus_tag LOCUS_10060 <40748 39973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QSD7:30S ribosomal protein S3 >Feature sequence018 173 1300 gene locus_tag LOCUS_10070 173 1300 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 protein_id gnl|my_center|LOCUS_10070 1297 3141 gene locus_tag LOCUS_10080 1297 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 3138 3926 gene locus_tag LOCUS_10090 3138 3926 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812849.1 protein_id gnl|my_center|LOCUS_10090 3923 4696 gene locus_tag LOCUS_10100 3923 4696 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_10100 5954 4758 gene locus_tag LOCUS_10110 5954 4758 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706369.1 protein_id gnl|my_center|LOCUS_10110 7555 5951 gene locus_tag LOCUS_10120 7555 5951 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706372.1 protein_id gnl|my_center|LOCUS_10120 9648 7552 gene locus_tag LOCUS_10130 9648 7552 CDS product N-methylhydantoinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706373.1 protein_id gnl|my_center|LOCUS_10130 10555 9704 gene locus_tag LOCUS_10140 gene fabG2 10555 9704 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707219.1 protein_id gnl|my_center|LOCUS_10140 11504 10611 gene locus_tag LOCUS_10150 11504 10611 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706652.1 protein_id gnl|my_center|LOCUS_10150 11556 11996 gene locus_tag LOCUS_10160 11556 11996 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 protein_id gnl|my_center|LOCUS_10160 12064 13071 gene locus_tag LOCUS_10170 12064 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 13043 13783 gene locus_tag LOCUS_10180 13043 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_10180 13780 14823 gene locus_tag LOCUS_10190 13780 14823 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168472.1 protein_id gnl|my_center|LOCUS_10190 15862 14840 gene locus_tag LOCUS_10200 gene ltaA 15862 14840 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943783.1 protein_id gnl|my_center|LOCUS_10200 17073 15943 gene locus_tag LOCUS_10210 17073 15943 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730272.1 protein_id gnl|my_center|LOCUS_10210 17795 17130 gene locus_tag LOCUS_10220 17795 17130 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_10220 17852 18151 gene locus_tag LOCUS_10230 17852 18151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 18164 18325 gene locus_tag LOCUS_10240 18164 18325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 18359 18958 gene locus_tag LOCUS_10250 18359 18958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 19068 19310 gene locus_tag LOCUS_10260 19068 19310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 19381 19851 gene locus_tag LOCUS_10270 gene bfr 19381 19851 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2S8 protein_id gnl|my_center|LOCUS_10270 19915 21588 gene locus_tag LOCUS_10280 gene betA 19915 21588 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGN2 protein_id gnl|my_center|LOCUS_10280 21647 22882 gene locus_tag LOCUS_10290 21647 22882 CDS product peptidase M38 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088242.1 protein_id gnl|my_center|LOCUS_10290 22848 24020 gene locus_tag LOCUS_10300 22848 24020 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_10300 25554 24034 gene locus_tag LOCUS_10310 25554 24034 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_10310 25581 26651 gene locus_tag LOCUS_10320 25581 26651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_10320 26682 26978 gene locus_tag LOCUS_10330 26682 26978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 27033 27218 gene locus_tag LOCUS_10340 27033 27218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 27232 28050 gene locus_tag LOCUS_10350 27232 28050 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976314.1 protein_id gnl|my_center|LOCUS_10350 29121 28051 gene locus_tag LOCUS_10360 gene adh 29121 28051 CDS product putative alcohol dehydrogenase adh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQC3 protein_id gnl|my_center|LOCUS_10360 30335 29142 gene locus_tag LOCUS_10370 gene atoB 30335 29142 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225687.1 protein_id gnl|my_center|LOCUS_10370 31622 30384 gene locus_tag LOCUS_10380 31622 30384 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_10380 32577 31645 gene locus_tag LOCUS_10390 32577 31645 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_10390 32765 33727 gene locus_tag LOCUS_10400 32765 33727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 33800 34669 gene locus_tag LOCUS_10410 33800 34669 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140207.1 protein_id gnl|my_center|LOCUS_10410 35571 34696 gene locus_tag LOCUS_10420 35571 34696 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523273.1 protein_id gnl|my_center|LOCUS_10420 36388 35600 gene locus_tag LOCUS_10430 36388 35600 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_10430 38238 36421 gene locus_tag LOCUS_10440 38238 36421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 39764 38238 gene locus_tag LOCUS_10450 39764 38238 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385288.1 protein_id gnl|my_center|LOCUS_10450 <40456 39934 gene locus_tag LOCUS_10460 <40456 39934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001284567.1:amino acid ABC transporter substrate-binding protein >Feature sequence019 1007 237 gene locus_tag LOCUS_10470 1007 237 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888912.1 protein_id gnl|my_center|LOCUS_10470 1075 2070 gene locus_tag LOCUS_10480 1075 2070 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726719.1 protein_id gnl|my_center|LOCUS_10480 2561 2100 gene locus_tag LOCUS_10490 2561 2100 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_10490 3495 2575 gene locus_tag LOCUS_10500 gene menB 3495 2575 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHD8 protein_id gnl|my_center|LOCUS_10500 6055 3668 gene locus_tag LOCUS_10510 6055 3668 CDS product putative CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95149 protein_id gnl|my_center|LOCUS_10510 6191 7345 gene locus_tag LOCUS_10520 6191 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140792.1 protein_id gnl|my_center|LOCUS_10520 7329 8024 gene locus_tag LOCUS_10530 7329 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 10173 8080 gene locus_tag LOCUS_10540 gene hppA1 10173 8080 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_10540 10398 11027 gene locus_tag LOCUS_10550 10398 11027 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT4 protein_id gnl|my_center|LOCUS_10550 11031 12437 gene locus_tag LOCUS_10560 11031 12437 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_10560 12502 14010 gene locus_tag LOCUS_10570 12502 14010 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173241.1 protein_id gnl|my_center|LOCUS_10570 14007 15578 gene locus_tag LOCUS_10580 14007 15578 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_10580 16892 15627 gene locus_tag LOCUS_10590 gene apeB 16892 15627 CDS product putative M18 family aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XA76 protein_id gnl|my_center|LOCUS_10590 17166 21815 gene locus_tag LOCUS_10600 17166 21815 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731294.1 protein_id gnl|my_center|LOCUS_10600 21825 23285 gene locus_tag LOCUS_10610 21825 23285 CDS product putative NADH-dependent glutamate synthase small subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700846.1 protein_id gnl|my_center|LOCUS_10610 24003 23317 gene locus_tag LOCUS_10620 24003 23317 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535020.1 protein_id gnl|my_center|LOCUS_10620 24072 25469 gene locus_tag LOCUS_10630 24072 25469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 29724 25474 gene locus_tag LOCUS_10640 29724 25474 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950366.1 protein_id gnl|my_center|LOCUS_10640 30896 29721 gene locus_tag LOCUS_10650 30896 29721 CDS product putative glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705203.1 protein_id gnl|my_center|LOCUS_10650 30998 32413 gene locus_tag LOCUS_10660 30998 32413 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203595.1 protein_id gnl|my_center|LOCUS_10660 33645 32476 gene locus_tag LOCUS_10670 33645 32476 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257464.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10670 33837 34502 gene locus_tag LOCUS_10680 33837 34502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 34515 34877 gene locus_tag LOCUS_10690 34515 34877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 34874 35452 gene locus_tag LOCUS_10700 34874 35452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 35795 35496 gene locus_tag LOCUS_10710 35795 35496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 36195 36362 gene locus_tag LOCUS_10720 36195 36362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 36923 36378 gene locus_tag LOCUS_10730 36923 36378 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1U6 protein_id gnl|my_center|LOCUS_10730 37978 36920 gene locus_tag LOCUS_10740 gene xerC 37978 36920 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226556.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence020 115 41 gene locus_tag LOCUS_t00160 115 41 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 224 5482 gene locus_tag LOCUS_10750 224 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 6064 5486 gene locus_tag LOCUS_10760 6064 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 6198 6123 gene locus_tag LOCUS_t00170 6198 6123 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6728 6264 gene locus_tag LOCUS_10770 6728 6264 CDS product putative phenylacetic acid degradation-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702780.1 protein_id gnl|my_center|LOCUS_10770 7321 6725 gene locus_tag LOCUS_10780 7321 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702776.1 protein_id gnl|my_center|LOCUS_10780 7387 8493 gene locus_tag LOCUS_10790 gene adh 7387 8493 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_10790 8510 9112 gene locus_tag LOCUS_10800 8510 9112 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_10800 9135 9566 gene locus_tag LOCUS_10810 9135 9566 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_10810 10057 9563 gene locus_tag LOCUS_10820 10057 9563 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223824.1 protein_id gnl|my_center|LOCUS_10820 11340 10054 gene locus_tag LOCUS_10830 gene metY 11340 10054 CDS product O-acetylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223825.1 protein_id gnl|my_center|LOCUS_10830 11454 11999 gene locus_tag LOCUS_10840 11454 11999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 12084 13745 gene locus_tag LOCUS_10850 12084 13745 CDS product putative acetyl/propionyl-CoA carboxylase beta subunit AccD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702802.1 protein_id gnl|my_center|LOCUS_10850 13742 15691 gene locus_tag LOCUS_10860 13742 15691 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 protein_id gnl|my_center|LOCUS_10860 15694 17457 gene locus_tag LOCUS_10870 15694 17457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702796.1 protein_id gnl|my_center|LOCUS_10870 17454 18107 gene locus_tag LOCUS_10880 17454 18107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 18131 18925 gene locus_tag LOCUS_10890 18131 18925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702795.1 protein_id gnl|my_center|LOCUS_10890 18925 19728 gene locus_tag LOCUS_10900 gene echA7 18925 19728 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404949.1 protein_id gnl|my_center|LOCUS_10900 19725 21362 gene locus_tag LOCUS_10910 gene ilvB 19725 21362 CDS product acetolactate synthase I/II/III large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226410.1 protein_id gnl|my_center|LOCUS_10910 22192 21359 gene locus_tag LOCUS_10920 22192 21359 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804288.1 protein_id gnl|my_center|LOCUS_10920 23597 22218 gene locus_tag LOCUS_10930 23597 22218 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_10930 24697 23594 gene locus_tag LOCUS_10940 24697 23594 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_10940 24793 25110 gene locus_tag LOCUS_10950 24793 25110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 25633 25558 gene locus_tag LOCUS_t00180 25633 25558 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25971 25741 gene locus_tag LOCUS_10960 25971 25741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 26499 25981 gene locus_tag LOCUS_10970 26499 25981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 27813 26575 gene locus_tag LOCUS_10980 27813 26575 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_10980 29050 27806 gene locus_tag LOCUS_10990 gene metX 29050 27806 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHP2 protein_id gnl|my_center|LOCUS_10990 30943 29306 gene locus_tag LOCUS_11000 30943 29306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 32134 30959 gene locus_tag LOCUS_11010 32134 30959 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029814.1 protein_id gnl|my_center|LOCUS_11010 32589 32320 gene locus_tag LOCUS_11020 32589 32320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 33139 32600 gene locus_tag LOCUS_11030 33139 32600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 33927 33136 gene locus_tag LOCUS_11040 gene lgt1 33927 33136 CDS product prolipoprotein diacylglyceryl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2U8 protein_id gnl|my_center|LOCUS_11040 35743 33944 gene locus_tag LOCUS_11050 gene mmgC 35743 33944 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 protein_id gnl|my_center|LOCUS_11050 35870 37327 gene locus_tag LOCUS_11060 35870 37327 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731462.1 protein_id gnl|my_center|LOCUS_11060 37362 39074 gene locus_tag LOCUS_11070 37362 39074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence021 1124 357 gene locus_tag LOCUS_11080 1124 357 CDS product beta-D-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065000.1 protein_id gnl|my_center|LOCUS_11080 2683 1124 gene locus_tag LOCUS_11090 2683 1124 CDS product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972706.1 protein_id gnl|my_center|LOCUS_11090 4956 2680 gene locus_tag LOCUS_11100 4956 2680 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533164.1 protein_id gnl|my_center|LOCUS_11100 5420 4953 gene locus_tag LOCUS_11110 5420 4953 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393459.1 protein_id gnl|my_center|LOCUS_11110 5491 6561 gene locus_tag LOCUS_11120 5491 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_11120 6981 6568 gene locus_tag LOCUS_11130 6981 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 8210 6978 gene locus_tag LOCUS_11140 8210 6978 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065102.1 protein_id gnl|my_center|LOCUS_11140 9376 8210 gene locus_tag LOCUS_11150 9376 8210 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887889.1 protein_id gnl|my_center|LOCUS_11150 10380 9373 gene locus_tag LOCUS_11160 10380 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 10697 10380 gene locus_tag LOCUS_11170 10697 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 11734 10736 gene locus_tag LOCUS_11180 gene mer 11734 10736 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_11180 13349 11736 gene locus_tag LOCUS_11190 13349 11736 CDS product hydantoinase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989476.1 protein_id gnl|my_center|LOCUS_11190 14425 13346 gene locus_tag LOCUS_11200 14425 13346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_11200 15408 14542 gene locus_tag LOCUS_11210 15408 14542 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_11210 16249 15476 gene locus_tag LOCUS_11220 16249 15476 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902223.1 protein_id gnl|my_center|LOCUS_11220 17504 16605 gene locus_tag LOCUS_11230 17504 16605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225794.1 protein_id gnl|my_center|LOCUS_11230 18145 17549 gene locus_tag LOCUS_11240 18145 17549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 18551 18482 gene locus_tag LOCUS_t00190 18551 18482 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 18653 19087 gene locus_tag LOCUS_11250 18653 19087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 19873 19142 gene locus_tag LOCUS_11260 19873 19142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 20039 20734 gene locus_tag LOCUS_11270 20039 20734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 21476 20841 gene locus_tag LOCUS_11280 21476 20841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 21535 21813 gene locus_tag LOCUS_11290 21535 21813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 22071 21997 gene locus_tag LOCUS_t00200 22071 21997 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22174 26694 gene locus_tag LOCUS_11300 22174 26694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 26745 27473 gene locus_tag LOCUS_11310 26745 27473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 27637 29193 gene locus_tag LOCUS_11320 27637 29193 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 protein_id gnl|my_center|LOCUS_11320 30052 29249 gene locus_tag LOCUS_11330 30052 29249 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064414.1 protein_id gnl|my_center|LOCUS_11330 30827 30159 gene locus_tag LOCUS_11340 30827 30159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 31309 30851 gene locus_tag LOCUS_11350 31309 30851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 31853 31374 gene locus_tag LOCUS_11360 31853 31374 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_11360 32317 31937 gene locus_tag LOCUS_11370 32317 31937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 34098 32383 gene locus_tag LOCUS_11380 gene proS 34098 32383 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJN1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence022 <1 2714 gene locus_tag LOCUS_11390 <1 2714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DHM4:protein translocase subunit SecA 2729 3832 gene locus_tag LOCUS_11400 gene prfB 2729 3832 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NS78 protein_id gnl|my_center|LOCUS_11400 3959 4636 gene locus_tag LOCUS_11410 3959 4636 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_11410 4697 5590 gene locus_tag LOCUS_11420 4697 5590 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLV9 protein_id gnl|my_center|LOCUS_11420 5595 5960 gene locus_tag LOCUS_11430 5595 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 6035 7105 gene locus_tag LOCUS_11440 6035 7105 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085431.1 protein_id gnl|my_center|LOCUS_11440 8789 7137 gene locus_tag LOCUS_11450 8789 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 8871 10136 gene locus_tag LOCUS_11460 8871 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 10188 10922 gene locus_tag LOCUS_11470 10188 10922 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_11470 10919 12457 gene locus_tag LOCUS_11480 10919 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 12925 12506 gene locus_tag LOCUS_11490 12925 12506 CDS product diadenosine tetraphosphate (Ap4A) hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601801.1 protein_id gnl|my_center|LOCUS_11490 12978 13592 gene locus_tag LOCUS_11500 gene pgsA 12978 13592 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226820.1 protein_id gnl|my_center|LOCUS_11500 13644 14027 gene locus_tag LOCUS_11510 gene gcvH 13644 14027 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D905 protein_id gnl|my_center|LOCUS_11510 14030 14494 gene locus_tag LOCUS_11520 14030 14494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11520 14504 15244 gene locus_tag LOCUS_11530 14504 15244 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226818.1 protein_id gnl|my_center|LOCUS_11530 15316 15936 gene locus_tag LOCUS_11540 15316 15936 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_11540 15980 16483 gene locus_tag LOCUS_11550 15980 16483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_11550 16648 17133 gene locus_tag LOCUS_11560 16648 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 17138 17485 gene locus_tag LOCUS_11570 17138 17485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 17495 17656 gene locus_tag LOCUS_11580 17495 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 18472 17678 gene locus_tag LOCUS_11590 18472 17678 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_11590 19624 18536 gene locus_tag LOCUS_11600 gene aroC 19624 18536 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_11600 20599 19736 gene locus_tag LOCUS_11610 20599 19736 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950459.1 protein_id gnl|my_center|LOCUS_11610 21976 20624 gene locus_tag LOCUS_11620 gene gor 21976 20624 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_11620 23077 21986 gene locus_tag LOCUS_11630 23077 21986 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704886.1 protein_id gnl|my_center|LOCUS_11630 24284 23082 gene locus_tag LOCUS_11640 24284 23082 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_11640 25532 24297 gene locus_tag LOCUS_11650 25532 24297 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920336.1 protein_id gnl|my_center|LOCUS_11650 25828 25529 gene locus_tag LOCUS_11660 25828 25529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 25889 26110 gene locus_tag LOCUS_11670 25889 26110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 26165 26632 gene locus_tag LOCUS_11680 26165 26632 CDS product benzoylsuccinyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729363.1 protein_id gnl|my_center|LOCUS_11680 26632 27819 gene locus_tag LOCUS_11690 26632 27819 CDS product putative lipid-transfer protein Ltp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703354.1 protein_id gnl|my_center|LOCUS_11690 27829 28593 gene locus_tag LOCUS_11700 gene paaG 27829 28593 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 protein_id gnl|my_center|LOCUS_11700 28590 29438 gene locus_tag LOCUS_11710 28590 29438 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_11710 29435 30235 gene locus_tag LOCUS_11720 gene echA19 29435 30235 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419179.1 protein_id gnl|my_center|LOCUS_11720 30909 30265 gene locus_tag LOCUS_11730 30909 30265 CDS product putative 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD41 protein_id gnl|my_center|LOCUS_11730 31688 30948 gene locus_tag LOCUS_11740 31688 30948 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729763.1 protein_id gnl|my_center|LOCUS_11740 31812 32468 gene locus_tag LOCUS_11750 31812 32468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 32851 32528 gene locus_tag LOCUS_11760 32851 32528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence023 <1 519 gene locus_tag LOCUS_11770 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MBA9:tRNA pseudouridine synthase B 595 1542 gene locus_tag LOCUS_11780 595 1542 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBM7 protein_id gnl|my_center|LOCUS_11780 1561 2310 gene locus_tag LOCUS_11790 1561 2310 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEK1 protein_id gnl|my_center|LOCUS_11790 2670 3341 gene locus_tag LOCUS_11800 2670 3341 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014470.1 protein_id gnl|my_center|LOCUS_11800 3341 4561 gene locus_tag LOCUS_11810 gene ribA 3341 4561 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4W9 protein_id gnl|my_center|LOCUS_11810 4558 5022 gene locus_tag LOCUS_11820 4558 5022 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811752.1 protein_id gnl|my_center|LOCUS_11820 5520 5065 gene locus_tag LOCUS_11830 5520 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143438.1 protein_id gnl|my_center|LOCUS_11830 5745 6014 gene locus_tag LOCUS_11840 gene rpsO 5745 6014 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT0 protein_id gnl|my_center|LOCUS_11840 6282 8723 gene locus_tag LOCUS_11850 gene pnp 6282 8723 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVQ5 protein_id gnl|my_center|LOCUS_11850 8729 10015 gene locus_tag LOCUS_11860 8729 10015 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728508.1 protein_id gnl|my_center|LOCUS_11860 10081 10866 gene locus_tag LOCUS_11870 gene dapB 10081 10866 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD52 protein_id gnl|my_center|LOCUS_11870 10875 11639 gene locus_tag LOCUS_11880 10875 11639 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC66 protein_id gnl|my_center|LOCUS_11880 11662 12309 gene locus_tag LOCUS_11890 11662 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405892.1 protein_id gnl|my_center|LOCUS_11890 12306 13199 gene locus_tag LOCUS_11900 gene dapA 12306 13199 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJK7 protein_id gnl|my_center|LOCUS_11900 13223 14986 gene locus_tag LOCUS_11910 gene rnj 13223 14986 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DD96 protein_id gnl|my_center|LOCUS_11910 15050 17566 gene locus_tag LOCUS_11920 15050 17566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 17599 18552 gene locus_tag LOCUS_11930 17599 18552 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455122.1 protein_id gnl|my_center|LOCUS_11930 18599 19849 gene locus_tag LOCUS_11940 gene rimO 18599 19849 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJK1 protein_id gnl|my_center|LOCUS_11940 19878 20450 gene locus_tag LOCUS_11950 gene pgsA 19878 20450 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404053.1 protein_id gnl|my_center|LOCUS_11950 20474 21727 gene locus_tag LOCUS_11960 20474 21727 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHU4 protein_id gnl|my_center|LOCUS_11960 21745 22236 gene locus_tag LOCUS_11970 21745 22236 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S292 protein_id gnl|my_center|LOCUS_11970 22645 22247 gene locus_tag LOCUS_11980 gene msrB 22645 22247 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1K0 protein_id gnl|my_center|LOCUS_11980 22830 23990 gene locus_tag LOCUS_11990 gene recA 22830 23990 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50487 protein_id gnl|my_center|LOCUS_11990 24074 25585 gene locus_tag LOCUS_12000 gene miaB 24074 25585 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD05 protein_id gnl|my_center|LOCUS_12000 25594 26517 gene locus_tag LOCUS_12010 gene miaA 25594 26517 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69967 protein_id gnl|my_center|LOCUS_12010 26552 27388 gene locus_tag LOCUS_12020 gene dapF 26552 27388 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK34 protein_id gnl|my_center|LOCUS_12020 27381 28775 gene locus_tag LOCUS_12030 gene hflX 27381 28775 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0N6 protein_id gnl|my_center|LOCUS_12030 28772 29908 gene locus_tag LOCUS_12040 28772 29908 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_12040 30099 30770 gene locus_tag LOCUS_12050 gene dapD 30099 30770 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_12050 30811 31875 gene locus_tag LOCUS_12060 30811 31875 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_12060 32587 31946 gene locus_tag LOCUS_12070 gene lexA 32587 31946 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1N3 protein_id gnl|my_center|LOCUS_12070 >Feature sequence024 1009 2175 gene locus_tag LOCUS_12080 1009 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2189 3547 gene locus_tag LOCUS_12090 2189 3547 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971350.1 protein_id gnl|my_center|LOCUS_12090 3673 4629 gene locus_tag LOCUS_12100 3673 4629 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706670.1 protein_id gnl|my_center|LOCUS_12100 4680 5321 gene locus_tag LOCUS_12110 4680 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 5318 5761 gene locus_tag LOCUS_12120 5318 5761 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531989.1 protein_id gnl|my_center|LOCUS_12120 6553 5771 gene locus_tag LOCUS_12130 6553 5771 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976846.1 protein_id gnl|my_center|LOCUS_12130 7497 6628 gene locus_tag LOCUS_12140 7497 6628 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402936.1 protein_id gnl|my_center|LOCUS_12140 8392 7529 gene locus_tag LOCUS_12150 8392 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 8574 8389 gene locus_tag LOCUS_12160 8574 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 8809 8567 gene locus_tag LOCUS_12170 8809 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 9581 8829 gene locus_tag LOCUS_12180 9581 8829 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122002.1 protein_id gnl|my_center|LOCUS_12180 10446 9646 gene locus_tag LOCUS_12190 10446 9646 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L016 protein_id gnl|my_center|LOCUS_12190 10648 10457 gene locus_tag LOCUS_12200 10648 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 10660 11589 gene locus_tag LOCUS_12210 10660 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_12210 11914 11618 gene locus_tag LOCUS_12220 11914 11618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 12295 12002 gene locus_tag LOCUS_12230 12295 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 13249 12530 gene locus_tag LOCUS_12240 13249 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 14014 13352 gene locus_tag LOCUS_12250 14014 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 14784 14011 gene locus_tag LOCUS_12260 gene ddaH 14784 14011 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X7M4 protein_id gnl|my_center|LOCUS_12260 15249 14818 gene locus_tag LOCUS_12270 15249 14818 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224891.1 protein_id gnl|my_center|LOCUS_12270 15337 16278 gene locus_tag LOCUS_12280 15337 16278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 17585 16632 gene locus_tag LOCUS_12290 17585 16632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 18168 17902 gene locus_tag LOCUS_12300 18168 17902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 18776 18243 gene locus_tag LOCUS_12310 18776 18243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257463.1 protein_id gnl|my_center|LOCUS_12310 19435 19094 gene locus_tag LOCUS_12320 19435 19094 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188214.1 protein_id gnl|my_center|LOCUS_12320 19647 19573 gene locus_tag LOCUS_t00210 19647 19573 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 19796 19719 gene locus_tag LOCUS_t00220 19796 19719 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 19809 21047 gene locus_tag LOCUS_12330 19809 21047 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975701.1 protein_id gnl|my_center|LOCUS_12330 21059 21137 gene locus_tag LOCUS_t00230 21059 21137 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21186 21317 gene locus_tag LOCUS_12340 21186 21317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 21459 21614 gene locus_tag LOCUS_12350 21459 21614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 23144 21693 gene locus_tag LOCUS_12360 23144 21693 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64746 protein_id gnl|my_center|LOCUS_12360 23256 23681 gene locus_tag LOCUS_12370 23256 23681 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035482.1 protein_id gnl|my_center|LOCUS_12370 24965 23694 gene locus_tag LOCUS_12380 24965 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 26385 25099 gene locus_tag LOCUS_12390 26385 25099 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027491.1 protein_id gnl|my_center|LOCUS_12390 28116 26476 gene locus_tag LOCUS_12400 28116 26476 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKY7 protein_id gnl|my_center|LOCUS_12400 28198 29736 gene locus_tag LOCUS_12410 28198 29736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 30611 29757 gene locus_tag LOCUS_12420 gene cpdA 30611 29757 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZTD8 protein_id gnl|my_center|LOCUS_12420 31918 30665 gene locus_tag LOCUS_12430 31918 30665 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930884.1 protein_id gnl|my_center|LOCUS_12430 32098 32026 gene locus_tag LOCUS_t00240 32098 32026 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence025 243 389 gene locus_tag LOCUS_12440 243 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 761 402 gene locus_tag LOCUS_12450 761 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1888 740 gene locus_tag LOCUS_12460 1888 740 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886887.1 protein_id gnl|my_center|LOCUS_12460 3201 1885 gene locus_tag LOCUS_12470 3201 1885 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_12470 3290 4540 gene locus_tag LOCUS_12480 3290 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 4728 5339 gene locus_tag LOCUS_12490 4728 5339 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897687.1 protein_id gnl|my_center|LOCUS_12490 6647 5373 gene locus_tag LOCUS_12500 6647 5373 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224422.1 protein_id gnl|my_center|LOCUS_12500 6827 7294 gene locus_tag LOCUS_12510 6827 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 7456 8016 gene locus_tag LOCUS_12520 7456 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 10419 8068 gene locus_tag LOCUS_12530 10419 8068 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067519.1 protein_id gnl|my_center|LOCUS_12530 10655 12067 gene locus_tag LOCUS_12540 10655 12067 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731465.1 protein_id gnl|my_center|LOCUS_12540 12112 13041 gene locus_tag LOCUS_12550 12112 13041 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_12550 13029 13817 gene locus_tag LOCUS_12560 gene fwdC 13029 13817 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973661.1 protein_id gnl|my_center|LOCUS_12560 13830 15260 gene locus_tag LOCUS_12570 13830 15260 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762863.1 protein_id gnl|my_center|LOCUS_12570 15270 15683 gene locus_tag LOCUS_12580 15270 15683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 15819 17156 gene locus_tag LOCUS_12590 15819 17156 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053632.1 protein_id gnl|my_center|LOCUS_12590 17704 17273 gene locus_tag LOCUS_12600 17704 17273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 18662 17739 gene locus_tag LOCUS_12610 18662 17739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 19291 18659 gene locus_tag LOCUS_12620 19291 18659 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940338.1 protein_id gnl|my_center|LOCUS_12620 20242 19301 gene locus_tag LOCUS_12630 20242 19301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 21191 20322 gene locus_tag LOCUS_12640 21191 20322 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_12640 22048 21242 gene locus_tag LOCUS_12650 gene fadB 22048 21242 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085730.1 protein_id gnl|my_center|LOCUS_12650 22155 23408 gene locus_tag LOCUS_12660 22155 23408 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_12660 23450 24235 gene locus_tag LOCUS_12670 23450 24235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 26449 24260 gene locus_tag LOCUS_12680 26449 24260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 28074 26461 gene locus_tag LOCUS_12690 28074 26461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 28542 28132 gene locus_tag LOCUS_12700 28542 28132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12700 29400 28594 gene locus_tag LOCUS_12710 29400 28594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12710 >Feature sequence026 274 924 gene locus_tag LOCUS_12720 274 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 983 1744 gene locus_tag LOCUS_12730 983 1744 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064991.1 protein_id gnl|my_center|LOCUS_12730 2166 1741 gene locus_tag LOCUS_12740 2166 1741 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223006.1 protein_id gnl|my_center|LOCUS_12740 2633 2163 gene locus_tag LOCUS_12750 2633 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3130 2663 gene locus_tag LOCUS_12760 3130 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 4143 3208 gene locus_tag LOCUS_12770 4143 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 5765 4140 gene locus_tag LOCUS_12780 5765 4140 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_12780 6993 5809 gene locus_tag LOCUS_12790 6993 5809 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228841.1 protein_id gnl|my_center|LOCUS_12790 7656 7045 gene locus_tag LOCUS_12800 7656 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 9782 7653 gene locus_tag LOCUS_12810 9782 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 10554 9784 gene locus_tag LOCUS_12820 10554 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 10864 10544 gene locus_tag LOCUS_12830 10864 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 10954 11670 gene locus_tag LOCUS_12840 10954 11670 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777044.1 protein_id gnl|my_center|LOCUS_12840 12687 11683 gene locus_tag LOCUS_12850 12687 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 13686 12733 gene locus_tag LOCUS_12860 13686 12733 CDS product protein pafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_12860 14600 13683 gene locus_tag LOCUS_12870 14600 13683 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027895.1 protein_id gnl|my_center|LOCUS_12870 16050 14692 gene locus_tag LOCUS_12880 gene pafA 16050 14692 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ61 protein_id gnl|my_center|LOCUS_12880 16779 16102 gene locus_tag LOCUS_12890 gene psmA 16779 16102 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAT2 protein_id gnl|my_center|LOCUS_12890 17570 16776 gene locus_tag LOCUS_12900 gene prcB 17570 16776 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKQ5 protein_id gnl|my_center|LOCUS_12900 17777 17577 gene locus_tag LOCUS_12910 gene pup 17777 17577 CDS product prokaryotic ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MAI1 protein_id gnl|my_center|LOCUS_12910 19327 17807 gene locus_tag LOCUS_12920 19327 17807 CDS product proteasome accessory factor PafA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_12920 21125 19371 gene locus_tag LOCUS_12930 gene arc 21125 19371 CDS product proteasome-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ58 protein_id gnl|my_center|LOCUS_12930 21338 21574 gene locus_tag LOCUS_12940 21338 21574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 22237 21641 gene locus_tag LOCUS_12950 22237 21641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 22281 22430 gene locus_tag LOCUS_12960 22281 22430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 23175 22402 gene locus_tag LOCUS_12970 23175 22402 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_12970 24152 23172 gene locus_tag LOCUS_12980 24152 23172 CDS product tRNA(Ile)-lysidine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584019.1 protein_id gnl|my_center|LOCUS_12980 24367 24149 gene locus_tag LOCUS_12990 24367 24149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 24600 24367 gene locus_tag LOCUS_13000 24600 24367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 24806 24600 gene locus_tag LOCUS_13010 24806 24600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 25090 24803 gene locus_tag LOCUS_13020 25090 24803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 25815 25150 gene locus_tag LOCUS_13030 25815 25150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704892.1 protein_id gnl|my_center|LOCUS_13030 27295 25856 gene locus_tag LOCUS_13040 27295 25856 CDS product peptidase S13 (D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701272.1 protein_id gnl|my_center|LOCUS_13040 27413 27802 gene locus_tag LOCUS_13050 27413 27802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 27807 28919 gene locus_tag LOCUS_13060 27807 28919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKR9 protein_id gnl|my_center|LOCUS_13060 >Feature sequence027 1863 1015 gene locus_tag LOCUS_13070 gene fmt 1863 1015 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YR6 protein_id gnl|my_center|LOCUS_13070 2459 1896 gene locus_tag LOCUS_13080 gene def2 2459 1896 CDS product peptide deformylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G487 protein_id gnl|my_center|LOCUS_13080 2415 3098 gene locus_tag LOCUS_13090 2415 3098 CDS product 16S RNA G1207 methylase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_13090 3133 3651 gene locus_tag LOCUS_13100 3133 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 5503 3665 gene locus_tag LOCUS_13110 5503 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 6725 5517 gene locus_tag LOCUS_13120 gene metK 6725 5517 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWT3 protein_id gnl|my_center|LOCUS_13120 7951 6710 gene locus_tag LOCUS_13130 7951 6710 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027808.1 protein_id gnl|my_center|LOCUS_13130 8318 7956 gene locus_tag LOCUS_13140 8318 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 8977 8450 gene locus_tag LOCUS_13150 gene gmk 8977 8450 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q82ZD5 protein_id gnl|my_center|LOCUS_13150 9313 8999 gene locus_tag LOCUS_13160 9313 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_13160 10148 9399 gene locus_tag LOCUS_13170 gene pyrF 10148 9399 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77888 protein_id gnl|my_center|LOCUS_13170 11117 10152 gene locus_tag LOCUS_13180 gene pyrD 11117 10152 CDS product dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB9 protein_id gnl|my_center|LOCUS_13180 14413 11114 gene locus_tag LOCUS_13190 14413 11114 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJR3 protein_id gnl|my_center|LOCUS_13190 15528 14413 gene locus_tag LOCUS_13200 gene carA 15528 14413 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP3 protein_id gnl|my_center|LOCUS_13200 16817 15525 gene locus_tag LOCUS_13210 gene pyrC 16817 15525 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7U057 protein_id gnl|my_center|LOCUS_13210 17799 16849 gene locus_tag LOCUS_13220 gene pyrB 17799 16849 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXR2 protein_id gnl|my_center|LOCUS_13220 18424 17858 gene locus_tag LOCUS_13230 gene pyrR 18424 17858 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RVB9 protein_id gnl|my_center|LOCUS_13230 19063 18485 gene locus_tag LOCUS_13240 19063 18485 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027890.1 protein_id gnl|my_center|LOCUS_13240 19497 19060 gene locus_tag LOCUS_13250 gene nusB 19497 19060 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCE4 protein_id gnl|my_center|LOCUS_13250 20066 19503 gene locus_tag LOCUS_13260 gene efp 20066 19503 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXQ9 protein_id gnl|my_center|LOCUS_13260 21169 20084 gene locus_tag LOCUS_13270 21169 20084 CDS product putative cytoplasmic peptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703571.1 protein_id gnl|my_center|LOCUS_13270 21609 21166 gene locus_tag LOCUS_13280 gene aroQ 21609 21166 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52377 protein_id gnl|my_center|LOCUS_13280 22644 21640 gene locus_tag LOCUS_13290 gene rifG 22644 21640 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWY6 protein_id gnl|my_center|LOCUS_13290 23201 22641 gene locus_tag LOCUS_13300 gene aroK 23201 22641 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V14 protein_id gnl|my_center|LOCUS_13300 23521 23252 gene locus_tag LOCUS_13310 23521 23252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 24593 23727 gene locus_tag LOCUS_13320 gene aroE 24593 23727 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI72 protein_id gnl|my_center|LOCUS_13320 26076 24586 gene locus_tag LOCUS_13330 26076 24586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 26500 26069 gene locus_tag LOCUS_13340 26500 26069 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67488 protein_id gnl|my_center|LOCUS_13340 29084 26511 gene locus_tag LOCUS_13350 gene alaS 29084 26511 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61701 protein_id gnl|my_center|LOCUS_13350 29533 29192 gene locus_tag LOCUS_13360 29533 29192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 <30373 29530 gene locus_tag LOCUS_13370 <30373 29530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224577.1:ATPase >Feature sequence028 398 1735 gene locus_tag LOCUS_13380 398 1735 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272198.1 protein_id gnl|my_center|LOCUS_13380 2754 1732 gene locus_tag LOCUS_13390 2754 1732 CDS product chloromuconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289275.1 protein_id gnl|my_center|LOCUS_13390 3557 2751 gene locus_tag LOCUS_13400 gene menH 3557 2751 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBD4 protein_id gnl|my_center|LOCUS_13400 5263 3554 gene locus_tag LOCUS_13410 gene menD 5263 3554 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2V6 protein_id gnl|my_center|LOCUS_13410 6573 5260 gene locus_tag LOCUS_13420 6573 5260 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_13420 7289 6564 gene locus_tag LOCUS_13430 7289 6564 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975643.1 protein_id gnl|my_center|LOCUS_13430 7380 8279 gene locus_tag LOCUS_13440 7380 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:7875..7877,aa:Sec) note codon on position 166 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_13440 8314 9240 gene locus_tag LOCUS_13450 gene lipI 8314 9240 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407279.1 protein_id gnl|my_center|LOCUS_13450 10454 9237 gene locus_tag LOCUS_13460 10454 9237 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_13460 10557 11102 gene locus_tag LOCUS_13470 gene etp 10557 11102 CDS product low molecular weight protein-tyrosine-phosphatase Etp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ACZ3 protein_id gnl|my_center|LOCUS_13470 11120 12331 gene locus_tag LOCUS_13480 11120 12331 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225242.1 protein_id gnl|my_center|LOCUS_13480 12465 13616 gene locus_tag LOCUS_13490 gene atoB 12465 13616 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_13490 14604 13636 gene locus_tag LOCUS_13500 14604 13636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 16173 14659 gene locus_tag LOCUS_13510 16173 14659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 16521 16213 gene locus_tag LOCUS_13520 16521 16213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896282.1 protein_id gnl|my_center|LOCUS_13520 16620 17828 gene locus_tag LOCUS_13530 16620 17828 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726790.1 protein_id gnl|my_center|LOCUS_13530 17855 18523 gene locus_tag LOCUS_13540 17855 18523 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 protein_id gnl|my_center|LOCUS_13540 18576 19913 gene locus_tag LOCUS_13550 gene gltX1 18576 19913 CDS product glutamate--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EV3 protein_id gnl|my_center|LOCUS_13550 20029 20103 gene locus_tag LOCUS_t00250 20029 20103 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20203 20278 gene locus_tag LOCUS_t00260 20203 20278 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20460 21446 gene locus_tag LOCUS_13560 gene cysM 20460 21446 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454499.1 protein_id gnl|my_center|LOCUS_13560 21596 22243 gene locus_tag LOCUS_13570 21596 22243 CDS product 2-keto-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029031.1 protein_id gnl|my_center|LOCUS_13570 22240 23196 gene locus_tag LOCUS_13580 22240 23196 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_13580 24196 23234 gene locus_tag LOCUS_13590 24196 23234 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730159.1 protein_id gnl|my_center|LOCUS_13590 24261 24644 gene locus_tag LOCUS_13600 24261 24644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 25576 24638 gene locus_tag LOCUS_13610 25576 24638 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892059.1 protein_id gnl|my_center|LOCUS_13610 26508 25573 gene locus_tag LOCUS_13620 26508 25573 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361018.1 protein_id gnl|my_center|LOCUS_13620 27386 26505 gene locus_tag LOCUS_13630 27386 26505 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083858.1 protein_id gnl|my_center|LOCUS_13630 28432 27407 gene locus_tag LOCUS_13640 28432 27407 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083857.1 protein_id gnl|my_center|LOCUS_13640 <30281 28608 gene locus_tag LOCUS_13650 <30281 28608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090343.1:ABC transporter substrate-binding protein >Feature sequence029 342 1133 gene locus_tag LOCUS_13660 gene suhB 342 1133 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 protein_id gnl|my_center|LOCUS_13660 1269 1958 gene locus_tag LOCUS_13670 gene regX 1269 1958 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_13670 2059 3387 gene locus_tag LOCUS_13680 gene mtrB 2059 3387 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_13680 3384 4046 gene locus_tag LOCUS_13690 3384 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 5298 4123 gene locus_tag LOCUS_13700 5298 4123 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIE3 protein_id gnl|my_center|LOCUS_13700 5814 5356 gene locus_tag LOCUS_13710 5814 5356 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_13710 6307 5879 gene locus_tag LOCUS_13720 6307 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 7437 6304 gene locus_tag LOCUS_13730 7437 6304 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028156.1 protein_id gnl|my_center|LOCUS_13730 8662 7463 gene locus_tag LOCUS_13740 8662 7463 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392044.1 protein_id gnl|my_center|LOCUS_13740 9018 8755 gene locus_tag LOCUS_13750 9018 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 8908 9114 gene locus_tag LOCUS_13760 8908 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 9124 10809 gene locus_tag LOCUS_13770 gene dnaQ 9124 10809 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_13770 11873 10845 gene locus_tag LOCUS_13780 gene trpD 11873 10845 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D056 protein_id gnl|my_center|LOCUS_13780 12196 11885 gene locus_tag LOCUS_13790 12196 11885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 13473 12820 gene locus_tag LOCUS_13800 13473 12820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 13708 14403 gene locus_tag LOCUS_13810 13708 14403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13810 15000 14422 gene locus_tag LOCUS_13820 15000 14422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 15541 15059 gene locus_tag LOCUS_13830 15541 15059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 16286 15573 gene locus_tag LOCUS_13840 16286 15573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028262.1 protein_id gnl|my_center|LOCUS_13840 16893 16345 gene locus_tag LOCUS_13850 16893 16345 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726631.1 protein_id gnl|my_center|LOCUS_13850 17179 18183 gene locus_tag LOCUS_13860 gene bkdA 17179 18183 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_13860 18180 19160 gene locus_tag LOCUS_13870 gene bkdB 18180 19160 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943294.1 protein_id gnl|my_center|LOCUS_13870 19223 20476 gene locus_tag LOCUS_13880 19223 20476 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819K5 protein_id gnl|my_center|LOCUS_13880 20527 21915 gene locus_tag LOCUS_13890 20527 21915 CDS product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903648.1 protein_id gnl|my_center|LOCUS_13890 22044 23231 gene locus_tag LOCUS_13900 22044 23231 CDS product amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384563.1 protein_id gnl|my_center|LOCUS_13900 23268 24929 gene locus_tag LOCUS_13910 23268 24929 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 protein_id gnl|my_center|LOCUS_13910 25674 24976 gene locus_tag LOCUS_13920 25674 24976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 27309 25846 gene locus_tag LOCUS_13930 gene gabD 27309 25846 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_13930 27625 27287 gene locus_tag LOCUS_13940 27625 27287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 27764 28672 gene locus_tag LOCUS_13950 27764 28672 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728755.1 protein_id gnl|my_center|LOCUS_13950 28698 29702 gene locus_tag LOCUS_13960 28698 29702 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence030 118 41 gene locus_tag LOCUS_t00270 118 41 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 555 343 gene locus_tag LOCUS_13970 555 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1644 571 gene locus_tag LOCUS_13980 1644 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3009 1699 gene locus_tag LOCUS_13990 gene der 3009 1699 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EWW8 protein_id gnl|my_center|LOCUS_13990 4376 3006 gene locus_tag LOCUS_14000 4376 3006 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142769.1 protein_id gnl|my_center|LOCUS_14000 4430 5464 gene locus_tag LOCUS_14010 gene ispH 4430 5464 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MET9 protein_id gnl|my_center|LOCUS_14010 6206 5469 gene locus_tag LOCUS_14020 6206 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 6859 6203 gene locus_tag LOCUS_14030 gene cmk 6859 6203 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63804 protein_id gnl|my_center|LOCUS_14030 8108 6846 gene locus_tag LOCUS_14040 gene aroA 8108 6846 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBA4 protein_id gnl|my_center|LOCUS_14040 9125 8112 gene locus_tag LOCUS_14050 9125 8112 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392846.1 protein_id gnl|my_center|LOCUS_14050 10009 9278 gene locus_tag LOCUS_14060 gene rluB 10009 9278 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB4 protein_id gnl|my_center|LOCUS_14060 10722 10024 gene locus_tag LOCUS_14070 10722 10024 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S231 protein_id gnl|my_center|LOCUS_14070 11506 10733 gene locus_tag LOCUS_14080 11506 10733 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027965.1 protein_id gnl|my_center|LOCUS_14080 11530 12606 gene locus_tag LOCUS_14090 gene trpS 11530 12606 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSZ6 protein_id gnl|my_center|LOCUS_14090 13167 12625 gene locus_tag LOCUS_14100 13167 12625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 13718 13164 gene locus_tag LOCUS_14110 13718 13164 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_14110 15358 13715 gene locus_tag LOCUS_14120 gene pyrG 15358 13715 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFU8 protein_id gnl|my_center|LOCUS_14120 17030 15417 gene locus_tag LOCUS_14130 gene recN 17030 15417 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S220 protein_id gnl|my_center|LOCUS_14130 17921 17112 gene locus_tag LOCUS_14140 gene nadK2 17921 17112 CDS product NAD kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S219 protein_id gnl|my_center|LOCUS_14140 18718 17921 gene locus_tag LOCUS_14150 18718 17921 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_14150 19469 18726 gene locus_tag LOCUS_14160 19469 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868725.1 protein_id gnl|my_center|LOCUS_14160 20564 19524 gene locus_tag LOCUS_14170 20564 19524 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_14170 22432 20561 gene locus_tag LOCUS_14180 22432 20561 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029751.1 protein_id gnl|my_center|LOCUS_14180 23502 22579 gene locus_tag LOCUS_14190 23502 22579 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090003.1 protein_id gnl|my_center|LOCUS_14190 24551 23499 gene locus_tag LOCUS_14200 gene fbaB 24551 23499 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120064.1 protein_id gnl|my_center|LOCUS_14200 25630 24770 gene locus_tag LOCUS_14210 25630 24770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence031 1523 261 gene locus_tag LOCUS_14220 gene livM 1523 261 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039704.1 protein_id gnl|my_center|LOCUS_14220 2488 1520 gene locus_tag LOCUS_14230 2488 1520 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_14230 4353 2485 gene locus_tag LOCUS_14240 4353 2485 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063644.1 protein_id gnl|my_center|LOCUS_14240 4352 5758 gene locus_tag LOCUS_14250 gene xseA 4352 5758 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_14250 5779 5982 gene locus_tag LOCUS_14260 5779 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 6020 6802 gene locus_tag LOCUS_14270 6020 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 7338 7414 gene locus_tag LOCUS_t00280 7338 7414 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8705 7479 gene locus_tag LOCUS_14280 8705 7479 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_14280 8838 9596 gene locus_tag LOCUS_14290 8838 9596 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727098.1 protein_id gnl|my_center|LOCUS_14290 9618 10742 gene locus_tag LOCUS_14300 9618 10742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_14300 11797 10766 gene locus_tag LOCUS_14310 11797 10766 CDS product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710075.1 protein_id gnl|my_center|LOCUS_14310 12867 11797 gene locus_tag LOCUS_14320 12867 11797 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730231.1 protein_id gnl|my_center|LOCUS_14320 13425 12904 gene locus_tag LOCUS_14330 13425 12904 CDS product doxX subfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896605.1 protein_id gnl|my_center|LOCUS_14330 13509 13757 gene locus_tag LOCUS_14340 13509 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 14125 13853 gene locus_tag LOCUS_14350 14125 13853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 14155 14796 gene locus_tag LOCUS_14360 gene trpG 14155 14796 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140885.1 protein_id gnl|my_center|LOCUS_14360 16763 14799 gene locus_tag LOCUS_14370 gene pknB 16763 14799 CDS product serine/threonine-protein kinase PknB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNG1 protein_id gnl|my_center|LOCUS_14370 17712 16834 gene locus_tag LOCUS_14380 17712 16834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 18124 17741 gene locus_tag LOCUS_14390 18124 17741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 18234 18319 gene locus_tag LOCUS_t00290 18234 18319 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19393 18347 gene locus_tag LOCUS_14400 19393 18347 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_14400 20390 19404 gene locus_tag LOCUS_14410 20390 19404 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_14410 20280 20543 gene locus_tag LOCUS_14420 20280 20543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 21187 20426 gene locus_tag LOCUS_14430 21187 20426 CDS product glyoxalase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403266.1 protein_id gnl|my_center|LOCUS_14430 22360 21209 gene locus_tag LOCUS_14440 22360 21209 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GV3 protein_id gnl|my_center|LOCUS_14440 23148 22405 gene locus_tag LOCUS_14450 23148 22405 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224946.1 protein_id gnl|my_center|LOCUS_14450 23147 24115 gene locus_tag LOCUS_14460 23147 24115 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_14460 24236 24149 gene locus_tag LOCUS_t00300 24236 24149 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24304 24397 gene locus_tag LOCUS_t00310 24304 24397 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24462 24538 gene locus_tag LOCUS_t00320 24462 24538 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence032 1461 1237 gene locus_tag LOCUS_14470 1461 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1695 1501 gene locus_tag LOCUS_14480 gene rpmB1 1695 1501 CDS product 50S ribosomal protein L28-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBR5 protein_id gnl|my_center|LOCUS_14480 1866 3518 gene locus_tag LOCUS_14490 1866 3518 CDS product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028485.1 protein_id gnl|my_center|LOCUS_14490 3542 5686 gene locus_tag LOCUS_14500 gene recG 3542 5686 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D041 protein_id gnl|my_center|LOCUS_14500 5691 6299 gene locus_tag LOCUS_14510 5691 6299 CDS product GCN5-like N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_14510 6501 6319 gene locus_tag LOCUS_14520 6501 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 6542 7087 gene locus_tag LOCUS_14530 6542 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 7084 7563 gene locus_tag LOCUS_14540 gene coaD 7084 7563 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMB9 protein_id gnl|my_center|LOCUS_14540 7569 8231 gene locus_tag LOCUS_14550 7569 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 8266 8811 gene locus_tag LOCUS_14560 8266 8811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 8808 9104 gene locus_tag LOCUS_14570 8808 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 9207 10205 gene locus_tag LOCUS_14580 gene plsX 9207 10205 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Y4 protein_id gnl|my_center|LOCUS_14580 10358 10648 gene locus_tag LOCUS_14590 10358 10648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 10626 11468 gene locus_tag LOCUS_14600 gene rnc 10626 11468 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBQ7 protein_id gnl|my_center|LOCUS_14600 11465 12304 gene locus_tag LOCUS_14610 gene mutM 11465 12304 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHE9 protein_id gnl|my_center|LOCUS_14610 12408 15920 gene locus_tag LOCUS_14620 gene smc 12408 15920 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYI4 protein_id gnl|my_center|LOCUS_14620 15982 16674 gene locus_tag LOCUS_14630 15982 16674 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225902.1 protein_id gnl|my_center|LOCUS_14630 16671 17873 gene locus_tag LOCUS_14640 16671 17873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 17870 19126 gene locus_tag LOCUS_14650 17870 19126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 19204 20094 gene locus_tag LOCUS_14660 19204 20094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 20119 21618 gene locus_tag LOCUS_14670 gene ffh 20119 21618 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WGD7 protein_id gnl|my_center|LOCUS_14670 21791 22252 gene locus_tag LOCUS_14680 21791 22252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 22249 22497 gene locus_tag LOCUS_14690 22249 22497 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I96 protein_id gnl|my_center|LOCUS_14690 22445 22996 gene locus_tag LOCUS_14700 gene rimM 22445 22996 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NNX5 protein_id gnl|my_center|LOCUS_14700 22999 23730 gene locus_tag LOCUS_14710 gene trmD 22999 23730 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV4 protein_id gnl|my_center|LOCUS_14710 23852 24199 gene locus_tag LOCUS_14720 gene rplS 23852 24199 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33020 protein_id gnl|my_center|LOCUS_14720 24260 24640 gene locus_tag LOCUS_14730 gene yraN 24260 24640 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0D3 protein_id gnl|my_center|LOCUS_14730 24910 24719 gene locus_tag LOCUS_14740 24910 24719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence033 205 1926 gene locus_tag LOCUS_14750 gene selB 205 1926 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226942.1 protein_id gnl|my_center|LOCUS_14750 2211 1951 gene locus_tag LOCUS_14760 2211 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 3606 2314 gene locus_tag LOCUS_14770 3606 2314 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_14770 4004 3663 gene locus_tag LOCUS_14780 4004 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4130 4504 gene locus_tag LOCUS_14790 4130 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4568 4644 gene locus_tag LOCUS_t00330 4568 4644 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5683 4892 gene locus_tag LOCUS_14800 5683 4892 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_14800 6154 5846 gene locus_tag LOCUS_14810 6154 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 7362 6250 gene locus_tag LOCUS_14820 7362 6250 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257747.1 protein_id gnl|my_center|LOCUS_14820 7591 7409 gene locus_tag LOCUS_14830 7591 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 9295 7814 gene locus_tag LOCUS_14840 9295 7814 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_14840 9349 10245 gene locus_tag LOCUS_14850 9349 10245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 10310 10807 gene locus_tag LOCUS_14860 10310 10807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_14860 11119 10817 gene locus_tag LOCUS_14870 11119 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 11225 11476 gene locus_tag LOCUS_14880 11225 11476 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868393.1 protein_id gnl|my_center|LOCUS_14880 12472 11492 gene locus_tag LOCUS_14890 gene asd 12472 11492 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1Z5 protein_id gnl|my_center|LOCUS_14890 13376 12615 gene locus_tag LOCUS_14900 13376 12615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 14072 13380 gene locus_tag LOCUS_14910 14072 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 14963 14076 gene locus_tag LOCUS_14920 14963 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 16360 15143 gene locus_tag LOCUS_14930 16360 15143 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI7 protein_id gnl|my_center|LOCUS_14930 16475 17278 gene locus_tag LOCUS_14940 16475 17278 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCA8 protein_id gnl|my_center|LOCUS_14940 17289 17960 gene locus_tag LOCUS_14950 gene aat 17289 17960 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BN2 protein_id gnl|my_center|LOCUS_14950 18180 17953 gene locus_tag LOCUS_14960 18180 17953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 19724 18183 gene locus_tag LOCUS_14970 19724 18183 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 protein_id gnl|my_center|LOCUS_14970 20682 19801 gene locus_tag LOCUS_14980 20682 19801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 21123 20722 gene locus_tag LOCUS_14990 gene mceE 21123 20722 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_14990 21993 21376 gene locus_tag LOCUS_15000 gene recR 21993 21376 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI4 protein_id gnl|my_center|LOCUS_15000 23882 22002 gene locus_tag LOCUS_15010 23882 22002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 24031 23944 gene locus_tag LOCUS_t00340 24031 23944 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24301 24756 gene locus_tag LOCUS_15020 gene tadA 24301 24756 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MGL9 protein_id gnl|my_center|LOCUS_15020 24813 24902 gene locus_tag LOCUS_t00350 24813 24902 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence034 1639 1034 gene locus_tag LOCUS_15030 gene nasT 1639 1034 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_15030 1926 1636 gene locus_tag LOCUS_15040 1926 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 2069 1984 gene locus_tag LOCUS_t00360 2069 1984 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2225 3403 gene locus_tag LOCUS_15050 2225 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3446 4162 gene locus_tag LOCUS_15060 gene fabG 3446 4162 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226771.1 protein_id gnl|my_center|LOCUS_15060 4343 4579 gene locus_tag LOCUS_15070 gene acpP 4343 4579 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXX4 protein_id gnl|my_center|LOCUS_15070 4579 5757 gene locus_tag LOCUS_15080 gene fabF 4579 5757 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67612 protein_id gnl|my_center|LOCUS_15080 6211 5774 gene locus_tag LOCUS_15090 gene fabZ 6211 5774 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLY7 protein_id gnl|my_center|LOCUS_15090 6641 6336 gene locus_tag LOCUS_15100 6641 6336 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382341.1 protein_id gnl|my_center|LOCUS_15100 7617 6835 gene locus_tag LOCUS_15110 gene trpA 7617 6835 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68816 protein_id gnl|my_center|LOCUS_15110 8795 7617 gene locus_tag LOCUS_15120 gene trpB 8795 7617 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIT9 protein_id gnl|my_center|LOCUS_15120 9485 8823 gene locus_tag LOCUS_15130 gene trpF 9485 8823 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56320 protein_id gnl|my_center|LOCUS_15130 10301 9495 gene locus_tag LOCUS_15140 gene trpC1 10301 9495 CDS product indole-3-glycerol phosphate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68814 protein_id gnl|my_center|LOCUS_15140 11170 10352 gene locus_tag LOCUS_15150 11170 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 12740 11217 gene locus_tag LOCUS_15160 12740 11217 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028114.1 protein_id gnl|my_center|LOCUS_15160 13116 12745 gene locus_tag LOCUS_15170 13116 12745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 13558 13199 gene locus_tag LOCUS_15180 13558 13199 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZQ4 protein_id gnl|my_center|LOCUS_15180 14387 13614 gene locus_tag LOCUS_15190 14387 13614 CDS product imidazole glycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_15190 15160 14387 gene locus_tag LOCUS_15200 gene hisA 15160 14387 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA6 protein_id gnl|my_center|LOCUS_15200 15276 15368 gene locus_tag LOCUS_t00370 15276 15368 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16394 15795 gene locus_tag LOCUS_15210 gene hisB 16394 15795 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33564 protein_id gnl|my_center|LOCUS_15210 17488 16391 gene locus_tag LOCUS_15220 gene hisC 17488 16391 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16246 protein_id gnl|my_center|LOCUS_15220 18785 17481 gene locus_tag LOCUS_15230 gene hisD 18785 17481 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WV5 protein_id gnl|my_center|LOCUS_15230 18885 19103 gene locus_tag LOCUS_15240 18885 19103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 20007 19366 gene locus_tag LOCUS_15250 gene nth 20007 19366 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NTL4 protein_id gnl|my_center|LOCUS_15250 20100 20840 gene locus_tag LOCUS_15260 20100 20840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 20852 21970 gene locus_tag LOCUS_15270 gene rlmN 20852 21970 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFY6 protein_id gnl|my_center|LOCUS_15270 21975 22313 gene locus_tag LOCUS_15280 21975 22313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 22310 23029 gene locus_tag LOCUS_15290 gene menG 22310 23029 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SH76 protein_id gnl|my_center|LOCUS_15290 <23683 23054 gene locus_tag LOCUS_15300 <23683 23054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MFJ4:1,4-dihydroxy-2-naphthoate octaprenyltransferase >Feature sequence035 <1 627 gene locus_tag LOCUS_15310 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084226.1:dehydrogenase 1080 712 gene locus_tag LOCUS_15320 1080 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1317 2330 gene locus_tag LOCUS_15330 1317 2330 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726789.1 protein_id gnl|my_center|LOCUS_15330 3548 2343 gene locus_tag LOCUS_15340 gene mct 3548 2343 CDS product 2-methylfumaryl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC36 protein_id gnl|my_center|LOCUS_15340 3830 3552 gene locus_tag LOCUS_15350 3830 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 4019 3888 gene locus_tag LOCUS_15360 4019 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15360 6732 4084 gene locus_tag LOCUS_15370 6732 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 7157 6717 gene locus_tag LOCUS_15380 7157 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 8629 7154 gene locus_tag LOCUS_15390 8629 7154 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_15390 8787 10496 gene locus_tag LOCUS_15400 8787 10496 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926642.1 protein_id gnl|my_center|LOCUS_15400 10511 11170 gene locus_tag LOCUS_15410 10511 11170 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_15410 11289 12491 gene locus_tag LOCUS_15420 11289 12491 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730434.1 protein_id gnl|my_center|LOCUS_15420 13537 12584 gene locus_tag LOCUS_15430 13537 12584 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709515.1 protein_id gnl|my_center|LOCUS_15430 14988 13552 gene locus_tag LOCUS_15440 14988 13552 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_15440 15155 15027 gene locus_tag LOCUS_15450 15155 15027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15450 15830 15234 gene locus_tag LOCUS_15460 15830 15234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15460 17176 15827 gene locus_tag LOCUS_15470 gene kmo 17176 15827 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD3 protein_id gnl|my_center|LOCUS_15470 18473 17208 gene locus_tag LOCUS_15480 gene kynU 18473 17208 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD2 protein_id gnl|my_center|LOCUS_15480 19024 18470 gene locus_tag LOCUS_15490 gene nbaC 19024 18470 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_15490 19520 19062 gene locus_tag LOCUS_15500 19520 19062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 20667 19636 gene locus_tag LOCUS_15510 gene ilvC 20667 19636 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS6 protein_id gnl|my_center|LOCUS_15510 21234 20725 gene locus_tag LOCUS_15520 gene ilvH 21234 20725 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_15520 22972 21245 gene locus_tag LOCUS_15530 gene ilvB 22972 21245 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1V7 protein_id gnl|my_center|LOCUS_15530 >Feature sequence036 1463 45 gene locus_tag LOCUS_15540 gene mtaD 1463 45 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E15 protein_id gnl|my_center|LOCUS_15540 1652 2047 gene locus_tag LOCUS_15550 1652 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 3002 2001 gene locus_tag LOCUS_15560 3002 2001 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705426.1 protein_id gnl|my_center|LOCUS_15560 4276 3002 gene locus_tag LOCUS_15570 gene guaD 4276 3002 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385587.1 protein_id gnl|my_center|LOCUS_15570 5276 4605 gene locus_tag LOCUS_15580 5276 4605 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970671.1 protein_id gnl|my_center|LOCUS_15580 7043 5286 gene locus_tag LOCUS_15590 7043 5286 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529898.1 protein_id gnl|my_center|LOCUS_15590 7407 7048 gene locus_tag LOCUS_15600 7407 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 8450 8364 gene locus_tag LOCUS_t00380 8450 8364 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10053 8530 gene locus_tag LOCUS_15610 gene glpK 10053 8530 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXW1 protein_id gnl|my_center|LOCUS_15610 10140 10568 gene locus_tag LOCUS_15620 10140 10568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 10731 10507 gene locus_tag LOCUS_15630 gene secG 10731 10507 CDS product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z469 protein_id gnl|my_center|LOCUS_15630 11573 10788 gene locus_tag LOCUS_15640 gene tpiA 11573 10788 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z520 protein_id gnl|my_center|LOCUS_15640 12742 11624 gene locus_tag LOCUS_15650 gene pgk 12742 11624 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKE4 protein_id gnl|my_center|LOCUS_15650 13803 12763 gene locus_tag LOCUS_15660 gene gap 13803 12763 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z518 protein_id gnl|my_center|LOCUS_15660 14801 13953 gene locus_tag LOCUS_15670 14801 13953 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z513 protein_id gnl|my_center|LOCUS_15670 16704 14812 gene locus_tag LOCUS_15680 gene uvrC 16704 14812 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4X3 protein_id gnl|my_center|LOCUS_15680 19641 16783 gene locus_tag LOCUS_15690 gene uvrA 19641 16783 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z507 protein_id gnl|my_center|LOCUS_15690 21789 19696 gene locus_tag LOCUS_15700 gene uvrB 21789 19696 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WFC7 protein_id gnl|my_center|LOCUS_15700 22483 21830 gene locus_tag LOCUS_15710 22483 21830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence037 2538 1660 gene locus_tag LOCUS_15720 2538 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2584 3420 gene locus_tag LOCUS_15730 2584 3420 CDS product SnoK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_15730 5136 3436 gene locus_tag LOCUS_15740 5136 3436 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_15740 5983 5147 gene locus_tag LOCUS_15750 5983 5147 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411201.1 protein_id gnl|my_center|LOCUS_15750 6116 6445 gene locus_tag LOCUS_15760 6116 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 7387 6485 gene locus_tag LOCUS_15770 7387 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 8099 7422 gene locus_tag LOCUS_15780 8099 7422 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896555.1 protein_id gnl|my_center|LOCUS_15780 9372 8146 gene locus_tag LOCUS_15790 9372 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 10195 9365 gene locus_tag LOCUS_15800 10195 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701168.1 protein_id gnl|my_center|LOCUS_15800 11777 10362 gene locus_tag LOCUS_15810 11777 10362 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532892.1 protein_id gnl|my_center|LOCUS_15810 13181 11802 gene locus_tag LOCUS_15820 gene pntB 13181 11802 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F962 protein_id gnl|my_center|LOCUS_15820 13468 13178 gene locus_tag LOCUS_15830 13468 13178 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_15830 14592 13465 gene locus_tag LOCUS_15840 14592 13465 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194415.1 protein_id gnl|my_center|LOCUS_15840 16489 14657 gene locus_tag LOCUS_15850 16489 14657 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_15850 16483 16734 gene locus_tag LOCUS_15860 16483 16734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 18552 16744 gene locus_tag LOCUS_15870 18552 16744 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_15870 18697 19134 gene locus_tag LOCUS_15880 18697 19134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15880 19153 19833 gene locus_tag LOCUS_15890 19153 19833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence038 68 1975 gene locus_tag LOCUS_15900 68 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 2005 2199 gene locus_tag LOCUS_15910 2005 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2629 2219 gene locus_tag LOCUS_15920 2629 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229515.1 protein_id gnl|my_center|LOCUS_15920 3609 2626 gene locus_tag LOCUS_15930 3609 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 4592 3609 gene locus_tag LOCUS_15940 4592 3609 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_15940 5001 4597 gene locus_tag LOCUS_15950 5001 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 5123 5950 gene locus_tag LOCUS_15960 gene punA 5123 5950 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QT39 protein_id gnl|my_center|LOCUS_15960 5947 7617 gene locus_tag LOCUS_15970 5947 7617 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029947.1 protein_id gnl|my_center|LOCUS_15970 7614 8519 gene locus_tag LOCUS_15980 7614 8519 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_15980 8554 10023 gene locus_tag LOCUS_15990 8554 10023 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_15990 10020 10865 gene locus_tag LOCUS_16000 10020 10865 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_16000 12167 10893 gene locus_tag LOCUS_16010 gene deoA 12167 10893 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222773.1 protein_id gnl|my_center|LOCUS_16010 12596 12195 gene locus_tag LOCUS_16020 gene cdd 12596 12195 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417264.1 protein_id gnl|my_center|LOCUS_16020 12740 13648 gene locus_tag LOCUS_16030 12740 13648 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897193.1 protein_id gnl|my_center|LOCUS_16030 14161 13733 gene locus_tag LOCUS_16040 14161 13733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 14243 15163 gene locus_tag LOCUS_16050 14243 15163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702863.1 protein_id gnl|my_center|LOCUS_16050 15887 15198 gene locus_tag LOCUS_16060 15887 15198 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935569.1 protein_id gnl|my_center|LOCUS_16060 18244 15926 gene locus_tag LOCUS_16070 gene glnD 18244 15926 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QV29 protein_id gnl|my_center|LOCUS_16070 19534 18296 gene locus_tag LOCUS_16080 gene amtB 19534 18296 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0Q9 protein_id gnl|my_center|LOCUS_16080 19984 19679 gene locus_tag LOCUS_16090 19984 19679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 20796 19981 gene locus_tag LOCUS_16100 20796 19981 CDS product TIGR00268 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_16100 21493 20804 gene locus_tag LOCUS_16110 21493 20804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence039 1623 859 gene locus_tag LOCUS_16120 1623 859 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103550.1 protein_id gnl|my_center|LOCUS_16120 2828 1659 gene locus_tag LOCUS_16130 2828 1659 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_16130 4620 2881 gene locus_tag LOCUS_16140 4620 2881 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_16140 4956 5423 gene locus_tag LOCUS_16150 4956 5423 CDS product putative enoyl-CoA hydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNP3 protein_id gnl|my_center|LOCUS_16150 6243 5449 gene locus_tag LOCUS_16160 gene bdhA 6243 5449 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084310.1 protein_id gnl|my_center|LOCUS_16160 6302 7237 gene locus_tag LOCUS_16170 6302 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 7234 7902 gene locus_tag LOCUS_16180 7234 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 9156 7915 gene locus_tag LOCUS_16190 9156 7915 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_16190 9563 11194 gene locus_tag LOCUS_16200 9563 11194 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16200 11260 12450 gene locus_tag LOCUS_16210 gene atoB 11260 12450 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_16210 12447 13955 gene locus_tag LOCUS_16220 12447 13955 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272219.1 protein_id gnl|my_center|LOCUS_16220 13982 15058 gene locus_tag LOCUS_16230 13982 15058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 16143 15139 gene locus_tag LOCUS_16240 16143 15139 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_16240 17237 16143 gene locus_tag LOCUS_16250 17237 16143 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_16250 18144 17239 gene locus_tag LOCUS_16260 18144 17239 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083811.1 protein_id gnl|my_center|LOCUS_16260 19144 18137 gene locus_tag LOCUS_16270 19144 18137 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388735.1 protein_id gnl|my_center|LOCUS_16270 <21920 19241 gene locus_tag LOCUS_16280 <21920 19241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393451.1:BMP family ABC transporter substrate-binding protein >Feature sequence040 3336 4010 gene locus_tag LOCUS_16290 3336 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 4059 4988 gene locus_tag LOCUS_16300 4059 4988 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259448.1 protein_id gnl|my_center|LOCUS_16300 4985 5893 gene locus_tag LOCUS_16310 4985 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 5890 6303 gene locus_tag LOCUS_16320 5890 6303 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_16320 6303 6668 gene locus_tag LOCUS_16330 6303 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923332.1 protein_id gnl|my_center|LOCUS_16330 8425 6665 gene locus_tag LOCUS_16340 8425 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 8482 8949 gene locus_tag LOCUS_16350 8482 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 9885 8953 gene locus_tag LOCUS_16360 9885 8953 CDS product ribosylpyrimidine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869316.1 protein_id gnl|my_center|LOCUS_16360 10788 9904 gene locus_tag LOCUS_16370 gene rbsK 10788 9904 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DK00 protein_id gnl|my_center|LOCUS_16370 11342 10785 gene locus_tag LOCUS_16380 11342 10785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 12308 11361 gene locus_tag LOCUS_16390 12308 11361 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228899.1 protein_id gnl|my_center|LOCUS_16390 13292 12357 gene locus_tag LOCUS_16400 13292 12357 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246890.1 protein_id gnl|my_center|LOCUS_16400 14098 13289 gene locus_tag LOCUS_16410 gene tesB 14098 13289 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225695.1 protein_id gnl|my_center|LOCUS_16410 14212 15399 gene locus_tag LOCUS_16420 14212 15399 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_16420 15912 15403 gene locus_tag LOCUS_16430 15912 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 15952 16971 gene locus_tag LOCUS_16440 15952 16971 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_16440 18260 16992 gene locus_tag LOCUS_16450 gene gltA 18260 16992 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBF3 protein_id gnl|my_center|LOCUS_16450 19799 18438 gene locus_tag LOCUS_16460 19799 18438 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972641.1 protein_id gnl|my_center|LOCUS_16460 20818 19796 gene locus_tag LOCUS_16470 gene cynR 20818 19796 CDS product HTH-type transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27111 protein_id gnl|my_center|LOCUS_16470 >Feature sequence041 1223 1672 gene locus_tag LOCUS_16480 1223 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1669 2196 gene locus_tag LOCUS_16490 1669 2196 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225670.1 protein_id gnl|my_center|LOCUS_16490 2193 4001 gene locus_tag LOCUS_16500 gene aceK 2193 4001 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3W8 protein_id gnl|my_center|LOCUS_16500 4044 4718 gene locus_tag LOCUS_16510 4044 4718 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9K4 protein_id gnl|my_center|LOCUS_16510 4762 5364 gene locus_tag LOCUS_16520 gene clpP2 4762 5364 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NN01 protein_id gnl|my_center|LOCUS_16520 5415 5497 gene locus_tag LOCUS_t00390 5415 5497 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5498 7969 gene locus_tag LOCUS_16530 5498 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 8562 7966 gene locus_tag LOCUS_16540 gene rdgB 8562 7966 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3D3 protein_id gnl|my_center|LOCUS_16540 9328 8609 gene locus_tag LOCUS_16550 gene rph 9328 8609 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVD6 protein_id gnl|my_center|LOCUS_16550 10352 9393 gene locus_tag LOCUS_16560 gene cysK 10352 9393 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_16560 10848 10393 gene locus_tag LOCUS_16570 10848 10393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 10905 11420 gene locus_tag LOCUS_16580 gene smpB 10905 11420 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM0 protein_id gnl|my_center|LOCUS_16580 11533 11920 gene locus_tag LOCUS_tm00010 11533 11920 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13240 12212 gene locus_tag LOCUS_16590 13240 12212 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87GM3 protein_id gnl|my_center|LOCUS_16590 13384 13899 gene locus_tag LOCUS_16600 13384 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 13976 14173 gene locus_tag LOCUS_16610 13976 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 15401 14577 gene locus_tag LOCUS_16620 15401 14577 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728098.1 protein_id gnl|my_center|LOCUS_16620 15841 16713 gene locus_tag LOCUS_16630 15841 16713 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968071.1 protein_id gnl|my_center|LOCUS_16630 16717 17199 gene locus_tag LOCUS_16640 16717 17199 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_16640 17196 19415 gene locus_tag LOCUS_16650 17196 19415 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 protein_id gnl|my_center|LOCUS_16650 19448 19693 gene locus_tag LOCUS_16660 19448 19693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 20898 19708 gene locus_tag LOCUS_16670 20898 19708 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889381.1 protein_id gnl|my_center|LOCUS_16670 21498 21184 gene locus_tag LOCUS_16680 21498 21184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence042 195 713 gene locus_tag LOCUS_16690 195 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 740 3004 gene locus_tag LOCUS_16700 740 3004 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_16700 3001 4221 gene locus_tag LOCUS_16710 3001 4221 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_16710 4234 6189 gene locus_tag LOCUS_16720 4234 6189 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028452.1 protein_id gnl|my_center|LOCUS_16720 6186 7094 gene locus_tag LOCUS_16730 6186 7094 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_16730 7113 8825 gene locus_tag LOCUS_16740 7113 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 8906 9229 gene locus_tag LOCUS_16750 gene rplU 8906 9229 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NN50 protein_id gnl|my_center|LOCUS_16750 9267 9518 gene locus_tag LOCUS_16760 gene rpmA 9267 9518 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCJ5 protein_id gnl|my_center|LOCUS_16760 10661 9570 gene locus_tag LOCUS_16770 10661 9570 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKT7 protein_id gnl|my_center|LOCUS_16770 10786 12030 gene locus_tag LOCUS_16780 10786 12030 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_16780 12027 13139 gene locus_tag LOCUS_16790 gene proB 12027 13139 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMY6 protein_id gnl|my_center|LOCUS_16790 14785 13157 gene locus_tag LOCUS_16800 gene mviN 14785 13157 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403272.1 protein_id gnl|my_center|LOCUS_16800 14890 16143 gene locus_tag LOCUS_16810 gene proA 14890 16143 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ6 protein_id gnl|my_center|LOCUS_16810 16233 17141 gene locus_tag LOCUS_16820 16233 17141 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224865.1 protein_id gnl|my_center|LOCUS_16820 17185 18663 gene locus_tag LOCUS_16830 17185 18663 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729941.1 protein_id gnl|my_center|LOCUS_16830 20065 18680 gene locus_tag LOCUS_16840 20065 18680 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK8 protein_id gnl|my_center|LOCUS_16840 20992 20159 gene locus_tag LOCUS_16850 gene hrdD 20992 20159 CDS product RNA polymerase principal sigma factor HrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18249 protein_id gnl|my_center|LOCUS_16850 >Feature sequence043 3379 644 gene locus_tag LOCUS_16860 gene ppc 3379 644 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RNU9 protein_id gnl|my_center|LOCUS_16860 3537 4475 gene locus_tag LOCUS_16870 3537 4475 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709137.1 protein_id gnl|my_center|LOCUS_16870 4541 5716 gene locus_tag LOCUS_16880 gene sucC 4541 5716 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MH95 protein_id gnl|my_center|LOCUS_16880 5713 6603 gene locus_tag LOCUS_16890 5713 6603 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MH96 protein_id gnl|my_center|LOCUS_16890 6694 7008 gene locus_tag LOCUS_16900 6694 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16900 7027 7821 gene locus_tag LOCUS_16910 7027 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16910 7844 8401 gene locus_tag LOCUS_16920 7844 8401 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_16920 8392 9042 gene locus_tag LOCUS_16930 8392 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 9058 9540 gene locus_tag LOCUS_16940 9058 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389758.1 protein_id gnl|my_center|LOCUS_16940 9533 10444 gene locus_tag LOCUS_16950 gene ppx 9533 10444 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229925.1 protein_id gnl|my_center|LOCUS_16950 10512 11606 gene locus_tag LOCUS_16960 10512 11606 CDS product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 protein_id gnl|my_center|LOCUS_16960 11750 12364 gene locus_tag LOCUS_16970 gene rimJ 11750 12364 CDS product ribosomal-protein-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084002.1 protein_id gnl|my_center|LOCUS_16970 13140 12400 gene locus_tag LOCUS_16980 gene paaG 13140 12400 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222473.1 protein_id gnl|my_center|LOCUS_16980 13270 14550 gene locus_tag LOCUS_16990 13270 14550 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_16990 15581 14625 gene locus_tag LOCUS_17000 15581 14625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 15620 15982 gene locus_tag LOCUS_17010 15620 15982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 16062 16149 gene locus_tag LOCUS_t00400 16062 16149 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16123 16914 gene locus_tag LOCUS_17020 16123 16914 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_17020 16955 19609 gene locus_tag LOCUS_17030 16955 19609 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_17030 19631 20839 gene locus_tag LOCUS_17040 19631 20839 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028803.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence044 293 1378 gene locus_tag LOCUS_17050 293 1378 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228819.1 protein_id gnl|my_center|LOCUS_17050 1392 2780 gene locus_tag LOCUS_17060 1392 2780 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706368.1 protein_id gnl|my_center|LOCUS_17060 4347 2806 gene locus_tag LOCUS_17070 4347 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 4536 5627 gene locus_tag LOCUS_17080 4536 5627 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_17080 5608 7227 gene locus_tag LOCUS_17090 5608 7227 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141015.1 protein_id gnl|my_center|LOCUS_17090 7231 8670 gene locus_tag LOCUS_17100 7231 8670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 9273 8578 gene locus_tag LOCUS_17110 9273 8578 CDS product iron-dependent repressor IdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703761.1 protein_id gnl|my_center|LOCUS_17110 10247 9273 gene locus_tag LOCUS_17120 gene ytcB 10247 9273 CDS product putative UDP-glucose epimerase YtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34886 protein_id gnl|my_center|LOCUS_17120 10368 11840 gene locus_tag LOCUS_17130 10368 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704555.1 protein_id gnl|my_center|LOCUS_17130 11866 13002 gene locus_tag LOCUS_17140 11866 13002 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06179 protein_id gnl|my_center|LOCUS_17140 13891 13061 gene locus_tag LOCUS_17150 gene rnz 13891 13061 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TYN1 protein_id gnl|my_center|LOCUS_17150 14696 13920 gene locus_tag LOCUS_17160 14696 13920 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_17160 16292 14733 gene locus_tag LOCUS_17170 16292 14733 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_17170 16461 17495 gene locus_tag LOCUS_17180 16461 17495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 17805 17503 gene locus_tag LOCUS_17190 17805 17503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 17915 18529 gene locus_tag LOCUS_17200 gene tag 17915 18529 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968813.1 protein_id gnl|my_center|LOCUS_17200 18540 21077 gene locus_tag LOCUS_17210 18540 21077 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence045 1770 967 gene locus_tag LOCUS_17220 1770 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816329.1 protein_id gnl|my_center|LOCUS_17220 1944 2708 gene locus_tag LOCUS_17230 1944 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3777 2728 gene locus_tag LOCUS_17240 gene pfkA1 3777 2728 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O08333 protein_id gnl|my_center|LOCUS_17240 4136 4210 gene locus_tag LOCUS_t00410 4136 4210 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4211 5101 gene locus_tag LOCUS_17250 4211 5101 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726959.1 protein_id gnl|my_center|LOCUS_17250 5196 6395 gene locus_tag LOCUS_17260 gene mshC 5196 6395 CDS product L-cysteine:1D-myo-inositol 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADA4 protein_id gnl|my_center|LOCUS_17260 6455 7825 gene locus_tag LOCUS_17270 gene cysS 6455 7825 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YQ2 protein_id gnl|my_center|LOCUS_17270 9092 7881 gene locus_tag LOCUS_17280 9092 7881 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_17280 10755 9169 gene locus_tag LOCUS_17290 10755 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 11278 10808 gene locus_tag LOCUS_17300 11278 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 11432 12121 gene locus_tag LOCUS_17310 11432 12121 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_17310 13128 12118 gene locus_tag LOCUS_17320 13128 12118 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259505.1 protein_id gnl|my_center|LOCUS_17320 13230 14696 gene locus_tag LOCUS_17330 13230 14696 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026997.1 protein_id gnl|my_center|LOCUS_17330 15544 14687 gene locus_tag LOCUS_17340 gene paaH 15544 14687 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230733.1 protein_id gnl|my_center|LOCUS_17340 16083 15571 gene locus_tag LOCUS_17350 16083 15571 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5A8 protein_id gnl|my_center|LOCUS_17350 16992 16483 gene locus_tag LOCUS_17360 16992 16483 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531271.1 protein_id gnl|my_center|LOCUS_17360 17075 17845 gene locus_tag LOCUS_17370 17075 17845 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027531.1 protein_id gnl|my_center|LOCUS_17370 17871 20573 gene locus_tag LOCUS_17380 17871 20573 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_17380 20817 20596 gene locus_tag LOCUS_17390 20817 20596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence046 2 232 gene locus_tag LOCUS_17400 2 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2741 222 gene locus_tag LOCUS_17410 2741 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 3429 2836 gene locus_tag LOCUS_17420 gene leuD 3429 2836 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86535 protein_id gnl|my_center|LOCUS_17420 4879 3446 gene locus_tag LOCUS_17430 gene leuC 4879 3446 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86534 protein_id gnl|my_center|LOCUS_17430 6668 5334 gene locus_tag LOCUS_17440 6668 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229091.1 protein_id gnl|my_center|LOCUS_17440 9411 6637 gene locus_tag LOCUS_17450 9411 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 9916 9464 gene locus_tag LOCUS_17460 9916 9464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 10187 9945 gene locus_tag LOCUS_17470 10187 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 10574 10248 gene locus_tag LOCUS_17480 10574 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 10735 12129 gene locus_tag LOCUS_17490 gene pdhD 10735 12129 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZA2 protein_id gnl|my_center|LOCUS_17490 12134 13351 gene locus_tag LOCUS_17500 12134 13351 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AQE7 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17500 13348 14967 gene locus_tag LOCUS_17510 13348 14967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 15001 16104 gene locus_tag LOCUS_17520 15001 16104 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_17520 16122 16973 gene locus_tag LOCUS_17530 16122 16973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence047 1001 69 gene locus_tag LOCUS_17540 1001 69 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564218.1 protein_id gnl|my_center|LOCUS_17540 2083 998 gene locus_tag LOCUS_17550 2083 998 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_17550 3615 2080 gene locus_tag LOCUS_17560 3615 2080 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_17560 3866 3621 gene locus_tag LOCUS_17570 3866 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 5189 3900 gene locus_tag LOCUS_17580 5189 3900 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727577.1 protein_id gnl|my_center|LOCUS_17580 6225 5224 gene locus_tag LOCUS_17590 6225 5224 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_17590 7295 6261 gene locus_tag LOCUS_17600 7295 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 9874 7292 gene locus_tag LOCUS_17610 9874 7292 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869184.1 protein_id gnl|my_center|LOCUS_17610 10845 9871 gene locus_tag LOCUS_17620 10845 9871 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085362.1 protein_id gnl|my_center|LOCUS_17620 12116 10842 gene locus_tag LOCUS_17630 12116 10842 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_17630 14389 12113 gene locus_tag LOCUS_17640 14389 12113 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223814.1 protein_id gnl|my_center|LOCUS_17640 14868 14386 gene locus_tag LOCUS_17650 14868 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17650 15728 14865 gene locus_tag LOCUS_17660 15728 14865 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030706.1 protein_id gnl|my_center|LOCUS_17660 15785 16144 gene locus_tag LOCUS_17670 15785 16144 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972719.1 protein_id gnl|my_center|LOCUS_17670 16169 17629 gene locus_tag LOCUS_17680 gene gatA 16169 17629 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136108.1 protein_id gnl|my_center|LOCUS_17680 18163 17642 gene locus_tag LOCUS_17690 18163 17642 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230535.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence048 <1 817 gene locus_tag LOCUS_17700 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727207.1:oxidoreductase 883 1491 gene locus_tag LOCUS_17710 883 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1732 1505 gene locus_tag LOCUS_17720 1732 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1796 2533 gene locus_tag LOCUS_17730 1796 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 3502 2540 gene locus_tag LOCUS_17740 3502 2540 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_17740 3643 4023 gene locus_tag LOCUS_17750 3643 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 4031 4537 gene locus_tag LOCUS_17760 4031 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 4592 5422 gene locus_tag LOCUS_17770 4592 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 5869 5474 gene locus_tag LOCUS_17780 5869 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 6807 5869 gene locus_tag LOCUS_17790 gene mca 6807 5869 CDS product mycothiol S-conjugate amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DI54 protein_id gnl|my_center|LOCUS_17790 6986 7441 gene locus_tag LOCUS_17800 6986 7441 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888773.1 protein_id gnl|my_center|LOCUS_17800 7486 8484 gene locus_tag LOCUS_17810 7486 8484 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_17810 9730 8492 gene locus_tag LOCUS_17820 9730 8492 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_17820 11030 9801 gene locus_tag LOCUS_17830 11030 9801 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_17830 14420 11133 gene locus_tag LOCUS_17840 gene dnaE2 14420 11133 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TWL9 protein_id gnl|my_center|LOCUS_17840 15504 14491 gene locus_tag LOCUS_17850 15504 14491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 15200 15298 gene locus_tag LOCUS_t00420 15200 15298 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 15593 17113 gene locus_tag LOCUS_17860 15593 17113 CDS product pyridoxal-5'-phosphate-dependent protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence049 1171 236 gene locus_tag LOCUS_17870 gene murB 1171 236 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18579 protein_id gnl|my_center|LOCUS_17870 2498 1164 gene locus_tag LOCUS_17880 gene murC 2498 1164 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61678 protein_id gnl|my_center|LOCUS_17880 3654 2548 gene locus_tag LOCUS_17890 gene murG 3654 2548 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBG5 protein_id gnl|my_center|LOCUS_17890 4841 3651 gene locus_tag LOCUS_17900 4841 3651 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_17900 6142 4838 gene locus_tag LOCUS_17910 gene murD 6142 4838 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2W9 protein_id gnl|my_center|LOCUS_17910 7203 6160 gene locus_tag LOCUS_17920 gene mraY 7203 6160 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56833 protein_id gnl|my_center|LOCUS_17920 8701 7253 gene locus_tag LOCUS_17930 8701 7253 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272490.1 protein_id gnl|my_center|LOCUS_17930 10593 8704 gene locus_tag LOCUS_17940 gene ftsI 10593 8704 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035957.1 protein_id gnl|my_center|LOCUS_17940 10997 10590 gene locus_tag LOCUS_17950 10997 10590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 11986 10994 gene locus_tag LOCUS_17960 gene rsmH 11986 10994 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK87 protein_id gnl|my_center|LOCUS_17960 12635 12210 gene locus_tag LOCUS_17970 gene mraZ 12635 12210 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG81 protein_id gnl|my_center|LOCUS_17970 13488 12817 gene locus_tag LOCUS_17980 13488 12817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 13994 13485 gene locus_tag LOCUS_17990 13994 13485 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_17990 14315 14004 gene locus_tag LOCUS_18000 14315 14004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 15238 14312 gene locus_tag LOCUS_18010 15238 14312 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727626.1 protein_id gnl|my_center|LOCUS_18010 15727 15263 gene locus_tag LOCUS_18020 15727 15263 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_18020 17029 15752 gene locus_tag LOCUS_18030 gene dinB 17029 15752 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAG1 protein_id gnl|my_center|LOCUS_18030 17508 17026 gene locus_tag LOCUS_18040 17508 17026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence050 617 177 gene locus_tag LOCUS_18050 617 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 685 987 gene locus_tag LOCUS_18060 685 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2444 1005 gene locus_tag LOCUS_18070 gene pykA 2444 1005 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3S2 protein_id gnl|my_center|LOCUS_18070 3055 2489 gene locus_tag LOCUS_18080 3055 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 3123 3896 gene locus_tag LOCUS_18090 3123 3896 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_18090 3928 4344 gene locus_tag LOCUS_18100 3928 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 6285 5167 gene locus_tag LOCUS_18110 6285 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 7748 6282 gene locus_tag LOCUS_18120 7748 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 7553 7466 gene locus_tag LOCUS_t00430 7553 7466 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7942 9423 gene locus_tag LOCUS_18130 7942 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_18130 9442 10821 gene locus_tag LOCUS_18140 9442 10821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 10850 11734 gene locus_tag LOCUS_18150 10850 11734 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_18150 11734 13104 gene locus_tag LOCUS_18160 11734 13104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 13865 13071 gene locus_tag LOCUS_18170 13865 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 13944 14276 gene locus_tag LOCUS_18180 13944 14276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 14273 15190 gene locus_tag LOCUS_18190 14273 15190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 15271 15978 gene locus_tag LOCUS_18200 15271 15978 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230619.1 protein_id gnl|my_center|LOCUS_18200 15975 16325 gene locus_tag LOCUS_18210 15975 16325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 17007 16336 gene locus_tag LOCUS_18220 17007 16336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence051 546 46 gene locus_tag LOCUS_18230 546 46 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_18230 1393 698 gene locus_tag LOCUS_18240 1393 698 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDD9 protein_id gnl|my_center|LOCUS_18240 2516 1407 gene locus_tag LOCUS_18250 gene dnaJ 2516 1407 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX3 protein_id gnl|my_center|LOCUS_18250 3525 2527 gene locus_tag LOCUS_18260 gene hrcA 3525 2527 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBK2 protein_id gnl|my_center|LOCUS_18260 5408 3624 gene locus_tag LOCUS_18270 gene lepA 5408 3624 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R0Y9 protein_id gnl|my_center|LOCUS_18270 5612 5872 gene locus_tag LOCUS_18280 gene rpsT 5612 5872 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDA3 protein_id gnl|my_center|LOCUS_18280 6932 5913 gene locus_tag LOCUS_18290 6932 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 7804 6929 gene locus_tag LOCUS_18300 7804 6929 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MH13 protein_id gnl|my_center|LOCUS_18300 8022 7816 gene locus_tag LOCUS_18310 8022 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 8820 8119 gene locus_tag LOCUS_18320 8820 8119 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067252.1 protein_id gnl|my_center|LOCUS_18320 8910 9938 gene locus_tag LOCUS_18330 8910 9938 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_18330 9949 10803 gene locus_tag LOCUS_18340 9949 10803 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729625.1 protein_id gnl|my_center|LOCUS_18340 13307 10833 gene locus_tag LOCUS_18350 gene leuS 13307 10833 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKZ1 protein_id gnl|my_center|LOCUS_18350 13395 13469 gene locus_tag LOCUS_t00440 13395 13469 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence052 <1 860 gene locus_tag LOCUS_18360 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q93JL5:phosphoenolpyruvate carboxykinase [GTP] 1244 891 gene locus_tag LOCUS_18370 1244 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 2099 1284 gene locus_tag LOCUS_18380 2099 1284 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_18380 3264 2122 gene locus_tag LOCUS_18390 3264 2122 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_18390 4169 3324 gene locus_tag LOCUS_18400 4169 3324 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_18400 4147 4677 gene locus_tag LOCUS_18410 gene elaA 4147 4677 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223944.1 protein_id gnl|my_center|LOCUS_18410 5031 4681 gene locus_tag LOCUS_18420 5031 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731270.1 protein_id gnl|my_center|LOCUS_18420 5197 7494 gene locus_tag LOCUS_18430 gene uvrD2 5197 7494 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64321 protein_id gnl|my_center|LOCUS_18430 7884 7498 gene locus_tag LOCUS_18440 7884 7498 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230197.1 protein_id gnl|my_center|LOCUS_18440 8671 7889 gene locus_tag LOCUS_18450 8671 7889 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_18450 9314 8691 gene locus_tag LOCUS_18460 9314 8691 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083783.1 protein_id gnl|my_center|LOCUS_18460 9415 11115 gene locus_tag LOCUS_18470 9415 11115 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_18470 11727 11119 gene locus_tag LOCUS_18480 11727 11119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18480 12992 11736 gene locus_tag LOCUS_18490 12992 11736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18490 13903 12992 gene locus_tag LOCUS_18500 gene cysD 13903 12992 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1W4 protein_id gnl|my_center|LOCUS_18500 13978 14739 gene locus_tag LOCUS_18510 13978 14739 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_18510 14771 15442 gene locus_tag LOCUS_18520 gene nucS 14771 15442 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4C3 protein_id gnl|my_center|LOCUS_18520 >Feature sequence053 1673 507 gene locus_tag LOCUS_18530 gene rhmD 1673 507 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EJ73 protein_id gnl|my_center|LOCUS_18530 2532 2116 gene locus_tag LOCUS_18540 2532 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 3234 2542 gene locus_tag LOCUS_18550 3234 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 3308 4627 gene locus_tag LOCUS_18560 gene glyS 3308 4627 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EBP4 protein_id gnl|my_center|LOCUS_18560 4697 6496 gene locus_tag LOCUS_18570 4697 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 6489 7739 gene locus_tag LOCUS_18580 gene rpoD 6489 7739 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DYP8 protein_id gnl|my_center|LOCUS_18580 7819 7894 gene locus_tag LOCUS_t00450 7819 7894 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 8190 7984 gene locus_tag LOCUS_18590 8190 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 9001 8282 gene locus_tag LOCUS_18600 gene recO 9001 8282 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCB6 protein_id gnl|my_center|LOCUS_18600 9752 9030 gene locus_tag LOCUS_18610 9752 9030 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MN49 protein_id gnl|my_center|LOCUS_18610 9831 11732 gene locus_tag LOCUS_18620 9831 11732 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 protein_id gnl|my_center|LOCUS_18620 12580 11741 gene locus_tag LOCUS_18630 gene era 12580 11741 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MD86 protein_id gnl|my_center|LOCUS_18630 13899 12610 gene locus_tag LOCUS_18640 13899 12610 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_18640 14384 13896 gene locus_tag LOCUS_18650 14384 13896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 15409 14390 gene locus_tag LOCUS_18660 15409 14390 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence054 294 2264 gene locus_tag LOCUS_18670 294 2264 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_18670 3496 2300 gene locus_tag LOCUS_18680 3496 2300 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811506.1 protein_id gnl|my_center|LOCUS_18680 3975 3568 gene locus_tag LOCUS_18690 3975 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 4724 4035 gene locus_tag LOCUS_18700 4724 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 5409 4741 gene locus_tag LOCUS_18710 5409 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 9086 5550 gene locus_tag LOCUS_18720 gene dnaE1 9086 5550 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNT7 protein_id gnl|my_center|LOCUS_18720 9618 9112 gene locus_tag LOCUS_18730 9618 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700958.1 protein_id gnl|my_center|LOCUS_18730 10803 9688 gene locus_tag LOCUS_18740 10803 9688 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_18740 10919 11359 gene locus_tag LOCUS_18750 gene iscR-2 10919 11359 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943207.1 protein_id gnl|my_center|LOCUS_18750 12299 11379 gene locus_tag LOCUS_18760 12299 11379 CDS product putative RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45826 protein_id gnl|my_center|LOCUS_18760 12793 12317 gene locus_tag LOCUS_18770 12793 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 <13329 12790 gene locus_tag LOCUS_18780 <13329 12790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125527.1:molecular chaperone DnaK >Feature sequence055 1110 589 gene locus_tag LOCUS_18790 1110 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 1769 1107 gene locus_tag LOCUS_18800 1769 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 2831 1809 gene locus_tag LOCUS_18810 2831 1809 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225246.1 protein_id gnl|my_center|LOCUS_18810 4009 2843 gene locus_tag LOCUS_18820 4009 2843 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_18820 5091 4015 gene locus_tag LOCUS_18830 5091 4015 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225238.1 protein_id gnl|my_center|LOCUS_18830 5875 5102 gene locus_tag LOCUS_18840 5875 5102 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_18840 6750 5872 gene locus_tag LOCUS_18850 6750 5872 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_18850 6960 7733 gene locus_tag LOCUS_18860 6960 7733 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701359.1 protein_id gnl|my_center|LOCUS_18860 7742 8254 gene locus_tag LOCUS_18870 7742 8254 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570773.1 protein_id gnl|my_center|LOCUS_18870 8535 8251 gene locus_tag LOCUS_18880 8535 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 8657 9352 gene locus_tag LOCUS_18890 gene cysH 8657 9352 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADG3 protein_id gnl|my_center|LOCUS_18890 9349 10026 gene locus_tag LOCUS_18900 9349 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 10023 10796 gene locus_tag LOCUS_18910 10023 10796 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903739.1 protein_id gnl|my_center|LOCUS_18910 10784 12574 gene locus_tag LOCUS_18920 10784 12574 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence056 1603 557 gene locus_tag LOCUS_18930 1603 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1720 3333 gene locus_tag LOCUS_18940 1720 3333 CDS product D-glutamate deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384301.1 protein_id gnl|my_center|LOCUS_18940 3406 4674 gene locus_tag LOCUS_18950 gene pgsA 3406 4674 CDS product poly-gamma-glutamate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223416.1 protein_id gnl|my_center|LOCUS_18950 4805 5896 gene locus_tag LOCUS_18960 gene serC 4805 5896 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHV7 protein_id gnl|my_center|LOCUS_18960 7688 5925 gene locus_tag LOCUS_18970 7688 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 7770 9806 gene locus_tag LOCUS_18980 7770 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 9803 12775 gene locus_tag LOCUS_18990 9803 12775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence057 4270 2750 gene locus_tag LOCUS_19000 4270 2750 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_19000 4882 4313 gene locus_tag LOCUS_19010 4882 4313 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110452.1 protein_id gnl|my_center|LOCUS_19010 5742 4945 gene locus_tag LOCUS_19020 5742 4945 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188283.1 protein_id gnl|my_center|LOCUS_19020 6636 5755 gene locus_tag LOCUS_19030 6636 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 6773 6645 gene locus_tag LOCUS_19040 6773 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 8188 6818 gene locus_tag LOCUS_19050 gene argD 8188 6818 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226084.1 protein_id gnl|my_center|LOCUS_19050 8389 10836 gene locus_tag LOCUS_19060 8389 10836 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531133.1 protein_id gnl|my_center|LOCUS_19060 11652 10846 gene locus_tag LOCUS_19070 11652 10846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_19070 12434 11640 gene locus_tag LOCUS_19080 12434 11640 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence058 4073 5167 gene locus_tag LOCUS_19090 gene fabH 4073 5167 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH32 protein_id gnl|my_center|LOCUS_19090 6293 5190 gene locus_tag LOCUS_19100 6293 5190 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708578.1 protein_id gnl|my_center|LOCUS_19100 7405 6296 gene locus_tag LOCUS_19110 7405 6296 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533459.1 protein_id gnl|my_center|LOCUS_19110 7682 7437 gene locus_tag LOCUS_19120 7682 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 7596 8117 gene locus_tag LOCUS_19130 7596 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 9096 8140 gene locus_tag LOCUS_19140 9096 8140 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530045.1 protein_id gnl|my_center|LOCUS_19140 9162 9320 gene locus_tag LOCUS_19150 9162 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 9363 10655 gene locus_tag LOCUS_19160 gene cysD 9363 10655 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_19160 10712 11473 gene locus_tag LOCUS_19170 10712 11473 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_19170 <12512 11493 gene locus_tag LOCUS_19180 <12512 11493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001703853.1:putative acyl-CoA dehydrogenase >Feature sequence059 772 32 gene locus_tag LOCUS_19190 772 32 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974911.1 protein_id gnl|my_center|LOCUS_19190 883 1941 gene locus_tag LOCUS_19200 gene mtnA 883 1941 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGQ8 protein_id gnl|my_center|LOCUS_19200 3519 1957 gene locus_tag LOCUS_19210 3519 1957 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256433.1 protein_id gnl|my_center|LOCUS_19210 4526 3525 gene locus_tag LOCUS_19220 4526 3525 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259763.1 protein_id gnl|my_center|LOCUS_19220 5572 4523 gene locus_tag LOCUS_19230 5572 4523 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256434.1 protein_id gnl|my_center|LOCUS_19230 6097 5732 gene locus_tag LOCUS_19240 6097 5732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 6372 7445 gene locus_tag LOCUS_19250 gene ychF 6372 7445 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ8 protein_id gnl|my_center|LOCUS_19250 7501 7830 gene locus_tag LOCUS_19260 7501 7830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 7827 8651 gene locus_tag LOCUS_19270 gene rsmI 7827 8651 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKD4 protein_id gnl|my_center|LOCUS_19270 8714 10378 gene locus_tag LOCUS_19280 gene metG 8714 10378 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKM1 protein_id gnl|my_center|LOCUS_19280 10375 11154 gene locus_tag LOCUS_19290 gene tatD 10375 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229979.1 protein_id gnl|my_center|LOCUS_19290 11300 12100 gene locus_tag LOCUS_19300 11300 12100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence060 498 1361 gene locus_tag LOCUS_19310 498 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2644 1397 gene locus_tag LOCUS_19320 2644 1397 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_19320 2973 2716 gene locus_tag LOCUS_19330 2973 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2915 4048 gene locus_tag LOCUS_19340 2915 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 4108 4626 gene locus_tag LOCUS_19350 4108 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015609.1 protein_id gnl|my_center|LOCUS_19350 4788 5768 gene locus_tag LOCUS_19360 gene prs 4788 5768 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3U0 protein_id gnl|my_center|LOCUS_19360 6054 5956 gene locus_tag LOCUS_t00460 6054 5956 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6657 7283 gene locus_tag LOCUS_19370 gene spoV 6657 7283 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DII2 protein_id gnl|my_center|LOCUS_19370 7297 10803 gene locus_tag LOCUS_19380 gene mfd 7297 10803 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DI96 protein_id gnl|my_center|LOCUS_19380 10808 11698 gene locus_tag LOCUS_19390 10808 11698 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKP1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence061 281 1363 gene locus_tag LOCUS_19400 281 1363 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_19400 2027 1389 gene locus_tag LOCUS_19410 2027 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028272.1 protein_id gnl|my_center|LOCUS_19410 2496 2032 gene locus_tag LOCUS_19420 2496 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 3511 2543 gene locus_tag LOCUS_19430 3511 2543 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_19430 3908 3495 gene locus_tag LOCUS_19440 3908 3495 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_19440 5485 3908 gene locus_tag LOCUS_19450 5485 3908 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_19450 5500 6051 gene locus_tag LOCUS_19460 gene marR 5500 6051 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223498.1 protein_id gnl|my_center|LOCUS_19460 6124 6909 gene locus_tag LOCUS_19470 6124 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 8105 6927 gene locus_tag LOCUS_19480 8105 6927 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_19480 9489 8107 gene locus_tag LOCUS_19490 9489 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 11858 9507 gene locus_tag LOCUS_19500 11858 9507 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence062 <1 1497 gene locus_tag LOCUS_19510 <1 1497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030068.1:peptidase 2352 1543 gene locus_tag LOCUS_19520 2352 1543 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_19520 3404 2364 gene locus_tag LOCUS_19530 3404 2364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_19530 4192 3401 gene locus_tag LOCUS_19540 4192 3401 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_19540 4854 4189 gene locus_tag LOCUS_19550 4854 4189 CDS product molybdate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775841.1 protein_id gnl|my_center|LOCUS_19550 5260 4868 gene locus_tag LOCUS_19560 5260 4868 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728091.1 protein_id gnl|my_center|LOCUS_19560 5313 5663 gene locus_tag LOCUS_19570 5313 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 6659 5691 gene locus_tag LOCUS_19580 6659 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19580 7504 6656 gene locus_tag LOCUS_19590 7504 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19590 8396 7521 gene locus_tag LOCUS_19600 8396 7521 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968090.1 protein_id gnl|my_center|LOCUS_19600 9417 8431 gene locus_tag LOCUS_19610 9417 8431 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084029.1 protein_id gnl|my_center|LOCUS_19610 <11792 9453 gene locus_tag LOCUS_19620 <11792 9453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970501.1:ABC transporter substrate-binding protein >Feature sequence063 1216 383 gene locus_tag LOCUS_19630 1216 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 1474 2058 gene locus_tag LOCUS_19640 1474 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2335 3060 gene locus_tag LOCUS_19650 2335 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 3442 6552 gene locus_tag LOCUS_19660 3442 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 7282 6731 gene locus_tag LOCUS_19670 7282 6731 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_19670 7614 7441 gene locus_tag LOCUS_19680 7614 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 9101 7917 gene locus_tag LOCUS_19690 9101 7917 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974018.1 protein_id gnl|my_center|LOCUS_19690 10485 9103 gene locus_tag LOCUS_19700 10485 9103 CDS product putative cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701937.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence064 1685 417 gene locus_tag LOCUS_19710 gene gdhA 1685 417 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96110 protein_id gnl|my_center|LOCUS_19710 4045 1721 gene locus_tag LOCUS_19720 4045 1721 CDS product putative cation-transporting ATPase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701708.1 protein_id gnl|my_center|LOCUS_19720 4823 4071 gene locus_tag LOCUS_19730 4823 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 6007 4820 gene locus_tag LOCUS_19740 6007 4820 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_19740 6484 6068 gene locus_tag LOCUS_19750 6484 6068 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731384.1 protein_id gnl|my_center|LOCUS_19750 7404 6490 gene locus_tag LOCUS_19760 7404 6490 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939109.1 protein_id gnl|my_center|LOCUS_19760 7518 7871 gene locus_tag LOCUS_19770 7518 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 7921 8694 gene locus_tag LOCUS_19780 7921 8694 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701581.1 protein_id gnl|my_center|LOCUS_19780 8798 9721 gene locus_tag LOCUS_19790 8798 9721 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 protein_id gnl|my_center|LOCUS_19790 9718 10497 gene locus_tag LOCUS_19800 gene fabG 9718 10497 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_19800 <11114 10534 gene locus_tag LOCUS_19810 <11114 10534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918807.1:MBL fold metallo-hydrolase >Feature sequence065 630 2105 gene locus_tag LOCUS_19820 630 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2317 3411 gene locus_tag LOCUS_19830 gene dnaN 2317 3411 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27903 protein_id gnl|my_center|LOCUS_19830 3429 4517 gene locus_tag LOCUS_19840 gene recF 3429 4517 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P36176 protein_id gnl|my_center|LOCUS_19840 4514 4837 gene locus_tag LOCUS_19850 4514 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 5032 6957 gene locus_tag LOCUS_19860 gene gyrB 5032 6957 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3E798 protein_id gnl|my_center|LOCUS_19860 6992 9457 gene locus_tag LOCUS_19870 gene gyrA 6992 9457 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CU92 protein_id gnl|my_center|LOCUS_19870 9530 9895 gene locus_tag LOCUS_19880 9530 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 9906 10718 gene locus_tag LOCUS_19890 9906 10718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 10756 10830 gene locus_tag LOCUS_t00470 10756 10830 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence066 <1 879 gene locus_tag LOCUS_19900 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MDF2:30S ribosomal protein S2 885 1676 gene locus_tag LOCUS_19910 gene tsf 885 1676 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDF1 protein_id gnl|my_center|LOCUS_19910 1681 2412 gene locus_tag LOCUS_19920 gene pyrH 1681 2412 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q831V1 protein_id gnl|my_center|LOCUS_19920 2426 2995 gene locus_tag LOCUS_19930 gene frr 2426 2995 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEZ1 protein_id gnl|my_center|LOCUS_19930 3019 4269 gene locus_tag LOCUS_19940 3019 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 4364 5515 gene locus_tag LOCUS_19950 gene dxr 4364 5515 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H0 protein_id gnl|my_center|LOCUS_19950 5512 6933 gene locus_tag LOCUS_19960 5512 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 6992 8218 gene locus_tag LOCUS_19970 gene ispG 6992 8218 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NP12 protein_id gnl|my_center|LOCUS_19970 8430 8951 gene locus_tag LOCUS_19980 gene rimP 8430 8951 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y4 protein_id gnl|my_center|LOCUS_19980 8948 10123 gene locus_tag LOCUS_19990 gene nusA 8948 10123 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJM8 protein_id gnl|my_center|LOCUS_19990 10129 10407 gene locus_tag LOCUS_20000 10129 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence067 472 942 gene locus_tag LOCUS_20010 472 942 CDS product MxaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416053.1 protein_id gnl|my_center|LOCUS_20010 942 3548 gene locus_tag LOCUS_20020 942 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 3835 4422 gene locus_tag LOCUS_20030 3835 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 4355 5332 gene locus_tag LOCUS_20040 4355 5332 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268040.1 protein_id gnl|my_center|LOCUS_20040 5362 6465 gene locus_tag LOCUS_20050 5362 6465 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229260.1 protein_id gnl|my_center|LOCUS_20050 6866 7549 gene locus_tag LOCUS_20060 6866 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 8351 7578 gene locus_tag LOCUS_20070 8351 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 <10634 8712 gene locus_tag LOCUS_20080 <10634 8712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257646.1:forkhead-associated protein >Feature sequence068 6 470 gene locus_tag LOCUS_20090 6 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2088 514 gene locus_tag LOCUS_20100 gene leuA 2088 514 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG97 protein_id gnl|my_center|LOCUS_20100 4264 2453 gene locus_tag LOCUS_20110 4264 2453 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_20110 5559 4360 gene locus_tag LOCUS_20120 5559 4360 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0L5 protein_id gnl|my_center|LOCUS_20120 7174 5663 gene locus_tag LOCUS_20130 7174 5663 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728258.1 protein_id gnl|my_center|LOCUS_20130 7625 7236 gene locus_tag LOCUS_20140 7625 7236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 8751 7678 gene locus_tag LOCUS_20150 8751 7678 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_20150 9531 8833 gene locus_tag LOCUS_20160 gene hlyI 9531 8833 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229810.1 protein_id gnl|my_center|LOCUS_20160 9871 9575 gene locus_tag LOCUS_20170 9871 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence069 1007 537 gene locus_tag LOCUS_20180 1007 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1136 2347 gene locus_tag LOCUS_20190 gene rimK 1136 2347 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 protein_id gnl|my_center|LOCUS_20190 4922 2361 gene locus_tag LOCUS_20200 4922 2361 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256961.1 protein_id gnl|my_center|LOCUS_20200 5022 5711 gene locus_tag LOCUS_20210 5022 5711 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_20210 5906 6499 gene locus_tag LOCUS_20220 5906 6499 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_20220 6655 7221 gene locus_tag LOCUS_20230 gene dcd 6655 7221 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQ98 protein_id gnl|my_center|LOCUS_20230 >Feature sequence070 3 428 gene locus_tag LOCUS_20240 3 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 469 789 gene locus_tag LOCUS_20250 469 789 CDS product rhodanese-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700875.1 protein_id gnl|my_center|LOCUS_20250 819 1988 gene locus_tag LOCUS_20260 gene rnd 819 1988 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM2 protein_id gnl|my_center|LOCUS_20260 2043 2288 gene locus_tag LOCUS_20270 2043 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 4051 2303 gene locus_tag LOCUS_20280 4051 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 4194 5648 gene locus_tag LOCUS_20290 4194 5648 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 protein_id gnl|my_center|LOCUS_20290 5645 6547 gene locus_tag LOCUS_20300 5645 6547 CDS product 2-hydroxy-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974600.1 protein_id gnl|my_center|LOCUS_20300 6544 7755 gene locus_tag LOCUS_20310 6544 7755 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTN0 protein_id gnl|my_center|LOCUS_20310 7745 7957 gene locus_tag LOCUS_20320 7745 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence071 2 940 gene locus_tag LOCUS_20330 2 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 986 2560 gene locus_tag LOCUS_20340 gene tig 986 2560 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DE09 protein_id gnl|my_center|LOCUS_20340 2569 3231 gene locus_tag LOCUS_20350 gene clpP 2569 3231 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA83 protein_id gnl|my_center|LOCUS_20350 3337 4611 gene locus_tag LOCUS_20360 gene clpX 3337 4611 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DFN3 protein_id gnl|my_center|LOCUS_20360 4659 5966 gene locus_tag LOCUS_20370 4659 5966 CDS product dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_20370 6033 6440 gene locus_tag LOCUS_20380 gene ndk 6033 6440 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50589 protein_id gnl|my_center|LOCUS_20380 6643 7716 gene locus_tag LOCUS_20390 6643 7716 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976188.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence072 579 349 gene locus_tag LOCUS_20400 579 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1165 617 gene locus_tag LOCUS_20410 1165 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 1287 2450 gene locus_tag LOCUS_20420 1287 2450 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532138.1 protein_id gnl|my_center|LOCUS_20420 3757 2423 gene locus_tag LOCUS_20430 3757 2423 CDS product FAD-linked oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_20430 4775 3762 gene locus_tag LOCUS_20440 4775 3762 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929812.1 protein_id gnl|my_center|LOCUS_20440 6008 4779 gene locus_tag LOCUS_20450 6008 4779 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225002.1 protein_id gnl|my_center|LOCUS_20450 7182 6067 gene locus_tag LOCUS_20460 gene cfa 7182 6067 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933625.1 protein_id gnl|my_center|LOCUS_20460 7273 8148 gene locus_tag LOCUS_20470 7273 8148 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943314.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence073 <1 537 gene locus_tag LOCUS_20480 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RFP4:elongation factor G 2305 569 gene locus_tag LOCUS_20490 2305 569 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_20490 2669 2316 gene locus_tag LOCUS_20500 2669 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2557 3612 gene locus_tag LOCUS_20510 2557 3612 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030360.1 protein_id gnl|my_center|LOCUS_20510 3638 5257 gene locus_tag LOCUS_20520 3638 5257 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030361.1 protein_id gnl|my_center|LOCUS_20520 5254 6258 gene locus_tag LOCUS_20530 gene fbpC 5254 6258 CDS product Fe(3+) ions import ATP-binding protein FbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86751 protein_id gnl|my_center|LOCUS_20530 7872 6271 gene locus_tag LOCUS_20540 7872 6271 CDS product fatty-acyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228885.1 protein_id gnl|my_center|LOCUS_20540 7965 8162 gene locus_tag LOCUS_20550 7965 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence074 <1 1239 gene locus_tag LOCUS_20560 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000710628.1:D-alanyl-D-alanine carboxypeptidase 1912 1244 gene locus_tag LOCUS_20570 1912 1244 CDS product MIP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_20570 3559 1934 gene locus_tag LOCUS_20580 gene cimA 3559 1934 CDS product (R)-citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86511 protein_id gnl|my_center|LOCUS_20580 4466 3549 gene locus_tag LOCUS_20590 4466 3549 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_20590 5510 4530 gene locus_tag LOCUS_20600 gene leuB 5510 4530 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94631 protein_id gnl|my_center|LOCUS_20600 5673 6221 gene locus_tag LOCUS_20610 gene greA 5673 6221 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DG08 protein_id gnl|my_center|LOCUS_20610 6226 7110 gene locus_tag LOCUS_20620 6226 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence075 <1 803 gene locus_tag LOCUS_20630 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975258.1:dipeptidase 809 1375 gene locus_tag LOCUS_20640 809 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 1375 2361 gene locus_tag LOCUS_20650 1375 2361 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969988.1 protein_id gnl|my_center|LOCUS_20650 2358 2813 gene locus_tag LOCUS_20660 2358 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704461.1 protein_id gnl|my_center|LOCUS_20660 3463 2834 gene locus_tag LOCUS_20670 gene tdk 3463 2834 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50519 protein_id gnl|my_center|LOCUS_20670 6314 3534 gene locus_tag LOCUS_20680 gene nrdA 6314 3534 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_20680 6623 7339 gene locus_tag LOCUS_20690 6623 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703708.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence076 915 1850 gene locus_tag LOCUS_20700 915 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085509.1 protein_id gnl|my_center|LOCUS_20700 1847 2503 gene locus_tag LOCUS_20710 1847 2503 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528866.1 protein_id gnl|my_center|LOCUS_20710 3297 2539 gene locus_tag LOCUS_20720 3297 2539 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 protein_id gnl|my_center|LOCUS_20720 3389 3314 gene locus_tag LOCUS_t00480 3389 3314 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4660 3425 gene locus_tag LOCUS_20730 4660 3425 CDS product creatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 protein_id gnl|my_center|LOCUS_20730 5370 4711 gene locus_tag LOCUS_20740 5370 4711 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229311.1 protein_id gnl|my_center|LOCUS_20740 5851 5417 gene locus_tag LOCUS_20750 5851 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 5867 6016 gene locus_tag LOCUS_20760 5867 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 6742 6023 gene locus_tag LOCUS_20770 gene ispE 6742 6023 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5K7 protein_id gnl|my_center|LOCUS_20770 <7341 6739 gene locus_tag LOCUS_20780 <7341 6739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9K3R5:ribosomal RNA small subunit methyltransferase A >Feature sequence077 1377 2159 gene locus_tag LOCUS_20790 gene yjkA 1377 2159 CDS product UPF0014 membrane protein YjkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34684 protein_id gnl|my_center|LOCUS_20790 2739 2164 gene locus_tag LOCUS_20800 2739 2164 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A46 protein_id gnl|my_center|LOCUS_20800 3922 2732 gene locus_tag LOCUS_20810 3922 2732 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKF6 protein_id gnl|my_center|LOCUS_20810 4842 3985 gene locus_tag LOCUS_20820 4842 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804229.1 protein_id gnl|my_center|LOCUS_20820 5546 4842 gene locus_tag LOCUS_20830 5546 4842 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083661.1 protein_id gnl|my_center|LOCUS_20830 <6513 5543 gene locus_tag LOCUS_20840 <6513 5543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225041.1:microsomal epoxide hydrolase >Feature sequence078 81 1106 gene locus_tag LOCUS_20850 81 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 1120 1653 gene locus_tag LOCUS_20860 1120 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2442 1660 gene locus_tag LOCUS_20870 2442 1660 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_20870 2486 6148 gene locus_tag LOCUS_20880 2486 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 3561 3658 gene locus_tag LOCUS_t00490 3561 3658 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence079 575 2626 gene locus_tag LOCUS_20890 gene ligA 575 2626 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCA1 protein_id gnl|my_center|LOCUS_20890 3077 2643 gene locus_tag LOCUS_20900 3077 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 3193 5076 gene locus_tag LOCUS_20910 gene pknB 3193 5076 CDS product serine/threonine-protein kinase PknB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNG1 protein_id gnl|my_center|LOCUS_20910 5107 5421 gene locus_tag LOCUS_20920 gene gatC 5107 5421 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170162.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence080 <1 872 gene locus_tag LOCUS_20930 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224513.1:protoporphyrinogen oxidase 949 1530 gene locus_tag LOCUS_20940 949 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 1535 3067 gene locus_tag LOCUS_20950 gene lnt 1535 3067 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAD0 protein_id gnl|my_center|LOCUS_20950 3849 3064 gene locus_tag LOCUS_20960 3849 3064 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225327.1 protein_id gnl|my_center|LOCUS_20960 4289 3852 gene locus_tag LOCUS_20970 gene dtd 4289 3852 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHV8 protein_id gnl|my_center|LOCUS_20970 4389 5687 gene locus_tag LOCUS_20980 4389 5687 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_20980 >Feature sequence081 1472 531 gene locus_tag LOCUS_20990 1472 531 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_20990 2342 1542 gene locus_tag LOCUS_21000 2342 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 3148 2339 gene locus_tag LOCUS_21010 3148 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 4113 3145 gene locus_tag LOCUS_21020 4113 3145 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225886.1 protein_id gnl|my_center|LOCUS_21020 4540 4214 gene locus_tag LOCUS_21030 4540 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 5835 4537 gene locus_tag LOCUS_21040 gene eno 5835 4537 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT60 protein_id gnl|my_center|LOCUS_21040 >Feature sequence082 <1 946 gene locus_tag LOCUS_21050 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DK65:glutamyl-tRNA(Gln) amidotransferase subunit A 943 2403 gene locus_tag LOCUS_21060 gene gatB 943 2403 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZH0 protein_id gnl|my_center|LOCUS_21060 2434 3219 gene locus_tag LOCUS_21070 2434 3219 CDS product putative aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703644.1 protein_id gnl|my_center|LOCUS_21070 4523 3216 gene locus_tag LOCUS_21080 4523 3216 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029304.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence083 137 367 gene locus_tag LOCUS_21090 137 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 778 1638 gene locus_tag LOCUS_21100 gene cobB2 778 1638 CDS product NAD-dependent protein deacetylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJM9 protein_id gnl|my_center|LOCUS_21100 1721 2287 gene locus_tag LOCUS_21110 1721 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 2346 3521 gene locus_tag LOCUS_21120 2346 3521 CDS product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 protein_id gnl|my_center|LOCUS_21120 3560 4852 gene locus_tag LOCUS_21130 3560 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence084 1587 895 gene locus_tag LOCUS_21140 gene rplA 1587 895 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0K2 protein_id gnl|my_center|LOCUS_21140 2146 1718 gene locus_tag LOCUS_21150 gene rplK 2146 1718 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EAK4 protein_id gnl|my_center|LOCUS_21150 3138 2275 gene locus_tag LOCUS_21160 3138 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 3410 3138 gene locus_tag LOCUS_21170 3410 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3637 3564 gene locus_tag LOCUS_t00500 3637 3564 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3886 3725 gene locus_tag LOCUS_21180 gene rpmG 3886 3725 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35871 protein_id gnl|my_center|LOCUS_21180 4012 3937 gene locus_tag LOCUS_t00510 4012 3937 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4089 4016 gene locus_tag LOCUS_t00520 4089 4016 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4216 4704 gene locus_tag LOCUS_21190 gene yncA 4216 4704 CDS product phosphinothricin acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038821.1 protein_id gnl|my_center|LOCUS_21190 4840 4756 gene locus_tag LOCUS_t00530 4840 4756 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4918 5406 gene locus_tag LOCUS_21200 4918 5406 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHA5 protein_id gnl|my_center|LOCUS_21200 >Feature sequence085 905 111 gene locus_tag LOCUS_21210 905 111 CDS product putative dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704240.1 protein_id gnl|my_center|LOCUS_21210 1014 1514 gene locus_tag LOCUS_21220 1014 1514 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227870.1 protein_id gnl|my_center|LOCUS_21220 1518 2525 gene locus_tag LOCUS_21230 1518 2525 CDS product putative bifunctional riboflavin biosynthesis protein RibG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703541.1 protein_id gnl|my_center|LOCUS_21230 2585 3460 gene locus_tag LOCUS_21240 gene hisG 2585 3460 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62364 protein_id gnl|my_center|LOCUS_21240 3511 3732 gene locus_tag LOCUS_21250 3511 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 4363 3737 gene locus_tag LOCUS_21260 4363 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 4615 5214 gene locus_tag LOCUS_21270 4615 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 5249 5443 gene locus_tag LOCUS_21280 5249 5443 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence086 1341 37 gene locus_tag LOCUS_21290 gene ugd 1341 37 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222056.1 protein_id gnl|my_center|LOCUS_21290 2801 1347 gene locus_tag LOCUS_21300 gene pepA 2801 1347 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67868 protein_id gnl|my_center|LOCUS_21300 3361 2822 gene locus_tag LOCUS_21310 3361 2822 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence087 214 1209 gene locus_tag LOCUS_21320 gene gpsA2 214 1209 CDS product putative glycerol-3-phosphate dehydrogenase 2 [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64189 protein_id gnl|my_center|LOCUS_21320 1212 2603 gene locus_tag LOCUS_21330 1212 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2778 3035 gene locus_tag LOCUS_21340 2778 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 3050 3703 gene locus_tag LOCUS_21350 gene rnhB 3050 3703 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69989 protein_id gnl|my_center|LOCUS_21350 3740 4189 gene locus_tag LOCUS_21360 3740 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 4201 4530 gene locus_tag LOCUS_21370 4201 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 4527 5162 gene locus_tag LOCUS_21380 4527 5162 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853622.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence088 761 1837 gene locus_tag LOCUS_21390 gene ftsZ 761 1837 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45500 protein_id gnl|my_center|LOCUS_21390 1884 2570 gene locus_tag LOCUS_21400 1884 2570 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKD5 protein_id gnl|my_center|LOCUS_21400 2552 3259 gene locus_tag LOCUS_21410 gene yggS 2552 3259 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_21410 3340 3846 gene locus_tag LOCUS_21420 3340 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 3889 4143 gene locus_tag LOCUS_21430 3889 4143 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450918.1 protein_id gnl|my_center|LOCUS_21430 4211 5038 gene locus_tag LOCUS_21440 4211 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence089 1433 390 gene locus_tag LOCUS_21450 gene hemE 1433 390 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69861 protein_id gnl|my_center|LOCUS_21450 2466 1483 gene locus_tag LOCUS_21460 2466 1483 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222197.1 protein_id gnl|my_center|LOCUS_21460 2635 4707 gene locus_tag LOCUS_21470 2635 4707 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZ13 protein_id gnl|my_center|LOCUS_21470 >Feature sequence090 2841 421 gene locus_tag LOCUS_21480 gene fbiC 2841 421 CDS product FO synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CBX6 protein_id gnl|my_center|LOCUS_21480 3320 2838 gene locus_tag LOCUS_21490 3320 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090577.1 protein_id gnl|my_center|LOCUS_21490 4463 3372 gene locus_tag LOCUS_21500 gene talA 4463 3372 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4Z8 protein_id gnl|my_center|LOCUS_21500 >Feature sequence091 <1 1638 gene locus_tag LOCUS_21510 <1 1638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225368.1:carbonate dehydratase 1661 3715 gene locus_tag LOCUS_21520 1661 3715 CDS product N-methylproline demethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532328.1 protein_id gnl|my_center|LOCUS_21520 4675 3728 gene locus_tag LOCUS_21530 4675 3728 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence092 1194 718 gene locus_tag LOCUS_21540 1194 718 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391686.1 protein_id gnl|my_center|LOCUS_21540 1565 1191 gene locus_tag LOCUS_21550 1565 1191 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKV4 protein_id gnl|my_center|LOCUS_21550 2107 1571 gene locus_tag LOCUS_21560 2107 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2974 2180 gene locus_tag LOCUS_21570 2974 2180 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCU6 protein_id gnl|my_center|LOCUS_21570 3582 2995 gene locus_tag LOCUS_21580 3582 2995 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211558.1 protein_id gnl|my_center|LOCUS_21580 4145 3579 gene locus_tag LOCUS_21590 gene hpt 4145 3579 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230473.1 protein_id gnl|my_center|LOCUS_21590 <4871 4157 gene locus_tag LOCUS_21600 <4871 4157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DJR2:tRNA(Ile)-lysidine synthase >Feature sequence093 <1 3587 gene locus_tag LOCUS_21610 <1 3587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014640143.1:autotransporter outer membrane protein 3603 4352 gene locus_tag LOCUS_21620 3603 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 4411 4611 gene locus_tag LOCUS_21630 4411 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence094 281 1366 gene locus_tag LOCUS_21640 281 1366 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 protein_id gnl|my_center|LOCUS_21640 2780 1359 gene locus_tag LOCUS_21650 2780 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 4075 2822 gene locus_tag LOCUS_21660 4075 2822 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence095 1093 773 gene locus_tag LOCUS_21670 1093 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_21670 1255 2391 gene locus_tag LOCUS_21680 gene mrp 1255 2391 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX37 protein_id gnl|my_center|LOCUS_21680 2994 2398 gene locus_tag LOCUS_21690 2994 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence096 2283 1540 gene locus_tag LOCUS_21700 2283 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 <3968 2291 gene locus_tag LOCUS_21710 <3968 2291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WNU5:DNA polymerase I >Feature sequence097 730 2034 gene locus_tag LOCUS_21720 730 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702368.1 protein_id gnl|my_center|LOCUS_21720 2059 2853 gene locus_tag LOCUS_21730 2059 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222725.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence098 1723 908 gene locus_tag LOCUS_21740 gene cutM 1723 908 CDS product carbon-monoxide dehydrogenase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_21740 <3426 1720 gene locus_tag LOCUS_21750 <3426 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223764.1:carbon-monoxide dehydrogenase large subunit >Feature sequence099 355 1917 gene locus_tag LOCUS_21760 355 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2755 1961 gene locus_tag LOCUS_21770 2755 1961 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013910.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence100 2211 391 gene locus_tag LOCUS_21780 gene infB 2211 391 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17889 protein_id gnl|my_center|LOCUS_21780 >Feature sequence101 >Feature sequence102 74 358 gene locus_tag LOCUS_21790 74 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 360 656 gene locus_tag LOCUS_21800 360 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 656 1945 gene locus_tag LOCUS_21810 656 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence103 274 1308 gene locus_tag LOCUS_21820 gene mnmA 274 1308 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFH2 protein_id gnl|my_center|LOCUS_21820