>Feature sequence01 1069 743 gene locus_tag LOCUS_00010 1069 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1489 1416 gene locus_tag LOCUS_t00010 1489 1416 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2628 1579 gene locus_tag LOCUS_00020 2628 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2742 3779 gene locus_tag LOCUS_00030 2742 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3879 4259 gene locus_tag LOCUS_00040 3879 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4651 4472 gene locus_tag LOCUS_00050 4651 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6572 4656 gene locus_tag LOCUS_00060 6572 4656 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_00060 6640 7017 gene locus_tag LOCUS_00070 6640 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_00070 8114 7014 gene locus_tag LOCUS_00080 gene fjo30 8114 7014 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_00080 9014 8118 gene locus_tag LOCUS_00090 gene gldN 9014 8118 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_00090 10576 9032 gene locus_tag LOCUS_00100 gene gldM 10576 9032 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_00100 11247 10603 gene locus_tag LOCUS_00110 gene gldL 11247 10603 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_00110 12713 11319 gene locus_tag LOCUS_00120 gene gldK 12713 11319 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_00120 13983 12829 gene locus_tag LOCUS_00130 gene fjo29 13983 12829 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_00130 16503 13990 gene locus_tag LOCUS_00140 gene topA 16503 13990 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_00140 17385 16603 gene locus_tag LOCUS_00150 17385 16603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18724 17501 gene locus_tag LOCUS_00160 18724 17501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18880 20325 gene locus_tag LOCUS_00170 gene miaB 18880 20325 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_00170 20329 21600 gene locus_tag LOCUS_00180 20329 21600 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_00180 21652 22122 gene locus_tag LOCUS_00190 21652 22122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_00190 22122 22946 gene locus_tag LOCUS_00200 22122 22946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_00200 22943 23305 gene locus_tag LOCUS_00210 gene secG 22943 23305 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964085.1 protein_id gnl|my_center|LOCUS_00210 23457 23732 gene locus_tag LOCUS_00220 gene groS 23457 23732 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_00220 23790 25427 gene locus_tag LOCUS_00230 gene groL 23790 25427 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_00230 25548 27194 gene locus_tag LOCUS_00240 25548 27194 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035657.1 protein_id gnl|my_center|LOCUS_00240 28728 27496 gene locus_tag LOCUS_00250 gene clpX 28728 27496 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_00250 29412 28732 gene locus_tag LOCUS_00260 gene clpP 29412 28732 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_00260 30847 29525 gene locus_tag LOCUS_00270 gene tig 30847 29525 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_00270 31264 30917 gene locus_tag LOCUS_00280 31264 30917 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964186.1 protein_id gnl|my_center|LOCUS_00280 32892 31351 gene locus_tag LOCUS_00290 32892 31351 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_00290 34161 32908 gene locus_tag LOCUS_00300 34161 32908 CDS product aromatic hydrocarbon degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_00300 35038 34268 gene locus_tag LOCUS_00310 35038 34268 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_00310 35757 35044 gene locus_tag LOCUS_00320 gene pdxJ 35757 35044 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 protein_id gnl|my_center|LOCUS_00320 35840 36499 gene locus_tag LOCUS_00330 35840 36499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_00330 36503 37387 gene locus_tag LOCUS_00340 gene nadK 36503 37387 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_00340 37516 38181 gene locus_tag LOCUS_00350 37516 38181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_00350 38182 38922 gene locus_tag LOCUS_00360 gene uppS 38182 38922 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_00360 38927 41521 gene locus_tag LOCUS_00370 gene bamA 38927 41521 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 protein_id gnl|my_center|LOCUS_00370 41632 42399 gene locus_tag LOCUS_00380 41632 42399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 42453 42968 gene locus_tag LOCUS_00390 42453 42968 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962186.1 protein_id gnl|my_center|LOCUS_00390 43033 43812 gene locus_tag LOCUS_00400 gene murI 43033 43812 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D7 protein_id gnl|my_center|LOCUS_00400 44825 43809 gene locus_tag LOCUS_00410 44825 43809 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_00410 45054 45962 gene locus_tag LOCUS_00420 45054 45962 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 protein_id gnl|my_center|LOCUS_00420 48304 46040 gene locus_tag LOCUS_00430 48304 46040 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A666 protein_id gnl|my_center|LOCUS_00430 48453 50468 gene locus_tag LOCUS_00440 gene yyaL 48453 50468 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_00440 50549 51418 gene locus_tag LOCUS_00450 50549 51418 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_00450 52086 51415 gene locus_tag LOCUS_00460 52086 51415 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_00460 53355 52093 gene locus_tag LOCUS_00470 53355 52093 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_00470 54798 53359 gene locus_tag LOCUS_00480 54798 53359 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_00480 55976 54861 gene locus_tag LOCUS_00490 55976 54861 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_00490 57262 55997 gene locus_tag LOCUS_00500 57262 55997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_00500 58520 57264 gene locus_tag LOCUS_00510 58520 57264 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_00510 59214 58513 gene locus_tag LOCUS_00520 59214 58513 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_00520 59548 59318 gene locus_tag LOCUS_00530 59548 59318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 60081 59548 gene locus_tag LOCUS_00540 gene yozB 60081 59548 CDS product putative membrane protein YozB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31845 protein_id gnl|my_center|LOCUS_00540 60777 60085 gene locus_tag LOCUS_00550 gene ypmQ 60777 60085 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_00550 61421 60774 gene locus_tag LOCUS_00560 61421 60774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964209.1 protein_id gnl|my_center|LOCUS_00560 61868 61506 gene locus_tag LOCUS_00570 61868 61506 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_00570 62888 61890 gene locus_tag LOCUS_00580 62888 61890 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_00580 63515 62934 gene locus_tag LOCUS_00590 gene ctaE 63515 62934 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_00590 64432 63506 gene locus_tag LOCUS_00600 gene ctaB 64432 63506 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_00600 66614 64500 gene locus_tag LOCUS_00610 66614 64500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964216.1 protein_id gnl|my_center|LOCUS_00610 67468 66701 gene locus_tag LOCUS_00620 67468 66701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 68292 67558 gene locus_tag LOCUS_00630 68292 67558 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_00630 68669 68343 gene locus_tag LOCUS_00640 68669 68343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 69105 68725 gene locus_tag LOCUS_00650 gene gcvH 69105 68725 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_00650 76324 69128 gene locus_tag LOCUS_00660 gene sprA 76324 69128 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_00660 76979 76395 gene locus_tag LOCUS_00670 gene ruvA 76979 76395 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_00670 79366 77069 gene locus_tag LOCUS_00680 gene maeB 79366 77069 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_00680 80346 79423 gene locus_tag LOCUS_00690 gene queG 80346 79423 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_00690 81685 80348 gene locus_tag LOCUS_00700 81685 80348 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_00700 82704 81682 gene locus_tag LOCUS_00710 gene ruvB 82704 81682 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_00710 84611 82776 gene locus_tag LOCUS_00720 gene ctaD 84611 82776 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_00720 85723 84632 gene locus_tag LOCUS_00730 gene ctaC 85723 84632 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_00730 87140 85755 gene locus_tag LOCUS_00740 gene actF 87140 85755 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_00740 87946 87173 gene locus_tag LOCUS_00750 87946 87173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 88476 87955 gene locus_tag LOCUS_00760 gene actD 88476 87955 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_00760 90295 88478 gene locus_tag LOCUS_00770 gene actC 90295 88478 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_00770 93415 90329 gene locus_tag LOCUS_00780 gene actB 93415 90329 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_00780 94824 93445 gene locus_tag LOCUS_00790 gene actA 94824 93445 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_00790 95053 95424 gene locus_tag LOCUS_00800 95053 95424 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962542.1 protein_id gnl|my_center|LOCUS_00800 98216 95499 gene locus_tag LOCUS_00810 gene infB 98216 95499 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 protein_id gnl|my_center|LOCUS_00810 99524 98289 gene locus_tag LOCUS_00820 gene nusA 99524 98289 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_00820 99998 99537 gene locus_tag LOCUS_00830 gene rimP 99998 99537 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV6 protein_id gnl|my_center|LOCUS_00830 100165 101001 gene locus_tag LOCUS_00840 gene uspA 100165 101001 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_00840 102493 100988 gene locus_tag LOCUS_00850 102493 100988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 102650 102886 gene locus_tag LOCUS_00860 102650 102886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 102923 103555 gene locus_tag LOCUS_00870 102923 103555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 103661 103987 gene locus_tag LOCUS_00880 103661 103987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 104267 104194 gene locus_tag LOCUS_t00020 104267 104194 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 104425 107748 gene locus_tag LOCUS_00890 104425 107748 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 protein_id gnl|my_center|LOCUS_00890 107751 108374 gene locus_tag LOCUS_00900 107751 108374 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_00900 109829 108375 gene locus_tag LOCUS_00910 109829 108375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 111562 110039 gene locus_tag LOCUS_00920 111562 110039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 112883 111657 gene locus_tag LOCUS_00930 112883 111657 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_00930 113004 113393 gene locus_tag LOCUS_00940 113004 113393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 113491 116334 gene locus_tag LOCUS_00950 gene polA 113491 116334 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_00950 116420 117049 gene locus_tag LOCUS_00960 116420 117049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 117481 117317 gene locus_tag LOCUS_00970 117481 117317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 117960 117655 gene locus_tag LOCUS_00980 117960 117655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 119194 118289 gene locus_tag LOCUS_00990 119194 118289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 119956 119384 gene locus_tag LOCUS_01000 119956 119384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 120882 120043 gene locus_tag LOCUS_01010 gene blaA 120882 120043 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK2 protein_id gnl|my_center|LOCUS_01010 121521 120892 gene locus_tag LOCUS_01020 121521 120892 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110142.1 protein_id gnl|my_center|LOCUS_01020 122278 121649 gene locus_tag LOCUS_01030 122278 121649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 122600 123304 gene locus_tag LOCUS_01040 122600 123304 CDS product catabolite gene activator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041104.1 protein_id gnl|my_center|LOCUS_01040 123428 123949 gene locus_tag LOCUS_01050 123428 123949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 123954 124337 gene locus_tag LOCUS_01060 123954 124337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 124380 125246 gene locus_tag LOCUS_01070 gene uspA 124380 125246 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_01070 125715 126122 gene locus_tag LOCUS_01080 gene yrdN 125715 126122 CDS product putative tautomerase YrdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94502 protein_id gnl|my_center|LOCUS_01080 126804 126544 gene locus_tag LOCUS_01090 126804 126544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 130765 127253 gene locus_tag LOCUS_01100 130765 127253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 131021 131476 gene locus_tag LOCUS_01110 gene rplM 131021 131476 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 protein_id gnl|my_center|LOCUS_01110 131477 131863 gene locus_tag LOCUS_01120 gene rpsI 131477 131863 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU3 protein_id gnl|my_center|LOCUS_01120 132019 132912 gene locus_tag LOCUS_01130 gene rpsB 132019 132912 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_01130 133012 133839 gene locus_tag LOCUS_01140 gene tsf 133012 133839 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_01140 134006 134668 gene locus_tag LOCUS_01150 gene pyrH 134006 134668 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_01150 134700 135254 gene locus_tag LOCUS_01160 gene frr 134700 135254 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_01160 135344 137788 gene locus_tag LOCUS_01170 135344 137788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962609.1 protein_id gnl|my_center|LOCUS_01170 137849 140266 gene locus_tag LOCUS_01180 137849 140266 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_01180 140395 141837 gene locus_tag LOCUS_01190 gene asnS 140395 141837 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_01190 142030 142875 gene locus_tag LOCUS_01200 gene rluD 142030 142875 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U1T3 protein_id gnl|my_center|LOCUS_01200 142968 144425 gene locus_tag LOCUS_01210 gene rpoN 142968 144425 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_01210 144474 145040 gene locus_tag LOCUS_01220 144474 145040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962552.1 protein_id gnl|my_center|LOCUS_01220 145802 145035 gene locus_tag LOCUS_01230 145802 145035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_01230 146339 145857 gene locus_tag LOCUS_01240 146339 145857 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108110.1 protein_id gnl|my_center|LOCUS_01240 146968 146366 gene locus_tag LOCUS_01250 146968 146366 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_01250 147409 146972 gene locus_tag LOCUS_01260 147409 146972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 148222 147428 gene locus_tag LOCUS_01270 148222 147428 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_01270 148384 148296 gene locus_tag LOCUS_t00030 148384 148296 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 149502 148471 gene locus_tag LOCUS_01280 gene ansA 149502 148471 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_01280 150280 149510 gene locus_tag LOCUS_01290 150280 149510 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_01290 150402 150839 gene locus_tag LOCUS_01300 150402 150839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 152180 150918 gene locus_tag LOCUS_01310 gene sucB 152180 150918 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_01310 154994 152214 gene locus_tag LOCUS_01320 gene sucA 154994 152214 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_01320 156131 155157 gene locus_tag LOCUS_01330 156131 155157 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_01330 156270 156875 gene locus_tag LOCUS_01340 156270 156875 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_01340 156896 158248 gene locus_tag LOCUS_01350 156896 158248 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_01350 158250 159419 gene locus_tag LOCUS_01360 158250 159419 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_01360 159409 162882 gene locus_tag LOCUS_01370 159409 162882 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_01370 164008 163064 gene locus_tag LOCUS_01380 164008 163064 CDS product protein of unknown function precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362027.1 protein_id gnl|my_center|LOCUS_01380 164604 164095 gene locus_tag LOCUS_01390 164604 164095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_01390 165096 164773 gene locus_tag LOCUS_01400 165096 164773 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_01400 165878 165219 gene locus_tag LOCUS_01410 165878 165219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 166499 165882 gene locus_tag LOCUS_01420 166499 165882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 166996 166502 gene locus_tag LOCUS_01430 166996 166502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 167560 167138 gene locus_tag LOCUS_01440 gene sufE 167560 167138 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_01440 167975 167562 gene locus_tag LOCUS_01450 167975 167562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 169252 168029 gene locus_tag LOCUS_01460 gene sufS 169252 168029 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_01460 170048 169266 gene locus_tag LOCUS_01470 170048 169266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 171373 170057 gene locus_tag LOCUS_01480 gene sufD 171373 170057 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_01480 172172 171417 gene locus_tag LOCUS_01490 gene sufC 172172 171417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_01490 172583 172188 gene locus_tag LOCUS_01500 172583 172188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 174063 172618 gene locus_tag LOCUS_01510 gene sufB 174063 172618 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_01510 174453 174124 gene locus_tag LOCUS_01520 gene sufA 174453 174124 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_01520 174734 175792 gene locus_tag LOCUS_01530 gene thiL 174734 175792 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_01530 176499 175843 gene locus_tag LOCUS_01540 176499 175843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 176601 177923 gene locus_tag LOCUS_01550 176601 177923 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 protein_id gnl|my_center|LOCUS_01550 178754 177978 gene locus_tag LOCUS_01560 178754 177978 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_01560 178933 180483 gene locus_tag LOCUS_01570 178933 180483 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037766.1 protein_id gnl|my_center|LOCUS_01570 182297 180612 gene locus_tag LOCUS_01580 gene asnB 182297 180612 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706472.1 protein_id gnl|my_center|LOCUS_01580 182617 183381 gene locus_tag LOCUS_01590 182617 183381 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_01590 183434 184411 gene locus_tag LOCUS_01600 183434 184411 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_01600 184467 185219 gene locus_tag LOCUS_01610 184467 185219 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 protein_id gnl|my_center|LOCUS_01610 185621 185256 gene locus_tag LOCUS_01620 185621 185256 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_01620 187948 185624 gene locus_tag LOCUS_01630 187948 185624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 188119 188454 gene locus_tag LOCUS_01640 188119 188454 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 protein_id gnl|my_center|LOCUS_01640 188512 189567 gene locus_tag LOCUS_01650 188512 189567 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_01650 189567 190058 gene locus_tag LOCUS_01660 189567 190058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 190055 190663 gene locus_tag LOCUS_01670 190055 190663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_01670 190660 191478 gene locus_tag LOCUS_01680 gene deoD 190660 191478 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH2 protein_id gnl|my_center|LOCUS_01680 191475 192443 gene locus_tag LOCUS_01690 191475 192443 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_01690 193013 192498 gene locus_tag LOCUS_01700 gene greA 193013 192498 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_01700 193200 193529 gene locus_tag LOCUS_01710 193200 193529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 194537 193533 gene locus_tag LOCUS_01720 194537 193533 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704685.1 protein_id gnl|my_center|LOCUS_01720 195453 194548 gene locus_tag LOCUS_01730 195453 194548 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_01730 196471 195713 gene locus_tag LOCUS_01740 196471 195713 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_01740 198987 196624 gene locus_tag LOCUS_01750 198987 196624 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_01750 199287 201737 gene locus_tag LOCUS_01760 199287 201737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 203076 201727 gene locus_tag LOCUS_01770 203076 201727 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_01770 203727 203404 gene locus_tag LOCUS_01780 203727 203404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 204397 203990 gene locus_tag LOCUS_01790 204397 203990 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_01790 >Feature sequence02 622 176 gene locus_tag LOCUS_01800 622 176 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_01800 2719 722 gene locus_tag LOCUS_01810 gene ftsZ 2719 722 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H191 protein_id gnl|my_center|LOCUS_01810 4165 2768 gene locus_tag LOCUS_01820 gene ftsA 4165 2768 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_01820 4894 4178 gene locus_tag LOCUS_01830 gene ftsQ 4894 4178 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964154.1 protein_id gnl|my_center|LOCUS_01830 6239 4884 gene locus_tag LOCUS_01840 gene murC 6239 4884 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_01840 7409 6315 gene locus_tag LOCUS_01850 gene murG 7409 6315 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_01850 8644 7406 gene locus_tag LOCUS_01860 gene ftsW 8644 7406 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_01860 9986 8652 gene locus_tag LOCUS_01870 gene murD 9986 8652 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_01870 11217 9988 gene locus_tag LOCUS_01880 gene mraY 11217 9988 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_01880 12697 11234 gene locus_tag LOCUS_01890 gene murE 12697 11234 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_01890 14661 12694 gene locus_tag LOCUS_01900 gene ftsI 14661 12694 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_01900 14988 14665 gene locus_tag LOCUS_01910 14988 14665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 15895 14990 gene locus_tag LOCUS_01920 gene rsmH 15895 14990 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 protein_id gnl|my_center|LOCUS_01920 16394 15873 gene locus_tag LOCUS_01930 gene mraZ 16394 15873 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_01930 16628 17392 gene locus_tag LOCUS_01940 gene pcbD 16628 17392 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_01940 17397 17993 gene locus_tag LOCUS_01950 gene engB 17397 17993 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 protein_id gnl|my_center|LOCUS_01950 18400 18062 gene locus_tag LOCUS_01960 gene gldC 18400 18062 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_01960 19374 18400 gene locus_tag LOCUS_01970 19374 18400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 19484 20275 gene locus_tag LOCUS_01980 gene nadE 19484 20275 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 protein_id gnl|my_center|LOCUS_01980 22413 20422 gene locus_tag LOCUS_01990 gene dnaG 22413 20422 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_01990 23604 22528 gene locus_tag LOCUS_02000 23604 22528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964174.1 protein_id gnl|my_center|LOCUS_02000 24474 23698 gene locus_tag LOCUS_02010 24474 23698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 25027 24461 gene locus_tag LOCUS_02020 25027 24461 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_02020 26349 25447 gene locus_tag LOCUS_02030 26349 25447 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_02030 28332 26872 gene locus_tag LOCUS_02040 28332 26872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 28587 29483 gene locus_tag LOCUS_02050 28587 29483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 29655 30728 gene locus_tag LOCUS_02060 29655 30728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 32488 31439 gene locus_tag LOCUS_02070 gene rlmN 32488 31439 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_02070 33808 32753 gene locus_tag LOCUS_02080 gene queA 33808 32753 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_02080 35144 33918 gene locus_tag LOCUS_02090 gene aroA 35144 33918 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW83 protein_id gnl|my_center|LOCUS_02090 35404 35141 gene locus_tag LOCUS_02100 35404 35141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 35730 35404 gene locus_tag LOCUS_02110 35730 35404 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_02110 37692 35731 gene locus_tag LOCUS_02120 37692 35731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 39601 37697 gene locus_tag LOCUS_02130 39601 37697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 40105 39653 gene locus_tag LOCUS_02140 gene dtd 40105 39653 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 protein_id gnl|my_center|LOCUS_02140 41058 40111 gene locus_tag LOCUS_02150 gene rsgA 41058 40111 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 protein_id gnl|my_center|LOCUS_02150 42798 41146 gene locus_tag LOCUS_02160 42798 41146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 43967 42885 gene locus_tag LOCUS_02170 43967 42885 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_02170 45324 44476 gene locus_tag LOCUS_02180 gene tyrA 45324 44476 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_02180 46472 45321 gene locus_tag LOCUS_02190 gene aspC3 46472 45321 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 protein_id gnl|my_center|LOCUS_02190 47292 46456 gene locus_tag LOCUS_02200 gene pheA 47292 46456 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_02200 47702 48616 gene locus_tag LOCUS_02210 gene gldA 47702 48616 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_02210 52587 48718 gene locus_tag LOCUS_02220 52587 48718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 53733 52777 gene locus_tag LOCUS_02230 53733 52777 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU8 protein_id gnl|my_center|LOCUS_02230 56620 53882 gene locus_tag LOCUS_02240 56620 53882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 57636 56629 gene locus_tag LOCUS_02250 57636 56629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 58216 59616 gene locus_tag LOCUS_02260 gene speA 58216 59616 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_02260 59606 60484 gene locus_tag LOCUS_02270 59606 60484 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_02270 60649 61620 gene locus_tag LOCUS_02280 60649 61620 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_02280 61907 63439 gene locus_tag LOCUS_02290 61907 63439 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_02290 63504 64139 gene locus_tag LOCUS_02300 63504 64139 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802698.1 protein_id gnl|my_center|LOCUS_02300 64175 64462 gene locus_tag LOCUS_02310 64175 64462 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_02310 64452 64799 gene locus_tag LOCUS_02320 64452 64799 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_02320 66107 64800 gene locus_tag LOCUS_02330 66107 64800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_02330 67647 66154 gene locus_tag LOCUS_02340 67647 66154 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_02340 68556 67861 gene locus_tag LOCUS_02350 68556 67861 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_02350 70149 68560 gene locus_tag LOCUS_02360 70149 68560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 71442 70153 gene locus_tag LOCUS_02370 71442 70153 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867775.1 protein_id gnl|my_center|LOCUS_02370 72765 71512 gene locus_tag LOCUS_02380 gene rodA 72765 71512 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_02380 74628 72766 gene locus_tag LOCUS_02390 gene pbpA 74628 72766 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_02390 75131 74625 gene locus_tag LOCUS_02400 gene mreD 75131 74625 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_02400 75882 75124 gene locus_tag LOCUS_02410 gene mreC 75882 75124 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 protein_id gnl|my_center|LOCUS_02410 76991 75963 gene locus_tag LOCUS_02420 gene mreB 76991 75963 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_02420 78565 77033 gene locus_tag LOCUS_02430 gene purH 78565 77033 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_02430 78714 79970 gene locus_tag LOCUS_02440 78714 79970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_02440 80050 80805 gene locus_tag LOCUS_02450 80050 80805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02450 80865 81365 gene locus_tag LOCUS_02460 80865 81365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02460 81475 81903 gene locus_tag LOCUS_02470 81475 81903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 81884 83632 gene locus_tag LOCUS_02480 81884 83632 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962869.1 protein_id gnl|my_center|LOCUS_02480 83629 84258 gene locus_tag LOCUS_02490 gene citB 83629 84258 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805069.1 protein_id gnl|my_center|LOCUS_02490 84703 85605 gene locus_tag LOCUS_02500 84703 85605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02500 88060 86009 gene locus_tag LOCUS_02510 88060 86009 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203283.1 protein_id gnl|my_center|LOCUS_02510 88152 89225 gene locus_tag LOCUS_02520 88152 89225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963854.1 protein_id gnl|my_center|LOCUS_02520 89225 89590 gene locus_tag LOCUS_02530 gene crcB 89225 89590 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZS4 protein_id gnl|my_center|LOCUS_02530 90012 89608 gene locus_tag LOCUS_02540 90012 89608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 90159 90413 gene locus_tag LOCUS_02550 90159 90413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 91342 90701 gene locus_tag LOCUS_02560 91342 90701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_02560 91606 91409 gene locus_tag LOCUS_02570 91606 91409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 95245 91793 gene locus_tag LOCUS_02580 gene icmF 95245 91793 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_02580 97212 95737 gene locus_tag LOCUS_02590 gene katA 97212 95737 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A323 protein_id gnl|my_center|LOCUS_02590 97402 98085 gene locus_tag LOCUS_02600 97402 98085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_02600 98332 98526 gene locus_tag LOCUS_02610 98332 98526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 98621 99541 gene locus_tag LOCUS_02620 98621 99541 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_02620 100390 99590 gene locus_tag LOCUS_02630 100390 99590 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_02630 100971 100483 gene locus_tag LOCUS_02640 100971 100483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 102035 101217 gene locus_tag LOCUS_02650 gene pyrF 102035 101217 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_02650 102354 102067 gene locus_tag LOCUS_02660 102354 102067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 102572 102345 gene locus_tag LOCUS_02670 102572 102345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 103690 102614 gene locus_tag LOCUS_02680 gene prfA 103690 102614 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_02680 103846 104082 gene locus_tag LOCUS_02690 103846 104082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 104079 104741 gene locus_tag LOCUS_02700 104079 104741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763958.1 protein_id gnl|my_center|LOCUS_02700 105753 104725 gene locus_tag LOCUS_02710 105753 104725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_02710 106953 105772 gene locus_tag LOCUS_02720 gene purM 106953 105772 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_02720 109224 107038 gene locus_tag LOCUS_02730 gene glnA 109224 107038 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_02730 110293 109349 gene locus_tag LOCUS_02740 gene yrbG 110293 109349 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_02740 113737 110420 gene locus_tag LOCUS_02750 113737 110420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 113943 114302 gene locus_tag LOCUS_02760 113943 114302 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_02760 114302 115603 gene locus_tag LOCUS_02770 114302 115603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 115631 116761 gene locus_tag LOCUS_02780 115631 116761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 116837 117022 gene locus_tag LOCUS_02790 116837 117022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 117528 117019 gene locus_tag LOCUS_02800 gene apt 117528 117019 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6E1 protein_id gnl|my_center|LOCUS_02800 117643 117717 gene locus_tag LOCUS_t00040 117643 117717 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 119254 117908 gene locus_tag LOCUS_02810 119254 117908 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107493.1 protein_id gnl|my_center|LOCUS_02810 120590 119244 gene locus_tag LOCUS_02820 120590 119244 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794226.1 protein_id gnl|my_center|LOCUS_02820 120805 122058 gene locus_tag LOCUS_02830 120805 122058 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_02830 122105 122812 gene locus_tag LOCUS_02840 122105 122812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_02840 122881 125232 gene locus_tag LOCUS_02850 122881 125232 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_02850 125294 127660 gene locus_tag LOCUS_02860 125294 127660 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_02860 127806 128057 gene locus_tag LOCUS_02870 127806 128057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 128196 130523 gene locus_tag LOCUS_02880 128196 130523 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_02880 130549 131217 gene locus_tag LOCUS_02890 130549 131217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768705.1 protein_id gnl|my_center|LOCUS_02890 131708 131499 gene locus_tag LOCUS_02900 131708 131499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 132217 132011 gene locus_tag LOCUS_02910 132217 132011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 136511 132732 gene locus_tag LOCUS_02920 136511 132732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 137062 138753 gene locus_tag LOCUS_02930 gene ilvD 137062 138753 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 protein_id gnl|my_center|LOCUS_02930 138737 140446 gene locus_tag LOCUS_02940 gene ilvB 138737 140446 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_02940 140453 140992 gene locus_tag LOCUS_02950 gene ilvH 140453 140992 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_02950 141112 142158 gene locus_tag LOCUS_02960 141112 142158 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108126.1 protein_id gnl|my_center|LOCUS_02960 142518 143780 gene locus_tag LOCUS_02970 gene ilvA 142518 143780 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT3 protein_id gnl|my_center|LOCUS_02970 143967 145880 gene locus_tag LOCUS_02980 gene acsA 143967 145880 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_02980 146346 146071 gene locus_tag LOCUS_02990 146346 146071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 146345 147250 gene locus_tag LOCUS_03000 146345 147250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 147287 148924 gene locus_tag LOCUS_03010 147287 148924 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 protein_id gnl|my_center|LOCUS_03010 148921 149409 gene locus_tag LOCUS_03020 gene yncA 148921 149409 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963787.1 protein_id gnl|my_center|LOCUS_03020 149455 150636 gene locus_tag LOCUS_03030 149455 150636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 152186 150633 gene locus_tag LOCUS_03040 152186 150633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 152333 153505 gene locus_tag LOCUS_03050 gene leuA 152333 153505 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L6 protein_id gnl|my_center|LOCUS_03050 153650 155032 gene locus_tag LOCUS_03060 gene leuC 153650 155032 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L7 protein_id gnl|my_center|LOCUS_03060 155032 155622 gene locus_tag LOCUS_03070 155032 155622 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_03070 155766 156881 gene locus_tag LOCUS_03080 gene leuB 155766 156881 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54354 protein_id gnl|my_center|LOCUS_03080 157443 157066 gene locus_tag LOCUS_03090 157443 157066 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_03090 157575 158453 gene locus_tag LOCUS_03100 157575 158453 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265735.1 protein_id gnl|my_center|LOCUS_03100 159952 158528 gene locus_tag LOCUS_03110 159952 158528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 161674 160076 gene locus_tag LOCUS_03120 161674 160076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 162531 161770 gene locus_tag LOCUS_03130 162531 161770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 163729 162587 gene locus_tag LOCUS_03140 163729 162587 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957532.1 protein_id gnl|my_center|LOCUS_03140 163948 165237 gene locus_tag LOCUS_03150 163948 165237 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207773.1 protein_id gnl|my_center|LOCUS_03150 165337 166092 gene locus_tag LOCUS_03160 165337 166092 CDS product DNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207772.1 protein_id gnl|my_center|LOCUS_03160 166076 166339 gene locus_tag LOCUS_03170 166076 166339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 166567 167313 gene locus_tag LOCUS_03180 166567 167313 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_03180 167649 167374 gene locus_tag LOCUS_03190 gene clpS 167649 167374 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_03190 168534 167701 gene locus_tag LOCUS_03200 gene prmA 168534 167701 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_03200 169204 168572 gene locus_tag LOCUS_03210 gene queE 169204 168572 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_03210 169346 169897 gene locus_tag LOCUS_03220 169346 169897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 169899 170513 gene locus_tag LOCUS_03230 169899 170513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 170596 170781 gene locus_tag LOCUS_03240 170596 170781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 170800 171639 gene locus_tag LOCUS_03250 170800 171639 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_03250 171653 172456 gene locus_tag LOCUS_03260 171653 172456 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_03260 172507 172743 gene locus_tag LOCUS_03270 172507 172743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_03270 172747 173172 gene locus_tag LOCUS_03280 172747 173172 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_03280 173176 174255 gene locus_tag LOCUS_03290 173176 174255 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107805.1 protein_id gnl|my_center|LOCUS_03290 174257 174655 gene locus_tag LOCUS_03300 174257 174655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943067.1 protein_id gnl|my_center|LOCUS_03300 175585 174695 gene locus_tag LOCUS_03310 gene folD 175585 174695 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 protein_id gnl|my_center|LOCUS_03310 176994 175666 gene locus_tag LOCUS_03320 gene ffh 176994 175666 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 protein_id gnl|my_center|LOCUS_03320 >Feature sequence03 26 100 gene locus_tag LOCUS_t00050 26 100 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 610 1689 gene locus_tag LOCUS_03330 610 1689 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O24892 protein_id gnl|my_center|LOCUS_03330 1656 4529 gene locus_tag LOCUS_03340 1656 4529 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939035.1 protein_id gnl|my_center|LOCUS_03340 4536 5735 gene locus_tag LOCUS_03350 4536 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 5868 6299 gene locus_tag LOCUS_03360 5868 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 6303 8099 gene locus_tag LOCUS_03370 6303 8099 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046961.1 protein_id gnl|my_center|LOCUS_03370 8948 8397 gene locus_tag LOCUS_03380 8948 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 9130 13620 gene locus_tag LOCUS_03390 9130 13620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 14686 13667 gene locus_tag LOCUS_03400 14686 13667 CDS product quinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765036.1 protein_id gnl|my_center|LOCUS_03400 15103 14690 gene locus_tag LOCUS_03410 15103 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 15664 15269 gene locus_tag LOCUS_03420 15664 15269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 16777 15938 gene locus_tag LOCUS_03430 16777 15938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_03430 19360 16784 gene locus_tag LOCUS_03440 19360 16784 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_03440 20261 19413 gene locus_tag LOCUS_03450 20261 19413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 21049 20513 gene locus_tag LOCUS_03460 21049 20513 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005346.1 protein_id gnl|my_center|LOCUS_03460 24516 21244 gene locus_tag LOCUS_03470 24516 21244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 24739 25395 gene locus_tag LOCUS_03480 gene tal 24739 25395 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_03480 26883 25441 gene locus_tag LOCUS_03490 26883 25441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 27534 28298 gene locus_tag LOCUS_03500 27534 28298 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_03500 28308 30683 gene locus_tag LOCUS_03510 28308 30683 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_03510 32772 31504 gene locus_tag LOCUS_03520 32772 31504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 33437 34441 gene locus_tag LOCUS_03530 33437 34441 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_03530 34582 35886 gene locus_tag LOCUS_03540 gene wbpO 34582 35886 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_03540 36520 36963 gene locus_tag LOCUS_03550 36520 36963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 36956 37540 gene locus_tag LOCUS_03560 gene cysC 36956 37540 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CR04 protein_id gnl|my_center|LOCUS_03560 37600 38505 gene locus_tag LOCUS_03570 gene cysD 37600 38505 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_03570 38566 39822 gene locus_tag LOCUS_03580 gene cysN 38566 39822 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_03580 40499 41782 gene locus_tag LOCUS_03590 40499 41782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 41779 43032 gene locus_tag LOCUS_03600 41779 43032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 43022 43978 gene locus_tag LOCUS_03610 43022 43978 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975608.1 protein_id gnl|my_center|LOCUS_03610 43966 44937 gene locus_tag LOCUS_03620 43966 44937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 44937 46394 gene locus_tag LOCUS_03630 44937 46394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 46499 47380 gene locus_tag LOCUS_03640 46499 47380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 47412 48419 gene locus_tag LOCUS_03650 gene fnlA 47412 48419 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963420.1 protein_id gnl|my_center|LOCUS_03650 48458 49603 gene locus_tag LOCUS_03660 48458 49603 CDS product capsular polysaccharide biosynthesis protein Cap8F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202261.1 protein_id gnl|my_center|LOCUS_03660 49621 50037 gene locus_tag LOCUS_03670 49621 50037 CDS product sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963419.1 protein_id gnl|my_center|LOCUS_03670 50051 51187 gene locus_tag LOCUS_03680 gene fnlC 50051 51187 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963417.1 protein_id gnl|my_center|LOCUS_03680 51191 52384 gene locus_tag LOCUS_03690 51191 52384 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107242.1 protein_id gnl|my_center|LOCUS_03690 52381 53562 gene locus_tag LOCUS_03700 52381 53562 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957841.1 protein_id gnl|my_center|LOCUS_03700 53600 54211 gene locus_tag LOCUS_03710 gene wcgN 53600 54211 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963415.1 protein_id gnl|my_center|LOCUS_03710 54204 54527 gene locus_tag LOCUS_03720 54204 54527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 54531 55289 gene locus_tag LOCUS_03730 54531 55289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 56781 55321 gene locus_tag LOCUS_03740 gene gltD 56781 55321 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_03740 61298 56781 gene locus_tag LOCUS_03750 61298 56781 CDS product glutamate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_03750 62680 61538 gene locus_tag LOCUS_03760 62680 61538 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_03760 62773 63909 gene locus_tag LOCUS_03770 62773 63909 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_03770 64048 65274 gene locus_tag LOCUS_03780 64048 65274 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_03780 65448 66770 gene locus_tag LOCUS_03790 gene nhaB 65448 66770 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2S5 protein_id gnl|my_center|LOCUS_03790 66855 67547 gene locus_tag LOCUS_03800 66855 67547 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_03800 67549 67938 gene locus_tag LOCUS_03810 67549 67938 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_03810 67943 68824 gene locus_tag LOCUS_03820 67943 68824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964028.1 protein_id gnl|my_center|LOCUS_03820 68836 70059 gene locus_tag LOCUS_03830 gene folC 68836 70059 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_03830 70130 70205 gene locus_tag LOCUS_t00060 70130 70205 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 70253 70328 gene locus_tag LOCUS_t00070 70253 70328 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 71610 70336 gene locus_tag LOCUS_03840 gene murF 71610 70336 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_03840 73347 71677 gene locus_tag LOCUS_03850 gene gldJ 73347 71677 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_03850 73556 77329 gene locus_tag LOCUS_03860 gene porU 73556 77329 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_03860 77370 78539 gene locus_tag LOCUS_03870 gene porV 77370 78539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_03870 78629 79111 gene locus_tag LOCUS_03880 gene cdd 78629 79111 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_03880 79212 80210 gene locus_tag LOCUS_03890 gene pdhA 79212 80210 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_03890 80220 81896 gene locus_tag LOCUS_03900 gene pdhC 80220 81896 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_03900 81958 82956 gene locus_tag LOCUS_03910 81958 82956 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_03910 82966 83646 gene locus_tag LOCUS_03920 82966 83646 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_03920 83647 84246 gene locus_tag LOCUS_03930 83647 84246 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_03930 84249 85337 gene locus_tag LOCUS_03940 gene manC 84249 85337 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_03940 85341 86777 gene locus_tag LOCUS_03950 85341 86777 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_03950 86864 88483 gene locus_tag LOCUS_03960 86864 88483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109284.1 protein_id gnl|my_center|LOCUS_03960 88493 89071 gene locus_tag LOCUS_03970 88493 89071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 89846 89082 gene locus_tag LOCUS_03980 89846 89082 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_03980 90524 89847 gene locus_tag LOCUS_03990 90524 89847 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_03990 90701 92392 gene locus_tag LOCUS_04000 gene pafA 90701 92392 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_04000 93352 92504 gene locus_tag LOCUS_04010 93352 92504 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963505.1 protein_id gnl|my_center|LOCUS_04010 94425 93361 gene locus_tag LOCUS_04020 gene fabH1 94425 93361 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_04020 97466 94617 gene locus_tag LOCUS_04030 gene gcvP 97466 94617 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_04030 98081 97569 gene locus_tag LOCUS_04040 98081 97569 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYT0 protein_id gnl|my_center|LOCUS_04040 98164 99111 gene locus_tag LOCUS_04050 98164 99111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_04050 99210 99713 gene locus_tag LOCUS_04060 99210 99713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 99912 101015 gene locus_tag LOCUS_04070 99912 101015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 101372 103438 gene locus_tag LOCUS_04080 101372 103438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 103512 103982 gene locus_tag LOCUS_04090 103512 103982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 104137 106965 gene locus_tag LOCUS_04100 104137 106965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 106972 107622 gene locus_tag LOCUS_04110 106972 107622 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705044.1 protein_id gnl|my_center|LOCUS_04110 107707 108321 gene locus_tag LOCUS_04120 107707 108321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 protein_id gnl|my_center|LOCUS_04120 108552 109124 gene locus_tag LOCUS_04130 108552 109124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 109173 110270 gene locus_tag LOCUS_04140 gene paaE 109173 110270 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 protein_id gnl|my_center|LOCUS_04140 110464 111420 gene locus_tag LOCUS_04150 gene paaA 110464 111420 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_04150 111465 111812 gene locus_tag LOCUS_04160 111465 111812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 111891 112184 gene locus_tag LOCUS_04170 gene paaB 111891 112184 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_04170 112261 113016 gene locus_tag LOCUS_04180 gene paaC 112261 113016 CDS product 1,2-phenylacetyl-CoA epoxidase, subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76079 protein_id gnl|my_center|LOCUS_04180 113156 113656 gene locus_tag LOCUS_04190 gene paaD 113156 113656 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_04190 113735 114517 gene locus_tag LOCUS_04200 113735 114517 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 protein_id gnl|my_center|LOCUS_04200 114675 115043 gene locus_tag LOCUS_04210 114675 115043 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405056.1 protein_id gnl|my_center|LOCUS_04210 115117 116289 gene locus_tag LOCUS_04220 115117 116289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 116325 116696 gene locus_tag LOCUS_04230 116325 116696 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963264.1 protein_id gnl|my_center|LOCUS_04230 116693 117121 gene locus_tag LOCUS_04240 116693 117121 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096754.1 protein_id gnl|my_center|LOCUS_04240 117293 118504 gene locus_tag LOCUS_04250 gene pcaF 117293 118504 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973951.1 protein_id gnl|my_center|LOCUS_04250 118573 121089 gene locus_tag LOCUS_04260 118573 121089 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889007.1 protein_id gnl|my_center|LOCUS_04260 121313 122071 gene locus_tag LOCUS_04270 121313 122071 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_04270 122113 122436 gene locus_tag LOCUS_04280 122113 122436 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946237.1 protein_id gnl|my_center|LOCUS_04280 122481 123077 gene locus_tag LOCUS_04290 122481 123077 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123453.1 protein_id gnl|my_center|LOCUS_04290 123121 124425 gene locus_tag LOCUS_04300 gene bfmBB 123121 124425 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_04300 124608 126653 gene locus_tag LOCUS_04310 124608 126653 CDS product tungsten formylmethanofuran dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403352.1 protein_id gnl|my_center|LOCUS_04310 126882 127328 gene locus_tag LOCUS_04320 126882 127328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 128556 127411 gene locus_tag LOCUS_04330 128556 127411 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_04330 129179 128640 gene locus_tag LOCUS_04340 129179 128640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_04340 131288 129306 gene locus_tag LOCUS_04350 gene hutU 131288 129306 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_04350 131605 131420 gene locus_tag LOCUS_04360 131605 131420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 132469 131681 gene locus_tag LOCUS_04370 132469 131681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 132858 132547 gene locus_tag LOCUS_04380 132858 132547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 133019 133927 gene locus_tag LOCUS_04390 gene acdS 133019 133927 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_04390 133927 134802 gene locus_tag LOCUS_04400 133927 134802 CDS product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 protein_id gnl|my_center|LOCUS_04400 134817 136106 gene locus_tag LOCUS_04410 gene hemL 134817 136106 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW4 protein_id gnl|my_center|LOCUS_04410 136126 136560 gene locus_tag LOCUS_04420 gene yhdJ 136126 136560 CDS product putative N-acetyltransferase YhdJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07579 protein_id gnl|my_center|LOCUS_04420 138026 136563 gene locus_tag LOCUS_04430 138026 136563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_04430 138178 138978 gene locus_tag LOCUS_04440 138178 138978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_04440 140043 138967 gene locus_tag LOCUS_04450 140043 138967 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_04450 140809 140366 gene locus_tag LOCUS_04460 140809 140366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 141007 140813 gene locus_tag LOCUS_04470 gene rpsU 141007 140813 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_04470 142052 141183 gene locus_tag LOCUS_04480 gene rpoD 142052 141183 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_04480 144719 142071 gene locus_tag LOCUS_04490 144719 142071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962569.1 protein_id gnl|my_center|LOCUS_04490 145411 144716 gene locus_tag LOCUS_04500 145411 144716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 145509 146630 gene locus_tag LOCUS_04510 145509 146630 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962567.1 protein_id gnl|my_center|LOCUS_04510 147202 146660 gene locus_tag LOCUS_04520 147202 146660 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_04520 148344 147325 gene locus_tag LOCUS_04530 148344 147325 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097452.1 protein_id gnl|my_center|LOCUS_04530 148530 151121 gene locus_tag LOCUS_04540 gene mutS 148530 151121 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWN3 protein_id gnl|my_center|LOCUS_04540 151212 151285 gene locus_tag LOCUS_t00080 151212 151285 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence04 1162 437 gene locus_tag LOCUS_04550 1162 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 1289 2812 gene locus_tag LOCUS_04560 gene gltX 1289 2812 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 protein_id gnl|my_center|LOCUS_04560 3029 4036 gene locus_tag LOCUS_04570 3029 4036 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_04570 4339 4109 gene locus_tag LOCUS_04580 4339 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 4740 4336 gene locus_tag LOCUS_04590 4740 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 5121 4744 gene locus_tag LOCUS_04600 5121 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 6994 5318 gene locus_tag LOCUS_04610 gene glnS 6994 5318 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_04610 7229 8521 gene locus_tag LOCUS_04620 7229 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 8610 9272 gene locus_tag LOCUS_04630 8610 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 9298 9654 gene locus_tag LOCUS_04640 gene folB 9298 9654 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_04640 9706 9777 gene locus_tag LOCUS_t00090 9706 9777 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 10513 9812 gene locus_tag LOCUS_04650 10513 9812 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_04650 11240 10566 gene locus_tag LOCUS_04660 11240 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 13657 11453 gene locus_tag LOCUS_04670 gene rnr 13657 11453 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_04670 14058 14297 gene locus_tag LOCUS_04680 14058 14297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 14828 15259 gene locus_tag LOCUS_04690 gene rpiB 14828 15259 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_04690 15264 16166 gene locus_tag LOCUS_04700 gene czcD 15264 16166 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964573.1 protein_id gnl|my_center|LOCUS_04700 16170 16613 gene locus_tag LOCUS_04710 gene elaA 16170 16613 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_04710 16693 18228 gene locus_tag LOCUS_04720 16693 18228 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881759.1 protein_id gnl|my_center|LOCUS_04720 19242 18571 gene locus_tag LOCUS_04730 19242 18571 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_04730 20159 19377 gene locus_tag LOCUS_04740 20159 19377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 20672 20875 gene locus_tag LOCUS_04750 20672 20875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 21081 21293 gene locus_tag LOCUS_04760 21081 21293 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202295.1 protein_id gnl|my_center|LOCUS_04760 21964 21296 gene locus_tag LOCUS_04770 21964 21296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 21927 22094 gene locus_tag LOCUS_04780 21927 22094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 22592 22110 gene locus_tag LOCUS_04790 22592 22110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 22770 22585 gene locus_tag LOCUS_04800 22770 22585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 24395 22767 gene locus_tag LOCUS_04810 gene prc 24395 22767 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 protein_id gnl|my_center|LOCUS_04810 24769 24407 gene locus_tag LOCUS_04820 gene rnpA 24769 24407 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 protein_id gnl|my_center|LOCUS_04820 26912 25059 gene locus_tag LOCUS_04830 26912 25059 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_04830 28679 27006 gene locus_tag LOCUS_04840 28679 27006 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_04840 29548 28688 gene locus_tag LOCUS_04850 29548 28688 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_04850 29729 31621 gene locus_tag LOCUS_04860 29729 31621 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_04860 32379 31618 gene locus_tag LOCUS_04870 32379 31618 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J055 protein_id gnl|my_center|LOCUS_04870 32608 33186 gene locus_tag LOCUS_04880 32608 33186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 35040 33244 gene locus_tag LOCUS_04890 gene lepA 35040 33244 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_04890 35204 37606 gene locus_tag LOCUS_04900 35204 37606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 37761 38753 gene locus_tag LOCUS_04910 37761 38753 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_04910 39952 38750 gene locus_tag LOCUS_04920 39952 38750 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_04920 40349 39954 gene locus_tag LOCUS_04930 gene rbfA 40349 39954 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 protein_id gnl|my_center|LOCUS_04930 40410 40814 gene locus_tag LOCUS_04940 40410 40814 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_04940 40868 40942 gene locus_tag LOCUS_t00100 40868 40942 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 41062 41241 gene locus_tag LOCUS_04950 41062 41241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 41831 41244 gene locus_tag LOCUS_04960 gene ribE 41831 41244 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_04960 41885 42934 gene locus_tag LOCUS_04970 gene pdxA 41885 42934 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_04970 42994 43548 gene locus_tag LOCUS_04980 42994 43548 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_04980 43560 43757 gene locus_tag LOCUS_04990 gene rpmF 43560 43757 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_04990 43969 44973 gene locus_tag LOCUS_05000 gene fabH3 43969 44973 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_05000 44993 45502 gene locus_tag LOCUS_05010 gene accB 44993 45502 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_05010 45590 46948 gene locus_tag LOCUS_05020 gene accC 45590 46948 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_05020 47064 48038 gene locus_tag LOCUS_05030 47064 48038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 48038 48532 gene locus_tag LOCUS_05040 48038 48532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 48609 49304 gene locus_tag LOCUS_05050 gene mtgA 48609 49304 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H228 protein_id gnl|my_center|LOCUS_05050 49301 49750 gene locus_tag LOCUS_05060 49301 49750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 50081 49743 gene locus_tag LOCUS_05070 50081 49743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 51835 50144 gene locus_tag LOCUS_05080 gene recJ 51835 50144 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_05080 52451 51879 gene locus_tag LOCUS_05090 52451 51879 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894086.1 protein_id gnl|my_center|LOCUS_05090 52736 52464 gene locus_tag LOCUS_05100 52736 52464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 52851 53279 gene locus_tag LOCUS_05110 52851 53279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 53422 53817 gene locus_tag LOCUS_05120 53422 53817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 54543 53872 gene locus_tag LOCUS_05130 gene rsmI 54543 53872 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 protein_id gnl|my_center|LOCUS_05130 55637 54543 gene locus_tag LOCUS_05140 55637 54543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 55688 56332 gene locus_tag LOCUS_05150 gene tdk 55688 56332 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_05150 56376 57482 gene locus_tag LOCUS_05160 56376 57482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 57521 59389 gene locus_tag LOCUS_05170 57521 59389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 59465 59899 gene locus_tag LOCUS_05180 gene mscL 59465 59899 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI6 protein_id gnl|my_center|LOCUS_05180 60089 61075 gene locus_tag LOCUS_05190 gene asd 60089 61075 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_05190 61284 61538 gene locus_tag LOCUS_05200 61284 61538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 61787 64141 gene locus_tag LOCUS_05210 61787 64141 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107767.1 protein_id gnl|my_center|LOCUS_05210 64226 64525 gene locus_tag LOCUS_05220 64226 64525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 64536 65654 gene locus_tag LOCUS_05230 64536 65654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 65723 66760 gene locus_tag LOCUS_05240 65723 66760 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530437.1 protein_id gnl|my_center|LOCUS_05240 68280 66817 gene locus_tag LOCUS_05250 68280 66817 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_05250 68710 68339 gene locus_tag LOCUS_05260 68710 68339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44075 protein_id gnl|my_center|LOCUS_05260 69882 68761 gene locus_tag LOCUS_05270 69882 68761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_05270 71101 69947 gene locus_tag LOCUS_05280 71101 69947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964256.1 protein_id gnl|my_center|LOCUS_05280 72625 71297 gene locus_tag LOCUS_05290 72625 71297 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029304.1 protein_id gnl|my_center|LOCUS_05290 73152 72640 gene locus_tag LOCUS_05300 73152 72640 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_05300 74232 73246 gene locus_tag LOCUS_05310 74232 73246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 protein_id gnl|my_center|LOCUS_05310 74332 75429 gene locus_tag LOCUS_05320 gene smf 74332 75429 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_05320 76481 75510 gene locus_tag LOCUS_05330 gene trpS 76481 75510 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_05330 76555 77301 gene locus_tag LOCUS_05340 76555 77301 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_05340 78901 77375 gene locus_tag LOCUS_05350 78901 77375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 79446 78898 gene locus_tag LOCUS_05360 79446 78898 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_05360 79875 79453 gene locus_tag LOCUS_05370 79875 79453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 81084 79996 gene locus_tag LOCUS_05380 gene recA 81084 79996 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_05380 81401 82432 gene locus_tag LOCUS_05390 gene yceA 81401 82432 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL9 protein_id gnl|my_center|LOCUS_05390 82565 82786 gene locus_tag LOCUS_05400 82565 82786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 82962 84122 gene locus_tag LOCUS_05410 gene fjo17 82962 84122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_05410 84115 84597 gene locus_tag LOCUS_05420 gene gldH 84115 84597 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_05420 84722 86953 gene locus_tag LOCUS_05430 gene mrcA 84722 86953 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_05430 87063 87764 gene locus_tag LOCUS_05440 gene atoD 87063 87764 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_05440 87823 88476 gene locus_tag LOCUS_05450 gene atoA 87823 88476 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_05450 89598 88732 gene locus_tag LOCUS_05460 89598 88732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_05460 89693 90193 gene locus_tag LOCUS_05470 89693 90193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 91905 90220 gene locus_tag LOCUS_05480 gene gsiA 91905 90220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_05480 92341 95439 gene locus_tag LOCUS_05490 92341 95439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 96202 95489 gene locus_tag LOCUS_05500 96202 95489 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_05500 97476 96337 gene locus_tag LOCUS_05510 97476 96337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 97985 97512 gene locus_tag LOCUS_05520 gene ogt1 97985 97512 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN0 protein_id gnl|my_center|LOCUS_05520 99078 97966 gene locus_tag LOCUS_05530 99078 97966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_05530 100218 99226 gene locus_tag LOCUS_05540 gene hemB 100218 99226 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN2 protein_id gnl|my_center|LOCUS_05540 101227 100325 gene locus_tag LOCUS_05550 gene hemF 101227 100325 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_05550 101628 101224 gene locus_tag LOCUS_05560 101628 101224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 102134 101631 gene locus_tag LOCUS_05570 102134 101631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 103163 102135 gene locus_tag LOCUS_05580 gene hemE 103163 102135 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 protein_id gnl|my_center|LOCUS_05580 103816 103265 gene locus_tag LOCUS_05590 103816 103265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 104880 104233 gene locus_tag LOCUS_05600 gene hemD 104880 104233 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962223.1 protein_id gnl|my_center|LOCUS_05600 105562 104858 gene locus_tag LOCUS_05610 105562 104858 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 protein_id gnl|my_center|LOCUS_05610 107320 105575 gene locus_tag LOCUS_05620 107320 105575 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_05620 108234 107320 gene locus_tag LOCUS_05630 gene hemC 108234 107320 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP0 protein_id gnl|my_center|LOCUS_05630 109492 108236 gene locus_tag LOCUS_05640 gene hemA 109492 108236 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 protein_id gnl|my_center|LOCUS_05640 109695 110594 gene locus_tag LOCUS_05650 109695 110594 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_05650 110632 111315 gene locus_tag LOCUS_05660 110632 111315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 111381 112418 gene locus_tag LOCUS_05670 gene hemH 111381 112418 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_05670 112418 113797 gene locus_tag LOCUS_05680 112418 113797 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_05680 113833 114108 gene locus_tag LOCUS_05690 113833 114108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 114098 114385 gene locus_tag LOCUS_05700 114098 114385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 114386 114934 gene locus_tag LOCUS_05710 114386 114934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_05710 115040 116449 gene locus_tag LOCUS_05720 115040 116449 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_05720 116454 117236 gene locus_tag LOCUS_05730 gene crt 116454 117236 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_05730 117359 118945 gene locus_tag LOCUS_05740 117359 118945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 119021 120094 gene locus_tag LOCUS_05750 119021 120094 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958153.1 protein_id gnl|my_center|LOCUS_05750 120696 120097 gene locus_tag LOCUS_05760 120696 120097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 121423 120770 gene locus_tag LOCUS_05770 121423 120770 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_05770 122420 121428 gene locus_tag LOCUS_05780 122420 121428 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_05780 123168 122431 gene locus_tag LOCUS_05790 gene plsC 123168 122431 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_05790 123736 123326 gene locus_tag LOCUS_05800 gene yqiW 123736 123326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_05800 124035 123850 gene locus_tag LOCUS_05810 124035 123850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 123950 124699 gene locus_tag LOCUS_05820 gene djlA 123950 124699 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45885 protein_id gnl|my_center|LOCUS_05820 124879 125634 gene locus_tag LOCUS_05830 gene lpxH 124879 125634 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_05830 126713 125739 gene locus_tag LOCUS_05840 126713 125739 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_05840 126798 127700 gene locus_tag LOCUS_05850 126798 127700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence05 189 1583 gene locus_tag LOCUS_05860 gene trpE 189 1583 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_05860 1712 2305 gene locus_tag LOCUS_05870 gene pabA 1712 2305 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_05870 2479 3471 gene locus_tag LOCUS_05880 gene trpD 2479 3471 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_05880 3471 4265 gene locus_tag LOCUS_05890 gene trpC 3471 4265 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_05890 4439 5347 gene locus_tag LOCUS_05900 4439 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 5344 6531 gene locus_tag LOCUS_05910 gene trpB 5344 6531 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_05910 6714 7478 gene locus_tag LOCUS_05920 gene trpA 6714 7478 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_05920 8178 7639 gene locus_tag LOCUS_05930 8178 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_05930 8286 10118 gene locus_tag LOCUS_05940 gene yfbK 8286 10118 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962713.1 protein_id gnl|my_center|LOCUS_05940 10299 10652 gene locus_tag LOCUS_05950 10299 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 10912 11553 gene locus_tag LOCUS_05960 10912 11553 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962669.1 protein_id gnl|my_center|LOCUS_05960 11543 12862 gene locus_tag LOCUS_05970 11543 12862 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962668.1 protein_id gnl|my_center|LOCUS_05970 12865 13962 gene locus_tag LOCUS_05980 12865 13962 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962667.1 protein_id gnl|my_center|LOCUS_05980 13966 15561 gene locus_tag LOCUS_05990 13966 15561 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962666.1 protein_id gnl|my_center|LOCUS_05990 15812 15955 gene locus_tag LOCUS_06000 15812 15955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 16085 16732 gene locus_tag LOCUS_06010 16085 16732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 16829 18148 gene locus_tag LOCUS_06020 gene phrB3 16829 18148 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964143.1 protein_id gnl|my_center|LOCUS_06020 18266 19714 gene locus_tag LOCUS_06030 18266 19714 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964142.1 protein_id gnl|my_center|LOCUS_06030 19801 19959 gene locus_tag LOCUS_06040 19801 19959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 19937 20155 gene locus_tag LOCUS_06050 19937 20155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 20274 20909 gene locus_tag LOCUS_06060 20274 20909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 21036 22307 gene locus_tag LOCUS_06070 gene kynU 21036 22307 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_06070 22307 23698 gene locus_tag LOCUS_06080 gene kmo 22307 23698 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_06080 23883 24644 gene locus_tag LOCUS_06090 23883 24644 CDS product putative hydratase/decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705098.1 protein_id gnl|my_center|LOCUS_06090 24677 25174 gene locus_tag LOCUS_06100 24677 25174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 25817 27265 gene locus_tag LOCUS_06110 25817 27265 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095454.1 protein_id gnl|my_center|LOCUS_06110 27344 28129 gene locus_tag LOCUS_06120 27344 28129 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_06120 28299 29381 gene locus_tag LOCUS_06130 28299 29381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 29381 30022 gene locus_tag LOCUS_06140 29381 30022 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_06140 30592 30017 gene locus_tag LOCUS_06150 30592 30017 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_06150 30880 30602 gene locus_tag LOCUS_06160 30880 30602 CDS product Sec-independent protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964182.1 protein_id gnl|my_center|LOCUS_06160 33275 30963 gene locus_tag LOCUS_06170 33275 30963 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_06170 33803 33300 gene locus_tag LOCUS_06180 33803 33300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964227.1 protein_id gnl|my_center|LOCUS_06180 34582 33800 gene locus_tag LOCUS_06190 34582 33800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 35286 34573 gene locus_tag LOCUS_06200 35286 34573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 36078 35356 gene locus_tag LOCUS_06210 36078 35356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 36261 36965 gene locus_tag LOCUS_06220 gene pepE 36261 36965 CDS product dipeptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_06220 36965 37879 gene locus_tag LOCUS_06230 gene glsA1 36965 37879 CDS product glutaminase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZHF1 protein_id gnl|my_center|LOCUS_06230 38075 38002 gene locus_tag LOCUS_t00110 38075 38002 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 38190 38741 gene locus_tag LOCUS_06240 gene clpP 38190 38741 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA83 protein_id gnl|my_center|LOCUS_06240 38748 39032 gene locus_tag LOCUS_06250 38748 39032 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025680.1 protein_id gnl|my_center|LOCUS_06250 39037 39480 gene locus_tag LOCUS_06260 gene yitI 39037 39480 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964230.1 protein_id gnl|my_center|LOCUS_06260 39551 40213 gene locus_tag LOCUS_06270 39551 40213 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172351.1 protein_id gnl|my_center|LOCUS_06270 40300 41817 gene locus_tag LOCUS_06280 gene gpmI 40300 41817 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_06280 41817 42356 gene locus_tag LOCUS_06290 41817 42356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 42368 42787 gene locus_tag LOCUS_06300 42368 42787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788667.1 protein_id gnl|my_center|LOCUS_06300 42787 43593 gene locus_tag LOCUS_06310 gene map 42787 43593 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_06310 43574 44152 gene locus_tag LOCUS_06320 43574 44152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 44154 44930 gene locus_tag LOCUS_06330 44154 44930 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_06330 45865 44927 gene locus_tag LOCUS_06340 45865 44927 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_06340 46274 45918 gene locus_tag LOCUS_06350 46274 45918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 47642 46353 gene locus_tag LOCUS_06360 gene nqrF 47642 46353 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_06360 48276 47659 gene locus_tag LOCUS_06370 gene nqrE 48276 47659 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR7 protein_id gnl|my_center|LOCUS_06370 49051 48299 gene locus_tag LOCUS_06380 gene nqrD 49051 48299 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_06380 49742 49059 gene locus_tag LOCUS_06390 gene nqrC 49742 49059 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 protein_id gnl|my_center|LOCUS_06390 50967 49798 gene locus_tag LOCUS_06400 gene nqrB 50967 49798 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US0 protein_id gnl|my_center|LOCUS_06400 52328 50982 gene locus_tag LOCUS_06410 gene nqrA 52328 50982 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_06410 52525 53775 gene locus_tag LOCUS_06420 52525 53775 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_06420 53780 54775 gene locus_tag LOCUS_06430 53780 54775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141810.1 protein_id gnl|my_center|LOCUS_06430 54777 55163 gene locus_tag LOCUS_06440 gene apaG 54777 55163 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_06440 55876 55160 gene locus_tag LOCUS_06450 55876 55160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_06450 56021 57649 gene locus_tag LOCUS_06460 gene pruA 56021 57649 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_06460 58489 57857 gene locus_tag LOCUS_06470 gene rsmG 58489 57857 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_06470 59341 58592 gene locus_tag LOCUS_06480 59341 58592 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250526.1 protein_id gnl|my_center|LOCUS_06480 59469 60572 gene locus_tag LOCUS_06490 59469 60572 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_06490 60597 61787 gene locus_tag LOCUS_06500 gene aspC1 60597 61787 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_06500 61791 62954 gene locus_tag LOCUS_06510 gene purT 61791 62954 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP9 protein_id gnl|my_center|LOCUS_06510 64506 63010 gene locus_tag LOCUS_06520 64506 63010 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_06520 65855 64506 gene locus_tag LOCUS_06530 65855 64506 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_06530 65991 66719 gene locus_tag LOCUS_06540 gene menG 65991 66719 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_06540 66724 67419 gene locus_tag LOCUS_06550 gene porT 66724 67419 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_06550 68145 67423 gene locus_tag LOCUS_06560 68145 67423 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_06560 68277 70754 gene locus_tag LOCUS_06570 68277 70754 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_06570 70806 71873 gene locus_tag LOCUS_06580 gene fbaA 70806 71873 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_06580 71906 72763 gene locus_tag LOCUS_06590 gene accD 71906 72763 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_06590 73465 72824 gene locus_tag LOCUS_06600 73465 72824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 73652 73921 gene locus_tag LOCUS_06610 gene rpsO 73652 73921 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H184 protein_id gnl|my_center|LOCUS_06610 74079 76250 gene locus_tag LOCUS_06620 gene pnp 74079 76250 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H185 protein_id gnl|my_center|LOCUS_06620 76537 77340 gene locus_tag LOCUS_06630 gene proC 76537 77340 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFV0 protein_id gnl|my_center|LOCUS_06630 77361 78137 gene locus_tag LOCUS_06640 77361 78137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 78167 79366 gene locus_tag LOCUS_06650 gene proA 78167 79366 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0D2 protein_id gnl|my_center|LOCUS_06650 79562 80425 gene locus_tag LOCUS_06660 gene rpoD 79562 80425 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_06660 80593 81000 gene locus_tag LOCUS_06670 80593 81000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 81053 81712 gene locus_tag LOCUS_06680 gene rpe 81053 81712 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_06680 81699 82685 gene locus_tag LOCUS_06690 81699 82685 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_06690 82695 83441 gene locus_tag LOCUS_06700 82695 83441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_06700 84262 83438 gene locus_tag LOCUS_06710 84262 83438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964150.1 protein_id gnl|my_center|LOCUS_06710 84350 85480 gene locus_tag LOCUS_06720 84350 85480 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 protein_id gnl|my_center|LOCUS_06720 85477 86625 gene locus_tag LOCUS_06730 gene alr 85477 86625 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_06730 86680 87732 gene locus_tag LOCUS_06740 gene czcO 86680 87732 CDS product putative oxidoreductase CzcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07085 protein_id gnl|my_center|LOCUS_06740 88331 87924 gene locus_tag LOCUS_06750 88331 87924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107464.1 protein_id gnl|my_center|LOCUS_06750 88773 88333 gene locus_tag LOCUS_06760 88773 88333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 88843 90075 gene locus_tag LOCUS_06770 88843 90075 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_06770 90065 91015 gene locus_tag LOCUS_06780 90065 91015 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103265.1 protein_id gnl|my_center|LOCUS_06780 91521 91027 gene locus_tag LOCUS_06790 91521 91027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 91857 91531 gene locus_tag LOCUS_06800 91857 91531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 92683 92072 gene locus_tag LOCUS_06810 gene paiB 92683 92072 CDS product protease synthase and sporulation protein PAI 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21341 protein_id gnl|my_center|LOCUS_06810 93204 92683 gene locus_tag LOCUS_06820 93204 92683 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119942.1 protein_id gnl|my_center|LOCUS_06820 93759 93280 gene locus_tag LOCUS_06830 93759 93280 CDS product TspO/MBR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_06830 93858 94940 gene locus_tag LOCUS_06840 gene mvaD 93858 94940 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_06840 94963 95901 gene locus_tag LOCUS_06850 gene mvaK 94963 95901 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_06850 95918 96832 gene locus_tag LOCUS_06860 95918 96832 CDS product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_06860 96932 97765 gene locus_tag LOCUS_06870 96932 97765 CDS product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962486.1 protein_id gnl|my_center|LOCUS_06870 98223 97804 gene locus_tag LOCUS_06880 98223 97804 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403972.1 protein_id gnl|my_center|LOCUS_06880 99409 98342 gene locus_tag LOCUS_06890 99409 98342 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962430.1 protein_id gnl|my_center|LOCUS_06890 100385 99372 gene locus_tag LOCUS_06900 gene metX 100385 99372 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW98 protein_id gnl|my_center|LOCUS_06900 101681 100389 gene locus_tag LOCUS_06910 gene metY 101681 100389 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962432.1 protein_id gnl|my_center|LOCUS_06910 102463 103719 gene locus_tag LOCUS_06920 gene metK 102463 103719 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_06920 103813 104394 gene locus_tag LOCUS_06930 103813 104394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 104426 105286 gene locus_tag LOCUS_06940 104426 105286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 105289 105660 gene locus_tag LOCUS_06950 105289 105660 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_06950 105772 107625 gene locus_tag LOCUS_06960 105772 107625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 107728 108369 gene locus_tag LOCUS_06970 107728 108369 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YL4 protein_id gnl|my_center|LOCUS_06970 109642 108371 gene locus_tag LOCUS_06980 109642 108371 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_06980 112098 109861 gene locus_tag LOCUS_06990 112098 109861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 114368 112224 gene locus_tag LOCUS_07000 114368 112224 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964572.1 protein_id gnl|my_center|LOCUS_07000 115109 115690 gene locus_tag LOCUS_07010 115109 115690 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence06 873 520 gene locus_tag LOCUS_07020 873 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 1435 965 gene locus_tag LOCUS_07030 1435 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 2091 1498 gene locus_tag LOCUS_07040 2091 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 2697 2293 gene locus_tag LOCUS_07050 2697 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 2946 4484 gene locus_tag LOCUS_07060 2946 4484 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_07060 4492 5649 gene locus_tag LOCUS_07070 4492 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121577.1 protein_id gnl|my_center|LOCUS_07070 6125 6856 gene locus_tag LOCUS_07080 6125 6856 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45347 protein_id gnl|my_center|LOCUS_07080 6860 7594 gene locus_tag LOCUS_07090 6860 7594 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851148.1 protein_id gnl|my_center|LOCUS_07090 7584 8444 gene locus_tag LOCUS_07100 gene kipA 7584 8444 CDS product KipI antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WY77 protein_id gnl|my_center|LOCUS_07100 8467 9108 gene locus_tag LOCUS_07110 8467 9108 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_07110 10014 9319 gene locus_tag LOCUS_07120 10014 9319 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_07120 10718 10023 gene locus_tag LOCUS_07130 10718 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 11508 11158 gene locus_tag LOCUS_07140 gene yfhL 11508 11158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31580 protein_id gnl|my_center|LOCUS_07140 12014 11508 gene locus_tag LOCUS_07150 12014 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_07150 12397 12014 gene locus_tag LOCUS_07160 12397 12014 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963608.1 protein_id gnl|my_center|LOCUS_07160 12957 12394 gene locus_tag LOCUS_07170 12957 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963609.1 protein_id gnl|my_center|LOCUS_07170 13779 12961 gene locus_tag LOCUS_07180 gene panB 13779 12961 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_07180 13843 14298 gene locus_tag LOCUS_07190 13843 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404629.1 protein_id gnl|my_center|LOCUS_07190 14341 15513 gene locus_tag LOCUS_07200 14341 15513 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_07200 17043 15583 gene locus_tag LOCUS_07210 17043 15583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_07210 17160 17921 gene locus_tag LOCUS_07220 gene phnP 17160 17921 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_07220 17940 18428 gene locus_tag LOCUS_07230 17940 18428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963236.1 protein_id gnl|my_center|LOCUS_07230 19078 18425 gene locus_tag LOCUS_07240 19078 18425 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_07240 19410 19078 gene locus_tag LOCUS_07250 19410 19078 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963234.1 protein_id gnl|my_center|LOCUS_07250 20660 19410 gene locus_tag LOCUS_07260 gene pyrC2 20660 19410 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_07260 22592 20670 gene locus_tag LOCUS_07270 22592 20670 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_07270 23891 22662 gene locus_tag LOCUS_07280 23891 22662 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268185.1 protein_id gnl|my_center|LOCUS_07280 24718 23945 gene locus_tag LOCUS_07290 24718 23945 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_07290 26423 24711 gene locus_tag LOCUS_07300 26423 24711 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879752.1 protein_id gnl|my_center|LOCUS_07300 27086 26427 gene locus_tag LOCUS_07310 gene lolD 27086 26427 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_07310 27216 27761 gene locus_tag LOCUS_07320 gene msrA 27216 27761 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_07320 27806 28099 gene locus_tag LOCUS_07330 27806 28099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962796.1 protein_id gnl|my_center|LOCUS_07330 28499 28155 gene locus_tag LOCUS_07340 28499 28155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 28967 28590 gene locus_tag LOCUS_07350 28967 28590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 30204 29008 gene locus_tag LOCUS_07360 gene ald 30204 29008 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_07360 30641 30267 gene locus_tag LOCUS_07370 30641 30267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 30882 30727 gene locus_tag LOCUS_07380 30882 30727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 31479 31036 gene locus_tag LOCUS_07390 31479 31036 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_07390 33036 31486 gene locus_tag LOCUS_07400 gene porX 33036 31486 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_07400 33072 34298 gene locus_tag LOCUS_07410 33072 34298 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_07410 34329 35363 gene locus_tag LOCUS_07420 gene lpxD 34329 35363 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_07420 35350 36753 gene locus_tag LOCUS_07430 gene fabZ 35350 36753 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_07430 36757 37539 gene locus_tag LOCUS_07440 gene lpxA 36757 37539 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_07440 37552 38118 gene locus_tag LOCUS_07450 gene efp 37552 38118 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_07450 38137 39069 gene locus_tag LOCUS_07460 38137 39069 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_07460 39071 39481 gene locus_tag LOCUS_07470 39071 39481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963120.1 protein_id gnl|my_center|LOCUS_07470 39546 40418 gene locus_tag LOCUS_07480 gene sucD 39546 40418 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_07480 40578 43508 gene locus_tag LOCUS_07490 40578 43508 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963047.1 protein_id gnl|my_center|LOCUS_07490 43623 44369 gene locus_tag LOCUS_07500 43623 44369 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_07500 44457 46478 gene locus_tag LOCUS_07510 44457 46478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_07510 46554 47306 gene locus_tag LOCUS_07520 46554 47306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 47533 48384 gene locus_tag LOCUS_07530 gene hisG 47533 48384 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY81 protein_id gnl|my_center|LOCUS_07530 48428 49714 gene locus_tag LOCUS_07540 gene hisD 48428 49714 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY80 protein_id gnl|my_center|LOCUS_07540 49849 50904 gene locus_tag LOCUS_07550 gene hisC 49849 50904 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY79 protein_id gnl|my_center|LOCUS_07550 51093 52235 gene locus_tag LOCUS_07560 gene hisB 51093 52235 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 protein_id gnl|my_center|LOCUS_07560 52468 53049 gene locus_tag LOCUS_07570 gene hisH 52468 53049 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY77 protein_id gnl|my_center|LOCUS_07570 53201 53926 gene locus_tag LOCUS_07580 gene hisA 53201 53926 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_07580 54139 54894 gene locus_tag LOCUS_07590 gene hisF 54139 54894 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_07590 55074 55670 gene locus_tag LOCUS_07600 gene hisIE 55074 55670 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 protein_id gnl|my_center|LOCUS_07600 55670 56314 gene locus_tag LOCUS_07610 55670 56314 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019355.1 protein_id gnl|my_center|LOCUS_07610 56824 56660 gene locus_tag LOCUS_07620 56824 56660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 56981 58312 gene locus_tag LOCUS_07630 gene rhlE 56981 58312 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_07630 58490 59170 gene locus_tag LOCUS_07640 58490 59170 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_07640 60204 59320 gene locus_tag LOCUS_07650 gene cysM 60204 59320 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_07650 60986 60201 gene locus_tag LOCUS_07660 60986 60201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 61140 61925 gene locus_tag LOCUS_07670 gene truA1 61140 61925 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CJ2 protein_id gnl|my_center|LOCUS_07670 61988 62683 gene locus_tag LOCUS_07680 61988 62683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 63150 62686 gene locus_tag LOCUS_07690 63150 62686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 64295 63213 gene locus_tag LOCUS_07700 gene corA 64295 63213 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I04 protein_id gnl|my_center|LOCUS_07700 64724 64317 gene locus_tag LOCUS_07710 64724 64317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_07710 64905 66266 gene locus_tag LOCUS_07720 64905 66266 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709100.1 protein_id gnl|my_center|LOCUS_07720 66382 66456 gene locus_tag LOCUS_t00120 66382 66456 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 67541 67957 gene locus_tag LOCUS_07730 67541 67957 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MJ80 protein_id gnl|my_center|LOCUS_07730 67966 68910 gene locus_tag LOCUS_07740 67966 68910 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722809.1 protein_id gnl|my_center|LOCUS_07740 69871 69032 gene locus_tag LOCUS_07750 69871 69032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 71194 69938 gene locus_tag LOCUS_07760 71194 69938 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017031.1 protein_id gnl|my_center|LOCUS_07760 74369 71250 gene locus_tag LOCUS_07770 74369 71250 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261805.1 protein_id gnl|my_center|LOCUS_07770 75397 74381 gene locus_tag LOCUS_07780 75397 74381 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402870.1 protein_id gnl|my_center|LOCUS_07780 76051 75467 gene locus_tag LOCUS_07790 76051 75467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 77432 76425 gene locus_tag LOCUS_07800 77432 76425 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_07800 77589 77674 gene locus_tag LOCUS_t00130 77589 77674 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 78370 78152 gene locus_tag LOCUS_07810 78370 78152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 78585 79181 gene locus_tag LOCUS_07820 gene wrbA 78585 79181 CDS product trp repressor-binding protein WrbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337407.1 protein_id gnl|my_center|LOCUS_07820 79909 79250 gene locus_tag LOCUS_07830 79909 79250 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_07830 81045 80005 gene locus_tag LOCUS_07840 81045 80005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 83014 81050 gene locus_tag LOCUS_07850 83014 81050 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_07850 83432 83145 gene locus_tag LOCUS_07860 83432 83145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 84410 83511 gene locus_tag LOCUS_07870 84410 83511 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015755.1 protein_id gnl|my_center|LOCUS_07870 85520 84435 gene locus_tag LOCUS_07880 gene gcvT 85520 84435 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_07880 86950 85658 gene locus_tag LOCUS_07890 86950 85658 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_07890 88023 87100 gene locus_tag LOCUS_07900 gene thrB 88023 87100 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_07900 90474 88027 gene locus_tag LOCUS_07910 90474 88027 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_07910 90754 92259 gene locus_tag LOCUS_07920 90754 92259 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ4 protein_id gnl|my_center|LOCUS_07920 92330 93856 gene locus_tag LOCUS_07930 gene hutH1 92330 93856 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW5 protein_id gnl|my_center|LOCUS_07930 94223 93846 gene locus_tag LOCUS_07940 94223 93846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 94691 94278 gene locus_tag LOCUS_07950 94691 94278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 97303 94739 gene locus_tag LOCUS_07960 gene clpA 97303 94739 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_07960 97546 100077 gene locus_tag LOCUS_07970 gene gyrA 97546 100077 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_07970 100081 101352 gene locus_tag LOCUS_07980 100081 101352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962908.1 protein_id gnl|my_center|LOCUS_07980 101402 101563 gene locus_tag LOCUS_07990 101402 101563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 102615 101863 gene locus_tag LOCUS_08000 102615 101863 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_08000 103817 102639 gene locus_tag LOCUS_08010 103817 102639 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_08010 103934 105991 gene locus_tag LOCUS_08020 103934 105991 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762019.1 protein_id gnl|my_center|LOCUS_08020 106016 106915 gene locus_tag LOCUS_08030 106016 106915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121591.1 protein_id gnl|my_center|LOCUS_08030 106912 107334 gene locus_tag LOCUS_08040 106912 107334 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963099.1 protein_id gnl|my_center|LOCUS_08040 107396 107788 gene locus_tag LOCUS_08050 107396 107788 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963098.1 protein_id gnl|my_center|LOCUS_08050 108648 108361 gene locus_tag LOCUS_08060 gene ydzA 108648 108361 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_08060 108925 109533 gene locus_tag LOCUS_08070 108925 109533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence07 105 890 gene locus_tag LOCUS_08080 105 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_08080 1017 1622 gene locus_tag LOCUS_08090 1017 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 1629 2294 gene locus_tag LOCUS_08100 gene msrA 1629 2294 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_08100 2648 2295 gene locus_tag LOCUS_08110 2648 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122309.1 protein_id gnl|my_center|LOCUS_08110 2746 4143 gene locus_tag LOCUS_08120 gene mnmE 2746 4143 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_08120 4813 4280 gene locus_tag LOCUS_08130 4813 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 5130 5273 gene locus_tag LOCUS_08140 5130 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 5276 5860 gene locus_tag LOCUS_08150 5276 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 6271 6858 gene locus_tag LOCUS_08160 6271 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 6868 7587 gene locus_tag LOCUS_08170 6868 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 7584 8294 gene locus_tag LOCUS_08180 7584 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 8482 9798 gene locus_tag LOCUS_08190 8482 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994245.1 protein_id gnl|my_center|LOCUS_08190 9782 10555 gene locus_tag LOCUS_08200 9782 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016982.1 protein_id gnl|my_center|LOCUS_08200 10614 10799 gene locus_tag LOCUS_08210 10614 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 10831 12306 gene locus_tag LOCUS_08220 10831 12306 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288614.1 protein_id gnl|my_center|LOCUS_08220 12364 12690 gene locus_tag LOCUS_08230 12364 12690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 13243 12683 gene locus_tag LOCUS_08240 13243 12683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 13405 15813 gene locus_tag LOCUS_08250 gene ccoI 13405 15813 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_08250 15797 16402 gene locus_tag LOCUS_08260 gene pdxH 15797 16402 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 protein_id gnl|my_center|LOCUS_08260 16608 16811 gene locus_tag LOCUS_08270 16608 16811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 16814 19012 gene locus_tag LOCUS_08280 gene ccoN/ccoO 16814 19012 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_08280 19024 19209 gene locus_tag LOCUS_08290 19024 19209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 19206 20177 gene locus_tag LOCUS_08300 gene ccoP 19206 20177 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_08300 20308 21729 gene locus_tag LOCUS_08310 gene ccoG 20308 21729 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_08310 21782 22231 gene locus_tag LOCUS_08320 gene ccoH 21782 22231 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_08320 22623 23279 gene locus_tag LOCUS_08330 22623 23279 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_08330 23369 24784 gene locus_tag LOCUS_08340 gene cstA 23369 24784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627647.1 protein_id gnl|my_center|LOCUS_08340 24911 26179 gene locus_tag LOCUS_08350 24911 26179 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_08350 27175 26450 gene locus_tag LOCUS_08360 27175 26450 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966116.1 protein_id gnl|my_center|LOCUS_08360 27871 27227 gene locus_tag LOCUS_08370 27871 27227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 28704 27868 gene locus_tag LOCUS_08380 28704 27868 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122415.1 protein_id gnl|my_center|LOCUS_08380 30128 28773 gene locus_tag LOCUS_08390 30128 28773 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108638.1 protein_id gnl|my_center|LOCUS_08390 30748 30164 gene locus_tag LOCUS_08400 30748 30164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963063.1 protein_id gnl|my_center|LOCUS_08400 31019 30756 gene locus_tag LOCUS_08410 31019 30756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963064.1 protein_id gnl|my_center|LOCUS_08410 31190 31483 gene locus_tag LOCUS_08420 31190 31483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 31490 31873 gene locus_tag LOCUS_08430 31490 31873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 33351 31990 gene locus_tag LOCUS_08440 gene hemN 33351 31990 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_08440 34181 33363 gene locus_tag LOCUS_08450 34181 33363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 35425 34340 gene locus_tag LOCUS_08460 35425 34340 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_08460 36618 35566 gene locus_tag LOCUS_08470 36618 35566 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 protein_id gnl|my_center|LOCUS_08470 37862 36630 gene locus_tag LOCUS_08480 37862 36630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 37994 38293 gene locus_tag LOCUS_08490 37994 38293 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_08490 38293 38937 gene locus_tag LOCUS_08500 38293 38937 CDS product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_08500 38973 39773 gene locus_tag LOCUS_08510 38973 39773 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201260.1 protein_id gnl|my_center|LOCUS_08510 39947 43399 gene locus_tag LOCUS_08520 gene pyc 39947 43399 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE8 protein_id gnl|my_center|LOCUS_08520 43551 44213 gene locus_tag LOCUS_08530 43551 44213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 45076 44267 gene locus_tag LOCUS_08540 45076 44267 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_08540 46197 45205 gene locus_tag LOCUS_08550 46197 45205 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_08550 46596 46207 gene locus_tag LOCUS_08560 46596 46207 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_08560 46686 47696 gene locus_tag LOCUS_08570 gene holA 46686 47696 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_08570 47697 48599 gene locus_tag LOCUS_08580 gene menA 47697 48599 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW2 protein_id gnl|my_center|LOCUS_08580 49971 48655 gene locus_tag LOCUS_08590 49971 48655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 50769 50047 gene locus_tag LOCUS_08600 50769 50047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 52635 50806 gene locus_tag LOCUS_08610 52635 50806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 52846 53328 gene locus_tag LOCUS_08620 52846 53328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 53344 54999 gene locus_tag LOCUS_08630 53344 54999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 55181 55861 gene locus_tag LOCUS_08640 gene ytkL 55181 55861 CDS product UPF0173 metal-dependent hydrolase YtkL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q795U4 protein_id gnl|my_center|LOCUS_08640 55861 56901 gene locus_tag LOCUS_08650 gene menC 55861 56901 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_08650 56903 57841 gene locus_tag LOCUS_08660 gene yyaK 56903 57841 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_08660 57913 59019 gene locus_tag LOCUS_08670 gene menE 57913 59019 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_08670 59466 59011 gene locus_tag LOCUS_08680 59466 59011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 61042 59456 gene locus_tag LOCUS_08690 61042 59456 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_08690 62542 61241 gene locus_tag LOCUS_08700 62542 61241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 63381 62743 gene locus_tag LOCUS_08710 63381 62743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 63649 65634 gene locus_tag LOCUS_08720 63649 65634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 67354 65711 gene locus_tag LOCUS_08730 67354 65711 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_08730 67657 67839 gene locus_tag LOCUS_08740 67657 67839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963197.1 protein_id gnl|my_center|LOCUS_08740 67930 68385 gene locus_tag LOCUS_08750 67930 68385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 68544 70235 gene locus_tag LOCUS_08760 68544 70235 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 protein_id gnl|my_center|LOCUS_08760 70743 70288 gene locus_tag LOCUS_08770 70743 70288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 70930 72864 gene locus_tag LOCUS_08780 70930 72864 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_08780 72857 73717 gene locus_tag LOCUS_08790 72857 73717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 73680 75146 gene locus_tag LOCUS_08800 gene surA 73680 75146 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT1 protein_id gnl|my_center|LOCUS_08800 75155 76108 gene locus_tag LOCUS_08810 75155 76108 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_08810 76395 78659 gene locus_tag LOCUS_08820 gene acnA 76395 78659 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_08820 79577 78732 gene locus_tag LOCUS_08830 79577 78732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 80033 79590 gene locus_tag LOCUS_08840 80033 79590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 81380 80097 gene locus_tag LOCUS_08850 81380 80097 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_08850 82054 81377 gene locus_tag LOCUS_08860 82054 81377 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_08860 82183 82617 gene locus_tag LOCUS_08870 82183 82617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 83527 82682 gene locus_tag LOCUS_08880 83527 82682 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289273.1 protein_id gnl|my_center|LOCUS_08880 83644 84204 gene locus_tag LOCUS_08890 83644 84204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 85344 84205 gene locus_tag LOCUS_08900 gene crtY 85344 84205 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_08900 86391 85372 gene locus_tag LOCUS_08910 gene cysP 86391 85372 CDS product sulfate permease CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34734 protein_id gnl|my_center|LOCUS_08910 87122 86394 gene locus_tag LOCUS_08920 87122 86394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 87631 87200 gene locus_tag LOCUS_08930 87631 87200 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_08930 88134 87685 gene locus_tag LOCUS_08940 gene crtZ 88134 87685 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_08940 89126 88275 gene locus_tag LOCUS_08950 gene crtB 89126 88275 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_08950 90576 89119 gene locus_tag LOCUS_08960 gene crtI 90576 89119 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_08960 91467 90577 gene locus_tag LOCUS_08970 91467 90577 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_08970 91788 94592 gene locus_tag LOCUS_08980 91788 94592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 94598 95761 gene locus_tag LOCUS_08990 94598 95761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 95907 95823 gene locus_tag LOCUS_t00140 95907 95823 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence08 5728 4913 gene locus_tag LOCUS_09000 5728 4913 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_09000 7429 5777 gene locus_tag LOCUS_09010 gene recN 7429 5777 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_09010 8379 7495 gene locus_tag LOCUS_09020 8379 7495 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_09020 9571 8369 gene locus_tag LOCUS_09030 gene coaBC 9571 8369 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_09030 9899 9573 gene locus_tag LOCUS_09040 9899 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_09040 10738 9902 gene locus_tag LOCUS_09050 gene bamD 10738 9902 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_09050 11707 10820 gene locus_tag LOCUS_09060 gene dapA 11707 10820 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_09060 12290 11715 gene locus_tag LOCUS_09070 12290 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 14218 12350 gene locus_tag LOCUS_09080 14218 12350 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_09080 14370 15134 gene locus_tag LOCUS_09090 14370 15134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 protein_id gnl|my_center|LOCUS_09090 15136 16047 gene locus_tag LOCUS_09100 15136 16047 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_09100 16727 16125 gene locus_tag LOCUS_09110 16727 16125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 18718 16724 gene locus_tag LOCUS_09120 gene ligA 18718 16724 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 protein_id gnl|my_center|LOCUS_09120 19108 18743 gene locus_tag LOCUS_09130 19108 18743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207903.1 protein_id gnl|my_center|LOCUS_09130 19893 19225 gene locus_tag LOCUS_09140 19893 19225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 20510 19893 gene locus_tag LOCUS_09150 gene yvdD 20510 19893 CDS product LOG family protein YvdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06986 protein_id gnl|my_center|LOCUS_09150 21570 20689 gene locus_tag LOCUS_09160 gene prmC 21570 20689 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_09160 21667 22113 gene locus_tag LOCUS_09170 21667 22113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 22604 22116 gene locus_tag LOCUS_09180 gene yjgM 22604 22116 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_09180 22692 23054 gene locus_tag LOCUS_09190 22692 23054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 23067 24119 gene locus_tag LOCUS_09200 gene ribD 23067 24119 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_09200 24112 24720 gene locus_tag LOCUS_09210 24112 24720 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_09210 24741 25586 gene locus_tag LOCUS_09220 24741 25586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 25589 26200 gene locus_tag LOCUS_09230 25589 26200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_09230 26756 26361 gene locus_tag LOCUS_09240 26756 26361 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_09240 26969 28396 gene locus_tag LOCUS_09250 gene dnaA 26969 28396 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_09250 28453 28860 gene locus_tag LOCUS_09260 28453 28860 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 protein_id gnl|my_center|LOCUS_09260 28899 30266 gene locus_tag LOCUS_09270 28899 30266 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_09270 30274 31005 gene locus_tag LOCUS_09280 30274 31005 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_09280 31681 30983 gene locus_tag LOCUS_09290 31681 30983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 31904 34360 gene locus_tag LOCUS_09300 31904 34360 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_09300 34364 35164 gene locus_tag LOCUS_09310 34364 35164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_09310 35164 36000 gene locus_tag LOCUS_09320 gene murQ 35164 36000 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_09320 35981 36205 gene locus_tag LOCUS_09330 35981 36205 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962883.1 protein_id gnl|my_center|LOCUS_09330 37638 36265 gene locus_tag LOCUS_09340 37638 36265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 39007 37688 gene locus_tag LOCUS_09350 39007 37688 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_09350 40772 39147 gene locus_tag LOCUS_09360 40772 39147 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_09360 40962 42347 gene locus_tag LOCUS_09370 40962 42347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963192.1 protein_id gnl|my_center|LOCUS_09370 43156 42350 gene locus_tag LOCUS_09380 43156 42350 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_09380 43430 44470 gene locus_tag LOCUS_09390 43430 44470 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_09390 44472 46007 gene locus_tag LOCUS_09400 44472 46007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_09400 46473 46066 gene locus_tag LOCUS_09410 46473 46066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 47763 46486 gene locus_tag LOCUS_09420 gene glyA 47763 46486 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_09420 47869 49149 gene locus_tag LOCUS_09430 gene fahA 47869 49149 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_09430 49647 49249 gene locus_tag LOCUS_09440 gene ytxJ 49647 49249 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_09440 49817 52432 gene locus_tag LOCUS_09450 gene clpB 49817 52432 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0F9 protein_id gnl|my_center|LOCUS_09450 52598 54958 gene locus_tag LOCUS_09460 52598 54958 CDS product ferrichrome-iron receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140357.1 protein_id gnl|my_center|LOCUS_09460 55405 55112 gene locus_tag LOCUS_09470 55405 55112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 55489 56412 gene locus_tag LOCUS_09480 55489 56412 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_09480 58872 56542 gene locus_tag LOCUS_09490 58872 56542 CDS product UPF0753 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0W8 protein_id gnl|my_center|LOCUS_09490 59971 58874 gene locus_tag LOCUS_09500 59971 58874 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404786.1 protein_id gnl|my_center|LOCUS_09500 60649 61146 gene locus_tag LOCUS_09510 60649 61146 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_09510 61298 61143 gene locus_tag LOCUS_09520 61298 61143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 61410 62618 gene locus_tag LOCUS_09530 gene sbcD 61410 62618 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA98 protein_id gnl|my_center|LOCUS_09530 62668 65688 gene locus_tag LOCUS_09540 gene rad50 62668 65688 CDS product putative DNA double-strand break repair Rad50 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67124 protein_id gnl|my_center|LOCUS_09540 67038 65737 gene locus_tag LOCUS_09550 gene bfmBB 67038 65737 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_09550 67789 67154 gene locus_tag LOCUS_09560 67789 67154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 68348 67776 gene locus_tag LOCUS_09570 68348 67776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 69155 68538 gene locus_tag LOCUS_09580 gene recR 69155 68538 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_09580 71073 69187 gene locus_tag LOCUS_09590 71073 69187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 73033 71177 gene locus_tag LOCUS_09600 73033 71177 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_09600 73222 74628 gene locus_tag LOCUS_09610 73222 74628 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_09610 74973 74605 gene locus_tag LOCUS_09620 74973 74605 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_09620 76312 75302 gene locus_tag LOCUS_09630 gene fabH2 76312 75302 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_09630 77791 76529 gene locus_tag LOCUS_09640 77791 76529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 78891 77908 gene locus_tag LOCUS_09650 78891 77908 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957282.1 protein_id gnl|my_center|LOCUS_09650 79227 79066 gene locus_tag LOCUS_09660 79227 79066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 79746 79285 gene locus_tag LOCUS_09670 gene ydcH 79746 79285 CDS product putative HTH-type transcriptional regulator YdcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96625 protein_id gnl|my_center|LOCUS_09670 80176 79739 gene locus_tag LOCUS_09680 gene ydcG 80176 79739 CDS product UPF0310 protein YdcG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96624 protein_id gnl|my_center|LOCUS_09680 80547 80188 gene locus_tag LOCUS_09690 80547 80188 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385272.1 protein_id gnl|my_center|LOCUS_09690 81016 80708 gene locus_tag LOCUS_09700 81016 80708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 81622 81071 gene locus_tag LOCUS_09710 81622 81071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 83840 82530 gene locus_tag LOCUS_09720 83840 82530 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_09720 84442 83840 gene locus_tag LOCUS_09730 84442 83840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_09730 84581 84408 gene locus_tag LOCUS_09740 84581 84408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 84870 86753 gene locus_tag LOCUS_09750 gene htpG 84870 86753 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_09750 86860 87360 gene locus_tag LOCUS_09760 86860 87360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 87373 88188 gene locus_tag LOCUS_09770 87373 88188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 88263 90215 gene locus_tag LOCUS_09780 gene thrS 88263 90215 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 protein_id gnl|my_center|LOCUS_09780 >Feature sequence09 1826 87 gene locus_tag LOCUS_09790 1826 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 3293 1845 gene locus_tag LOCUS_09800 3293 1845 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_09800 4782 3295 gene locus_tag LOCUS_09810 4782 3295 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108759.1 protein_id gnl|my_center|LOCUS_09810 7680 4792 gene locus_tag LOCUS_09820 7680 4792 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_09820 8077 10968 gene locus_tag LOCUS_09830 8077 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_09830 11063 11215 gene locus_tag LOCUS_09840 11063 11215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 12802 11501 gene locus_tag LOCUS_09850 gene ndh 12802 11501 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_09850 12930 13424 gene locus_tag LOCUS_09860 12930 13424 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_09860 13429 14046 gene locus_tag LOCUS_09870 13429 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964037.1 protein_id gnl|my_center|LOCUS_09870 14147 17053 gene locus_tag LOCUS_09880 14147 17053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 17151 18425 gene locus_tag LOCUS_09890 17151 18425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 21238 18422 gene locus_tag LOCUS_09900 21238 18422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 22176 21262 gene locus_tag LOCUS_09910 22176 21262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 23159 22332 gene locus_tag LOCUS_09920 23159 22332 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_09920 23844 23203 gene locus_tag LOCUS_09930 23844 23203 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_09930 23838 24590 gene locus_tag LOCUS_09940 23838 24590 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q834U8 protein_id gnl|my_center|LOCUS_09940 25210 24593 gene locus_tag LOCUS_09950 25210 24593 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_09950 25924 25211 gene locus_tag LOCUS_09960 25924 25211 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108179.1 protein_id gnl|my_center|LOCUS_09960 25961 26941 gene locus_tag LOCUS_09970 25961 26941 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108173.1 protein_id gnl|my_center|LOCUS_09970 26919 27791 gene locus_tag LOCUS_09980 26919 27791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 27792 28538 gene locus_tag LOCUS_09990 27792 28538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 28538 29728 gene locus_tag LOCUS_10000 28538 29728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 29728 30786 gene locus_tag LOCUS_10010 29728 30786 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_10010 30945 32120 gene locus_tag LOCUS_10020 30945 32120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_10020 32231 32647 gene locus_tag LOCUS_10030 32231 32647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 32766 33707 gene locus_tag LOCUS_10040 gene oxyR 32766 33707 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_10040 33967 33773 gene locus_tag LOCUS_10050 33967 33773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 34591 34136 gene locus_tag LOCUS_10060 34591 34136 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_10060 34790 35305 gene locus_tag LOCUS_10070 34790 35305 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 protein_id gnl|my_center|LOCUS_10070 35308 36156 gene locus_tag LOCUS_10080 35308 36156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 36243 36596 gene locus_tag LOCUS_10090 36243 36596 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_10090 36580 38334 gene locus_tag LOCUS_10100 36580 38334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_10100 38361 39092 gene locus_tag LOCUS_10110 38361 39092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 39150 39392 gene locus_tag LOCUS_10120 39150 39392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 41011 39536 gene locus_tag LOCUS_10130 41011 39536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 41366 41908 gene locus_tag LOCUS_10140 41366 41908 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963990.1 protein_id gnl|my_center|LOCUS_10140 44033 42162 gene locus_tag LOCUS_10150 44033 42162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 45496 44396 gene locus_tag LOCUS_10160 45496 44396 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_10160 46161 45589 gene locus_tag LOCUS_10170 46161 45589 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_10170 47437 46178 gene locus_tag LOCUS_10180 gene entS 47437 46178 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_10180 48363 47443 gene locus_tag LOCUS_10190 48363 47443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 48708 48986 gene locus_tag LOCUS_10200 48708 48986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 49110 50606 gene locus_tag LOCUS_10210 gene icsA 49110 50606 CDS product lipopolysaccharide glycosyltransferase, putative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_294436.1 protein_id gnl|my_center|LOCUS_10210 50610 52214 gene locus_tag LOCUS_10220 50610 52214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 52201 53007 gene locus_tag LOCUS_10230 52201 53007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 53025 55019 gene locus_tag LOCUS_10240 53025 55019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 55074 59024 gene locus_tag LOCUS_10250 55074 59024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 59079 61187 gene locus_tag LOCUS_10260 59079 61187 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108019.1 protein_id gnl|my_center|LOCUS_10260 61306 62034 gene locus_tag LOCUS_10270 61306 62034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 62192 62803 gene locus_tag LOCUS_10280 62192 62803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 62894 64528 gene locus_tag LOCUS_10290 62894 64528 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861369.1 protein_id gnl|my_center|LOCUS_10290 64531 65661 gene locus_tag LOCUS_10300 64531 65661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889821.1 protein_id gnl|my_center|LOCUS_10300 65978 65775 gene locus_tag LOCUS_10310 65978 65775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 66146 66352 gene locus_tag LOCUS_10320 66146 66352 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202295.1 protein_id gnl|my_center|LOCUS_10320 66418 66618 gene locus_tag LOCUS_10330 66418 66618 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109410.1 protein_id gnl|my_center|LOCUS_10330 66874 67272 gene locus_tag LOCUS_10340 66874 67272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 67428 68192 gene locus_tag LOCUS_10350 67428 68192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 68407 68637 gene locus_tag LOCUS_10360 68407 68637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 68975 70039 gene locus_tag LOCUS_10370 68975 70039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 70463 71194 gene locus_tag LOCUS_10380 70463 71194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 71336 71725 gene locus_tag LOCUS_10390 71336 71725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 71897 72349 gene locus_tag LOCUS_10400 71897 72349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 72386 72916 gene locus_tag LOCUS_10410 72386 72916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 73112 73351 gene locus_tag LOCUS_10420 73112 73351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 74153 73386 gene locus_tag LOCUS_10430 74153 73386 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_10430 75045 74179 gene locus_tag LOCUS_10440 75045 74179 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083599.1 protein_id gnl|my_center|LOCUS_10440 75619 75107 gene locus_tag LOCUS_10450 gene padC 75619 75107 CDS product phenolic acid decarboxylase PadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07006 protein_id gnl|my_center|LOCUS_10450 75720 76493 gene locus_tag LOCUS_10460 75720 76493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 76761 77834 gene locus_tag LOCUS_10470 76761 77834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10470 77841 79166 gene locus_tag LOCUS_10480 77841 79166 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546410.1 protein_id gnl|my_center|LOCUS_10480 79404 79255 gene locus_tag LOCUS_10490 79404 79255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 79471 80772 gene locus_tag LOCUS_10500 79471 80772 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEM0 protein_id gnl|my_center|LOCUS_10500 80784 81209 gene locus_tag LOCUS_10510 80784 81209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 81212 81598 gene locus_tag LOCUS_10520 81212 81598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 81607 81999 gene locus_tag LOCUS_10530 81607 81999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 82492 82169 gene locus_tag LOCUS_10540 82492 82169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 82957 82496 gene locus_tag LOCUS_10550 82957 82496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 83564 82971 gene locus_tag LOCUS_10560 83564 82971 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109260.1 protein_id gnl|my_center|LOCUS_10560 84861 83644 gene locus_tag LOCUS_10570 84861 83644 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908332.1 protein_id gnl|my_center|LOCUS_10570 85427 84885 gene locus_tag LOCUS_10580 85427 84885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 86473 85937 gene locus_tag LOCUS_10590 86473 85937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 87278 86613 gene locus_tag LOCUS_10600 87278 86613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence10 548 21 gene locus_tag LOCUS_10610 548 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 2913 679 gene locus_tag LOCUS_10620 gene PhcA 2913 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268909.1 protein_id gnl|my_center|LOCUS_10620 4184 3267 gene locus_tag LOCUS_10630 4184 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 5535 4186 gene locus_tag LOCUS_10640 5535 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 9230 5532 gene locus_tag LOCUS_10650 9230 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 10527 9808 gene locus_tag LOCUS_10660 10527 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 18407 10551 gene locus_tag LOCUS_10670 18407 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 24783 18412 gene locus_tag LOCUS_10680 24783 18412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 26160 24793 gene locus_tag LOCUS_10690 26160 24793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 29219 26157 gene locus_tag LOCUS_10700 29219 26157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 29611 30222 gene locus_tag LOCUS_10710 29611 30222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 30452 31012 gene locus_tag LOCUS_10720 30452 31012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 31009 31770 gene locus_tag LOCUS_10730 31009 31770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 31790 33439 gene locus_tag LOCUS_10740 31790 33439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 33476 33946 gene locus_tag LOCUS_10750 33476 33946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 33949 34392 gene locus_tag LOCUS_10760 33949 34392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 34725 36497 gene locus_tag LOCUS_10770 34725 36497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 36665 37327 gene locus_tag LOCUS_10780 36665 37327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 37332 39119 gene locus_tag LOCUS_10790 37332 39119 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_10790 39308 39763 gene locus_tag LOCUS_10800 39308 39763 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_10800 39771 43319 gene locus_tag LOCUS_10810 39771 43319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 43306 44046 gene locus_tag LOCUS_10820 43306 44046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 44727 44041 gene locus_tag LOCUS_10830 44727 44041 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705044.1 protein_id gnl|my_center|LOCUS_10830 45046 46734 gene locus_tag LOCUS_10840 45046 46734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 46734 46991 gene locus_tag LOCUS_10850 46734 46991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 46996 47382 gene locus_tag LOCUS_10860 46996 47382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_10860 47393 49645 gene locus_tag LOCUS_10870 47393 49645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 49632 53195 gene locus_tag LOCUS_10880 49632 53195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 54008 53292 gene locus_tag LOCUS_10890 gene menG 54008 53292 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_10890 54421 54086 gene locus_tag LOCUS_10900 54421 54086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 55007 54651 gene locus_tag LOCUS_10910 55007 54651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 55819 55598 gene locus_tag LOCUS_10920 55819 55598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 56392 55943 gene locus_tag LOCUS_10930 56392 55943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 56730 56509 gene locus_tag LOCUS_10940 56730 56509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 57462 56854 gene locus_tag LOCUS_10950 57462 56854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 59501 57453 gene locus_tag LOCUS_10960 59501 57453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 61100 60045 gene locus_tag LOCUS_10970 61100 60045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962872.1 protein_id gnl|my_center|LOCUS_10970 62535 61204 gene locus_tag LOCUS_10980 62535 61204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 62690 63055 gene locus_tag LOCUS_10990 62690 63055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 63617 64474 gene locus_tag LOCUS_11000 63617 64474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 64789 65691 gene locus_tag LOCUS_11010 64789 65691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 67137 65755 gene locus_tag LOCUS_11020 67137 65755 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958071.1 protein_id gnl|my_center|LOCUS_11020 67280 68149 gene locus_tag LOCUS_11030 67280 68149 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365532.1 protein_id gnl|my_center|LOCUS_11030 69751 68252 gene locus_tag LOCUS_11040 69751 68252 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 protein_id gnl|my_center|LOCUS_11040 69999 70394 gene locus_tag LOCUS_11050 69999 70394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 70509 71105 gene locus_tag LOCUS_11060 gene ddpX 70509 71105 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H017 protein_id gnl|my_center|LOCUS_11060 71161 71343 gene locus_tag LOCUS_11070 71161 71343 CDS product Pmp3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262271.1 protein_id gnl|my_center|LOCUS_11070 72355 71345 gene locus_tag LOCUS_11080 gene galE 72355 71345 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_11080 72993 72610 gene locus_tag LOCUS_11090 72993 72610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 74072 73086 gene locus_tag LOCUS_11100 74072 73086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 75693 74341 gene locus_tag LOCUS_11110 75693 74341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 76162 75752 gene locus_tag LOCUS_11120 76162 75752 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530567.1 protein_id gnl|my_center|LOCUS_11120 76964 76203 gene locus_tag LOCUS_11130 76964 76203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 77834 77142 gene locus_tag LOCUS_11140 77834 77142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 78802 78104 gene locus_tag LOCUS_11150 78802 78104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 80852 79413 gene locus_tag LOCUS_11160 80852 79413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 81586 80960 gene locus_tag LOCUS_11170 81586 80960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 82318 81905 gene locus_tag LOCUS_11180 82318 81905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 82980 82507 gene locus_tag LOCUS_11190 82980 82507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 83577 83149 gene locus_tag LOCUS_11200 83577 83149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 84591 83905 gene locus_tag LOCUS_11210 84591 83905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence11 1329 94 gene locus_tag LOCUS_11220 1329 94 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403427.1 protein_id gnl|my_center|LOCUS_11220 2261 1467 gene locus_tag LOCUS_11230 2261 1467 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_11230 3559 2489 gene locus_tag LOCUS_11240 3559 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_11240 3780 5240 gene locus_tag LOCUS_11250 gene pepD 3780 5240 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964033.1 protein_id gnl|my_center|LOCUS_11250 6312 5362 gene locus_tag LOCUS_11260 6312 5362 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_11260 7317 6421 gene locus_tag LOCUS_11270 gene xerD 7317 6421 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_11270 7434 8042 gene locus_tag LOCUS_11280 7434 8042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_11280 8567 9127 gene locus_tag LOCUS_11290 8567 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 9246 9767 gene locus_tag LOCUS_11300 9246 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 9885 10505 gene locus_tag LOCUS_11310 9885 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 10607 11200 gene locus_tag LOCUS_11320 10607 11200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_11320 11206 11853 gene locus_tag LOCUS_11330 11206 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_11330 11899 12396 gene locus_tag LOCUS_11340 11899 12396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 12400 12825 gene locus_tag LOCUS_11350 gene aroQ 12400 12825 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_11350 12818 13540 gene locus_tag LOCUS_11360 12818 13540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_11360 13655 14209 gene locus_tag LOCUS_11370 13655 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 15682 14291 gene locus_tag LOCUS_11380 gene lpdA2 15682 14291 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_11380 16363 15806 gene locus_tag LOCUS_11390 16363 15806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 16764 16372 gene locus_tag LOCUS_11400 gene mrsB2 16764 16372 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963829.1 protein_id gnl|my_center|LOCUS_11400 17260 16775 gene locus_tag LOCUS_11410 gene mrsB1 17260 16775 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963828.1 protein_id gnl|my_center|LOCUS_11410 17388 18203 gene locus_tag LOCUS_11420 17388 18203 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_11420 18511 18266 gene locus_tag LOCUS_11430 18511 18266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 19785 18580 gene locus_tag LOCUS_11440 19785 18580 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_11440 20661 19939 gene locus_tag LOCUS_11450 20661 19939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 20817 21332 gene locus_tag LOCUS_11460 20817 21332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 21818 21390 gene locus_tag LOCUS_11470 gene yigI 21818 21390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073919.1 protein_id gnl|my_center|LOCUS_11470 24340 21914 gene locus_tag LOCUS_11480 gene pheT 24340 21914 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_11480 24482 24919 gene locus_tag LOCUS_11490 24482 24919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 25825 24923 gene locus_tag LOCUS_11500 25825 24923 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932156.1 protein_id gnl|my_center|LOCUS_11500 27930 25825 gene locus_tag LOCUS_11510 gene recG 27930 25825 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_11510 28016 30100 gene locus_tag LOCUS_11520 28016 30100 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963153.1 protein_id gnl|my_center|LOCUS_11520 30097 31008 gene locus_tag LOCUS_11530 30097 31008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 31715 31194 gene locus_tag LOCUS_11540 31715 31194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_11540 33322 31718 gene locus_tag LOCUS_11550 gene gltB2 33322 31718 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_11550 33443 35797 gene locus_tag LOCUS_11560 gene uvrD 33443 35797 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_11560 35866 36075 gene locus_tag LOCUS_11570 35866 36075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973278.1 protein_id gnl|my_center|LOCUS_11570 36191 36868 gene locus_tag LOCUS_11580 36191 36868 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_11580 36875 38476 gene locus_tag LOCUS_11590 36875 38476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_11590 38486 39844 gene locus_tag LOCUS_11600 38486 39844 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_11600 39847 41268 gene locus_tag LOCUS_11610 39847 41268 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_11610 41328 41945 gene locus_tag LOCUS_11620 41328 41945 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_11620 42987 41947 gene locus_tag LOCUS_11630 42987 41947 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_11630 44963 43044 gene locus_tag LOCUS_11640 gene acsA 44963 43044 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_11640 46018 45104 gene locus_tag LOCUS_11650 46018 45104 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_11650 46329 49685 gene locus_tag LOCUS_11660 46329 49685 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202647.1 protein_id gnl|my_center|LOCUS_11660 49705 51186 gene locus_tag LOCUS_11670 49705 51186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787024.1 protein_id gnl|my_center|LOCUS_11670 51198 52049 gene locus_tag LOCUS_11680 51198 52049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762845.1 protein_id gnl|my_center|LOCUS_11680 52036 53397 gene locus_tag LOCUS_11690 52036 53397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 53548 54519 gene locus_tag LOCUS_11700 gene trxB1 53548 54519 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_11700 54699 55718 gene locus_tag LOCUS_11710 54699 55718 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104051.1 protein_id gnl|my_center|LOCUS_11710 56133 55705 gene locus_tag LOCUS_11720 56133 55705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_11720 56799 56134 gene locus_tag LOCUS_11730 56799 56134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_11730 57534 56803 gene locus_tag LOCUS_11740 57534 56803 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_11740 57580 58740 gene locus_tag LOCUS_11750 57580 58740 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_11750 59692 58955 gene locus_tag LOCUS_11760 59692 58955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_11760 60179 59658 gene locus_tag LOCUS_11770 60179 59658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 protein_id gnl|my_center|LOCUS_11770 61588 60176 gene locus_tag LOCUS_11780 gene trmA 61588 60176 CDS product tRNA (uracil-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_11780 61730 62980 gene locus_tag LOCUS_11790 gene rocD 61730 62980 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_11790 63385 63047 gene locus_tag LOCUS_11800 63385 63047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 63703 63425 gene locus_tag LOCUS_11810 63703 63425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962900.1 protein_id gnl|my_center|LOCUS_11810 65607 63706 gene locus_tag LOCUS_11820 65607 63706 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962777.1 protein_id gnl|my_center|LOCUS_11820 65711 65911 gene locus_tag LOCUS_11830 65711 65911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 65901 66443 gene locus_tag LOCUS_11840 65901 66443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 protein_id gnl|my_center|LOCUS_11840 67537 66449 gene locus_tag LOCUS_11850 67537 66449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 67595 68746 gene locus_tag LOCUS_11860 67595 68746 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_11860 71175 68743 gene locus_tag LOCUS_11870 71175 68743 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_11870 72925 71219 gene locus_tag LOCUS_11880 72925 71219 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_11880 73092 73382 gene locus_tag LOCUS_11890 73092 73382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963282.1 protein_id gnl|my_center|LOCUS_11890 73391 73684 gene locus_tag LOCUS_11900 73391 73684 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 protein_id gnl|my_center|LOCUS_11900 73904 75469 gene locus_tag LOCUS_11910 gene rny 73904 75469 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 protein_id gnl|my_center|LOCUS_11910 75602 76378 gene locus_tag LOCUS_11920 75602 76378 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_11920 76381 76995 gene locus_tag LOCUS_11930 76381 76995 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_11930 76995 77333 gene locus_tag LOCUS_11940 76995 77333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 77333 78577 gene locus_tag LOCUS_11950 77333 78577 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 protein_id gnl|my_center|LOCUS_11950 78657 78896 gene locus_tag LOCUS_11960 gene rpmB 78657 78896 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_11960 78925 79107 gene locus_tag LOCUS_11970 gene rpmG 78925 79107 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_11970 79114 79266 gene locus_tag LOCUS_11980 79114 79266 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence12 1221 583 gene locus_tag LOCUS_11990 gene yhfK 1221 583 CDS product putative sugar epimerase YhfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07609 protein_id gnl|my_center|LOCUS_11990 2357 1314 gene locus_tag LOCUS_12000 2357 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 4158 2347 gene locus_tag LOCUS_12010 4158 2347 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_12010 5457 4204 gene locus_tag LOCUS_12020 gene lysC 5457 4204 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_12020 5945 5454 gene locus_tag LOCUS_12030 5945 5454 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_12030 6010 7023 gene locus_tag LOCUS_12040 gene fbp 6010 7023 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWD9 protein_id gnl|my_center|LOCUS_12040 7472 7047 gene locus_tag LOCUS_12050 7472 7047 CDS product fructose 1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962635.1 protein_id gnl|my_center|LOCUS_12050 7668 11090 gene locus_tag LOCUS_12060 gene ileS 7668 11090 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_12060 11097 11480 gene locus_tag LOCUS_12070 gene dksA 11097 11480 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_12070 11665 12291 gene locus_tag LOCUS_12080 11665 12291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 12323 12934 gene locus_tag LOCUS_12090 gene lspA 12323 12934 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_12090 13519 12950 gene locus_tag LOCUS_12100 gene ygfA 13519 12950 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_12100 14503 13523 gene locus_tag LOCUS_12110 14503 13523 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_12110 15368 14496 gene locus_tag LOCUS_12120 gene rimK 15368 14496 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_12120 15805 15374 gene locus_tag LOCUS_12130 15805 15374 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 protein_id gnl|my_center|LOCUS_12130 15951 16346 gene locus_tag LOCUS_12140 15951 16346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 16412 18202 gene locus_tag LOCUS_12150 gene uvrC 16412 18202 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_12150 18207 20447 gene locus_tag LOCUS_12160 18207 20447 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_12160 20989 21384 gene locus_tag LOCUS_12170 20989 21384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 21431 21910 gene locus_tag LOCUS_12180 21431 21910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 21879 22472 gene locus_tag LOCUS_12190 21879 22472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 22559 23035 gene locus_tag LOCUS_12200 22559 23035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 24110 23082 gene locus_tag LOCUS_12210 gene ywcH 24110 23082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39606 protein_id gnl|my_center|LOCUS_12210 24369 24139 gene locus_tag LOCUS_12220 24369 24139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 24427 25524 gene locus_tag LOCUS_12230 gene hmgA 24427 25524 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_12230 25593 26786 gene locus_tag LOCUS_12240 gene hppD 25593 26786 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_12240 27090 27863 gene locus_tag LOCUS_12250 27090 27863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_12250 27946 29202 gene locus_tag LOCUS_12260 27946 29202 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_12260 29377 31998 gene locus_tag LOCUS_12270 29377 31998 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962323.1 protein_id gnl|my_center|LOCUS_12270 32087 32527 gene locus_tag LOCUS_12280 32087 32527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 32732 32529 gene locus_tag LOCUS_12290 32732 32529 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774957.1 protein_id gnl|my_center|LOCUS_12290 33262 32744 gene locus_tag LOCUS_12300 33262 32744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 33466 35778 gene locus_tag LOCUS_12310 33466 35778 CDS product Na(+)/H(+) antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404440.1 protein_id gnl|my_center|LOCUS_12310 35791 36204 gene locus_tag LOCUS_12320 gene mrpB 35791 36204 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 protein_id gnl|my_center|LOCUS_12320 36206 36562 gene locus_tag LOCUS_12330 gene mrpC 36206 36562 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_12330 36563 38077 gene locus_tag LOCUS_12340 gene shaD 36563 38077 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958316.1 protein_id gnl|my_center|LOCUS_12340 38079 38555 gene locus_tag LOCUS_12350 gene mrpE 38079 38555 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 protein_id gnl|my_center|LOCUS_12350 38552 38860 gene locus_tag LOCUS_12360 gene mrpF 38552 38860 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942975.1 protein_id gnl|my_center|LOCUS_12360 38850 39266 gene locus_tag LOCUS_12370 38850 39266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 39268 40404 gene locus_tag LOCUS_12380 gene bioF 39268 40404 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_12380 40401 40817 gene locus_tag LOCUS_12390 40401 40817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 40814 41437 gene locus_tag LOCUS_12400 gene bioD 40814 41437 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_12400 41434 42717 gene locus_tag LOCUS_12410 gene bioA 41434 42717 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_12410 42927 44087 gene locus_tag LOCUS_12420 42927 44087 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964416.1 protein_id gnl|my_center|LOCUS_12420 44187 45275 gene locus_tag LOCUS_12430 gene bioB 44187 45275 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_12430 45292 46146 gene locus_tag LOCUS_12440 45292 46146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521521.1 protein_id gnl|my_center|LOCUS_12440 46155 47027 gene locus_tag LOCUS_12450 46155 47027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 47515 47024 gene locus_tag LOCUS_12460 gene recX 47515 47024 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_12460 49145 47607 gene locus_tag LOCUS_12470 gene cafA 49145 47607 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_12470 49715 49425 gene locus_tag LOCUS_12480 gene hupA 49715 49425 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_12480 49856 50920 gene locus_tag LOCUS_12490 gene mutY 49856 50920 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_12490 50955 51443 gene locus_tag LOCUS_12500 50955 51443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 51464 52816 gene locus_tag LOCUS_12510 51464 52816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 52788 53366 gene locus_tag LOCUS_12520 gene gldD 52788 53366 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_12520 53419 54333 gene locus_tag LOCUS_12530 gene fjo11 53419 54333 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_12530 56370 54349 gene locus_tag LOCUS_12540 56370 54349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 57762 56437 gene locus_tag LOCUS_12550 57762 56437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 57826 58437 gene locus_tag LOCUS_12560 57826 58437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 58531 59028 gene locus_tag LOCUS_12570 58531 59028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 59058 59318 gene locus_tag LOCUS_12580 gene rpmA 59058 59318 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P8 protein_id gnl|my_center|LOCUS_12580 61240 59396 gene locus_tag LOCUS_12590 61240 59396 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 protein_id gnl|my_center|LOCUS_12590 62885 61317 gene locus_tag LOCUS_12600 62885 61317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962728.1 protein_id gnl|my_center|LOCUS_12600 64840 63149 gene locus_tag LOCUS_12610 64840 63149 CDS product ribonucleoside-diphosphate reductase, alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229097.1 protein_id gnl|my_center|LOCUS_12610 65836 64862 gene locus_tag LOCUS_12620 65836 64862 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402917.1 protein_id gnl|my_center|LOCUS_12620 66229 67734 gene locus_tag LOCUS_12630 66229 67734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 67913 69733 gene locus_tag LOCUS_12640 67913 69733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12640 69806 70771 gene locus_tag LOCUS_12650 69806 70771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12650 70932 71951 gene locus_tag LOCUS_12660 70932 71951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 71920 72903 gene locus_tag LOCUS_12670 71920 72903 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797170.1 protein_id gnl|my_center|LOCUS_12670 74299 72983 gene locus_tag LOCUS_12680 gene ahcY 74299 72983 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_12680 74363 74995 gene locus_tag LOCUS_12690 gene sfp 74363 74995 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_12690 74998 75747 gene locus_tag LOCUS_12700 gene pcrB 74998 75747 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_12700 75788 76423 gene locus_tag LOCUS_12710 gene pnuC 75788 76423 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_12710 76654 78183 gene locus_tag LOCUS_12720 76654 78183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence13 3932 2145 gene locus_tag LOCUS_12730 3932 2145 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 protein_id gnl|my_center|LOCUS_12730 4193 5026 gene locus_tag LOCUS_12740 4193 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 5138 5440 gene locus_tag LOCUS_12750 5138 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 6592 5573 gene locus_tag LOCUS_12760 gene ltaE 6592 5573 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_12760 6780 7154 gene locus_tag LOCUS_12770 gene mgsA 6780 7154 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HL22 protein_id gnl|my_center|LOCUS_12770 7577 8338 gene locus_tag LOCUS_12780 gene prfB 7577 8338 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_12780 8433 8774 gene locus_tag LOCUS_12790 8433 8774 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_12790 8848 9246 gene locus_tag LOCUS_12800 8848 9246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 9374 11917 gene locus_tag LOCUS_12810 9374 11917 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_12810 12235 12053 gene locus_tag LOCUS_12820 12235 12053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963717.1 protein_id gnl|my_center|LOCUS_12820 12429 13826 gene locus_tag LOCUS_12830 gene fumC 12429 13826 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_12830 14638 14240 gene locus_tag LOCUS_12840 14638 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 17829 14644 gene locus_tag LOCUS_12850 gene ccsBA 17829 14644 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_12850 18148 18897 gene locus_tag LOCUS_12860 18148 18897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_12860 18890 19414 gene locus_tag LOCUS_12870 gene kdsC 18890 19414 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_12870 19534 20406 gene locus_tag LOCUS_12880 19534 20406 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_12880 20414 20995 gene locus_tag LOCUS_12890 20414 20995 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_12890 21042 21587 gene locus_tag LOCUS_12900 21042 21587 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071240.1 protein_id gnl|my_center|LOCUS_12900 21693 22016 gene locus_tag LOCUS_12910 21693 22016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 22013 22747 gene locus_tag LOCUS_12920 22013 22747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 22912 23493 gene locus_tag LOCUS_12930 22912 23493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 23499 23924 gene locus_tag LOCUS_12940 23499 23924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 24416 26092 gene locus_tag LOCUS_12950 24416 26092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 26099 26440 gene locus_tag LOCUS_12960 26099 26440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 26599 27006 gene locus_tag LOCUS_12970 26599 27006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 27038 27373 gene locus_tag LOCUS_12980 27038 27373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 27660 27941 gene locus_tag LOCUS_12990 27660 27941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 28257 28718 gene locus_tag LOCUS_13000 28257 28718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 28830 29087 gene locus_tag LOCUS_13010 28830 29087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 29122 29409 gene locus_tag LOCUS_13020 29122 29409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 29551 32037 gene locus_tag LOCUS_13030 29551 32037 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383264.1 protein_id gnl|my_center|LOCUS_13030 32160 33845 gene locus_tag LOCUS_13040 32160 33845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 33963 34940 gene locus_tag LOCUS_13050 33963 34940 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_13050 35838 34993 gene locus_tag LOCUS_13060 35838 34993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_13060 36399 35887 gene locus_tag LOCUS_13070 36399 35887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 36499 36960 gene locus_tag LOCUS_13080 36499 36960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_13080 36963 37658 gene locus_tag LOCUS_13090 36963 37658 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_13090 37658 38968 gene locus_tag LOCUS_13100 gene phrB1 37658 38968 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_13100 39717 38965 gene locus_tag LOCUS_13110 gene kdsB 39717 38965 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_13110 41200 39767 gene locus_tag LOCUS_13120 41200 39767 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_13120 41322 41972 gene locus_tag LOCUS_13130 41322 41972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 42004 42783 gene locus_tag LOCUS_13140 42004 42783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 protein_id gnl|my_center|LOCUS_13140 42780 43319 gene locus_tag LOCUS_13150 42780 43319 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_13150 43339 43716 gene locus_tag LOCUS_13160 43339 43716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 44132 45871 gene locus_tag LOCUS_13170 44132 45871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 45874 46455 gene locus_tag LOCUS_13180 gene miaE 45874 46455 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_13180 46472 47155 gene locus_tag LOCUS_13190 46472 47155 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660145.1 protein_id gnl|my_center|LOCUS_13190 47152 48516 gene locus_tag LOCUS_13200 47152 48516 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_13200 48607 49926 gene locus_tag LOCUS_13210 48607 49926 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817697.1 protein_id gnl|my_center|LOCUS_13210 49926 51026 gene locus_tag LOCUS_13220 49926 51026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 51048 54146 gene locus_tag LOCUS_13230 51048 54146 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765563.1 protein_id gnl|my_center|LOCUS_13230 55135 54236 gene locus_tag LOCUS_13240 gene ppx 55135 54236 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_13240 57364 55298 gene locus_tag LOCUS_13250 gene ppk 57364 55298 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY90 protein_id gnl|my_center|LOCUS_13250 57853 57365 gene locus_tag LOCUS_13260 gene sixA 57853 57365 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_13260 58541 57891 gene locus_tag LOCUS_13270 gene pdxH 58541 57891 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 protein_id gnl|my_center|LOCUS_13270 59608 58700 gene locus_tag LOCUS_13280 gene rnz 59608 58700 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_13280 59910 59662 gene locus_tag LOCUS_13290 59910 59662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 60771 60052 gene locus_tag LOCUS_13300 60771 60052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 61938 61501 gene locus_tag LOCUS_13310 61938 61501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 62434 61931 gene locus_tag LOCUS_13320 62434 61931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166396.1 protein_id gnl|my_center|LOCUS_13320 62596 63033 gene locus_tag LOCUS_13330 62596 63033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 63444 63097 gene locus_tag LOCUS_13340 63444 63097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963901.1 protein_id gnl|my_center|LOCUS_13340 64377 63448 gene locus_tag LOCUS_13350 gene pyrB 64377 63448 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_13350 64924 64385 gene locus_tag LOCUS_13360 gene pyrR1 64924 64385 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_13360 65045 66310 gene locus_tag LOCUS_13370 65045 66310 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_13370 66325 67170 gene locus_tag LOCUS_13380 66325 67170 CDS product glyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060181.1 protein_id gnl|my_center|LOCUS_13380 69168 67234 gene locus_tag LOCUS_13390 gene dnaK 69168 67234 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_13390 69439 70872 gene locus_tag LOCUS_13400 gene sdaA 69439 70872 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_13400 72530 70908 gene locus_tag LOCUS_13410 72530 70908 CDS product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706469.1 protein_id gnl|my_center|LOCUS_13410 73226 72684 gene locus_tag LOCUS_13420 73226 72684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 73790 73266 gene locus_tag LOCUS_13430 73790 73266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 74256 73795 gene locus_tag LOCUS_13440 74256 73795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 74752 74243 gene locus_tag LOCUS_13450 74752 74243 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_13450 74865 76259 gene locus_tag LOCUS_13460 74865 76259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 77486 76260 gene locus_tag LOCUS_13470 77486 76260 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_13470 77633 77708 gene locus_tag LOCUS_t00150 77633 77708 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence14 1388 24 gene locus_tag LOCUS_13480 1388 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 2990 1458 gene locus_tag LOCUS_13490 2990 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 8802 3073 gene locus_tag LOCUS_13500 8802 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 9478 9017 gene locus_tag LOCUS_13510 9478 9017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 10115 9615 gene locus_tag LOCUS_13520 10115 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964402.1 protein_id gnl|my_center|LOCUS_13520 11038 10118 gene locus_tag LOCUS_13530 11038 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 11525 11067 gene locus_tag LOCUS_13540 11525 11067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 12760 11594 gene locus_tag LOCUS_13550 12760 11594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 14673 12769 gene locus_tag LOCUS_13560 14673 12769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 16069 14675 gene locus_tag LOCUS_13570 gene gspE 16069 14675 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964389.1 protein_id gnl|my_center|LOCUS_13570 16539 16066 gene locus_tag LOCUS_13580 16539 16066 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964390.1 protein_id gnl|my_center|LOCUS_13580 16963 16544 gene locus_tag LOCUS_13590 gene gspG 16963 16544 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964391.1 protein_id gnl|my_center|LOCUS_13590 18113 17001 gene locus_tag LOCUS_13600 18113 17001 CDS product general secretion pathway protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964406.1 protein_id gnl|my_center|LOCUS_13600 18570 18097 gene locus_tag LOCUS_13610 18570 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 18892 18557 gene locus_tag LOCUS_13620 18892 18557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 20087 18873 gene locus_tag LOCUS_13630 20087 18873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 21351 20317 gene locus_tag LOCUS_13640 21351 20317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 21721 22332 gene locus_tag LOCUS_13650 gene hnoX 21721 22332 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262973.1 protein_id gnl|my_center|LOCUS_13650 22286 24625 gene locus_tag LOCUS_13660 22286 24625 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963162.1 protein_id gnl|my_center|LOCUS_13660 24631 25761 gene locus_tag LOCUS_13670 24631 25761 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963163.1 protein_id gnl|my_center|LOCUS_13670 25761 26792 gene locus_tag LOCUS_13680 25761 26792 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963164.1 protein_id gnl|my_center|LOCUS_13680 26900 27610 gene locus_tag LOCUS_13690 26900 27610 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_13690 27842 27690 gene locus_tag LOCUS_13700 27842 27690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 27931 30363 gene locus_tag LOCUS_13710 27931 30363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 30521 30964 gene locus_tag LOCUS_13720 30521 30964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 33096 31099 gene locus_tag LOCUS_13730 33096 31099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963167.1 protein_id gnl|my_center|LOCUS_13730 33318 33626 gene locus_tag LOCUS_13740 33318 33626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 33654 34910 gene locus_tag LOCUS_13750 33654 34910 CDS product sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963088.1 protein_id gnl|my_center|LOCUS_13750 34988 36184 gene locus_tag LOCUS_13760 34988 36184 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963087.1 protein_id gnl|my_center|LOCUS_13760 37726 36176 gene locus_tag LOCUS_13770 37726 36176 CDS product glycosyl hydrolase family 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963086.1 protein_id gnl|my_center|LOCUS_13770 38945 37719 gene locus_tag LOCUS_13780 38945 37719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963085.1 protein_id gnl|my_center|LOCUS_13780 42034 38945 gene locus_tag LOCUS_13790 42034 38945 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963084.1 protein_id gnl|my_center|LOCUS_13790 42229 43419 gene locus_tag LOCUS_13800 42229 43419 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963083.1 protein_id gnl|my_center|LOCUS_13800 43617 44030 gene locus_tag LOCUS_13810 43617 44030 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_13810 44098 44421 gene locus_tag LOCUS_13820 44098 44421 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963165.1 protein_id gnl|my_center|LOCUS_13820 44431 45120 gene locus_tag LOCUS_13830 44431 45120 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_13830 49472 45423 gene locus_tag LOCUS_13840 49472 45423 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963617.1 protein_id gnl|my_center|LOCUS_13840 50891 50139 gene locus_tag LOCUS_13850 50891 50139 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_13850 51113 52690 gene locus_tag LOCUS_13860 gene glpA 51113 52690 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404213.1 protein_id gnl|my_center|LOCUS_13860 52778 54286 gene locus_tag LOCUS_13870 gene glpK 52778 54286 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHM7 protein_id gnl|my_center|LOCUS_13870 54290 55030 gene locus_tag LOCUS_13880 gene glpF 54290 55030 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189870.1 protein_id gnl|my_center|LOCUS_13880 55037 55813 gene locus_tag LOCUS_13890 55037 55813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 56753 55881 gene locus_tag LOCUS_13900 56753 55881 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727261.1 protein_id gnl|my_center|LOCUS_13900 56874 57929 gene locus_tag LOCUS_13910 56874 57929 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113749.1 protein_id gnl|my_center|LOCUS_13910 59208 57994 gene locus_tag LOCUS_13920 gene mntH 59208 57994 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_13920 60810 59518 gene locus_tag LOCUS_13930 gene pepP 60810 59518 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_13930 61184 60894 gene locus_tag LOCUS_13940 61184 60894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 62101 61181 gene locus_tag LOCUS_13950 62101 61181 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_13950 62426 63088 gene locus_tag LOCUS_13960 gene sdhC 62426 63088 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_13960 63103 65106 gene locus_tag LOCUS_13970 gene sdhA 63103 65106 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_13970 65182 65928 gene locus_tag LOCUS_13980 gene sdhB 65182 65928 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_13980 66120 66524 gene locus_tag LOCUS_13990 66120 66524 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837388.1 protein_id gnl|my_center|LOCUS_13990 66550 67641 gene locus_tag LOCUS_14000 66550 67641 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204968.1 protein_id gnl|my_center|LOCUS_14000 68171 67716 gene locus_tag LOCUS_14010 68171 67716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 68369 69076 gene locus_tag LOCUS_14020 68369 69076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 69081 69710 gene locus_tag LOCUS_14030 69081 69710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 69680 70420 gene locus_tag LOCUS_14040 69680 70420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 70404 71081 gene locus_tag LOCUS_14050 70404 71081 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_14050 71112 71184 gene locus_tag LOCUS_t00160 71112 71184 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 72125 71181 gene locus_tag LOCUS_14060 gene ltd 72125 71181 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_14060 72266 72883 gene locus_tag LOCUS_14070 72266 72883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 72880 73371 gene locus_tag LOCUS_14080 72880 73371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_14080 73419 75494 gene locus_tag LOCUS_14090 gene pepO 73419 75494 CDS product endothelin-converting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962266.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence15 1025 3226 gene locus_tag LOCUS_14100 1025 3226 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_14100 3692 3333 gene locus_tag LOCUS_14110 3692 3333 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087586.1 protein_id gnl|my_center|LOCUS_14110 4693 4145 gene locus_tag LOCUS_14120 4693 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 5524 5336 gene locus_tag LOCUS_14130 5524 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 6127 5558 gene locus_tag LOCUS_14140 6127 5558 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538562.1 protein_id gnl|my_center|LOCUS_14140 7202 7705 gene locus_tag LOCUS_14150 7202 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 7946 8344 gene locus_tag LOCUS_14160 7946 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 8608 9333 gene locus_tag LOCUS_14170 8608 9333 CDS product putative Crp/Fnr-family transriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701169.1 protein_id gnl|my_center|LOCUS_14170 9800 9988 gene locus_tag LOCUS_14180 9800 9988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 10435 13602 gene locus_tag LOCUS_14190 10435 13602 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_14190 13615 15102 gene locus_tag LOCUS_14200 13615 15102 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_14200 15367 16776 gene locus_tag LOCUS_14210 gene pel 15367 16776 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_14210 16910 19303 gene locus_tag LOCUS_14220 16910 19303 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108625.1 protein_id gnl|my_center|LOCUS_14220 19306 19524 gene locus_tag LOCUS_14230 19306 19524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 19533 20933 gene locus_tag LOCUS_14240 19533 20933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 21052 21366 gene locus_tag LOCUS_14250 gene rhaM 21052 21366 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFZ6 protein_id gnl|my_center|LOCUS_14250 23035 21518 gene locus_tag LOCUS_14260 23035 21518 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109150.1 protein_id gnl|my_center|LOCUS_14260 26609 23838 gene locus_tag LOCUS_14270 26609 23838 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A065 protein_id gnl|my_center|LOCUS_14270 27959 26697 gene locus_tag LOCUS_14280 27959 26697 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_14280 29088 28042 gene locus_tag LOCUS_14290 29088 28042 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766583.1 protein_id gnl|my_center|LOCUS_14290 29890 30453 gene locus_tag LOCUS_14300 29890 30453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964064.1 protein_id gnl|my_center|LOCUS_14300 30552 34244 gene locus_tag LOCUS_14310 30552 34244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 34478 37492 gene locus_tag LOCUS_14320 34478 37492 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202552.1 protein_id gnl|my_center|LOCUS_14320 37519 39105 gene locus_tag LOCUS_14330 37519 39105 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794953.1 protein_id gnl|my_center|LOCUS_14330 39188 40960 gene locus_tag LOCUS_14340 39188 40960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 41940 41281 gene locus_tag LOCUS_14350 41940 41281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 42457 41948 gene locus_tag LOCUS_14360 42457 41948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 42586 42744 gene locus_tag LOCUS_14370 42586 42744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 43698 42718 gene locus_tag LOCUS_14380 43698 42718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 43852 45747 gene locus_tag LOCUS_14390 43852 45747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 45747 47036 gene locus_tag LOCUS_14400 45747 47036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 48403 47420 gene locus_tag LOCUS_14410 48403 47420 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942015.1 protein_id gnl|my_center|LOCUS_14410 48712 48407 gene locus_tag LOCUS_14420 48712 48407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 49472 48720 gene locus_tag LOCUS_14430 49472 48720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 49741 49469 gene locus_tag LOCUS_14440 49741 49469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 50988 49861 gene locus_tag LOCUS_14450 50988 49861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 51875 51186 gene locus_tag LOCUS_14460 51875 51186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 52596 52315 gene locus_tag LOCUS_14470 52596 52315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 52835 52596 gene locus_tag LOCUS_14480 52835 52596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 53350 53102 gene locus_tag LOCUS_14490 53350 53102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 53706 55802 gene locus_tag LOCUS_14500 53706 55802 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973081.1 protein_id gnl|my_center|LOCUS_14500 56475 57755 gene locus_tag LOCUS_14510 56475 57755 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973080.1 protein_id gnl|my_center|LOCUS_14510 58653 60038 gene locus_tag LOCUS_14520 58653 60038 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706833.1 protein_id gnl|my_center|LOCUS_14520 60485 61636 gene locus_tag LOCUS_14530 gene lldD 60485 61636 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 protein_id gnl|my_center|LOCUS_14530 62400 63818 gene locus_tag LOCUS_14540 62400 63818 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118019.1 protein_id gnl|my_center|LOCUS_14540 64191 65648 gene locus_tag LOCUS_14550 64191 65648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 65700 69287 gene locus_tag LOCUS_14560 65700 69287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 69287 70351 gene locus_tag LOCUS_14570 69287 70351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 71138 73255 gene locus_tag LOCUS_14580 71138 73255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence16 1371 343 gene locus_tag LOCUS_14590 1371 343 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_14590 1703 4936 gene locus_tag LOCUS_14600 1703 4936 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_14600 4990 6774 gene locus_tag LOCUS_14610 4990 6774 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_14610 6785 8497 gene locus_tag LOCUS_14620 6785 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 8580 10835 gene locus_tag LOCUS_14630 8580 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 10983 12455 gene locus_tag LOCUS_14640 10983 12455 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_14640 12542 15577 gene locus_tag LOCUS_14650 12542 15577 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108253.1 protein_id gnl|my_center|LOCUS_14650 15582 17201 gene locus_tag LOCUS_14660 15582 17201 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_14660 17297 18334 gene locus_tag LOCUS_14670 17297 18334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 18336 19607 gene locus_tag LOCUS_14680 18336 19607 CDS product family 88 glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107571.1 protein_id gnl|my_center|LOCUS_14680 19614 21248 gene locus_tag LOCUS_14690 19614 21248 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109159.1 protein_id gnl|my_center|LOCUS_14690 21250 22197 gene locus_tag LOCUS_14700 21250 22197 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_14700 22200 23186 gene locus_tag LOCUS_14710 22200 23186 CDS product pectinesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0B2 protein_id gnl|my_center|LOCUS_14710 23207 24481 gene locus_tag LOCUS_14720 23207 24481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 24481 25251 gene locus_tag LOCUS_14730 24481 25251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 25251 25598 gene locus_tag LOCUS_14740 25251 25598 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_14740 25664 26470 gene locus_tag LOCUS_14750 25664 26470 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783762.1 protein_id gnl|my_center|LOCUS_14750 27111 26566 gene locus_tag LOCUS_14760 27111 26566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 27681 27118 gene locus_tag LOCUS_14770 27681 27118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 29921 27705 gene locus_tag LOCUS_14780 29921 27705 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_14780 33562 29921 gene locus_tag LOCUS_14790 33562 29921 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_14790 33718 35862 gene locus_tag LOCUS_14800 33718 35862 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_14800 36285 36010 gene locus_tag LOCUS_14810 36285 36010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 36935 36285 gene locus_tag LOCUS_14820 gene psd 36935 36285 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_14820 37735 36944 gene locus_tag LOCUS_14830 gene cdsA 37735 36944 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 protein_id gnl|my_center|LOCUS_14830 38353 37739 gene locus_tag LOCUS_14840 38353 37739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_14840 40482 38449 gene locus_tag LOCUS_14850 gene ftsH 40482 38449 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_14850 40874 40503 gene locus_tag LOCUS_14860 gene rsfS 40874 40503 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_14860 40958 41689 gene locus_tag LOCUS_14870 gene birA 40958 41689 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_14870 41816 43267 gene locus_tag LOCUS_14880 41816 43267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 43743 43351 gene locus_tag LOCUS_14890 43743 43351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 protein_id gnl|my_center|LOCUS_14890 44394 43750 gene locus_tag LOCUS_14900 gene pyrE 44394 43750 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 protein_id gnl|my_center|LOCUS_14900 44403 45026 gene locus_tag LOCUS_14910 44403 45026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 46748 44994 gene locus_tag LOCUS_14920 46748 44994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_14920 46896 48200 gene locus_tag LOCUS_14930 46896 48200 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_14930 48231 50324 gene locus_tag LOCUS_14940 48231 50324 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882427.1 protein_id gnl|my_center|LOCUS_14940 50979 50407 gene locus_tag LOCUS_14950 50979 50407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938028.1 protein_id gnl|my_center|LOCUS_14950 51289 51852 gene locus_tag LOCUS_14960 51289 51852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 51922 52527 gene locus_tag LOCUS_14970 51922 52527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 52598 53068 gene locus_tag LOCUS_14980 52598 53068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 53679 53227 gene locus_tag LOCUS_14990 gene coaD 53679 53227 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_14990 54685 53711 gene locus_tag LOCUS_15000 gene ddl 54685 53711 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD5 protein_id gnl|my_center|LOCUS_15000 54868 55347 gene locus_tag LOCUS_15010 54868 55347 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962813.1 protein_id gnl|my_center|LOCUS_15010 55354 56394 gene locus_tag LOCUS_15020 55354 56394 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_15020 56633 57265 gene locus_tag LOCUS_15030 56633 57265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 57415 58176 gene locus_tag LOCUS_15040 57415 58176 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ8 protein_id gnl|my_center|LOCUS_15040 59323 58439 gene locus_tag LOCUS_15050 59323 58439 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205074.1 protein_id gnl|my_center|LOCUS_15050 59549 60130 gene locus_tag LOCUS_15060 59549 60130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 60269 60697 gene locus_tag LOCUS_15070 60269 60697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 60862 61926 gene locus_tag LOCUS_15080 60862 61926 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_15080 61951 65118 gene locus_tag LOCUS_15090 61951 65118 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_15090 65108 66592 gene locus_tag LOCUS_15100 65108 66592 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_15100 67279 66710 gene locus_tag LOCUS_15110 67279 66710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 67632 67285 gene locus_tag LOCUS_15120 67632 67285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 68413 67835 gene locus_tag LOCUS_15130 68413 67835 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_15130 69590 68673 gene locus_tag LOCUS_15140 69590 68673 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108261.1 protein_id gnl|my_center|LOCUS_15140 70393 69662 gene locus_tag LOCUS_15150 70393 69662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence17 903 127 gene locus_tag LOCUS_15160 903 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 3904 905 gene locus_tag LOCUS_15170 3904 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 11117 3930 gene locus_tag LOCUS_15180 11117 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 13126 11243 gene locus_tag LOCUS_15190 13126 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 16486 14393 gene locus_tag LOCUS_15200 16486 14393 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_15200 17889 16483 gene locus_tag LOCUS_15210 gene xylE 17889 16483 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_15210 19025 18105 gene locus_tag LOCUS_15220 19025 18105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 20864 19032 gene locus_tag LOCUS_15230 20864 19032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 23212 20906 gene locus_tag LOCUS_15240 23212 20906 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_15240 24869 23223 gene locus_tag LOCUS_15250 24869 23223 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789258.1 protein_id gnl|my_center|LOCUS_15250 26276 24876 gene locus_tag LOCUS_15260 26276 24876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796641.1 protein_id gnl|my_center|LOCUS_15260 26998 26279 gene locus_tag LOCUS_15270 26998 26279 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122354.1 protein_id gnl|my_center|LOCUS_15270 28414 27008 gene locus_tag LOCUS_15280 28414 27008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796641.1 protein_id gnl|my_center|LOCUS_15280 29982 28501 gene locus_tag LOCUS_15290 29982 28501 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_15290 33076 29984 gene locus_tag LOCUS_15300 33076 29984 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_15300 36140 33372 gene locus_tag LOCUS_15310 36140 33372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_15310 36652 36203 gene locus_tag LOCUS_15320 gene tadA 36652 36203 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_15320 36690 38465 gene locus_tag LOCUS_15330 gene dxs 36690 38465 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWC0 protein_id gnl|my_center|LOCUS_15330 39803 38457 gene locus_tag LOCUS_15340 gene dgt 39803 38457 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_15340 40031 43852 gene locus_tag LOCUS_15350 40031 43852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 44422 43853 gene locus_tag LOCUS_15360 44422 43853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_15360 44571 45143 gene locus_tag LOCUS_15370 44571 45143 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_15370 45148 45345 gene locus_tag LOCUS_15380 45148 45345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 46934 45342 gene locus_tag LOCUS_15390 46934 45342 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_15390 47380 46952 gene locus_tag LOCUS_15400 47380 46952 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_15400 48167 47583 gene locus_tag LOCUS_15410 48167 47583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_15410 49969 48488 gene locus_tag LOCUS_15420 49969 48488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 50259 50402 gene locus_tag LOCUS_15430 50259 50402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 52314 50899 gene locus_tag LOCUS_15440 52314 50899 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_15440 52734 52955 gene locus_tag LOCUS_15450 52734 52955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 53543 53106 gene locus_tag LOCUS_15460 53543 53106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 54705 53527 gene locus_tag LOCUS_15470 54705 53527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459849.1 protein_id gnl|my_center|LOCUS_15470 55342 54680 gene locus_tag LOCUS_15480 55342 54680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 55776 56117 gene locus_tag LOCUS_15490 55776 56117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 56234 57028 gene locus_tag LOCUS_15500 56234 57028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 57232 57414 gene locus_tag LOCUS_15510 57232 57414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 57529 57651 gene locus_tag LOCUS_15520 57529 57651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 58001 57919 gene locus_tag LOCUS_t00170 58001 57919 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 58144 59085 gene locus_tag LOCUS_15530 gene prsA 58144 59085 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_15530 59119 59766 gene locus_tag LOCUS_15540 gene rplY 59119 59766 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 protein_id gnl|my_center|LOCUS_15540 59844 60464 gene locus_tag LOCUS_15550 gene pth 59844 60464 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_15550 63828 60529 gene locus_tag LOCUS_15560 gene fpp1 63828 60529 CDS product metalloprotease Fpp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962407.1 protein_id gnl|my_center|LOCUS_15560 63925 64833 gene locus_tag LOCUS_15570 gene ribF 63925 64833 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_15570 64838 66157 gene locus_tag LOCUS_15580 64838 66157 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_15580 66212 67483 gene locus_tag LOCUS_15590 gene serS 66212 67483 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_15590 67853 68056 gene locus_tag LOCUS_15600 67853 68056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 68038 68367 gene locus_tag LOCUS_15610 68038 68367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence18 994 221 gene locus_tag LOCUS_15620 994 221 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_15620 1861 1430 gene locus_tag LOCUS_15630 1861 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 2508 1918 gene locus_tag LOCUS_15640 gene def 2508 1918 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_15640 2966 2562 gene locus_tag LOCUS_15650 2966 2562 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_15650 3054 3869 gene locus_tag LOCUS_15660 gene dapD 3054 3869 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_15660 3938 5023 gene locus_tag LOCUS_15670 3938 5023 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016813.1 protein_id gnl|my_center|LOCUS_15670 5842 5018 gene locus_tag LOCUS_15680 5842 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 6021 6779 gene locus_tag LOCUS_15690 6021 6779 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_15690 7543 6782 gene locus_tag LOCUS_15700 7543 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963748.1 protein_id gnl|my_center|LOCUS_15700 7635 8747 gene locus_tag LOCUS_15710 7635 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 8747 9925 gene locus_tag LOCUS_15720 8747 9925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 9930 10778 gene locus_tag LOCUS_15730 9930 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 10802 11857 gene locus_tag LOCUS_15740 10802 11857 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355946.1 protein_id gnl|my_center|LOCUS_15740 11857 12417 gene locus_tag LOCUS_15750 11857 12417 CDS product translation factor Sua5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_15750 12420 13856 gene locus_tag LOCUS_15760 gene cca 12420 13856 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_15760 13913 14929 gene locus_tag LOCUS_15770 gene ctaA 13913 14929 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H039 protein_id gnl|my_center|LOCUS_15770 15018 15530 gene locus_tag LOCUS_15780 15018 15530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_15780 15661 16719 gene locus_tag LOCUS_15790 15661 16719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_15790 17972 16905 gene locus_tag LOCUS_15800 17972 16905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 18134 19039 gene locus_tag LOCUS_15810 18134 19039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_15810 19041 19877 gene locus_tag LOCUS_15820 19041 19877 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_15820 19954 22806 gene locus_tag LOCUS_15830 19954 22806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 22852 25827 gene locus_tag LOCUS_15840 22852 25827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 25921 28248 gene locus_tag LOCUS_15850 25921 28248 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963773.1 protein_id gnl|my_center|LOCUS_15850 28354 30360 gene locus_tag LOCUS_15860 gene uvrB 28354 30360 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY25 protein_id gnl|my_center|LOCUS_15860 30956 30513 gene locus_tag LOCUS_15870 30956 30513 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_15870 31155 32444 gene locus_tag LOCUS_15880 31155 32444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 32489 32728 gene locus_tag LOCUS_15890 32489 32728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 32803 33495 gene locus_tag LOCUS_15900 gene cysH 32803 33495 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J542 protein_id gnl|my_center|LOCUS_15900 33983 33525 gene locus_tag LOCUS_15910 33983 33525 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_15910 35290 34097 gene locus_tag LOCUS_15920 gene sucC 35290 34097 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_15920 35436 35672 gene locus_tag LOCUS_15930 35436 35672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 protein_id gnl|my_center|LOCUS_15930 35758 37377 gene locus_tag LOCUS_15940 gene pyrG 35758 37377 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_15940 37510 39369 gene locus_tag LOCUS_15950 gene yidC 37510 39369 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U2 protein_id gnl|my_center|LOCUS_15950 39461 40537 gene locus_tag LOCUS_15960 39461 40537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 41888 40542 gene locus_tag LOCUS_15970 41888 40542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 42003 42713 gene locus_tag LOCUS_15980 42003 42713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964005.1 protein_id gnl|my_center|LOCUS_15980 42754 43947 gene locus_tag LOCUS_15990 gene mnmA 42754 43947 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_15990 43969 45573 gene locus_tag LOCUS_16000 43969 45573 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_16000 45573 46517 gene locus_tag LOCUS_16010 45573 46517 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_16010 46925 46674 gene locus_tag LOCUS_16020 46925 46674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 47512 47006 gene locus_tag LOCUS_16030 47512 47006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 47951 47544 gene locus_tag LOCUS_16040 gene osmC 47951 47544 CDS product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_16040 49872 47953 gene locus_tag LOCUS_16050 49872 47953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 protein_id gnl|my_center|LOCUS_16050 51412 49883 gene locus_tag LOCUS_16060 gene guaA 51412 49883 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_16060 52899 51490 gene locus_tag LOCUS_16070 52899 51490 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803953.1 protein_id gnl|my_center|LOCUS_16070 54565 52973 gene locus_tag LOCUS_16080 gene bshC 54565 52973 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_16080 54702 57227 gene locus_tag LOCUS_16090 54702 57227 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_16090 58613 57306 gene locus_tag LOCUS_16100 gene rimO 58613 57306 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_16100 59112 60107 gene locus_tag LOCUS_16110 59112 60107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 60121 61527 gene locus_tag LOCUS_16120 60121 61527 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525350.1 protein_id gnl|my_center|LOCUS_16120 61566 64436 gene locus_tag LOCUS_16130 61566 64436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 64501 66222 gene locus_tag LOCUS_16140 64501 66222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 66272 66748 gene locus_tag LOCUS_16150 66272 66748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 67042 66749 gene locus_tag LOCUS_16160 67042 66749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 <68004 67047 gene locus_tag LOCUS_16170 <68004 67047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZI3:signal recognition particle receptor FtsY >Feature sequence19 750 1052 gene locus_tag LOCUS_16180 750 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3160 8910 gene locus_tag LOCUS_16190 3160 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 8935 11664 gene locus_tag LOCUS_16200 8935 11664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 12809 11721 gene locus_tag LOCUS_16210 12809 11721 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964556.1 protein_id gnl|my_center|LOCUS_16210 13475 12864 gene locus_tag LOCUS_16220 13475 12864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_16220 14479 13481 gene locus_tag LOCUS_16230 14479 13481 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106543.1 protein_id gnl|my_center|LOCUS_16230 15114 14476 gene locus_tag LOCUS_16240 15114 14476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016370.1 protein_id gnl|my_center|LOCUS_16240 16040 15111 gene locus_tag LOCUS_16250 16040 15111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964559.1 protein_id gnl|my_center|LOCUS_16250 16089 16319 gene locus_tag LOCUS_16260 16089 16319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 17597 16323 gene locus_tag LOCUS_16270 gene purD 17597 16323 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_16270 17677 18984 gene locus_tag LOCUS_16280 gene capK 17677 18984 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964561.1 protein_id gnl|my_center|LOCUS_16280 18981 20153 gene locus_tag LOCUS_16290 18981 20153 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107354.1 protein_id gnl|my_center|LOCUS_16290 21457 20150 gene locus_tag LOCUS_16300 gene wcaJ 21457 20150 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_16300 22495 21503 gene locus_tag LOCUS_16310 22495 21503 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_16310 23934 22516 gene locus_tag LOCUS_16320 gene ugd 23934 22516 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_16320 24688 23939 gene locus_tag LOCUS_16330 24688 23939 CDS product UDP-N-acetyl-D-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_16330 25790 24678 gene locus_tag LOCUS_16340 25790 24678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 27090 25831 gene locus_tag LOCUS_16350 27090 25831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 28082 27096 gene locus_tag LOCUS_16360 28082 27096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 28950 28084 gene locus_tag LOCUS_16370 28950 28084 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887309.1 protein_id gnl|my_center|LOCUS_16370 30158 28920 gene locus_tag LOCUS_16380 30158 28920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 32082 30160 gene locus_tag LOCUS_16390 32082 30160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 33356 32106 gene locus_tag LOCUS_16400 33356 32106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 34438 33359 gene locus_tag LOCUS_16410 34438 33359 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880750.1 protein_id gnl|my_center|LOCUS_16410 35652 34432 gene locus_tag LOCUS_16420 35652 34432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 36962 35649 gene locus_tag LOCUS_16430 36962 35649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 37857 37096 gene locus_tag LOCUS_16440 gene cysQ 37857 37096 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_16440 39127 37871 gene locus_tag LOCUS_16450 gene cysN 39127 37871 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_16450 40175 39270 gene locus_tag LOCUS_16460 gene cysD 40175 39270 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_16460 40773 40168 gene locus_tag LOCUS_16470 gene cysC 40773 40168 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CR04 protein_id gnl|my_center|LOCUS_16470 41237 40806 gene locus_tag LOCUS_16480 41237 40806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 42463 41255 gene locus_tag LOCUS_16490 42463 41255 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202257.1 protein_id gnl|my_center|LOCUS_16490 43636 42509 gene locus_tag LOCUS_16500 43636 42509 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767232.1 protein_id gnl|my_center|LOCUS_16500 44488 43637 gene locus_tag LOCUS_16510 gene rmlD 44488 43637 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_16510 45033 44485 gene locus_tag LOCUS_16520 gene rmlC 45033 44485 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_16520 45886 45035 gene locus_tag LOCUS_16530 gene rfbA 45886 45035 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y2R7 protein_id gnl|my_center|LOCUS_16530 46913 45903 gene locus_tag LOCUS_16540 gene rfbB 46913 45903 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5L7 protein_id gnl|my_center|LOCUS_16540 47888 46914 gene locus_tag LOCUS_16550 47888 46914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 49568 47889 gene locus_tag LOCUS_16560 49568 47889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_16560 51086 49593 gene locus_tag LOCUS_16570 51086 49593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_16570 51954 51088 gene locus_tag LOCUS_16580 51954 51088 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_16580 52075 52272 gene locus_tag LOCUS_16590 52075 52272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 53322 52342 gene locus_tag LOCUS_16600 53322 52342 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_16600 54957 53341 gene locus_tag LOCUS_16610 54957 53341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 56252 55065 gene locus_tag LOCUS_16620 gene pgk 56252 55065 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_16620 56340 57488 gene locus_tag LOCUS_16630 gene holB 56340 57488 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_16630 58094 57540 gene locus_tag LOCUS_16640 58094 57540 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962186.1 protein_id gnl|my_center|LOCUS_16640 59166 58312 gene locus_tag LOCUS_16650 59166 58312 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_16650 59651 59166 gene locus_tag LOCUS_16660 59651 59166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 60168 59668 gene locus_tag LOCUS_16670 60168 59668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 62072 60201 gene locus_tag LOCUS_16680 gene mnmG 62072 60201 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_16680 62506 62087 gene locus_tag LOCUS_16690 gene ybeY 62506 62087 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_16690 66041 62499 gene locus_tag LOCUS_16700 66041 62499 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence20 92 18 gene locus_tag LOCUS_t00180 92 18 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 900 184 gene locus_tag LOCUS_16710 900 184 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_16710 2446 965 gene locus_tag LOCUS_16720 2446 965 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_16720 3401 2994 gene locus_tag LOCUS_16730 3401 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 3848 3402 gene locus_tag LOCUS_16740 3848 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 4326 4012 gene locus_tag LOCUS_16750 4326 4012 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY02 protein_id gnl|my_center|LOCUS_16750 4493 4311 gene locus_tag LOCUS_16760 4493 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 4435 6498 gene locus_tag LOCUS_16770 gene ptrB 4435 6498 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_16770 6590 7630 gene locus_tag LOCUS_16780 6590 7630 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963027.1 protein_id gnl|my_center|LOCUS_16780 7778 9037 gene locus_tag LOCUS_16790 7778 9037 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_16790 9123 9725 gene locus_tag LOCUS_16800 9123 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 10745 9786 gene locus_tag LOCUS_16810 10745 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963908.1 protein_id gnl|my_center|LOCUS_16810 10868 11161 gene locus_tag LOCUS_16820 10868 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 11204 13630 gene locus_tag LOCUS_16830 11204 13630 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_16830 13646 14938 gene locus_tag LOCUS_16840 13646 14938 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_16840 14939 16387 gene locus_tag LOCUS_16850 14939 16387 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022292.1 protein_id gnl|my_center|LOCUS_16850 17542 16448 gene locus_tag LOCUS_16860 17542 16448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 20671 17885 gene locus_tag LOCUS_16870 gene uvrA1 20671 17885 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_16870 20913 21503 gene locus_tag LOCUS_16880 20913 21503 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_16880 21565 21714 gene locus_tag LOCUS_16890 21565 21714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 22412 21732 gene locus_tag LOCUS_16900 gene nth 22412 21732 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_16900 23928 22570 gene locus_tag LOCUS_16910 gene hmcM 23928 22570 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906037.1 protein_id gnl|my_center|LOCUS_16910 24185 24697 gene locus_tag LOCUS_16920 24185 24697 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_16920 25841 24774 gene locus_tag LOCUS_16930 gene aroB 25841 24774 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_16930 25935 27125 gene locus_tag LOCUS_16940 gene putA 25935 27125 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_16940 27202 28191 gene locus_tag LOCUS_16950 27202 28191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144116.1 protein_id gnl|my_center|LOCUS_16950 28303 28851 gene locus_tag LOCUS_16960 28303 28851 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119882.1 protein_id gnl|my_center|LOCUS_16960 29241 28912 gene locus_tag LOCUS_16970 29241 28912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 protein_id gnl|my_center|LOCUS_16970 29656 29246 gene locus_tag LOCUS_16980 29656 29246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962798.1 protein_id gnl|my_center|LOCUS_16980 30383 29658 gene locus_tag LOCUS_16990 30383 29658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 31585 30623 gene locus_tag LOCUS_17000 gene serA 31585 30623 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_17000 32675 31611 gene locus_tag LOCUS_17010 gene serC 32675 31611 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 protein_id gnl|my_center|LOCUS_17010 33788 32745 gene locus_tag LOCUS_17020 33788 32745 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_17020 33854 34204 gene locus_tag LOCUS_17030 gene fdx1 33854 34204 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_17030 34814 34251 gene locus_tag LOCUS_17040 gene mcbG 34814 34251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 protein_id gnl|my_center|LOCUS_17040 36219 34885 gene locus_tag LOCUS_17050 gene purB 36219 34885 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_17050 36381 36566 gene locus_tag LOCUS_17060 36381 36566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 37119 36556 gene locus_tag LOCUS_17070 37119 36556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963491.1 protein_id gnl|my_center|LOCUS_17070 37795 37112 gene locus_tag LOCUS_17080 gene npdA 37795 37112 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 protein_id gnl|my_center|LOCUS_17080 37911 39113 gene locus_tag LOCUS_17090 37911 39113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 39177 39836 gene locus_tag LOCUS_17100 gene trmH 39177 39836 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_17100 40633 39815 gene locus_tag LOCUS_17110 40633 39815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 41510 40737 gene locus_tag LOCUS_17120 41510 40737 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 protein_id gnl|my_center|LOCUS_17120 43363 41591 gene locus_tag LOCUS_17130 43363 41591 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_17130 44011 43439 gene locus_tag LOCUS_17140 44011 43439 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_17140 44547 44074 gene locus_tag LOCUS_17150 gene rlmH 44547 44074 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_17150 45398 44547 gene locus_tag LOCUS_17160 45398 44547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 45442 46299 gene locus_tag LOCUS_17170 gene nadC 45442 46299 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_17170 46300 47220 gene locus_tag LOCUS_17180 gene yfkH 46300 47220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_17180 47248 47811 gene locus_tag LOCUS_17190 47248 47811 CDS product chalcone isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964030.1 protein_id gnl|my_center|LOCUS_17190 47816 48238 gene locus_tag LOCUS_17200 47816 48238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193599.1 protein_id gnl|my_center|LOCUS_17200 48699 48289 gene locus_tag LOCUS_17210 gene osmC 48699 48289 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_17210 48833 51283 gene locus_tag LOCUS_17220 gene priA 48833 51283 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 protein_id gnl|my_center|LOCUS_17220 51990 51280 gene locus_tag LOCUS_17230 51990 51280 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_17230 52155 52493 gene locus_tag LOCUS_17240 gene rpsF 52155 52493 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 protein_id gnl|my_center|LOCUS_17240 52497 52793 gene locus_tag LOCUS_17250 gene rpsR 52497 52793 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_17250 52807 53256 gene locus_tag LOCUS_17260 gene rplI 52807 53256 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P1 protein_id gnl|my_center|LOCUS_17260 53331 53807 gene locus_tag LOCUS_17270 53331 53807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 protein_id gnl|my_center|LOCUS_17270 55053 53812 gene locus_tag LOCUS_17280 55053 53812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_17280 55151 56521 gene locus_tag LOCUS_17290 gene hisS 55151 56521 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H160 protein_id gnl|my_center|LOCUS_17290 56581 57573 gene locus_tag LOCUS_17300 gene ldhA 56581 57573 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112591.1 protein_id gnl|my_center|LOCUS_17300 57872 58270 gene locus_tag LOCUS_17310 57872 58270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 58275 58487 gene locus_tag LOCUS_17320 58275 58487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 59083 58541 gene locus_tag LOCUS_17330 59083 58541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 59580 59996 gene locus_tag LOCUS_17340 59580 59996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 60342 60692 gene locus_tag LOCUS_17350 60342 60692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 60734 61492 gene locus_tag LOCUS_17360 60734 61492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 61677 62048 gene locus_tag LOCUS_17370 61677 62048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 62638 62405 gene locus_tag LOCUS_17380 62638 62405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 62714 62923 gene locus_tag LOCUS_17390 62714 62923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence21 3593 189 gene locus_tag LOCUS_17400 3593 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 3971 3825 gene locus_tag LOCUS_17410 3971 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 4495 4099 gene locus_tag LOCUS_tm00010 4495 4099 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 4822 6027 gene locus_tag LOCUS_17420 4822 6027 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_17420 6045 6884 gene locus_tag LOCUS_17430 6045 6884 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_17430 6949 8049 gene locus_tag LOCUS_17440 6949 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 8066 10066 gene locus_tag LOCUS_17450 8066 10066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 11455 10106 gene locus_tag LOCUS_17460 11455 10106 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_17460 11961 11419 gene locus_tag LOCUS_17470 11961 11419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 12783 12016 gene locus_tag LOCUS_17480 12783 12016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 13141 12842 gene locus_tag LOCUS_17490 13141 12842 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_17490 13748 13143 gene locus_tag LOCUS_17500 13748 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107677.1 protein_id gnl|my_center|LOCUS_17500 15633 13846 gene locus_tag LOCUS_17510 15633 13846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 16570 15713 gene locus_tag LOCUS_17520 16570 15713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 18186 16573 gene locus_tag LOCUS_17530 18186 16573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 19352 18201 gene locus_tag LOCUS_17540 19352 18201 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_17540 20256 19438 gene locus_tag LOCUS_17550 gene kdsA 20256 19438 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY4 protein_id gnl|my_center|LOCUS_17550 20484 22286 gene locus_tag LOCUS_17560 gene typA 20484 22286 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_17560 22563 23534 gene locus_tag LOCUS_17570 22563 23534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_17570 23534 24634 gene locus_tag LOCUS_17580 23534 24634 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963975.1 protein_id gnl|my_center|LOCUS_17580 24854 26038 gene locus_tag LOCUS_17590 24854 26038 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036849.1 protein_id gnl|my_center|LOCUS_17590 27732 26776 gene locus_tag LOCUS_17600 27732 26776 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_17600 29351 27747 gene locus_tag LOCUS_17610 29351 27747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 29672 29379 gene locus_tag LOCUS_17620 29672 29379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17620 29988 29680 gene locus_tag LOCUS_17630 29988 29680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17630 30765 30959 gene locus_tag LOCUS_17640 30765 30959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 31077 31499 gene locus_tag LOCUS_17650 31077 31499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17650 31717 32130 gene locus_tag LOCUS_17660 31717 32130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963968.1 protein_id gnl|my_center|LOCUS_17660 33266 32127 gene locus_tag LOCUS_17670 gene wbsE 33266 32127 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 protein_id gnl|my_center|LOCUS_17670 33313 34413 gene locus_tag LOCUS_17680 33313 34413 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963969.1 protein_id gnl|my_center|LOCUS_17680 35373 34432 gene locus_tag LOCUS_17690 35373 34432 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_17690 36266 35370 gene locus_tag LOCUS_17700 36266 35370 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_17700 36966 36283 gene locus_tag LOCUS_17710 gene ftsE 36966 36283 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_17710 37172 40207 gene locus_tag LOCUS_17720 37172 40207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_17720 40218 41978 gene locus_tag LOCUS_17730 40218 41978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_17730 42074 43741 gene locus_tag LOCUS_17740 42074 43741 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_17740 44536 43778 gene locus_tag LOCUS_17750 44536 43778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 45298 44588 gene locus_tag LOCUS_17760 45298 44588 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_17760 45441 45821 gene locus_tag LOCUS_17770 45441 45821 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_17770 46456 45824 gene locus_tag LOCUS_17780 46456 45824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 47102 46440 gene locus_tag LOCUS_17790 47102 46440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 48381 47161 gene locus_tag LOCUS_17800 48381 47161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_17800 48387 49625 gene locus_tag LOCUS_17810 48387 49625 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_17810 49758 50738 gene locus_tag LOCUS_17820 49758 50738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 50962 51732 gene locus_tag LOCUS_17830 50962 51732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 52127 52318 gene locus_tag LOCUS_17840 52127 52318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 52625 52870 gene locus_tag LOCUS_17850 52625 52870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 52861 53184 gene locus_tag LOCUS_17860 52861 53184 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH1 protein_id gnl|my_center|LOCUS_17860 53364 54008 gene locus_tag LOCUS_17870 53364 54008 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_17870 54009 55289 gene locus_tag LOCUS_17880 54009 55289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_17880 55305 55535 gene locus_tag LOCUS_17890 55305 55535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_17890 55525 56568 gene locus_tag LOCUS_17900 55525 56568 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938897.1 protein_id gnl|my_center|LOCUS_17900 56702 58786 gene locus_tag LOCUS_17910 56702 58786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 58797 59681 gene locus_tag LOCUS_17920 58797 59681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963324.1 protein_id gnl|my_center|LOCUS_17920 59766 60932 gene locus_tag LOCUS_17930 59766 60932 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_17930 61006 61224 gene locus_tag LOCUS_17940 gene rpsU 61006 61224 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_17940 61298 62191 gene locus_tag LOCUS_17950 gene xerC 61298 62191 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_17950 62219 62521 gene locus_tag LOCUS_17960 62219 62521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_17960 62634 62708 gene locus_tag LOCUS_t00190 62634 62708 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence22 578 1540 gene locus_tag LOCUS_17970 578 1540 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_17970 1545 1871 gene locus_tag LOCUS_17980 1545 1871 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963176.1 protein_id gnl|my_center|LOCUS_17980 1875 2807 gene locus_tag LOCUS_17990 1875 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2810 3685 gene locus_tag LOCUS_18000 gene udp 2810 3685 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_18000 3755 5803 gene locus_tag LOCUS_18010 gene ppk 3755 5803 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCX2 protein_id gnl|my_center|LOCUS_18010 5803 6654 gene locus_tag LOCUS_18020 5803 6654 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_18020 6730 6903 gene locus_tag LOCUS_18030 6730 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 7540 6875 gene locus_tag LOCUS_18040 gene ung2 7540 6875 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_18040 7586 9769 gene locus_tag LOCUS_18050 7586 9769 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG0 protein_id gnl|my_center|LOCUS_18050 9769 10185 gene locus_tag LOCUS_18060 gene yuxK 9769 10185 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_18060 11565 10258 gene locus_tag LOCUS_18070 gene gltP 11565 10258 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_18070 12634 11573 gene locus_tag LOCUS_18080 gene aroC 12634 11573 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_18080 12808 13647 gene locus_tag LOCUS_18090 12808 13647 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_18090 13685 14515 gene locus_tag LOCUS_18100 13685 14515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 17445 14527 gene locus_tag LOCUS_18110 17445 14527 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_18110 17599 18099 gene locus_tag LOCUS_18120 17599 18099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 19351 18221 gene locus_tag LOCUS_18130 19351 18221 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_18130 22378 19460 gene locus_tag LOCUS_18140 22378 19460 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_18140 22929 22447 gene locus_tag LOCUS_18150 22929 22447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_18150 23747 22956 gene locus_tag LOCUS_18160 23747 22956 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_18160 24219 23773 gene locus_tag LOCUS_18170 24219 23773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_18170 25569 24226 gene locus_tag LOCUS_18180 25569 24226 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_18180 26526 25579 gene locus_tag LOCUS_18190 26526 25579 CDS product organic solvent ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_18190 27642 26581 gene locus_tag LOCUS_18200 27642 26581 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_18200 27881 30541 gene locus_tag LOCUS_18210 27881 30541 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_18210 30552 30938 gene locus_tag LOCUS_18220 gene yjgF 30552 30938 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_18220 30982 32709 gene locus_tag LOCUS_18230 gene sglT 30982 32709 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_18230 37358 33000 gene locus_tag LOCUS_18240 37358 33000 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_18240 37264 37449 gene locus_tag LOCUS_18250 37264 37449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 37578 38600 gene locus_tag LOCUS_18260 gene tsaD 37578 38600 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_18260 38610 39317 gene locus_tag LOCUS_18270 38610 39317 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_18270 39360 40001 gene locus_tag LOCUS_18280 39360 40001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_18280 40005 40532 gene locus_tag LOCUS_18290 40005 40532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 40557 41642 gene locus_tag LOCUS_18300 40557 41642 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_18300 41642 42835 gene locus_tag LOCUS_18310 41642 42835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 protein_id gnl|my_center|LOCUS_18310 42991 43542 gene locus_tag LOCUS_18320 42991 43542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_18320 45050 43767 gene locus_tag LOCUS_18330 45050 43767 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_18330 46639 45050 gene locus_tag LOCUS_18340 46639 45050 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964344.1 protein_id gnl|my_center|LOCUS_18340 49234 46805 gene locus_tag LOCUS_18350 49234 46805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 50426 49227 gene locus_tag LOCUS_18360 50426 49227 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964347.1 protein_id gnl|my_center|LOCUS_18360 50807 50436 gene locus_tag LOCUS_18370 50807 50436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 51560 50919 gene locus_tag LOCUS_18380 51560 50919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 52302 51529 gene locus_tag LOCUS_18390 52302 51529 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964353.1 protein_id gnl|my_center|LOCUS_18390 53371 52295 gene locus_tag LOCUS_18400 53371 52295 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_18400 54555 53368 gene locus_tag LOCUS_18410 54555 53368 CDS product beta-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964355.1 protein_id gnl|my_center|LOCUS_18410 54858 54607 gene locus_tag LOCUS_18420 54858 54607 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_18420 55456 54833 gene locus_tag LOCUS_18430 55456 54833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964358.1 protein_id gnl|my_center|LOCUS_18430 56603 55449 gene locus_tag LOCUS_18440 56603 55449 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964359.1 protein_id gnl|my_center|LOCUS_18440 56799 56605 gene locus_tag LOCUS_18450 56799 56605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 57017 56799 gene locus_tag LOCUS_18460 57017 56799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_18460 57486 57055 gene locus_tag LOCUS_18470 gene darC1 57486 57055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964368.1 protein_id gnl|my_center|LOCUS_18470 58450 57584 gene locus_tag LOCUS_18480 58450 57584 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_18480 59197 58460 gene locus_tag LOCUS_18490 59197 58460 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_18490 60719 59187 gene locus_tag LOCUS_18500 gene hutH2 60719 59187 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964377.1 protein_id gnl|my_center|LOCUS_18500 60780 62015 gene locus_tag LOCUS_18510 60780 62015 CDS product dehydrogenase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964378.1 protein_id gnl|my_center|LOCUS_18510 62152 62237 gene locus_tag LOCUS_t00200 62152 62237 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 62306 62381 gene locus_tag LOCUS_t00210 62306 62381 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence23 633 433 gene locus_tag LOCUS_18520 633 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 774 989 gene locus_tag LOCUS_18530 774 989 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109410.1 protein_id gnl|my_center|LOCUS_18530 1360 1887 gene locus_tag LOCUS_18540 1360 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2605 2066 gene locus_tag LOCUS_18550 gene haaO 2605 2066 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_18550 3956 2772 gene locus_tag LOCUS_18560 3956 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 4727 4302 gene locus_tag LOCUS_18570 4727 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 5071 5961 gene locus_tag LOCUS_18580 5071 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 5966 6673 gene locus_tag LOCUS_18590 5966 6673 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107796.1 protein_id gnl|my_center|LOCUS_18590 6863 12424 gene locus_tag LOCUS_18600 6863 12424 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964323.1 protein_id gnl|my_center|LOCUS_18600 13598 12453 gene locus_tag LOCUS_18610 13598 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 13813 15405 gene locus_tag LOCUS_18620 13813 15405 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_18620 15565 16863 gene locus_tag LOCUS_18630 15565 16863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 17314 19527 gene locus_tag LOCUS_18640 gene pbpC 17314 19527 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_18640 19662 20144 gene locus_tag LOCUS_18650 19662 20144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 20163 21293 gene locus_tag LOCUS_18660 20163 21293 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108777.1 protein_id gnl|my_center|LOCUS_18660 21312 24446 gene locus_tag LOCUS_18670 21312 24446 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_18670 24455 25852 gene locus_tag LOCUS_18680 24455 25852 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 protein_id gnl|my_center|LOCUS_18680 26416 25943 gene locus_tag LOCUS_18690 26416 25943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784138.1 protein_id gnl|my_center|LOCUS_18690 26538 28187 gene locus_tag LOCUS_18700 gene mscS1 26538 28187 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963046.1 protein_id gnl|my_center|LOCUS_18700 28710 28270 gene locus_tag LOCUS_18710 28710 28270 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477506.1 protein_id gnl|my_center|LOCUS_18710 29229 28813 gene locus_tag LOCUS_18720 29229 28813 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974779.1 protein_id gnl|my_center|LOCUS_18720 30813 29326 gene locus_tag LOCUS_18730 30813 29326 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107154.1 protein_id gnl|my_center|LOCUS_18730 31546 30881 gene locus_tag LOCUS_18740 31546 30881 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680175.1 protein_id gnl|my_center|LOCUS_18740 31633 32691 gene locus_tag LOCUS_18750 gene dinB2 31633 32691 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_18750 33032 32664 gene locus_tag LOCUS_18760 33032 32664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 34802 33372 gene locus_tag LOCUS_18770 gene pykA 34802 33372 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_18770 35284 34802 gene locus_tag LOCUS_18780 35284 34802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 36111 35371 gene locus_tag LOCUS_18790 gene rnc 36111 35371 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 protein_id gnl|my_center|LOCUS_18790 37372 36119 gene locus_tag LOCUS_18800 gene fabF 37372 36119 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_18800 37621 37385 gene locus_tag LOCUS_18810 gene acpP 37621 37385 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_18810 37778 38368 gene locus_tag LOCUS_18820 gene purN 37778 38368 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 protein_id gnl|my_center|LOCUS_18820 38368 38997 gene locus_tag LOCUS_18830 38368 38997 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 protein_id gnl|my_center|LOCUS_18830 39758 39111 gene locus_tag LOCUS_18840 39758 39111 CDS product putative outer-membrane protein y4mB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55561 protein_id gnl|my_center|LOCUS_18840 39997 40920 gene locus_tag LOCUS_18850 39997 40920 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_18850 40965 42866 gene locus_tag LOCUS_18860 gene purF 40965 42866 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_18860 43653 43045 gene locus_tag LOCUS_18870 gene sodA 43653 43045 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_18870 43821 46964 gene locus_tag LOCUS_18880 43821 46964 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_18880 46991 48187 gene locus_tag LOCUS_18890 gene kbl 46991 48187 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_18890 48348 49676 gene locus_tag LOCUS_18900 48348 49676 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_18900 49744 52449 gene locus_tag LOCUS_18910 49744 52449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_18910 52452 53294 gene locus_tag LOCUS_18920 52452 53294 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_18920 53295 54746 gene locus_tag LOCUS_18930 53295 54746 CDS product K+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_18930 54794 54868 gene locus_tag LOCUS_t00220 54794 54868 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 56295 55072 gene locus_tag LOCUS_18940 56295 55072 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_18940 57068 56292 gene locus_tag LOCUS_18950 57068 56292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 protein_id gnl|my_center|LOCUS_18950 58457 57075 gene locus_tag LOCUS_18960 58457 57075 CDS product cytochrome c biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964529.1 protein_id gnl|my_center|LOCUS_18960 59571 58573 gene locus_tag LOCUS_18970 59571 58573 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_18970 60113 59682 gene locus_tag LOCUS_18980 gene dut 60113 59682 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_18980 61499 60117 gene locus_tag LOCUS_18990 61499 60117 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence24 92 17 gene locus_tag LOCUS_t00230 92 17 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 220 615 gene locus_tag LOCUS_19000 220 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_19000 673 1518 gene locus_tag LOCUS_19010 673 1518 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_19010 2075 1515 gene locus_tag LOCUS_19020 2075 1515 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_19020 2486 2214 gene locus_tag LOCUS_19030 gene hupB 2486 2214 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_19030 3595 2672 gene locus_tag LOCUS_19040 gene fmt 3595 2672 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H148 protein_id gnl|my_center|LOCUS_19040 5352 3616 gene locus_tag LOCUS_19050 gene recQ2 5352 3616 CDS product ATP-dependent DNA helicase RecQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 protein_id gnl|my_center|LOCUS_19050 6055 5516 gene locus_tag LOCUS_19060 6055 5516 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_19060 6135 6428 gene locus_tag LOCUS_19070 6135 6428 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_19070 6607 7167 gene locus_tag LOCUS_19080 6607 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 7196 8506 gene locus_tag LOCUS_19090 gene murA 7196 8506 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 protein_id gnl|my_center|LOCUS_19090 9203 8586 gene locus_tag LOCUS_19100 9203 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 10550 9270 gene locus_tag LOCUS_19110 gene mscS2 10550 9270 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_19110 10693 12939 gene locus_tag LOCUS_19120 10693 12939 CDS product TIGR01666 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706489.1 protein_id gnl|my_center|LOCUS_19120 12923 13834 gene locus_tag LOCUS_19130 12923 13834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 16516 14210 gene locus_tag LOCUS_19140 gene mrcA 16516 14210 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_19140 17300 16530 gene locus_tag LOCUS_19150 17300 16530 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031583.1 protein_id gnl|my_center|LOCUS_19150 17484 18209 gene locus_tag LOCUS_19160 17484 18209 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_19160 18219 19169 gene locus_tag LOCUS_19170 18219 19169 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529392.1 protein_id gnl|my_center|LOCUS_19170 20092 19226 gene locus_tag LOCUS_19180 gene rpoD 20092 19226 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_19180 20684 20256 gene locus_tag LOCUS_19190 20684 20256 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB93 protein_id gnl|my_center|LOCUS_19190 21093 21284 gene locus_tag LOCUS_19200 21093 21284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 22493 21492 gene locus_tag LOCUS_19210 22493 21492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 23935 22706 gene locus_tag LOCUS_19220 23935 22706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 24698 24078 gene locus_tag LOCUS_19230 24698 24078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 25705 24941 gene locus_tag LOCUS_19240 gene mapB 25705 24941 CDS product methionine aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34484 protein_id gnl|my_center|LOCUS_19240 26887 25982 gene locus_tag LOCUS_19250 26887 25982 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968526.1 protein_id gnl|my_center|LOCUS_19250 27491 26937 gene locus_tag LOCUS_19260 27491 26937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 28006 29685 gene locus_tag LOCUS_19270 28006 29685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 30920 29721 gene locus_tag LOCUS_19280 30920 29721 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_19280 31080 31541 gene locus_tag LOCUS_19290 31080 31541 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_19290 31632 33032 gene locus_tag LOCUS_19300 gene lpdA1 31632 33032 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_19300 33106 33648 gene locus_tag LOCUS_19310 33106 33648 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369022.1 protein_id gnl|my_center|LOCUS_19310 33797 35098 gene locus_tag LOCUS_19320 gene pabB 33797 35098 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_19320 35047 35367 gene locus_tag LOCUS_19330 35047 35367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 35349 35648 gene locus_tag LOCUS_19340 35349 35648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 35705 37021 gene locus_tag LOCUS_19350 gene tilS 35705 37021 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_19350 37011 39062 gene locus_tag LOCUS_19360 gene dsbD 37011 39062 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_19360 39457 39065 gene locus_tag LOCUS_19370 39457 39065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 40947 39460 gene locus_tag LOCUS_19380 40947 39460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481819.1 protein_id gnl|my_center|LOCUS_19380 41547 40960 gene locus_tag LOCUS_19390 41547 40960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 41727 43583 gene locus_tag LOCUS_19400 gene gaa 41727 43583 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_19400 43590 45428 gene locus_tag LOCUS_19410 43590 45428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_19410 46905 45535 gene locus_tag LOCUS_19420 46905 45535 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250835.1 protein_id gnl|my_center|LOCUS_19420 49799 46992 gene locus_tag LOCUS_19430 49799 46992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 50991 49924 gene locus_tag LOCUS_19440 50991 49924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 52580 51003 gene locus_tag LOCUS_19450 52580 51003 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403138.1 protein_id gnl|my_center|LOCUS_19450 55565 52635 gene locus_tag LOCUS_19460 55565 52635 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_19460 55797 56816 gene locus_tag LOCUS_19470 55797 56816 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_19470 57087 58571 gene locus_tag LOCUS_19480 gene malT 57087 58571 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072433.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence25 734 114 gene locus_tag LOCUS_19490 734 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 2173 995 gene locus_tag LOCUS_19500 2173 995 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_19500 6638 2307 gene locus_tag LOCUS_19510 6638 2307 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_19510 7222 6908 gene locus_tag LOCUS_19520 7222 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 7735 7265 gene locus_tag LOCUS_19530 7735 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 9084 7768 gene locus_tag LOCUS_19540 9084 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963601.1 protein_id gnl|my_center|LOCUS_19540 9304 9092 gene locus_tag LOCUS_19550 9304 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 10197 9301 gene locus_tag LOCUS_19560 gene apbE 10197 9301 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZN4 protein_id gnl|my_center|LOCUS_19560 10720 10283 gene locus_tag LOCUS_19570 10720 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 11683 10790 gene locus_tag LOCUS_19580 11683 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993022.1 protein_id gnl|my_center|LOCUS_19580 13643 11670 gene locus_tag LOCUS_19590 13643 11670 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_19590 15094 13712 gene locus_tag LOCUS_19600 15094 13712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 15759 15091 gene locus_tag LOCUS_19610 15759 15091 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_19610 16393 15797 gene locus_tag LOCUS_19620 16393 15797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 18149 16491 gene locus_tag LOCUS_19630 18149 16491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 20888 18168 gene locus_tag LOCUS_19640 20888 18168 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947353.1 protein_id gnl|my_center|LOCUS_19640 21518 20958 gene locus_tag LOCUS_19650 21518 20958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 22747 21521 gene locus_tag LOCUS_19660 22747 21521 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_19660 23325 22798 gene locus_tag LOCUS_19670 23325 22798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 24702 23329 gene locus_tag LOCUS_19680 24702 23329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 28458 24721 gene locus_tag LOCUS_19690 28458 24721 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_19690 29042 28701 gene locus_tag LOCUS_19700 29042 28701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 29202 29582 gene locus_tag LOCUS_19710 29202 29582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 29579 30841 gene locus_tag LOCUS_19720 29579 30841 CDS product SOS mutagenesis and repair protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202620.1 protein_id gnl|my_center|LOCUS_19720 33181 30959 gene locus_tag LOCUS_19730 33181 30959 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 protein_id gnl|my_center|LOCUS_19730 33344 33529 gene locus_tag LOCUS_19740 33344 33529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 34027 33671 gene locus_tag LOCUS_19750 gene rplS 34027 33671 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_19750 34815 34135 gene locus_tag LOCUS_19760 gene trmD 34815 34135 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_19760 35432 34827 gene locus_tag LOCUS_19770 35432 34827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 37051 35606 gene locus_tag LOCUS_19780 gene gapA2 37051 35606 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX7 protein_id gnl|my_center|LOCUS_19780 38602 37184 gene locus_tag LOCUS_19790 gene degP/Q 38602 37184 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_19790 38726 39505 gene locus_tag LOCUS_19800 gene dapF 38726 39505 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_19800 39499 40029 gene locus_tag LOCUS_19810 39499 40029 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_19810 40019 41062 gene locus_tag LOCUS_19820 gene pabC 40019 41062 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_19820 41733 41218 gene locus_tag LOCUS_19830 41733 41218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 43409 41796 gene locus_tag LOCUS_19840 43409 41796 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_19840 43525 44880 gene locus_tag LOCUS_19850 43525 44880 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_19850 45430 44984 gene locus_tag LOCUS_19860 45430 44984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 45731 45432 gene locus_tag LOCUS_19870 45731 45432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 46458 45742 gene locus_tag LOCUS_19880 46458 45742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_19880 46575 47264 gene locus_tag LOCUS_19890 46575 47264 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_19890 47267 48232 gene locus_tag LOCUS_19900 47267 48232 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_19900 48225 49679 gene locus_tag LOCUS_19910 gene cls 48225 49679 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CT1 protein_id gnl|my_center|LOCUS_19910 50393 49683 gene locus_tag LOCUS_19920 50393 49683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 51021 50506 gene locus_tag LOCUS_19930 51021 50506 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 protein_id gnl|my_center|LOCUS_19930 51436 54291 gene locus_tag LOCUS_19940 gene carB 51436 54291 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_19940 55103 54351 gene locus_tag LOCUS_19950 55103 54351 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_19950 55622 57931 gene locus_tag LOCUS_19960 55622 57931 CDS product 2,6-beta-D-fructofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203244.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence26 318 244 gene locus_tag LOCUS_t00240 318 244 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 779 1894 gene locus_tag LOCUS_19970 779 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1920 2432 gene locus_tag LOCUS_19980 1920 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2512 3210 gene locus_tag LOCUS_19990 2512 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 3252 3701 gene locus_tag LOCUS_20000 3252 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 3698 4297 gene locus_tag LOCUS_20010 3698 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_20010 4494 4751 gene locus_tag LOCUS_20020 4494 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 4753 5547 gene locus_tag LOCUS_20030 4753 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 5782 6249 gene locus_tag LOCUS_20040 5782 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991273.1 protein_id gnl|my_center|LOCUS_20040 7233 6304 gene locus_tag LOCUS_20050 7233 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_20050 7735 7418 gene locus_tag LOCUS_20060 7735 7418 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_20060 9728 7980 gene locus_tag LOCUS_20070 9728 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 11210 9798 gene locus_tag LOCUS_20080 11210 9798 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403033.1 protein_id gnl|my_center|LOCUS_20080 12130 11213 gene locus_tag LOCUS_20090 12130 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 12593 12240 gene locus_tag LOCUS_20100 12593 12240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 13346 12597 gene locus_tag LOCUS_20110 13346 12597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 16467 13360 gene locus_tag LOCUS_20120 16467 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 17759 16512 gene locus_tag LOCUS_20130 17759 16512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 22281 17893 gene locus_tag LOCUS_20140 gene dnaE 22281 17893 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_20140 23180 22524 gene locus_tag LOCUS_20150 23180 22524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 23324 23887 gene locus_tag LOCUS_20160 23324 23887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 23900 24427 gene locus_tag LOCUS_20170 gene rimM 23900 24427 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_20170 24532 25194 gene locus_tag LOCUS_20180 24532 25194 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI6 protein_id gnl|my_center|LOCUS_20180 25268 26443 gene locus_tag LOCUS_20190 gene gcdH 25268 26443 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_20190 26823 27605 gene locus_tag LOCUS_20200 26823 27605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_20200 27646 27969 gene locus_tag LOCUS_20210 27646 27969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962738.1 protein_id gnl|my_center|LOCUS_20210 28097 29140 gene locus_tag LOCUS_20220 28097 29140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 protein_id gnl|my_center|LOCUS_20220 29691 29359 gene locus_tag LOCUS_20230 29691 29359 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_20230 30758 29691 gene locus_tag LOCUS_20240 30758 29691 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_20240 31095 30844 gene locus_tag LOCUS_20250 31095 30844 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_20250 32233 31100 gene locus_tag LOCUS_20260 gene mrp 32233 31100 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 protein_id gnl|my_center|LOCUS_20260 32686 32354 gene locus_tag LOCUS_20270 gene ogt2 32686 32354 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_20270 33309 32683 gene locus_tag LOCUS_20280 33309 32683 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962540.1 protein_id gnl|my_center|LOCUS_20280 33991 33317 gene locus_tag LOCUS_20290 gene trmB 33991 33317 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_20290 34059 35111 gene locus_tag LOCUS_20300 34059 35111 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_20300 36137 35058 gene locus_tag LOCUS_20310 gene phoR 36137 35058 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_20310 36820 36137 gene locus_tag LOCUS_20320 gene phoP 36820 36137 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_20320 37006 39762 gene locus_tag LOCUS_20330 37006 39762 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_20330 39801 41021 gene locus_tag LOCUS_20340 39801 41021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764295.1 protein_id gnl|my_center|LOCUS_20340 41197 42933 gene locus_tag LOCUS_20350 41197 42933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 43017 43997 gene locus_tag LOCUS_20360 43017 43997 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_20360 45450 44155 gene locus_tag LOCUS_20370 gene tyrS 45450 44155 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 protein_id gnl|my_center|LOCUS_20370 45583 46599 gene locus_tag LOCUS_20380 45583 46599 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_20380 47148 46693 gene locus_tag LOCUS_20390 47148 46693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 48488 47148 gene locus_tag LOCUS_20400 gene pyrC1 48488 47148 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_20400 49274 48546 gene locus_tag LOCUS_20410 49274 48546 CDS product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962342.1 protein_id gnl|my_center|LOCUS_20410 50056 50802 gene locus_tag LOCUS_20420 50056 50802 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_20420 52478 50880 gene locus_tag LOCUS_20430 gene pckA 52478 50880 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816Q7 protein_id gnl|my_center|LOCUS_20430 52901 52551 gene locus_tag LOCUS_20440 52901 52551 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_20440 53013 54383 gene locus_tag LOCUS_20450 53013 54383 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_20450 55257 54523 gene locus_tag LOCUS_20460 55257 54523 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence27 926 1060 gene locus_tag LOCUS_20470 926 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 1047 3578 gene locus_tag LOCUS_20480 1047 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 3620 5629 gene locus_tag LOCUS_20490 gene bfmBA 3620 5629 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_20490 5753 6238 gene locus_tag LOCUS_20500 5753 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 6259 6954 gene locus_tag LOCUS_20510 gene yiaD 6259 6954 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963625.1 protein_id gnl|my_center|LOCUS_20510 7335 7030 gene locus_tag LOCUS_20520 7335 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 7519 9486 gene locus_tag LOCUS_20530 7519 9486 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727420.1 protein_id gnl|my_center|LOCUS_20530 9975 9571 gene locus_tag LOCUS_20540 9975 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 10124 11239 gene locus_tag LOCUS_20550 10124 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 12274 11438 gene locus_tag LOCUS_20560 12274 11438 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_20560 12473 13126 gene locus_tag LOCUS_20570 12473 13126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 14219 13311 gene locus_tag LOCUS_20580 14219 13311 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_20580 14378 14515 gene locus_tag LOCUS_20590 14378 14515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 14699 15211 gene locus_tag LOCUS_20600 14699 15211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765910.1 protein_id gnl|my_center|LOCUS_20600 17889 16177 gene locus_tag LOCUS_20610 17889 16177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 21862 18212 gene locus_tag LOCUS_20620 21862 18212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 24233 22290 gene locus_tag LOCUS_20630 24233 22290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 24341 25303 gene locus_tag LOCUS_20640 24341 25303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 25752 25417 gene locus_tag LOCUS_20650 25752 25417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087185.1 protein_id gnl|my_center|LOCUS_20650 25996 26610 gene locus_tag LOCUS_20660 25996 26610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 26651 27286 gene locus_tag LOCUS_20670 gene thiE 26651 27286 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWR9 protein_id gnl|my_center|LOCUS_20670 27834 27388 gene locus_tag LOCUS_20680 27834 27388 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 protein_id gnl|my_center|LOCUS_20680 28173 27949 gene locus_tag LOCUS_20690 28173 27949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 29721 28174 gene locus_tag LOCUS_20700 29721 28174 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626351.1 protein_id gnl|my_center|LOCUS_20700 31342 30029 gene locus_tag LOCUS_20710 gene dbpA 31342 30029 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_20710 32685 31348 gene locus_tag LOCUS_20720 32685 31348 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_20720 33210 33878 gene locus_tag LOCUS_20730 33210 33878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 34390 34214 gene locus_tag LOCUS_20740 34390 34214 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780999.1 protein_id gnl|my_center|LOCUS_20740 35119 34490 gene locus_tag LOCUS_20750 35119 34490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 35889 35188 gene locus_tag LOCUS_20760 35889 35188 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963636.1 protein_id gnl|my_center|LOCUS_20760 37280 35886 gene locus_tag LOCUS_20770 37280 35886 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963137.1 protein_id gnl|my_center|LOCUS_20770 37525 39915 gene locus_tag LOCUS_20780 37525 39915 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_20780 40605 39991 gene locus_tag LOCUS_20790 40605 39991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 41097 40693 gene locus_tag LOCUS_20800 41097 40693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 41362 41718 gene locus_tag LOCUS_20810 41362 41718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 41875 44124 gene locus_tag LOCUS_20820 41875 44124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227744.1 protein_id gnl|my_center|LOCUS_20820 44136 45593 gene locus_tag LOCUS_20830 44136 45593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 45590 47029 gene locus_tag LOCUS_20840 45590 47029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 46998 50090 gene locus_tag LOCUS_20850 46998 50090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 50087 50509 gene locus_tag LOCUS_20860 50087 50509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 50529 51392 gene locus_tag LOCUS_20870 50529 51392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 52450 51965 gene locus_tag LOCUS_20880 52450 51965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 52589 52389 gene locus_tag LOCUS_20890 52589 52389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 53071 52613 gene locus_tag LOCUS_20900 53071 52613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 53765 53073 gene locus_tag LOCUS_20910 53765 53073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 54449 54084 gene locus_tag LOCUS_20920 54449 54084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 54808 54455 gene locus_tag LOCUS_20930 54808 54455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 55231 54911 gene locus_tag LOCUS_20940 55231 54911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence28 513 1121 gene locus_tag LOCUS_20950 gene udk 513 1121 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 protein_id gnl|my_center|LOCUS_20950 1139 1474 gene locus_tag LOCUS_20960 1139 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1467 2840 gene locus_tag LOCUS_20970 gene mutA 1467 2840 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963259.1 protein_id gnl|my_center|LOCUS_20970 2881 3324 gene locus_tag LOCUS_20980 2881 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 3324 3551 gene locus_tag LOCUS_20990 3324 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_20990 3532 3768 gene locus_tag LOCUS_21000 3532 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390667.1 protein_id gnl|my_center|LOCUS_21000 3798 5930 gene locus_tag LOCUS_21010 gene mutB 3798 5930 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 protein_id gnl|my_center|LOCUS_21010 5984 6886 gene locus_tag LOCUS_21020 5984 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 9691 7004 gene locus_tag LOCUS_21030 9691 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 9909 10790 gene locus_tag LOCUS_21040 gene ykuF 9909 10790 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963270.1 protein_id gnl|my_center|LOCUS_21040 10891 11655 gene locus_tag LOCUS_21050 gene parA 10891 11655 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_21050 11661 12569 gene locus_tag LOCUS_21060 gene parB 11661 12569 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_21060 12559 13140 gene locus_tag LOCUS_21070 12559 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_21070 13140 13853 gene locus_tag LOCUS_21080 gene dapB 13140 13853 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_21080 13903 15474 gene locus_tag LOCUS_21090 gene lepB 13903 15474 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP1 protein_id gnl|my_center|LOCUS_21090 15484 16116 gene locus_tag LOCUS_21100 15484 16116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 protein_id gnl|my_center|LOCUS_21100 17090 16113 gene locus_tag LOCUS_21110 17090 16113 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_21110 18064 17150 gene locus_tag LOCUS_21120 18064 17150 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963287.1 protein_id gnl|my_center|LOCUS_21120 18812 18066 gene locus_tag LOCUS_21130 18812 18066 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_21130 20684 18813 gene locus_tag LOCUS_21140 gene mutL 20684 18813 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_21140 20974 20684 gene locus_tag LOCUS_21150 20974 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 21559 21053 gene locus_tag LOCUS_21160 gene ribH 21559 21053 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_21160 22350 21559 gene locus_tag LOCUS_21170 22350 21559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_21170 22501 23583 gene locus_tag LOCUS_21180 gene recF 22501 23583 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_21180 23662 24087 gene locus_tag LOCUS_21190 23662 24087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963536.1 protein_id gnl|my_center|LOCUS_21190 24074 24367 gene locus_tag LOCUS_21200 24074 24367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_21200 24368 24940 gene locus_tag LOCUS_21210 24368 24940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 25428 25009 gene locus_tag LOCUS_21220 gene ndk 25428 25009 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_21220 25544 26566 gene locus_tag LOCUS_21230 gene fjo19 25544 26566 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_21230 26556 27122 gene locus_tag LOCUS_21240 gene gldI 26556 27122 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T4 protein_id gnl|my_center|LOCUS_21240 27133 28188 gene locus_tag LOCUS_21250 gene ppiC 27133 28188 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_21250 28454 28269 gene locus_tag LOCUS_21260 28454 28269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 28512 29669 gene locus_tag LOCUS_21270 28512 29669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142879.1 protein_id gnl|my_center|LOCUS_21270 29735 30301 gene locus_tag LOCUS_21280 29735 30301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 31259 30447 gene locus_tag LOCUS_21290 31259 30447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_21290 31727 32185 gene locus_tag LOCUS_21300 gene smpB 31727 32185 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 protein_id gnl|my_center|LOCUS_21300 32363 34819 gene locus_tag LOCUS_21310 32363 34819 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_21310 35020 35763 gene locus_tag LOCUS_21320 35020 35763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 35863 37341 gene locus_tag LOCUS_21330 35863 37341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 38035 37493 gene locus_tag LOCUS_21340 38035 37493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790695.1 protein_id gnl|my_center|LOCUS_21340 38802 38122 gene locus_tag LOCUS_21350 gene pcm 38802 38122 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_21350 39640 38891 gene locus_tag LOCUS_21360 39640 38891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 39768 40733 gene locus_tag LOCUS_21370 39768 40733 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_21370 40758 41648 gene locus_tag LOCUS_21380 40758 41648 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_21380 41657 42898 gene locus_tag LOCUS_21390 41657 42898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964016.1 protein_id gnl|my_center|LOCUS_21390 42922 43584 gene locus_tag LOCUS_21400 42922 43584 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_21400 43597 44958 gene locus_tag LOCUS_21410 43597 44958 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_21410 45142 45990 gene locus_tag LOCUS_21420 45142 45990 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_21420 45980 46894 gene locus_tag LOCUS_21430 gene miaA 45980 46894 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V8 protein_id gnl|my_center|LOCUS_21430 47667 46945 gene locus_tag LOCUS_21440 gene rprY 47667 46945 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_21440 49197 47671 gene locus_tag LOCUS_21450 gene rprX 49197 47671 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_21450 49892 49302 gene locus_tag LOCUS_21460 gene coaE 49892 49302 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_21460 50752 49892 gene locus_tag LOCUS_21470 50752 49892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 51850 50852 gene locus_tag LOCUS_21480 51850 50852 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_21480 <52825 51925 gene locus_tag LOCUS_21490 <52825 51925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963841.1:esterase >Feature sequence29 762 199 gene locus_tag LOCUS_21500 762 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 3417 1225 gene locus_tag LOCUS_21510 gene recQ1 3417 1225 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 protein_id gnl|my_center|LOCUS_21510 3508 4470 gene locus_tag LOCUS_21520 gene kdsD 3508 4470 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_21520 4472 5326 gene locus_tag LOCUS_21530 gene tatC 4472 5326 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_21530 5327 5674 gene locus_tag LOCUS_21540 5327 5674 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_21540 5717 6457 gene locus_tag LOCUS_21550 gene lptB 5717 6457 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_21550 8501 6951 gene locus_tag LOCUS_21560 8501 6951 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073265.1 protein_id gnl|my_center|LOCUS_21560 8793 8506 gene locus_tag LOCUS_21570 8793 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 8882 9079 gene locus_tag LOCUS_21580 8882 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 9861 9130 gene locus_tag LOCUS_21590 9861 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 10860 10105 gene locus_tag LOCUS_21600 gene pssA 10860 10105 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_21600 11070 12056 gene locus_tag LOCUS_21610 11070 12056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_21610 12120 13697 gene locus_tag LOCUS_21620 gene lnt 12120 13697 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCC4 protein_id gnl|my_center|LOCUS_21620 15639 14248 gene locus_tag LOCUS_21630 15639 14248 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_21630 16711 15677 gene locus_tag LOCUS_21640 16711 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 17945 16650 gene locus_tag LOCUS_21650 17945 16650 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_21650 19496 18381 gene locus_tag LOCUS_21660 19496 18381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 21085 19982 gene locus_tag LOCUS_21670 21085 19982 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_21670 22654 21326 gene locus_tag LOCUS_21680 22654 21326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 23709 22651 gene locus_tag LOCUS_21690 23709 22651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 24935 23769 gene locus_tag LOCUS_21700 24935 23769 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142460.1 protein_id gnl|my_center|LOCUS_21700 25102 24938 gene locus_tag LOCUS_21710 25102 24938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 26027 25092 gene locus_tag LOCUS_21720 26027 25092 CDS product glycosyl transferase group 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_21720 26790 26011 gene locus_tag LOCUS_21730 26790 26011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 27677 26787 gene locus_tag LOCUS_21740 27677 26787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 29067 27679 gene locus_tag LOCUS_21750 29067 27679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 30818 29646 gene locus_tag LOCUS_21760 30818 29646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 31852 30818 gene locus_tag LOCUS_21770 31852 30818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 32986 31865 gene locus_tag LOCUS_21780 32986 31865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 34128 32995 gene locus_tag LOCUS_21790 34128 32995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 34943 34128 gene locus_tag LOCUS_21800 34943 34128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 35962 34946 gene locus_tag LOCUS_21810 35962 34946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 36883 35966 gene locus_tag LOCUS_21820 36883 35966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 37609 36887 gene locus_tag LOCUS_21830 37609 36887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 38790 37687 gene locus_tag LOCUS_21840 38790 37687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 39880 38963 gene locus_tag LOCUS_21850 39880 38963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 40553 39906 gene locus_tag LOCUS_21860 gene wecD 40553 39906 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700389.1 protein_id gnl|my_center|LOCUS_21860 41626 40547 gene locus_tag LOCUS_21870 gene wbtI 41626 40547 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014989.1 protein_id gnl|my_center|LOCUS_21870 42261 41626 gene locus_tag LOCUS_21880 42261 41626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 43519 42248 gene locus_tag LOCUS_21890 gene rfbB 43519 42248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_21890 44572 43715 gene locus_tag LOCUS_21900 44572 43715 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ30 protein_id gnl|my_center|LOCUS_21900 47120 44667 gene locus_tag LOCUS_21910 gene wzc 47120 44667 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_21910 47922 47125 gene locus_tag LOCUS_21920 gene wza 47922 47125 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 protein_id gnl|my_center|LOCUS_21920 48034 49902 gene locus_tag LOCUS_21930 48034 49902 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_21930 50119 50313 gene locus_tag LOCUS_21940 50119 50313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 50661 51035 gene locus_tag LOCUS_21950 50661 51035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21950 52071 51130 gene locus_tag LOCUS_21960 52071 51130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 <52697 52078 gene locus_tag LOCUS_21970 <52697 52078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963532.1:O-acyltransferase >Feature sequence30 <1 671 gene locus_tag LOCUS_21980 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288121.1:beta-phosphoglucomutase 676 2988 gene locus_tag LOCUS_21990 676 2988 CDS product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_21990 3235 5346 gene locus_tag LOCUS_22000 gene susB 3235 5346 CDS product glucan 1,4-alpha-glucosidase SusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G8JZS4 protein_id gnl|my_center|LOCUS_22000 5549 7414 gene locus_tag LOCUS_22010 5549 7414 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_22010 7536 8990 gene locus_tag LOCUS_22020 7536 8990 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 protein_id gnl|my_center|LOCUS_22020 9119 10105 gene locus_tag LOCUS_22030 gene pfkA 9119 10105 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_22030 10118 11125 gene locus_tag LOCUS_22040 gene gapA 10118 11125 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CIH3 protein_id gnl|my_center|LOCUS_22040 11132 11992 gene locus_tag LOCUS_22050 11132 11992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_22050 11982 13586 gene locus_tag LOCUS_22060 gene pgi 11982 13586 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ0 protein_id gnl|my_center|LOCUS_22060 14621 13848 gene locus_tag LOCUS_22070 14621 13848 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_22070 15125 14703 gene locus_tag LOCUS_22080 15125 14703 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_22080 16786 15290 gene locus_tag LOCUS_22090 gene mqo 16786 15290 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E6 protein_id gnl|my_center|LOCUS_22090 17265 16927 gene locus_tag LOCUS_22100 17265 16927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 18085 17393 gene locus_tag LOCUS_22110 18085 17393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 20972 18336 gene locus_tag LOCUS_22120 20972 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 21228 22343 gene locus_tag LOCUS_22130 21228 22343 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766053.1 protein_id gnl|my_center|LOCUS_22130 22438 23730 gene locus_tag LOCUS_22140 22438 23730 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122409.1 protein_id gnl|my_center|LOCUS_22140 26694 24391 gene locus_tag LOCUS_22150 26694 24391 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_22150 27999 26698 gene locus_tag LOCUS_22160 27999 26698 CDS product endo-1,4-beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_22160 29183 27996 gene locus_tag LOCUS_22170 29183 27996 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y26 protein_id gnl|my_center|LOCUS_22170 30354 29185 gene locus_tag LOCUS_22180 30354 29185 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y28 protein_id gnl|my_center|LOCUS_22180 31462 30419 gene locus_tag LOCUS_22190 31462 30419 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WXS5 protein_id gnl|my_center|LOCUS_22190 33388 31571 gene locus_tag LOCUS_22200 33388 31571 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_22200 34323 33397 gene locus_tag LOCUS_22210 34323 33397 CDS product mannan endo-1,4-beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_22210 34655 35533 gene locus_tag LOCUS_22220 34655 35533 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_22220 35533 36486 gene locus_tag LOCUS_22230 35533 36486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 36864 40055 gene locus_tag LOCUS_22240 36864 40055 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_22240 40069 41637 gene locus_tag LOCUS_22250 40069 41637 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_22250 41624 42703 gene locus_tag LOCUS_22260 41624 42703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 43809 42916 gene locus_tag LOCUS_22270 43809 42916 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_22270 43961 44254 gene locus_tag LOCUS_22280 43961 44254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 45063 44272 gene locus_tag LOCUS_22290 45063 44272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_22290 45179 45556 gene locus_tag LOCUS_22300 45179 45556 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876902.1 protein_id gnl|my_center|LOCUS_22300 46335 45790 gene locus_tag LOCUS_22310 46335 45790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 47130 46537 gene locus_tag LOCUS_22320 47130 46537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 48509 47424 gene locus_tag LOCUS_22330 48509 47424 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_22330 49441 48698 gene locus_tag LOCUS_22340 49441 48698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 50094 49600 gene locus_tag LOCUS_22350 50094 49600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 50943 50356 gene locus_tag LOCUS_22360 50943 50356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 52034 51276 gene locus_tag LOCUS_22370 52034 51276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence31 992 360 gene locus_tag LOCUS_22380 992 360 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 protein_id gnl|my_center|LOCUS_22380 1448 993 gene locus_tag LOCUS_22390 1448 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 4179 1699 gene locus_tag LOCUS_22400 4179 1699 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_22400 4693 4331 gene locus_tag LOCUS_22410 4693 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 6394 4799 gene locus_tag LOCUS_22420 gene lig2 6394 4799 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_22420 7414 6395 gene locus_tag LOCUS_22430 7414 6395 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_22430 8352 7636 gene locus_tag LOCUS_22440 gene recO 8352 7636 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 protein_id gnl|my_center|LOCUS_22440 10658 8352 gene locus_tag LOCUS_22450 10658 8352 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_22450 12138 10795 gene locus_tag LOCUS_22460 gene gdhA 12138 10795 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_22460 12349 13131 gene locus_tag LOCUS_22470 12349 13131 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962446.1 protein_id gnl|my_center|LOCUS_22470 14350 13208 gene locus_tag LOCUS_22480 14350 13208 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_22480 14574 15368 gene locus_tag LOCUS_22490 14574 15368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 15379 15732 gene locus_tag LOCUS_22500 15379 15732 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_22500 15725 16627 gene locus_tag LOCUS_22510 15725 16627 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_22510 17096 16605 gene locus_tag LOCUS_22520 17096 16605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 17201 19315 gene locus_tag LOCUS_22530 17201 19315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 19399 20265 gene locus_tag LOCUS_22540 19399 20265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_22540 20266 20838 gene locus_tag LOCUS_22550 gene gmk 20266 20838 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_22550 20842 21429 gene locus_tag LOCUS_22560 gene nadD 20842 21429 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_22560 21611 22615 gene locus_tag LOCUS_22570 gene gpsA 21611 22615 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_22570 22625 23518 gene locus_tag LOCUS_22580 gene fjo20 22625 23518 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963631.1 protein_id gnl|my_center|LOCUS_22580 23914 23519 gene locus_tag LOCUS_22590 23914 23519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_22590 24087 23917 gene locus_tag LOCUS_22600 24087 23917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 25111 24089 gene locus_tag LOCUS_22610 gene pheS 25111 24089 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_22610 25862 25167 gene locus_tag LOCUS_22620 25862 25167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 26219 25863 gene locus_tag LOCUS_22630 26219 25863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_22630 26266 26787 gene locus_tag LOCUS_22640 26266 26787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 27479 26835 gene locus_tag LOCUS_22650 gene cynT 27479 26835 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_22650 29062 27479 gene locus_tag LOCUS_22660 gene sulP 29062 27479 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_22660 29413 29159 gene locus_tag LOCUS_22670 29413 29159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 30251 29502 gene locus_tag LOCUS_22680 gene batE 30251 29502 CDS product BatE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_22680 32022 30253 gene locus_tag LOCUS_22690 gene batD 32022 30253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_22690 32882 32022 gene locus_tag LOCUS_22700 32882 32022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107513.1 protein_id gnl|my_center|LOCUS_22700 33921 32872 gene locus_tag LOCUS_22710 gene batB 33921 32872 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_22710 34938 33922 gene locus_tag LOCUS_22720 gene batA 34938 33922 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_22720 36572 34938 gene locus_tag LOCUS_22730 36572 34938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 protein_id gnl|my_center|LOCUS_22730 37440 36574 gene locus_tag LOCUS_22740 37440 36574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_22740 38495 37494 gene locus_tag LOCUS_22750 38495 37494 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_22750 39572 38766 gene locus_tag LOCUS_22760 39572 38766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 39746 40498 gene locus_tag LOCUS_22770 39746 40498 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_22770 40500 41633 gene locus_tag LOCUS_22780 40500 41633 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962316.1 protein_id gnl|my_center|LOCUS_22780 43653 41689 gene locus_tag LOCUS_22790 43653 41689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 43885 44358 gene locus_tag LOCUS_22800 43885 44358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 44497 45222 gene locus_tag LOCUS_22810 gene pphA 44497 45222 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 protein_id gnl|my_center|LOCUS_22810 45236 45787 gene locus_tag LOCUS_22820 45236 45787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 45847 46431 gene locus_tag LOCUS_22830 gene phnA 45847 46431 CDS product PhnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 protein_id gnl|my_center|LOCUS_22830 47267 46440 gene locus_tag LOCUS_22840 47267 46440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 49073 47589 gene locus_tag LOCUS_22850 49073 47589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 50059 49220 gene locus_tag LOCUS_22860 50059 49220 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_22860 <51405 50211 gene locus_tag LOCUS_22870 <51405 50211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964414.1:aldehyde dehydrogenase >Feature sequence32 692 2599 gene locus_tag LOCUS_22880 692 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2494 3030 gene locus_tag LOCUS_22890 2494 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 3042 3737 gene locus_tag LOCUS_22900 3042 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3852 4784 gene locus_tag LOCUS_22910 gene ppiC 3852 4784 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_22910 5514 4876 gene locus_tag LOCUS_22920 5514 4876 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207606.1 protein_id gnl|my_center|LOCUS_22920 6181 5618 gene locus_tag LOCUS_22930 6181 5618 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_22930 6269 6610 gene locus_tag LOCUS_22940 gene csaA 6269 6610 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_22940 7025 6657 gene locus_tag LOCUS_22950 7025 6657 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_22950 8862 7102 gene locus_tag LOCUS_22960 8862 7102 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_22960 8993 10084 gene locus_tag LOCUS_22970 gene vdh 8993 10084 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 protein_id gnl|my_center|LOCUS_22970 10179 11120 gene locus_tag LOCUS_22980 gene nusB 10179 11120 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_22980 11182 11652 gene locus_tag LOCUS_22990 11182 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 11675 11974 gene locus_tag LOCUS_23000 gene yajC 11675 11974 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_23000 12063 13091 gene locus_tag LOCUS_23010 12063 13091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 13094 14146 gene locus_tag LOCUS_23020 13094 14146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 14740 14150 gene locus_tag LOCUS_23030 14740 14150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291519.1 protein_id gnl|my_center|LOCUS_23030 14840 15331 gene locus_tag LOCUS_23040 14840 15331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 15344 15628 gene locus_tag LOCUS_23050 15344 15628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 16984 15743 gene locus_tag LOCUS_23060 gene pepT 16984 15743 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W1 protein_id gnl|my_center|LOCUS_23060 17095 18114 gene locus_tag LOCUS_23070 gene pyrD 17095 18114 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_23070 18228 18845 gene locus_tag LOCUS_23080 18228 18845 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 protein_id gnl|my_center|LOCUS_23080 18850 19602 gene locus_tag LOCUS_23090 18850 19602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 19701 20564 gene locus_tag LOCUS_23100 gene mvaB 19701 20564 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_23100 20670 22478 gene locus_tag LOCUS_23110 20670 22478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 22579 23781 gene locus_tag LOCUS_23120 22579 23781 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_23120 23781 24914 gene locus_tag LOCUS_23130 gene irpA 23781 24914 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_23130 24926 26290 gene locus_tag LOCUS_23140 24926 26290 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_23140 26313 28745 gene locus_tag LOCUS_23150 gene fecA 26313 28745 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_23150 28984 28742 gene locus_tag LOCUS_23160 28984 28742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 30403 29144 gene locus_tag LOCUS_23170 30403 29144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 31846 30431 gene locus_tag LOCUS_23180 31846 30431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 34000 31850 gene locus_tag LOCUS_23190 34000 31850 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963613.1 protein_id gnl|my_center|LOCUS_23190 34116 35015 gene locus_tag LOCUS_23200 34116 35015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963614.1 protein_id gnl|my_center|LOCUS_23200 35019 35540 gene locus_tag LOCUS_23210 35019 35540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 35542 36042 gene locus_tag LOCUS_23220 35542 36042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 37109 36273 gene locus_tag LOCUS_23230 gene uspA 37109 36273 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_23230 37278 38750 gene locus_tag LOCUS_23240 gene guaB 37278 38750 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_23240 38963 40282 gene locus_tag LOCUS_23250 gene fucP 38963 40282 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_23250 42476 40401 gene locus_tag LOCUS_23260 42476 40401 CDS product alpha-1,2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108864.1 protein_id gnl|my_center|LOCUS_23260 43743 42481 gene locus_tag LOCUS_23270 43743 42481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 45541 43850 gene locus_tag LOCUS_23280 45541 43850 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_23280 48701 45528 gene locus_tag LOCUS_23290 48701 45528 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107964.1 protein_id gnl|my_center|LOCUS_23290 49119 49745 gene locus_tag LOCUS_23300 49119 49745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 49838 50518 gene locus_tag LOCUS_23310 49838 50518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence33 551 2272 gene locus_tag LOCUS_23320 551 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 2277 3392 gene locus_tag LOCUS_23330 2277 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521284.1 protein_id gnl|my_center|LOCUS_23330 5184 3376 gene locus_tag LOCUS_23340 5184 3376 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_23340 5267 7471 gene locus_tag LOCUS_23350 5267 7471 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_23350 7594 7878 gene locus_tag LOCUS_23360 7594 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 7957 8328 gene locus_tag LOCUS_23370 7957 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 8382 9200 gene locus_tag LOCUS_23380 8382 9200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 10200 9238 gene locus_tag LOCUS_23390 10200 9238 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_23390 10269 11129 gene locus_tag LOCUS_23400 10269 11129 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362274.1 protein_id gnl|my_center|LOCUS_23400 11259 12095 gene locus_tag LOCUS_23410 11259 12095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404631.1 protein_id gnl|my_center|LOCUS_23410 12201 12737 gene locus_tag LOCUS_23420 12201 12737 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_23420 12737 13543 gene locus_tag LOCUS_23430 12737 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 13938 13783 gene locus_tag LOCUS_23440 13938 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 13910 15106 gene locus_tag LOCUS_23450 13910 15106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 15864 15103 gene locus_tag LOCUS_23460 15864 15103 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_23460 16183 15878 gene locus_tag LOCUS_23470 16183 15878 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963761.1 protein_id gnl|my_center|LOCUS_23470 17547 16204 gene locus_tag LOCUS_23480 17547 16204 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_23480 17824 20529 gene locus_tag LOCUS_23490 17824 20529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 21178 20591 gene locus_tag LOCUS_23500 21178 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 21635 21438 gene locus_tag LOCUS_23510 21635 21438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 22476 21625 gene locus_tag LOCUS_23520 22476 21625 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918272.1 protein_id gnl|my_center|LOCUS_23520 26321 22578 gene locus_tag LOCUS_23530 26321 22578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 26385 27587 gene locus_tag LOCUS_23540 26385 27587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 30280 27911 gene locus_tag LOCUS_23550 30280 27911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 30416 31537 gene locus_tag LOCUS_23560 30416 31537 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_23560 32301 31618 gene locus_tag LOCUS_23570 32301 31618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 33000 32353 gene locus_tag LOCUS_23580 33000 32353 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 protein_id gnl|my_center|LOCUS_23580 33130 33930 gene locus_tag LOCUS_23590 33130 33930 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_23590 34225 34884 gene locus_tag LOCUS_23600 34225 34884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 35000 36358 gene locus_tag LOCUS_23610 35000 36358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 38013 36625 gene locus_tag LOCUS_23620 38013 36625 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_23620 38109 38705 gene locus_tag LOCUS_23630 38109 38705 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_23630 39740 38745 gene locus_tag LOCUS_23640 39740 38745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_23640 40731 39715 gene locus_tag LOCUS_23650 40731 39715 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_23650 41626 40817 gene locus_tag LOCUS_23660 41626 40817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962739.1 protein_id gnl|my_center|LOCUS_23660 42161 41847 gene locus_tag LOCUS_23670 42161 41847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962738.1 protein_id gnl|my_center|LOCUS_23670 42779 42468 gene locus_tag LOCUS_23680 42779 42468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962738.1 protein_id gnl|my_center|LOCUS_23680 44274 45110 gene locus_tag LOCUS_23690 44274 45110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 45384 46313 gene locus_tag LOCUS_23700 45384 46313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 46514 48010 gene locus_tag LOCUS_23710 46514 48010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 48355 49053 gene locus_tag LOCUS_23720 48355 49053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 49543 49947 gene locus_tag LOCUS_23730 49543 49947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence34 621 2411 gene locus_tag LOCUS_23740 621 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2660 2950 gene locus_tag LOCUS_23750 2660 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_23750 3857 3351 gene locus_tag LOCUS_23760 3857 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 6074 3930 gene locus_tag LOCUS_23770 6074 3930 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_23770 6157 6414 gene locus_tag LOCUS_23780 6157 6414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 7055 6411 gene locus_tag LOCUS_23790 7055 6411 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022240.1 protein_id gnl|my_center|LOCUS_23790 7275 7724 gene locus_tag LOCUS_23800 7275 7724 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_23800 7770 8573 gene locus_tag LOCUS_23810 7770 8573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 8995 8528 gene locus_tag LOCUS_23820 8995 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 11522 9189 gene locus_tag LOCUS_23830 11522 9189 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_23830 11639 12298 gene locus_tag LOCUS_23840 gene sirR 11639 12298 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_23840 12295 14190 gene locus_tag LOCUS_23850 gene mntH 12295 14190 CDS product divalent metal cation transporter MntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVS3 protein_id gnl|my_center|LOCUS_23850 14205 15026 gene locus_tag LOCUS_23860 14205 15026 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_23860 15043 15468 gene locus_tag LOCUS_23870 15043 15468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 15882 15499 gene locus_tag LOCUS_23880 15882 15499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 18206 16107 gene locus_tag LOCUS_23890 gene feoB 18206 16107 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_23890 18463 18206 gene locus_tag LOCUS_23900 gene feoA 18463 18206 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_23900 19195 18518 gene locus_tag LOCUS_23910 19195 18518 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_23910 19363 20691 gene locus_tag LOCUS_23920 19363 20691 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A685 protein_id gnl|my_center|LOCUS_23920 20806 20880 gene locus_tag LOCUS_t00250 20806 20880 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 21855 20947 gene locus_tag LOCUS_23930 21855 20947 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815329.1 protein_id gnl|my_center|LOCUS_23930 23427 21946 gene locus_tag LOCUS_23940 23427 21946 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196166.1 protein_id gnl|my_center|LOCUS_23940 23560 25962 gene locus_tag LOCUS_23950 23560 25962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 26292 27161 gene locus_tag LOCUS_23960 26292 27161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 27167 28774 gene locus_tag LOCUS_23970 27167 28774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 28911 30275 gene locus_tag LOCUS_23980 gene dcuD 28911 30275 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262088.1 protein_id gnl|my_center|LOCUS_23980 30282 31427 gene locus_tag LOCUS_23990 gene iadA 30282 31427 CDS product isoaspartyl dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4P2 protein_id gnl|my_center|LOCUS_23990 31437 32747 gene locus_tag LOCUS_24000 31437 32747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 32816 34309 gene locus_tag LOCUS_24010 32816 34309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 34374 35549 gene locus_tag LOCUS_24020 34374 35549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 35779 37023 gene locus_tag LOCUS_24030 35779 37023 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24030 37023 37253 gene locus_tag LOCUS_24040 37023 37253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24040 39390 37288 gene locus_tag LOCUS_24050 gene yfjK 39390 37288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52126 protein_id gnl|my_center|LOCUS_24050 40313 39393 gene locus_tag LOCUS_24060 40313 39393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 42101 41688 gene locus_tag LOCUS_24070 42101 41688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 42413 42102 gene locus_tag LOCUS_24080 42413 42102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 44048 42660 gene locus_tag LOCUS_24090 44048 42660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 44544 44197 gene locus_tag LOCUS_24100 44544 44197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 45826 44702 gene locus_tag LOCUS_24110 45826 44702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_24110 46533 45928 gene locus_tag LOCUS_24120 gene pncA 46533 45928 CDS product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946032.1 protein_id gnl|my_center|LOCUS_24120 47940 46537 gene locus_tag LOCUS_24130 47940 46537 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CS0 protein_id gnl|my_center|LOCUS_24130 48439 48074 gene locus_tag LOCUS_24140 48439 48074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 49400 48879 gene locus_tag LOCUS_24150 49400 48879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 50113 49406 gene locus_tag LOCUS_24160 50113 49406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence35 1460 360 gene locus_tag LOCUS_24170 1460 360 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA0 protein_id gnl|my_center|LOCUS_24170 4866 1564 gene locus_tag LOCUS_24180 4866 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 5150 6559 gene locus_tag LOCUS_24190 gene glgA 5150 6559 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DPS3 protein_id gnl|my_center|LOCUS_24190 6561 7829 gene locus_tag LOCUS_24200 gene glgC 6561 7829 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_24200 7829 9739 gene locus_tag LOCUS_24210 gene glgB 7829 9739 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHB1 protein_id gnl|my_center|LOCUS_24210 9894 12308 gene locus_tag LOCUS_24220 9894 12308 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_24220 12538 13302 gene locus_tag LOCUS_24230 gene ftsX 12538 13302 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_24230 13331 13540 gene locus_tag LOCUS_24240 13331 13540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 13528 13851 gene locus_tag LOCUS_24250 13528 13851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 13869 14129 gene locus_tag LOCUS_24260 gene fjo13 13869 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_24260 14129 14917 gene locus_tag LOCUS_24270 gene uppP 14129 14917 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_24270 15328 14942 gene locus_tag LOCUS_24280 15328 14942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 15648 16367 gene locus_tag LOCUS_24290 gene truB 15648 16367 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_24290 17103 16381 gene locus_tag LOCUS_24300 gene yqjF 17103 16381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54543 protein_id gnl|my_center|LOCUS_24300 17735 17130 gene locus_tag LOCUS_24310 17735 17130 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_24310 17810 18385 gene locus_tag LOCUS_24320 gene tag 17810 18385 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_24320 18475 19194 gene locus_tag LOCUS_24330 18475 19194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 19824 19177 gene locus_tag LOCUS_24340 gene aat 19824 19177 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H233 protein_id gnl|my_center|LOCUS_24340 20418 20041 gene locus_tag LOCUS_24350 20418 20041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_24350 21298 20426 gene locus_tag LOCUS_24360 21298 20426 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_24360 21413 22564 gene locus_tag LOCUS_24370 gene porY 21413 22564 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_24370 22950 22561 gene locus_tag LOCUS_24380 22950 22561 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_24380 24095 22980 gene locus_tag LOCUS_24390 24095 22980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 26238 24103 gene locus_tag LOCUS_24400 26238 24103 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_24400 26466 27248 gene locus_tag LOCUS_24410 gene surE 26466 27248 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_24410 27241 27522 gene locus_tag LOCUS_24420 27241 27522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 27524 28645 gene locus_tag LOCUS_24430 gene lpxB 27524 28645 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_24430 28638 29153 gene locus_tag LOCUS_24440 gene nlpC 28638 29153 CDS product lipoprotein NlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262004.1 protein_id gnl|my_center|LOCUS_24440 29306 29677 gene locus_tag LOCUS_24450 29306 29677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 29794 31218 gene locus_tag LOCUS_24460 29794 31218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24460 31798 31259 gene locus_tag LOCUS_24470 31798 31259 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_24470 33935 31869 gene locus_tag LOCUS_24480 33935 31869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 35516 33951 gene locus_tag LOCUS_24490 35516 33951 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_24490 37700 35523 gene locus_tag LOCUS_24500 gene pepX1 37700 35523 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_24500 37903 39210 gene locus_tag LOCUS_24510 gene mvaA 37903 39210 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_24510 39200 40129 gene locus_tag LOCUS_24520 39200 40129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_24520 42260 40185 gene locus_tag LOCUS_24530 42260 40185 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_24530 43782 42493 gene locus_tag LOCUS_24540 43782 42493 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_24540 43973 43782 gene locus_tag LOCUS_24550 43973 43782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 44539 43973 gene locus_tag LOCUS_24560 44539 43973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 45944 44550 gene locus_tag LOCUS_24570 45944 44550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 47200 45962 gene locus_tag LOCUS_24580 47200 45962 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_24580 47931 47200 gene locus_tag LOCUS_24590 gene coaX 47931 47200 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B4 protein_id gnl|my_center|LOCUS_24590 48031 48105 gene locus_tag LOCUS_t00260 48031 48105 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence36 47 1582 gene locus_tag LOCUS_24600 47 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 1575 2726 gene locus_tag LOCUS_24610 1575 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2802 3275 gene locus_tag LOCUS_24620 2802 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 4161 3277 gene locus_tag LOCUS_24630 4161 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 5346 4222 gene locus_tag LOCUS_24640 5346 4222 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_24640 6245 5337 gene locus_tag LOCUS_24650 6245 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962386.1 protein_id gnl|my_center|LOCUS_24650 6326 6877 gene locus_tag LOCUS_24660 gene ruvC 6326 6877 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_24660 6950 7504 gene locus_tag LOCUS_24670 6950 7504 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_24670 7506 8054 gene locus_tag LOCUS_24680 gene bsaA 7506 8054 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH0 protein_id gnl|my_center|LOCUS_24680 10274 8250 gene locus_tag LOCUS_24690 gene dcp1 10274 8250 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_24690 10783 10373 gene locus_tag LOCUS_24700 10783 10373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 10932 11234 gene locus_tag LOCUS_24710 10932 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 11793 11305 gene locus_tag LOCUS_24720 gene purE 11793 11305 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_24720 13087 11927 gene locus_tag LOCUS_24730 gene purK 13087 11927 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_24730 13399 13923 gene locus_tag LOCUS_24740 gene hpt 13399 13923 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963490.1 protein_id gnl|my_center|LOCUS_24740 13930 14502 gene locus_tag LOCUS_24750 gene adk 13930 14502 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_24750 14558 15571 gene locus_tag LOCUS_24760 gene obg 14558 15571 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB7 protein_id gnl|my_center|LOCUS_24760 15697 16227 gene locus_tag LOCUS_24770 15697 16227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 22926 16459 gene locus_tag LOCUS_24780 22926 16459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 23069 23803 gene locus_tag LOCUS_24790 23069 23803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963484.1 protein_id gnl|my_center|LOCUS_24790 23933 25285 gene locus_tag LOCUS_24800 23933 25285 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_24800 25742 25293 gene locus_tag LOCUS_24810 25742 25293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 25795 26493 gene locus_tag LOCUS_24820 gene radC 25795 26493 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_24820 27144 26512 gene locus_tag LOCUS_24830 27144 26512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 27283 28596 gene locus_tag LOCUS_24840 27283 28596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 28574 29266 gene locus_tag LOCUS_24850 28574 29266 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_24850 29268 30080 gene locus_tag LOCUS_24860 29268 30080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 31358 30081 gene locus_tag LOCUS_24870 31358 30081 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_24870 31435 32205 gene locus_tag LOCUS_24880 31435 32205 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963478.1 protein_id gnl|my_center|LOCUS_24880 32933 32202 gene locus_tag LOCUS_24890 32933 32202 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_24890 33494 32997 gene locus_tag LOCUS_24900 33494 32997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759578.1 protein_id gnl|my_center|LOCUS_24900 34138 33506 gene locus_tag LOCUS_24910 34138 33506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 35666 34158 gene locus_tag LOCUS_24920 35666 34158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759577.1 protein_id gnl|my_center|LOCUS_24920 38822 35673 gene locus_tag LOCUS_24930 38822 35673 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759576.1 protein_id gnl|my_center|LOCUS_24930 40121 38934 gene locus_tag LOCUS_24940 40121 38934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 40805 41179 gene locus_tag LOCUS_24950 gene rpsL 40805 41179 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 protein_id gnl|my_center|LOCUS_24950 41204 41680 gene locus_tag LOCUS_24960 gene rpsG 41204 41680 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_24960 41686 43797 gene locus_tag LOCUS_24970 gene fusA 41686 43797 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 protein_id gnl|my_center|LOCUS_24970 43808 44113 gene locus_tag LOCUS_24980 gene rpsJ 43808 44113 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_24980 44249 44866 gene locus_tag LOCUS_24990 gene rplC 44249 44866 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ99 protein_id gnl|my_center|LOCUS_24990 44866 45495 gene locus_tag LOCUS_25000 gene rplD 44866 45495 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_25000 45501 45791 gene locus_tag LOCUS_25010 gene rplW 45501 45791 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ97 protein_id gnl|my_center|LOCUS_25010 45801 46628 gene locus_tag LOCUS_25020 gene rplB 45801 46628 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ96 protein_id gnl|my_center|LOCUS_25020 >Feature sequence37 23 98 gene locus_tag LOCUS_t00270 23 98 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 503 1786 gene locus_tag LOCUS_25030 gene eno1 503 1786 CDS product enolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB35 protein_id gnl|my_center|LOCUS_25030 1823 2293 gene locus_tag LOCUS_25040 1823 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_25040 3478 2765 gene locus_tag LOCUS_25050 3478 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 3791 4021 gene locus_tag LOCUS_25060 3791 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 4065 5714 gene locus_tag LOCUS_25070 4065 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 5719 6378 gene locus_tag LOCUS_25080 5719 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 7048 6560 gene locus_tag LOCUS_25090 7048 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 8069 7215 gene locus_tag LOCUS_25100 8069 7215 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_25100 9785 8241 gene locus_tag LOCUS_25110 gene pccB 9785 8241 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_25110 11320 9875 gene locus_tag LOCUS_25120 gene accC 11320 9875 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_25120 11926 11441 gene locus_tag LOCUS_25130 11926 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 12011 12349 gene locus_tag LOCUS_25140 12011 12349 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168851.1 protein_id gnl|my_center|LOCUS_25140 12759 12346 gene locus_tag LOCUS_25150 12759 12346 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_25150 13408 12851 gene locus_tag LOCUS_25160 13408 12851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_25160 13574 14002 gene locus_tag LOCUS_25170 13574 14002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 15425 14091 gene locus_tag LOCUS_25180 15425 14091 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259726.1 protein_id gnl|my_center|LOCUS_25180 16337 15444 gene locus_tag LOCUS_25190 16337 15444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 17043 16432 gene locus_tag LOCUS_25200 17043 16432 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283365.1 protein_id gnl|my_center|LOCUS_25200 17851 17045 gene locus_tag LOCUS_25210 17851 17045 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_25210 18551 17916 gene locus_tag LOCUS_25220 18551 17916 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_25220 19015 18563 gene locus_tag LOCUS_25230 19015 18563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 19159 21342 gene locus_tag LOCUS_25240 19159 21342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 21930 21676 gene locus_tag LOCUS_25250 gene rpmE 21930 21676 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_25250 22092 22628 gene locus_tag LOCUS_25260 22092 22628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 22637 23593 gene locus_tag LOCUS_25270 22637 23593 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_25270 23648 25363 gene locus_tag LOCUS_25280 23648 25363 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 protein_id gnl|my_center|LOCUS_25280 25377 27203 gene locus_tag LOCUS_25290 gene msbA 25377 27203 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_25290 27221 27772 gene locus_tag LOCUS_25300 27221 27772 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_25300 27787 28287 gene locus_tag LOCUS_25310 27787 28287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 28291 28713 gene locus_tag LOCUS_25320 28291 28713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_25320 29780 28716 gene locus_tag LOCUS_25330 29780 28716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_25330 29920 31134 gene locus_tag LOCUS_25340 gene rsmB 29920 31134 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_25340 31141 33024 gene locus_tag LOCUS_25350 31141 33024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 33142 36828 gene locus_tag LOCUS_25360 gene purL 33142 36828 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXH5 protein_id gnl|my_center|LOCUS_25360 37039 38430 gene locus_tag LOCUS_25370 37039 38430 CDS product chitin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726975.1 protein_id gnl|my_center|LOCUS_25370 38739 39350 gene locus_tag LOCUS_25380 38739 39350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 39603 41390 gene locus_tag LOCUS_25390 gene fadD 39603 41390 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_25390 41611 42168 gene locus_tag LOCUS_25400 gene sigW 41611 42168 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_25400 42158 42709 gene locus_tag LOCUS_25410 42158 42709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 42711 43781 gene locus_tag LOCUS_25420 42711 43781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 44111 45550 gene locus_tag LOCUS_25430 44111 45550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 45734 46186 gene locus_tag LOCUS_25440 45734 46186 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence38 696 3689 gene locus_tag LOCUS_25450 696 3689 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_25450 3700 5088 gene locus_tag LOCUS_25460 3700 5088 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_25460 5098 7947 gene locus_tag LOCUS_25470 5098 7947 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_25470 8293 8021 gene locus_tag LOCUS_25480 8293 8021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 11832 9163 gene locus_tag LOCUS_25490 11832 9163 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_25490 12641 11844 gene locus_tag LOCUS_25500 12641 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 12957 12739 gene locus_tag LOCUS_25510 12957 12739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 13160 13498 gene locus_tag LOCUS_25520 13160 13498 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788181.1 protein_id gnl|my_center|LOCUS_25520 13495 14091 gene locus_tag LOCUS_25530 13495 14091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 14198 16747 gene locus_tag LOCUS_25540 14198 16747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962501.1 protein_id gnl|my_center|LOCUS_25540 16814 17482 gene locus_tag LOCUS_25550 16814 17482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 20306 17652 gene locus_tag LOCUS_25560 20306 17652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962501.1 protein_id gnl|my_center|LOCUS_25560 21046 20306 gene locus_tag LOCUS_25570 21046 20306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 21361 21182 gene locus_tag LOCUS_25580 21361 21182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 22200 21535 gene locus_tag LOCUS_25590 22200 21535 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966699.1 protein_id gnl|my_center|LOCUS_25590 24195 22216 gene locus_tag LOCUS_25600 24195 22216 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 protein_id gnl|my_center|LOCUS_25600 24460 24290 gene locus_tag LOCUS_25610 24460 24290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 25646 24717 gene locus_tag LOCUS_25620 25646 24717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 25742 26047 gene locus_tag LOCUS_25630 25742 26047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 26063 27361 gene locus_tag LOCUS_25640 26063 27361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 27445 28281 gene locus_tag LOCUS_25650 27445 28281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963653.1 protein_id gnl|my_center|LOCUS_25650 28577 28855 gene locus_tag LOCUS_25660 28577 28855 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 protein_id gnl|my_center|LOCUS_25660 28855 29394 gene locus_tag LOCUS_25670 28855 29394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 29391 30059 gene locus_tag LOCUS_25680 29391 30059 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963650.1 protein_id gnl|my_center|LOCUS_25680 30121 30849 gene locus_tag LOCUS_25690 30121 30849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 30872 32239 gene locus_tag LOCUS_25700 30872 32239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 32258 34576 gene locus_tag LOCUS_25710 32258 34576 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816115.1 protein_id gnl|my_center|LOCUS_25710 34563 35690 gene locus_tag LOCUS_25720 34563 35690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 35677 36480 gene locus_tag LOCUS_25730 35677 36480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 36487 38406 gene locus_tag LOCUS_25740 36487 38406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 39122 39409 gene locus_tag LOCUS_25750 39122 39409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 39677 42085 gene locus_tag LOCUS_25760 39677 42085 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005842190.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence39 537 734 gene locus_tag LOCUS_25770 gene rpmI 537 734 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_25770 832 1176 gene locus_tag LOCUS_25780 gene rplT 832 1176 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_25780 1253 2053 gene locus_tag LOCUS_25790 gene ybiV 1253 2053 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263941.1 protein_id gnl|my_center|LOCUS_25790 2472 2050 gene locus_tag LOCUS_25800 2472 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_25800 2650 3474 gene locus_tag LOCUS_25810 2650 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 5015 3471 gene locus_tag LOCUS_25820 5015 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 6236 5016 gene locus_tag LOCUS_25830 6236 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 7292 6303 gene locus_tag LOCUS_25840 7292 6303 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_25840 8487 7303 gene locus_tag LOCUS_25850 8487 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_25850 10226 8676 gene locus_tag LOCUS_25860 gene dnaB 10226 8676 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_25860 11346 10393 gene locus_tag LOCUS_25870 gene accA 11346 10393 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_25870 12514 11438 gene locus_tag LOCUS_25880 12514 11438 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_25880 13646 12516 gene locus_tag LOCUS_25890 gene tgt 13646 12516 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_25890 13842 14690 gene locus_tag LOCUS_25900 gene tktA 13842 14690 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_25900 14727 15680 gene locus_tag LOCUS_25910 gene tktC 14727 15680 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_25910 15906 16718 gene locus_tag LOCUS_25920 15906 16718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 17067 17672 gene locus_tag LOCUS_25930 17067 17672 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H133 protein_id gnl|my_center|LOCUS_25930 18321 17650 gene locus_tag LOCUS_25940 18321 17650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_25940 19538 18318 gene locus_tag LOCUS_25950 19538 18318 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946127.1 protein_id gnl|my_center|LOCUS_25950 20991 19540 gene locus_tag LOCUS_25960 20991 19540 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_25960 23179 21218 gene locus_tag LOCUS_25970 23179 21218 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962880.1 protein_id gnl|my_center|LOCUS_25970 24164 23241 gene locus_tag LOCUS_25980 24164 23241 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_25980 24359 24994 gene locus_tag LOCUS_25990 24359 24994 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_25990 26182 25034 gene locus_tag LOCUS_26000 gene ribBA 26182 25034 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_26000 28236 26215 gene locus_tag LOCUS_26010 28236 26215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 28981 28310 gene locus_tag LOCUS_26020 gene lolA 28981 28310 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_26020 31436 28974 gene locus_tag LOCUS_26030 gene ftsK 31436 28974 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_26030 31901 31539 gene locus_tag LOCUS_26040 31901 31539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 32401 31901 gene locus_tag LOCUS_26050 gene tpx 32401 31901 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZY8 protein_id gnl|my_center|LOCUS_26050 32806 32558 gene locus_tag LOCUS_26060 32806 32558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_26060 33101 32787 gene locus_tag LOCUS_26070 33101 32787 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_26070 33827 33189 gene locus_tag LOCUS_26080 33827 33189 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963839.1 protein_id gnl|my_center|LOCUS_26080 34097 35335 gene locus_tag LOCUS_26090 gene hutI 34097 35335 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_26090 35357 36334 gene locus_tag LOCUS_26100 35357 36334 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963810.1 protein_id gnl|my_center|LOCUS_26100 36335 36796 gene locus_tag LOCUS_26110 36335 36796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 36808 37602 gene locus_tag LOCUS_26120 36808 37602 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_26120 37819 38190 gene locus_tag LOCUS_26130 37819 38190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 39050 38364 gene locus_tag LOCUS_26140 39050 38364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 39240 39818 gene locus_tag LOCUS_26150 gene guaA 39240 39818 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206978.1 protein_id gnl|my_center|LOCUS_26150 39881 40252 gene locus_tag LOCUS_26160 39881 40252 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797821.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence40 880 23 gene locus_tag LOCUS_26170 880 23 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108181.1 protein_id gnl|my_center|LOCUS_26170 1310 1011 gene locus_tag LOCUS_26180 1310 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 1453 2052 gene locus_tag LOCUS_26190 1453 2052 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367810.1 protein_id gnl|my_center|LOCUS_26190 2360 3151 gene locus_tag LOCUS_26200 2360 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26200 4524 3577 gene locus_tag LOCUS_26210 gene purC 4524 3577 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_26210 5493 4540 gene locus_tag LOCUS_26220 gene phoH 5493 4540 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_26220 5593 6438 gene locus_tag LOCUS_26230 gene fjo14 5593 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_26230 6449 6724 gene locus_tag LOCUS_26240 gene fjo15 6449 6724 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_26240 6734 7465 gene locus_tag LOCUS_26250 gene gldF 6734 7465 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_26250 7462 9147 gene locus_tag LOCUS_26260 gene gldG 7462 9147 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_26260 12454 9551 gene locus_tag LOCUS_26270 12454 9551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 12589 13707 gene locus_tag LOCUS_26280 gene dnaN 12589 13707 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_26280 15738 13795 gene locus_tag LOCUS_26290 15738 13795 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_26290 15815 16282 gene locus_tag LOCUS_26300 15815 16282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 16491 16802 gene locus_tag LOCUS_26310 16491 16802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 16906 17400 gene locus_tag LOCUS_26320 16906 17400 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_26320 17417 18325 gene locus_tag LOCUS_26330 gene mscS 17417 18325 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389820.1 protein_id gnl|my_center|LOCUS_26330 18419 19414 gene locus_tag LOCUS_26340 18419 19414 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_26340 19682 19476 gene locus_tag LOCUS_26350 19682 19476 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_26350 20160 19672 gene locus_tag LOCUS_26360 20160 19672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 20284 20763 gene locus_tag LOCUS_26370 gene guaD 20284 20763 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34598 protein_id gnl|my_center|LOCUS_26370 21569 20760 gene locus_tag LOCUS_26380 21569 20760 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970669.1 protein_id gnl|my_center|LOCUS_26380 21723 22313 gene locus_tag LOCUS_26390 21723 22313 CDS product protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_26390 23519 22419 gene locus_tag LOCUS_26400 23519 22419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963574.1 protein_id gnl|my_center|LOCUS_26400 25181 23529 gene locus_tag LOCUS_26410 25181 23529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108830.1 protein_id gnl|my_center|LOCUS_26410 26974 25184 gene locus_tag LOCUS_26420 26974 25184 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963575.1 protein_id gnl|my_center|LOCUS_26420 27335 28477 gene locus_tag LOCUS_26430 27335 28477 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_26430 28698 29672 gene locus_tag LOCUS_26440 28698 29672 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_26440 29729 30511 gene locus_tag LOCUS_26450 29729 30511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 protein_id gnl|my_center|LOCUS_26450 30683 32008 gene locus_tag LOCUS_26460 gene rmuC 30683 32008 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_26460 32005 32370 gene locus_tag LOCUS_26470 32005 32370 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_26470 32681 33232 gene locus_tag LOCUS_26480 32681 33232 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_26480 33304 33693 gene locus_tag LOCUS_26490 33304 33693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 34225 33824 gene locus_tag LOCUS_26500 34225 33824 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_26500 35250 34231 gene locus_tag LOCUS_26510 35250 34231 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_26510 36553 35252 gene locus_tag LOCUS_26520 36553 35252 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730651.1 protein_id gnl|my_center|LOCUS_26520 36757 37371 gene locus_tag LOCUS_26530 36757 37371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 37368 38075 gene locus_tag LOCUS_26540 37368 38075 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836846.1 protein_id gnl|my_center|LOCUS_26540 38201 38758 gene locus_tag LOCUS_26550 38201 38758 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095888.1 protein_id gnl|my_center|LOCUS_26550 39118 38759 gene locus_tag LOCUS_26560 39118 38759 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476381.1 protein_id gnl|my_center|LOCUS_26560 39217 39912 gene locus_tag LOCUS_26570 39217 39912 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973894.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence41 256 1110 gene locus_tag LOCUS_26580 256 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 1272 2126 gene locus_tag LOCUS_26590 1272 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 2336 2175 gene locus_tag LOCUS_26600 2336 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 2740 3360 gene locus_tag LOCUS_26610 2740 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 3581 3976 gene locus_tag LOCUS_26620 3581 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 3960 4406 gene locus_tag LOCUS_26630 3960 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 4560 4910 gene locus_tag LOCUS_26640 4560 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 5256 5867 gene locus_tag LOCUS_26650 5256 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 6008 7006 gene locus_tag LOCUS_26660 6008 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 7477 8979 gene locus_tag LOCUS_26670 7477 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 9313 9116 gene locus_tag LOCUS_26680 9313 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26680 10088 9438 gene locus_tag LOCUS_26690 10088 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 10459 10815 gene locus_tag LOCUS_26700 10459 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 11157 10840 gene locus_tag LOCUS_26710 11157 10840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 11293 12294 gene locus_tag LOCUS_26720 11293 12294 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436791.1 protein_id gnl|my_center|LOCUS_26720 12458 12625 gene locus_tag LOCUS_26730 12458 12625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 12810 13157 gene locus_tag LOCUS_26740 12810 13157 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021110.1 protein_id gnl|my_center|LOCUS_26740 13300 13503 gene locus_tag LOCUS_26750 13300 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 13525 13797 gene locus_tag LOCUS_26760 13525 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 14040 14645 gene locus_tag LOCUS_26770 14040 14645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 14703 15704 gene locus_tag LOCUS_26780 14703 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122465.1 protein_id gnl|my_center|LOCUS_26780 19398 15820 gene locus_tag LOCUS_26790 19398 15820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 19788 22619 gene locus_tag LOCUS_26800 gene uvrA2 19788 22619 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX6 protein_id gnl|my_center|LOCUS_26800 22641 23336 gene locus_tag LOCUS_26810 22641 23336 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_26810 23493 26222 gene locus_tag LOCUS_26820 23493 26222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962879.1 protein_id gnl|my_center|LOCUS_26820 26405 28816 gene locus_tag LOCUS_26830 26405 28816 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_26830 30537 28990 gene locus_tag LOCUS_26840 30537 28990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 31060 30530 gene locus_tag LOCUS_26850 31060 30530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 31887 31048 gene locus_tag LOCUS_26860 gene menB 31887 31048 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_26860 31970 32329 gene locus_tag LOCUS_26870 31970 32329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 32326 32745 gene locus_tag LOCUS_26880 32326 32745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 32781 33347 gene locus_tag LOCUS_26890 32781 33347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 34179 33340 gene locus_tag LOCUS_26900 34179 33340 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_26900 34653 34315 gene locus_tag LOCUS_26910 34653 34315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963785.1 protein_id gnl|my_center|LOCUS_26910 36567 34825 gene locus_tag LOCUS_26920 gene menD 36567 34825 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_26920 36736 36963 gene locus_tag LOCUS_26930 36736 36963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 36975 37286 gene locus_tag LOCUS_26940 36975 37286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 38517 37390 gene locus_tag LOCUS_26950 gene menF 38517 37390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 protein_id gnl|my_center|LOCUS_26950 39112 38687 gene locus_tag LOCUS_26960 39112 38687 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_26960 39350 39997 gene locus_tag LOCUS_26970 39350 39997 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence42 <1 3456 gene locus_tag LOCUS_26980 <1 3456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 3638 6238 gene locus_tag LOCUS_26990 3638 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 6316 7677 gene locus_tag LOCUS_27000 gene gcdH 6316 7677 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228249.1 protein_id gnl|my_center|LOCUS_27000 7702 8628 gene locus_tag LOCUS_27010 7702 8628 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103054.1 protein_id gnl|my_center|LOCUS_27010 8642 10408 gene locus_tag LOCUS_27020 8642 10408 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_27020 10405 10731 gene locus_tag LOCUS_27030 10405 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 10735 11061 gene locus_tag LOCUS_27040 10735 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 11071 11853 gene locus_tag LOCUS_27050 11071 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 11863 12477 gene locus_tag LOCUS_27060 11863 12477 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_27060 12492 13157 gene locus_tag LOCUS_27070 12492 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 14197 13160 gene locus_tag LOCUS_27080 14197 13160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119948.1 protein_id gnl|my_center|LOCUS_27080 16505 14253 gene locus_tag LOCUS_27090 16505 14253 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_27090 17123 16614 gene locus_tag LOCUS_27100 gene ppa 17123 16614 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH9 protein_id gnl|my_center|LOCUS_27100 19713 17203 gene locus_tag LOCUS_27110 19713 17203 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_27110 20749 19760 gene locus_tag LOCUS_27120 gene pdhB 20749 19760 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_27120 20923 21669 gene locus_tag LOCUS_27130 gene etfB 20923 21669 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_27130 21718 22686 gene locus_tag LOCUS_27140 gene etfA 21718 22686 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_27140 22789 23418 gene locus_tag LOCUS_27150 22789 23418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_27150 23428 25116 gene locus_tag LOCUS_27160 23428 25116 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_27160 25631 25113 gene locus_tag LOCUS_27170 25631 25113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 26995 25709 gene locus_tag LOCUS_27180 26995 25709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 27571 27023 gene locus_tag LOCUS_27190 27571 27023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 27864 28688 gene locus_tag LOCUS_27200 gene thyA 27864 28688 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 protein_id gnl|my_center|LOCUS_27200 28777 29184 gene locus_tag LOCUS_27210 28777 29184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 29353 30519 gene locus_tag LOCUS_27220 29353 30519 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119788.1 protein_id gnl|my_center|LOCUS_27220 30527 31495 gene locus_tag LOCUS_27230 30527 31495 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141637.1 protein_id gnl|my_center|LOCUS_27230 32798 31713 gene locus_tag LOCUS_27240 32798 31713 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085879.1 protein_id gnl|my_center|LOCUS_27240 32859 33275 gene locus_tag LOCUS_27250 32859 33275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 33278 33763 gene locus_tag LOCUS_27260 gene dfrA 33278 33763 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_27260 33928 34620 gene locus_tag LOCUS_27270 33928 34620 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287963.1 protein_id gnl|my_center|LOCUS_27270 34715 35215 gene locus_tag LOCUS_27280 34715 35215 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887789.1 protein_id gnl|my_center|LOCUS_27280 35312 36193 gene locus_tag LOCUS_27290 gene fabD 35312 36193 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_27290 36193 38559 gene locus_tag LOCUS_27300 36193 38559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence43 268 1020 gene locus_tag LOCUS_27310 268 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1240 1704 gene locus_tag LOCUS_27320 1240 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 1701 2060 gene locus_tag LOCUS_27330 1701 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 2102 2797 gene locus_tag LOCUS_27340 2102 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 2959 3600 gene locus_tag LOCUS_27350 2959 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 3794 4252 gene locus_tag LOCUS_27360 3794 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 4245 4628 gene locus_tag LOCUS_27370 4245 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 4843 5070 gene locus_tag LOCUS_27380 4843 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 5389 5568 gene locus_tag LOCUS_27390 5389 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 5580 7556 gene locus_tag LOCUS_27400 5580 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 7585 7884 gene locus_tag LOCUS_27410 7585 7884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27410 7884 8087 gene locus_tag LOCUS_27420 7884 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 8402 9073 gene locus_tag LOCUS_27430 8402 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 9596 9985 gene locus_tag LOCUS_27440 9596 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 9936 10241 gene locus_tag LOCUS_27450 9936 10241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 10430 11242 gene locus_tag LOCUS_27460 10430 11242 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477173.1 protein_id gnl|my_center|LOCUS_27460 11294 12379 gene locus_tag LOCUS_27470 11294 12379 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259711.1 protein_id gnl|my_center|LOCUS_27470 12556 13344 gene locus_tag LOCUS_27480 12556 13344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 13454 13930 gene locus_tag LOCUS_27490 13454 13930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 14071 14448 gene locus_tag LOCUS_27500 14071 14448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 14704 14489 gene locus_tag LOCUS_27510 14704 14489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 14793 15584 gene locus_tag LOCUS_27520 14793 15584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963508.1 protein_id gnl|my_center|LOCUS_27520 15737 16189 gene locus_tag LOCUS_27530 15737 16189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 16818 16432 gene locus_tag LOCUS_27540 16818 16432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_27540 17081 17854 gene locus_tag LOCUS_27550 17081 17854 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_27550 18135 18365 gene locus_tag LOCUS_27560 18135 18365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 18368 19003 gene locus_tag LOCUS_27570 18368 19003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 18996 19874 gene locus_tag LOCUS_27580 18996 19874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309798.1 protein_id gnl|my_center|LOCUS_27580 19877 20254 gene locus_tag LOCUS_27590 19877 20254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_27590 20308 22083 gene locus_tag LOCUS_27600 20308 22083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_27600 22327 23322 gene locus_tag LOCUS_27610 22327 23322 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_27610 23572 24579 gene locus_tag LOCUS_27620 23572 24579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 24855 25991 gene locus_tag LOCUS_27630 24855 25991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 27523 26066 gene locus_tag LOCUS_27640 27523 26066 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119875.1 protein_id gnl|my_center|LOCUS_27640 30338 27537 gene locus_tag LOCUS_27650 30338 27537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 30829 31797 gene locus_tag LOCUS_27660 30829 31797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090572.1 protein_id gnl|my_center|LOCUS_27660 33260 31872 gene locus_tag LOCUS_27670 33260 31872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_27670 33408 33490 gene locus_tag LOCUS_t00280 33408 33490 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33600 35066 gene locus_tag LOCUS_27680 33600 35066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 35917 35204 gene locus_tag LOCUS_27690 35917 35204 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence44 3724 1481 gene locus_tag LOCUS_27700 3724 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 4340 4855 gene locus_tag LOCUS_27710 4340 4855 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763535.1 protein_id gnl|my_center|LOCUS_27710 4911 5813 gene locus_tag LOCUS_27720 4911 5813 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_27720 5806 8112 gene locus_tag LOCUS_27730 5806 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 9891 8116 gene locus_tag LOCUS_27740 gene argS 9891 8116 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 protein_id gnl|my_center|LOCUS_27740 10121 10519 gene locus_tag LOCUS_27750 10121 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 10527 10949 gene locus_tag LOCUS_27760 10527 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 11101 11733 gene locus_tag LOCUS_27770 11101 11733 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ63 protein_id gnl|my_center|LOCUS_27770 12624 11743 gene locus_tag LOCUS_27780 12624 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 13555 12722 gene locus_tag LOCUS_27790 13555 12722 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_27790 13813 14076 gene locus_tag LOCUS_27800 13813 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 14154 14423 gene locus_tag LOCUS_27810 14154 14423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27810 15089 14424 gene locus_tag LOCUS_27820 15089 14424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 15307 15104 gene locus_tag LOCUS_27830 15307 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 15377 16807 gene locus_tag LOCUS_27840 15377 16807 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_27840 16804 18294 gene locus_tag LOCUS_27850 gene opuD 16804 18294 CDS product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54417 protein_id gnl|my_center|LOCUS_27850 19349 18411 gene locus_tag LOCUS_27860 19349 18411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_27860 20485 19571 gene locus_tag LOCUS_27870 20485 19571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_27870 21844 20558 gene locus_tag LOCUS_27880 gene gltA 21844 20558 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_27880 23343 22057 gene locus_tag LOCUS_27890 gene eno 23343 22057 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_27890 24615 23503 gene locus_tag LOCUS_27900 gene carA 24615 23503 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_27900 25243 24710 gene locus_tag LOCUS_27910 gene rplQ 25243 24710 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ72 protein_id gnl|my_center|LOCUS_27910 26292 25300 gene locus_tag LOCUS_27920 gene rpoA 26292 25300 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_27920 26922 26317 gene locus_tag LOCUS_27930 gene rpsD 26922 26317 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ74 protein_id gnl|my_center|LOCUS_27930 27404 27021 gene locus_tag LOCUS_27940 gene rpsK 27404 27021 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 protein_id gnl|my_center|LOCUS_27940 27791 27417 gene locus_tag LOCUS_27950 gene rpsM 27791 27417 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ76 protein_id gnl|my_center|LOCUS_27950 28240 28025 gene locus_tag LOCUS_27960 gene infA 28240 28025 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ78 protein_id gnl|my_center|LOCUS_27960 29586 28243 gene locus_tag LOCUS_27970 gene secY 29586 28243 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ79 protein_id gnl|my_center|LOCUS_27970 30048 29596 gene locus_tag LOCUS_27980 gene rplO 30048 29596 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ80 protein_id gnl|my_center|LOCUS_27980 30239 30057 gene locus_tag LOCUS_27990 gene rpmD 30239 30057 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ81 protein_id gnl|my_center|LOCUS_27990 30775 30251 gene locus_tag LOCUS_28000 gene rpsE 30775 30251 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ82 protein_id gnl|my_center|LOCUS_28000 31136 30783 gene locus_tag LOCUS_28010 gene rplR 31136 30783 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ83 protein_id gnl|my_center|LOCUS_28010 31691 31149 gene locus_tag LOCUS_28020 gene rplF 31691 31149 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 protein_id gnl|my_center|LOCUS_28020 32112 31711 gene locus_tag LOCUS_28030 gene rpsH 32112 31711 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_28030 32438 32169 gene locus_tag LOCUS_28040 gene rpsN 32438 32169 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_28040 32992 32441 gene locus_tag LOCUS_28050 gene rplE 32992 32441 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_28050 33306 32995 gene locus_tag LOCUS_28060 gene rplX 33306 32995 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ88 protein_id gnl|my_center|LOCUS_28060 33688 33320 gene locus_tag LOCUS_28070 gene rplN 33688 33320 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_28070 33948 33691 gene locus_tag LOCUS_28080 gene rpsQ 33948 33691 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_28080 34151 33960 gene locus_tag LOCUS_28090 34151 33960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 34581 34162 gene locus_tag LOCUS_28100 gene rplP 34581 34162 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ92 protein_id gnl|my_center|LOCUS_28100 35316 34600 gene locus_tag LOCUS_28110 gene rpsC 35316 34600 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_28110 35732 35325 gene locus_tag LOCUS_28120 gene rplV 35732 35325 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 protein_id gnl|my_center|LOCUS_28120 36019 35741 gene locus_tag LOCUS_28130 gene rpsS 36019 35741 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ95 protein_id gnl|my_center|LOCUS_28130 >Feature sequence45 <1 1382 gene locus_tag LOCUS_28140 <1 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000682783.1:peptidase 1396 2835 gene locus_tag LOCUS_28150 1396 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 2896 4077 gene locus_tag LOCUS_28160 2896 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 4173 5000 gene locus_tag LOCUS_28170 4173 5000 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_28170 5116 7872 gene locus_tag LOCUS_28180 5116 7872 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_28180 8807 7980 gene locus_tag LOCUS_28190 8807 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 9238 8807 gene locus_tag LOCUS_28200 9238 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_28200 9915 9325 gene locus_tag LOCUS_28210 9915 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402887.1 protein_id gnl|my_center|LOCUS_28210 10255 9926 gene locus_tag LOCUS_28220 10255 9926 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_28220 11229 10255 gene locus_tag LOCUS_28230 11229 10255 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_28230 11351 13981 gene locus_tag LOCUS_28240 gene alaS 11351 13981 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 protein_id gnl|my_center|LOCUS_28240 14268 15095 gene locus_tag LOCUS_28250 14268 15095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362021.1 protein_id gnl|my_center|LOCUS_28250 15344 15081 gene locus_tag LOCUS_28260 15344 15081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 15908 15348 gene locus_tag LOCUS_28270 15908 15348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 15987 17228 gene locus_tag LOCUS_28280 15987 17228 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_28280 17228 18352 gene locus_tag LOCUS_28290 17228 18352 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_28290 18477 19112 gene locus_tag LOCUS_28300 18477 19112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 19329 19847 gene locus_tag LOCUS_28310 19329 19847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 19892 20620 gene locus_tag LOCUS_28320 19892 20620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 20802 21446 gene locus_tag LOCUS_28330 20802 21446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 22015 21557 gene locus_tag LOCUS_28340 22015 21557 CDS product GAF domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_28340 22167 22655 gene locus_tag LOCUS_28350 22167 22655 CDS product exosortase family protein XrtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964136.1 protein_id gnl|my_center|LOCUS_28350 22648 23082 gene locus_tag LOCUS_28360 22648 23082 CDS product exosortase F system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964135.1 protein_id gnl|my_center|LOCUS_28360 23490 23113 gene locus_tag LOCUS_28370 23490 23113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 25001 23556 gene locus_tag LOCUS_28380 25001 23556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 25155 25610 gene locus_tag LOCUS_28390 25155 25610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208936.1 protein_id gnl|my_center|LOCUS_28390 26241 25615 gene locus_tag LOCUS_28400 26241 25615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 26524 26351 gene locus_tag LOCUS_28410 26524 26351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 28408 26717 gene locus_tag LOCUS_28420 gene lysS 28408 26717 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 protein_id gnl|my_center|LOCUS_28420 28592 29722 gene locus_tag LOCUS_28430 28592 29722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 30034 30738 gene locus_tag LOCUS_28440 gene lipB 30034 30738 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_28440 33207 30739 gene locus_tag LOCUS_28450 33207 30739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 33878 33279 gene locus_tag LOCUS_28460 gene rnhB 33878 33279 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_28460 33979 35967 gene locus_tag LOCUS_28470 33979 35967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence46 51 378 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttccagagcattccatcaaacaactaggattgaaac 517 1284 gene locus_tag LOCUS_28480 gene xth 517 1284 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_28480 1295 2254 gene locus_tag LOCUS_28490 1295 2254 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_28490 3534 2461 gene locus_tag LOCUS_28500 3534 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 4982 3618 gene locus_tag LOCUS_28510 gene radA 4982 3618 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_28510 5803 5072 gene locus_tag LOCUS_28520 5803 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 7176 6031 gene locus_tag LOCUS_28530 7176 6031 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962284.1 protein_id gnl|my_center|LOCUS_28530 7926 7213 gene locus_tag LOCUS_28540 7926 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 8536 8186 gene locus_tag LOCUS_28550 gene panD 8536 8186 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 protein_id gnl|my_center|LOCUS_28550 9409 8561 gene locus_tag LOCUS_28560 gene panC 9409 8561 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 protein_id gnl|my_center|LOCUS_28560 9522 10340 gene locus_tag LOCUS_28570 9522 10340 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_28570 10349 11920 gene locus_tag LOCUS_28580 10349 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962289.1 protein_id gnl|my_center|LOCUS_28580 11931 13778 gene locus_tag LOCUS_28590 gene glmS 11931 13778 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_28590 13906 15417 gene locus_tag LOCUS_28600 gene atpD 13906 15417 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_28600 15472 15750 gene locus_tag LOCUS_28610 15472 15750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 17437 15899 gene locus_tag LOCUS_28620 gene glyS 17437 15899 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2A9 protein_id gnl|my_center|LOCUS_28620 18371 17490 gene locus_tag LOCUS_28630 18371 17490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964516.1 protein_id gnl|my_center|LOCUS_28630 18496 19098 gene locus_tag LOCUS_28640 18496 19098 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_28640 19226 20764 gene locus_tag LOCUS_28650 19226 20764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_28650 21527 20751 gene locus_tag LOCUS_28660 21527 20751 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_28660 21705 22034 gene locus_tag LOCUS_28670 21705 22034 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_28670 22205 22945 gene locus_tag LOCUS_28680 22205 22945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 22987 23844 gene locus_tag LOCUS_28690 22987 23844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 24013 24477 gene locus_tag LOCUS_28700 24013 24477 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262101.1 protein_id gnl|my_center|LOCUS_28700 25583 24573 gene locus_tag LOCUS_28710 25583 24573 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970652.1 protein_id gnl|my_center|LOCUS_28710 26542 25703 gene locus_tag LOCUS_28720 26542 25703 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_28720 28054 26618 gene locus_tag LOCUS_28730 28054 26618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 30134 28056 gene locus_tag LOCUS_28740 gene metG 30134 28056 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_28740 30109 30339 gene locus_tag LOCUS_28750 30109 30339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 30336 30872 gene locus_tag LOCUS_28760 30336 30872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 30959 31510 gene locus_tag LOCUS_28770 30959 31510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 31598 31843 gene locus_tag LOCUS_28780 31598 31843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 32176 32715 gene locus_tag LOCUS_28790 32176 32715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 32753 33652 gene locus_tag LOCUS_28800 32753 33652 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_28800 34010 33867 gene locus_tag LOCUS_28810 34010 33867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 34095 34454 gene locus_tag LOCUS_28820 34095 34454 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_28820 34492 35148 gene locus_tag LOCUS_28830 34492 35148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 >Feature sequence47 1092 31 gene locus_tag LOCUS_28840 1092 31 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_28840 2117 1104 gene locus_tag LOCUS_28850 2117 1104 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023275.1 protein_id gnl|my_center|LOCUS_28850 3494 2139 gene locus_tag LOCUS_28860 3494 2139 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_28860 4851 3484 gene locus_tag LOCUS_28870 gene ndh 4851 3484 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_28870 5347 4886 gene locus_tag LOCUS_28880 gene yjaB 5347 4886 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CH60 protein_id gnl|my_center|LOCUS_28880 6101 5397 gene locus_tag LOCUS_28890 6101 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 6478 6203 gene locus_tag LOCUS_28900 6478 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 6715 6497 gene locus_tag LOCUS_28910 6715 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 6951 6733 gene locus_tag LOCUS_28920 6951 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 7952 7371 gene locus_tag LOCUS_28930 7952 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 8438 8130 gene locus_tag LOCUS_28940 8438 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 8824 9240 gene locus_tag LOCUS_28950 8824 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 9430 13161 gene locus_tag LOCUS_28960 9430 13161 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_28960 13158 14375 gene locus_tag LOCUS_28970 13158 14375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 14378 14941 gene locus_tag LOCUS_28980 14378 14941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 14991 17300 gene locus_tag LOCUS_28990 14991 17300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 17313 17525 gene locus_tag LOCUS_29000 17313 17525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 18071 18634 gene locus_tag LOCUS_29010 18071 18634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 18634 19086 gene locus_tag LOCUS_29020 18634 19086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 19448 20113 gene locus_tag LOCUS_29030 19448 20113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 20163 21392 gene locus_tag LOCUS_29040 20163 21392 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_29040 21509 22000 gene locus_tag LOCUS_29050 21509 22000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_29050 22026 23840 gene locus_tag LOCUS_29060 22026 23840 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203354.1 protein_id gnl|my_center|LOCUS_29060 24165 24656 gene locus_tag LOCUS_29070 24165 24656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 24762 27023 gene locus_tag LOCUS_29080 24762 27023 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_29080 27047 27259 gene locus_tag LOCUS_29090 27047 27259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 28352 27759 gene locus_tag LOCUS_29100 28352 27759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 28510 30444 gene locus_tag LOCUS_29110 28510 30444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 30428 31072 gene locus_tag LOCUS_29120 gene rrp4 30428 31072 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101433.1 protein_id gnl|my_center|LOCUS_29120 31173 31595 gene locus_tag LOCUS_29130 31173 31595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253510.1 protein_id gnl|my_center|LOCUS_29130 31625 32008 gene locus_tag LOCUS_29140 31625 32008 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 protein_id gnl|my_center|LOCUS_29140 32779 33489 gene locus_tag LOCUS_29150 32779 33489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence48 1875 193 gene locus_tag LOCUS_29160 gene rho 1875 193 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_29160 2072 2482 gene locus_tag LOCUS_29170 2072 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_29170 2626 3240 gene locus_tag LOCUS_29180 2626 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 3837 3343 gene locus_tag LOCUS_29190 3837 3343 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_29190 3909 4652 gene locus_tag LOCUS_29200 gene truA 3909 4652 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_29200 4657 6423 gene locus_tag LOCUS_29210 4657 6423 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_29210 7196 6420 gene locus_tag LOCUS_29220 7196 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 7993 7208 gene locus_tag LOCUS_29230 7993 7208 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202009.1 protein_id gnl|my_center|LOCUS_29230 8845 8021 gene locus_tag LOCUS_29240 gene folP 8845 8021 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_29240 8915 9454 gene locus_tag LOCUS_29250 8915 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_29250 9703 10671 gene locus_tag LOCUS_29260 9703 10671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_29260 10678 11754 gene locus_tag LOCUS_29270 10678 11754 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020359.1 protein_id gnl|my_center|LOCUS_29270 11776 12531 gene locus_tag LOCUS_29280 gene tpiA 11776 12531 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI2 protein_id gnl|my_center|LOCUS_29280 12790 13125 gene locus_tag LOCUS_29290 12790 13125 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_29290 13169 13690 gene locus_tag LOCUS_29300 13169 13690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888245.1 protein_id gnl|my_center|LOCUS_29300 13702 14745 gene locus_tag LOCUS_29310 13702 14745 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826549.1 protein_id gnl|my_center|LOCUS_29310 14745 15365 gene locus_tag LOCUS_29320 gene arsC 14745 15365 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_29320 16036 15479 gene locus_tag LOCUS_29330 16036 15479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_29330 16249 18186 gene locus_tag LOCUS_29340 gene gyrB 16249 18186 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX10 protein_id gnl|my_center|LOCUS_29340 18270 19274 gene locus_tag LOCUS_29350 18270 19274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 19376 20302 gene locus_tag LOCUS_29360 gene mdh 19376 20302 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX11 protein_id gnl|my_center|LOCUS_29360 20459 23467 gene locus_tag LOCUS_29370 gene secDF 20459 23467 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 protein_id gnl|my_center|LOCUS_29370 24925 24095 gene locus_tag LOCUS_29380 gene lgt 24925 24095 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG9 protein_id gnl|my_center|LOCUS_29380 26725 25241 gene locus_tag LOCUS_29390 gene cysS 26725 25241 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_29390 27448 26771 gene locus_tag LOCUS_29400 gene folE2 27448 26771 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_29400 >Feature sequence49 737 1255 gene locus_tag LOCUS_29410 737 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 1951 1526 gene locus_tag LOCUS_29420 1951 1526 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359781.1 protein_id gnl|my_center|LOCUS_29420 2047 3132 gene locus_tag LOCUS_29430 gene argK 2047 3132 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962733.1 protein_id gnl|my_center|LOCUS_29430 4068 3127 gene locus_tag LOCUS_29440 4068 3127 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_29440 4201 4914 gene locus_tag LOCUS_29450 4201 4914 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789838.1 protein_id gnl|my_center|LOCUS_29450 4911 5534 gene locus_tag LOCUS_29460 4911 5534 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802698.1 protein_id gnl|my_center|LOCUS_29460 5524 7146 gene locus_tag LOCUS_29470 5524 7146 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661302.1 protein_id gnl|my_center|LOCUS_29470 7700 7143 gene locus_tag LOCUS_29480 gene lpxF 7700 7143 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M3 protein_id gnl|my_center|LOCUS_29480 7933 7706 gene locus_tag LOCUS_29490 7933 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_29490 9305 7944 gene locus_tag LOCUS_29500 gene norM 9305 7944 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_29500 9439 10041 gene locus_tag LOCUS_29510 9439 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 11793 10264 gene locus_tag LOCUS_29520 11793 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_29520 12120 12788 gene locus_tag LOCUS_29530 12120 12788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 13329 12790 gene locus_tag LOCUS_29540 13329 12790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 14470 13304 gene locus_tag LOCUS_29550 14470 13304 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_29550 15369 14470 gene locus_tag LOCUS_29560 15369 14470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 16756 15458 gene locus_tag LOCUS_29570 gene natB 16756 15458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_29570 17678 16749 gene locus_tag LOCUS_29580 gene natA 17678 16749 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_29580 18992 17868 gene locus_tag LOCUS_29590 gene dnaJ 18992 17868 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_29590 19600 19028 gene locus_tag LOCUS_29600 gene grpE 19600 19028 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_29600 19765 20448 gene locus_tag LOCUS_29610 gene yceI 19765 20448 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_29610 21405 20503 gene locus_tag LOCUS_29620 21405 20503 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_29620 22186 21512 gene locus_tag LOCUS_29630 22186 21512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_29630 22629 22189 gene locus_tag LOCUS_29640 22629 22189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 23162 22629 gene locus_tag LOCUS_29650 23162 22629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 23273 24346 gene locus_tag LOCUS_29660 23273 24346 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_29660 24657 26360 gene locus_tag LOCUS_29670 24657 26360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 26768 26394 gene locus_tag LOCUS_29680 26768 26394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_29680 27696 28010 gene locus_tag LOCUS_29690 27696 28010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29690 28079 28498 gene locus_tag LOCUS_29700 28079 28498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 28499 29026 gene locus_tag LOCUS_29710 28499 29026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 29178 29534 gene locus_tag LOCUS_29720 29178 29534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 29531 29878 gene locus_tag LOCUS_29730 29531 29878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 30051 30470 gene locus_tag LOCUS_29740 30051 30470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 >Feature sequence50 8 92 gene locus_tag LOCUS_t00290 8 92 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 196 1188 gene locus_tag LOCUS_29750 196 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_603290.2 protein_id gnl|my_center|LOCUS_29750 1730 1284 gene locus_tag LOCUS_29760 1730 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 2044 3117 gene locus_tag LOCUS_29770 2044 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 3119 3646 gene locus_tag LOCUS_29780 3119 3646 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962661.1 protein_id gnl|my_center|LOCUS_29780 4451 3621 gene locus_tag LOCUS_29790 gene glpQ 4451 3621 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_29790 5601 4513 gene locus_tag LOCUS_29800 5601 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 6619 5609 gene locus_tag LOCUS_29810 6619 5609 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_29810 6784 6984 gene locus_tag LOCUS_29820 6784 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 6968 7879 gene locus_tag LOCUS_29830 6968 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 8224 7937 gene locus_tag LOCUS_29840 8224 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 8406 11057 gene locus_tag LOCUS_29850 8406 11057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_29850 11297 14341 gene locus_tag LOCUS_29860 11297 14341 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_29860 14352 15842 gene locus_tag LOCUS_29870 14352 15842 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_29870 15849 17891 gene locus_tag LOCUS_29880 15849 17891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 17897 19543 gene locus_tag LOCUS_29890 17897 19543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 19624 21912 gene locus_tag LOCUS_29900 19624 21912 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_29900 21916 22680 gene locus_tag LOCUS_29910 21916 22680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 23075 22749 gene locus_tag LOCUS_29920 23075 22749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 23353 23138 gene locus_tag LOCUS_29930 23353 23138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 24652 23477 gene locus_tag LOCUS_29940 gene kdtA 24652 23477 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_29940 24826 25953 gene locus_tag LOCUS_29950 gene porR 24826 25953 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence51 1154 501 gene locus_tag LOCUS_29960 1154 501 CDS product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGB4 protein_id gnl|my_center|LOCUS_29960 1980 1138 gene locus_tag LOCUS_29970 1980 1138 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202801.1 protein_id gnl|my_center|LOCUS_29970 2540 1980 gene locus_tag LOCUS_29980 gene thiE-2 2540 1980 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729I8 protein_id gnl|my_center|LOCUS_29980 3408 2602 gene locus_tag LOCUS_29990 gene thiM 3408 2602 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JW7 protein_id gnl|my_center|LOCUS_29990 7283 3699 gene locus_tag LOCUS_30000 7283 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 7787 12865 gene locus_tag LOCUS_30010 7787 12865 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_30010 12866 15184 gene locus_tag LOCUS_30020 12866 15184 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_30020 15359 16216 gene locus_tag LOCUS_30030 15359 16216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 16821 19559 gene locus_tag LOCUS_30040 16821 19559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence52 52 2265 gene locus_tag LOCUS_30050 gene relA 52 2265 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_30050 2289 2744 gene locus_tag LOCUS_30060 gene fur 2289 2744 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_30060 2754 4025 gene locus_tag LOCUS_30070 gene purA 2754 4025 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_30070 4194 5882 gene locus_tag LOCUS_30080 4194 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_30080 5885 7063 gene locus_tag LOCUS_30090 gene argD 5885 7063 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_30090 7169 8560 gene locus_tag LOCUS_30100 7169 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_30100 8621 9565 gene locus_tag LOCUS_30110 8621 9565 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458367.1 protein_id gnl|my_center|LOCUS_30110 9543 10565 gene locus_tag LOCUS_30120 9543 10565 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_30120 10558 11289 gene locus_tag LOCUS_30130 10558 11289 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 protein_id gnl|my_center|LOCUS_30130 11371 13431 gene locus_tag LOCUS_30140 11371 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963876.1 protein_id gnl|my_center|LOCUS_30140 13556 14398 gene locus_tag LOCUS_30150 13556 14398 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963867.1 protein_id gnl|my_center|LOCUS_30150 14513 16015 gene locus_tag LOCUS_30160 gene aldA 14513 16015 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYG9 protein_id gnl|my_center|LOCUS_30160 16135 16665 gene locus_tag LOCUS_30170 16135 16665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 18888 17065 gene locus_tag LOCUS_30180 gene rpsA 18888 17065 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963900.1 protein_id gnl|my_center|LOCUS_30180 20290 19124 gene locus_tag LOCUS_30190 20290 19124 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766719.1 protein_id gnl|my_center|LOCUS_30190 20984 20292 gene locus_tag LOCUS_30200 gene cmk 20984 20292 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 protein_id gnl|my_center|LOCUS_30200 21200 23503 gene locus_tag LOCUS_30210 21200 23503 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107653.1 protein_id gnl|my_center|LOCUS_30210 24467 23496 gene locus_tag LOCUS_30220 gene porQ 24467 23496 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_30220 24833 26110 gene locus_tag LOCUS_30230 24833 26110 CDS product ammonia channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461712.1 protein_id gnl|my_center|LOCUS_30230 27132 26188 gene locus_tag LOCUS_30240 27132 26188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963560.1 protein_id gnl|my_center|LOCUS_30240 27200 27589 gene locus_tag LOCUS_30250 27200 27589 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_30250 27592 28095 gene locus_tag LOCUS_30260 gene pyrR2 27592 28095 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_30260 28605 28084 gene locus_tag LOCUS_30270 gene aroK 28605 28084 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 protein_id gnl|my_center|LOCUS_30270 28730 28803 gene locus_tag LOCUS_t00300 28730 28803 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence53 778 140 gene locus_tag LOCUS_30280 778 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 1026 1583 gene locus_tag LOCUS_30290 1026 1583 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_30290 1663 2463 gene locus_tag LOCUS_30300 1663 2463 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183070.1 protein_id gnl|my_center|LOCUS_30300 3377 2646 gene locus_tag LOCUS_30310 3377 2646 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897697.1 protein_id gnl|my_center|LOCUS_30310 3848 3438 gene locus_tag LOCUS_30320 3848 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088402.1 protein_id gnl|my_center|LOCUS_30320 4716 3862 gene locus_tag LOCUS_30330 4716 3862 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920985.1 protein_id gnl|my_center|LOCUS_30330 6070 4736 gene locus_tag LOCUS_30340 6070 4736 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362024.1 protein_id gnl|my_center|LOCUS_30340 7700 6438 gene locus_tag LOCUS_30350 7700 6438 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 protein_id gnl|my_center|LOCUS_30350 7921 7700 gene locus_tag LOCUS_30360 7921 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 8530 10260 gene locus_tag LOCUS_30370 8530 10260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 12100 10838 gene locus_tag LOCUS_30380 12100 10838 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763524.1 protein_id gnl|my_center|LOCUS_30380 13608 12100 gene locus_tag LOCUS_30390 gene mqo 13608 12100 CDS product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E6 protein_id gnl|my_center|LOCUS_30390 14282 13731 gene locus_tag LOCUS_30400 14282 13731 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410764.1 protein_id gnl|my_center|LOCUS_30400 15628 14309 gene locus_tag LOCUS_30410 15628 14309 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963764.1 protein_id gnl|my_center|LOCUS_30410 16304 15834 gene locus_tag LOCUS_30420 16304 15834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 16774 16316 gene locus_tag LOCUS_30430 16774 16316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 17230 16790 gene locus_tag LOCUS_30440 17230 16790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 17664 17425 gene locus_tag LOCUS_30450 17664 17425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 19419 18445 gene locus_tag LOCUS_30460 19419 18445 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_30460 20318 19434 gene locus_tag LOCUS_30470 gene rimK 20318 19434 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_30470 20957 21484 gene locus_tag LOCUS_30480 gene menG 20957 21484 CDS product 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMX4 protein_id gnl|my_center|LOCUS_30480 21950 21489 gene locus_tag LOCUS_30490 21950 21489 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY55 protein_id gnl|my_center|LOCUS_30490 23265 23987 gene locus_tag LOCUS_30500 23265 23987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 24073 24603 gene locus_tag LOCUS_30510 24073 24603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 24959 26083 gene locus_tag LOCUS_30520 24959 26083 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203483.1 protein_id gnl|my_center|LOCUS_30520 26100 26648 gene locus_tag LOCUS_30530 26100 26648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779367.1 protein_id gnl|my_center|LOCUS_30530 27103 27444 gene locus_tag LOCUS_30540 27103 27444 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201974.1 protein_id gnl|my_center|LOCUS_30540 27428 27736 gene locus_tag LOCUS_30550 27428 27736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 >Feature sequence54 3939 2038 gene locus_tag LOCUS_30560 3939 2038 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_30560 4898 3969 gene locus_tag LOCUS_30570 gene porP 4898 3969 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_30570 10557 4981 gene locus_tag LOCUS_30580 10557 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 10786 12024 gene locus_tag LOCUS_30590 gene hflX 10786 12024 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 protein_id gnl|my_center|LOCUS_30590 14016 12094 gene locus_tag LOCUS_30600 14016 12094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 16786 14024 gene locus_tag LOCUS_30610 16786 14024 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_30610 16876 17973 gene locus_tag LOCUS_30620 16876 17973 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_30620 21350 18027 gene locus_tag LOCUS_30630 21350 18027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_30630 22070 23479 gene locus_tag LOCUS_30640 22070 23479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 23491 23910 gene locus_tag LOCUS_30650 23491 23910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 23933 24850 gene locus_tag LOCUS_30660 23933 24850 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_30660 24840 25601 gene locus_tag LOCUS_30670 24840 25601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 25598 28003 gene locus_tag LOCUS_30680 25598 28003 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_30680 >Feature sequence55 1341 184 gene locus_tag LOCUS_30690 1341 184 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_30690 1621 2049 gene locus_tag LOCUS_30700 1621 2049 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_30700 2085 2456 gene locus_tag LOCUS_30710 2085 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962882.1 protein_id gnl|my_center|LOCUS_30710 2456 3286 gene locus_tag LOCUS_30720 2456 3286 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 protein_id gnl|my_center|LOCUS_30720 3757 3308 gene locus_tag LOCUS_30730 gene mscL 3757 3308 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN97 protein_id gnl|my_center|LOCUS_30730 6393 3763 gene locus_tag LOCUS_30740 gene parC 6393 3763 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_30740 8578 6722 gene locus_tag LOCUS_30750 gene parE 8578 6722 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_30750 10833 8668 gene locus_tag LOCUS_30760 10833 8668 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_30760 12011 10917 gene locus_tag LOCUS_30770 gene engD 12011 10917 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC6 protein_id gnl|my_center|LOCUS_30770 12182 12664 gene locus_tag LOCUS_30780 12182 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 12992 12801 gene locus_tag LOCUS_30790 12992 12801 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_30790 13143 13481 gene locus_tag LOCUS_30800 13143 13481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 13542 14009 gene locus_tag LOCUS_30810 13542 14009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 14031 14609 gene locus_tag LOCUS_30820 14031 14609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 14718 16010 gene locus_tag LOCUS_30830 14718 16010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 16000 16563 gene locus_tag LOCUS_30840 16000 16563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 16694 17689 gene locus_tag LOCUS_30850 gene yfmJ 16694 17689 CDS product putative NADP-dependent oxidoreductase YfmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34812 protein_id gnl|my_center|LOCUS_30850 18182 19309 gene locus_tag LOCUS_30860 18182 19309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 19711 20043 gene locus_tag LOCUS_30870 19711 20043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004327465.1 protein_id gnl|my_center|LOCUS_30870 20043 20591 gene locus_tag LOCUS_30880 20043 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 21607 20636 gene locus_tag LOCUS_30890 21607 20636 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202571.1 protein_id gnl|my_center|LOCUS_30890 22176 24962 gene locus_tag LOCUS_30900 22176 24962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 24974 25669 gene locus_tag LOCUS_30910 24974 25669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 26951 26007 gene locus_tag LOCUS_30920 26951 26007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 >Feature sequence56 908 1192 gene locus_tag LOCUS_30930 908 1192 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 protein_id gnl|my_center|LOCUS_30930 1469 1948 gene locus_tag LOCUS_30940 1469 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 1932 2594 gene locus_tag LOCUS_30950 1932 2594 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_30950 2591 3109 gene locus_tag LOCUS_30960 2591 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203019.1 protein_id gnl|my_center|LOCUS_30960 3502 3834 gene locus_tag LOCUS_30970 3502 3834 CDS product killer suppression protein HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387766.1 protein_id gnl|my_center|LOCUS_30970 3850 4947 gene locus_tag LOCUS_30980 3850 4947 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_30980 4961 6100 gene locus_tag LOCUS_30990 4961 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 6892 6113 gene locus_tag LOCUS_31000 6892 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 7635 7048 gene locus_tag LOCUS_31010 7635 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 7897 8184 gene locus_tag LOCUS_31020 7897 8184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 8455 10857 gene locus_tag LOCUS_31030 8455 10857 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005842190.1 protein_id gnl|my_center|LOCUS_31030 10862 11437 gene locus_tag LOCUS_31040 10862 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 11437 12282 gene locus_tag LOCUS_31050 11437 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 12398 12931 gene locus_tag LOCUS_31060 12398 12931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 12928 13863 gene locus_tag LOCUS_31070 12928 13863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 13939 14724 gene locus_tag LOCUS_31080 13939 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 14732 15097 gene locus_tag LOCUS_31090 14732 15097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 16282 15182 gene locus_tag LOCUS_31100 16282 15182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 17567 16287 gene locus_tag LOCUS_31110 17567 16287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 18580 17564 gene locus_tag LOCUS_31120 18580 17564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 19832 18573 gene locus_tag LOCUS_31130 19832 18573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 20409 19987 gene locus_tag LOCUS_31140 20409 19987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 20433 20642 gene locus_tag LOCUS_31150 20433 20642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 21691 20762 gene locus_tag LOCUS_31160 21691 20762 CDS product dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900117.1 protein_id gnl|my_center|LOCUS_31160 22329 21763 gene locus_tag LOCUS_31170 22329 21763 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763969.1 protein_id gnl|my_center|LOCUS_31170 22468 22271 gene locus_tag LOCUS_31180 22468 22271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 24093 22513 gene locus_tag LOCUS_31190 24093 22513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 25134 24103 gene locus_tag LOCUS_31200 25134 24103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 25526 25146 gene locus_tag LOCUS_31210 25526 25146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 >Feature sequence57 2049 1273 gene locus_tag LOCUS_31220 2049 1273 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_31220 2661 2092 gene locus_tag LOCUS_31230 2661 2092 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_31230 4063 3068 gene locus_tag LOCUS_31240 4063 3068 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035338.1 protein_id gnl|my_center|LOCUS_31240 5033 4224 gene locus_tag LOCUS_31250 5033 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 5855 5040 gene locus_tag LOCUS_31260 5855 5040 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100978.1 protein_id gnl|my_center|LOCUS_31260 6935 6015 gene locus_tag LOCUS_31270 6935 6015 CDS product putative dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701467.1 protein_id gnl|my_center|LOCUS_31270 7907 7005 gene locus_tag LOCUS_31280 7907 7005 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896869.1 protein_id gnl|my_center|LOCUS_31280 8718 7813 gene locus_tag LOCUS_31290 8718 7813 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_31290 9478 8744 gene locus_tag LOCUS_31300 9478 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 10320 9475 gene locus_tag LOCUS_31310 10320 9475 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183070.1 protein_id gnl|my_center|LOCUS_31310 12001 10793 gene locus_tag LOCUS_31320 12001 10793 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203295.1 protein_id gnl|my_center|LOCUS_31320 13618 12356 gene locus_tag LOCUS_31330 13618 12356 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 protein_id gnl|my_center|LOCUS_31330 13938 13618 gene locus_tag LOCUS_31340 13938 13618 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005845276.1 protein_id gnl|my_center|LOCUS_31340 15166 14270 gene locus_tag LOCUS_31350 15166 14270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 16520 15615 gene locus_tag LOCUS_31360 16520 15615 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528028.1 protein_id gnl|my_center|LOCUS_31360 17126 16572 gene locus_tag LOCUS_31370 17126 16572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 17431 18264 gene locus_tag LOCUS_31380 17431 18264 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706541.1 protein_id gnl|my_center|LOCUS_31380 18272 19183 gene locus_tag LOCUS_31390 18272 19183 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_31390 19347 20084 gene locus_tag LOCUS_31400 19347 20084 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978344.1 protein_id gnl|my_center|LOCUS_31400 20107 21021 gene locus_tag LOCUS_31410 20107 21021 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_31410 21094 21906 gene locus_tag LOCUS_31420 21094 21906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 21978 22553 gene locus_tag LOCUS_31430 21978 22553 CDS product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683439.1 protein_id gnl|my_center|LOCUS_31430 22819 23400 gene locus_tag LOCUS_31440 22819 23400 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_31440 23441 24232 gene locus_tag LOCUS_31450 23441 24232 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_31450 >Feature sequence58 1253 1092 gene locus_tag LOCUS_31460 1253 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 2605 1271 gene locus_tag LOCUS_31470 2605 1271 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887115.1 protein_id gnl|my_center|LOCUS_31470 2867 3814 gene locus_tag LOCUS_31480 2867 3814 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379249.1 protein_id gnl|my_center|LOCUS_31480 3849 4601 gene locus_tag LOCUS_31490 3849 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967667.1 protein_id gnl|my_center|LOCUS_31490 4696 5277 gene locus_tag LOCUS_31500 4696 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 5326 6219 gene locus_tag LOCUS_31510 5326 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932762.1 protein_id gnl|my_center|LOCUS_31510 6307 7389 gene locus_tag LOCUS_31520 6307 7389 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_31520 7404 8306 gene locus_tag LOCUS_31530 gene est 7404 8306 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004790086.1 protein_id gnl|my_center|LOCUS_31530 8472 9239 gene locus_tag LOCUS_31540 8472 9239 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_31540 9367 9813 gene locus_tag LOCUS_31550 9367 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 9858 10607 gene locus_tag LOCUS_31560 9858 10607 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_31560 10775 11695 gene locus_tag LOCUS_31570 10775 11695 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 protein_id gnl|my_center|LOCUS_31570 11929 11705 gene locus_tag LOCUS_31580 11929 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 12150 13082 gene locus_tag LOCUS_31590 12150 13082 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764893.1 protein_id gnl|my_center|LOCUS_31590 13180 14022 gene locus_tag LOCUS_31600 13180 14022 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727784.1 protein_id gnl|my_center|LOCUS_31600 14110 14544 gene locus_tag LOCUS_31610 14110 14544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 14615 15469 gene locus_tag LOCUS_31620 14615 15469 CDS product AttM/AiiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729411.1 protein_id gnl|my_center|LOCUS_31620 15834 16724 gene locus_tag LOCUS_31630 15834 16724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932762.1 protein_id gnl|my_center|LOCUS_31630 16879 17664 gene locus_tag LOCUS_31640 16879 17664 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_31640 17805 18827 gene locus_tag LOCUS_31650 17805 18827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 19161 20006 gene locus_tag LOCUS_31660 19161 20006 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183070.1 protein_id gnl|my_center|LOCUS_31660 20019 20267 gene locus_tag LOCUS_31670 20019 20267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 20284 21198 gene locus_tag LOCUS_31680 20284 21198 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_31680 21471 21256 gene locus_tag LOCUS_31690 21471 21256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 21497 22159 gene locus_tag LOCUS_31700 21497 22159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 22810 22457 gene locus_tag LOCUS_31710 22810 22457 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206336.1 protein_id gnl|my_center|LOCUS_31710 22897 23493 gene locus_tag LOCUS_31720 gene kefF 22897 23493 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206335.1 protein_id gnl|my_center|LOCUS_31720 >Feature sequence59 1360 497 gene locus_tag LOCUS_31730 gene atpG 1360 497 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_31730 3010 1430 gene locus_tag LOCUS_31740 gene atpA 3010 1430 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_31740 3605 3060 gene locus_tag LOCUS_31750 gene atpH 3605 3060 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_31750 4110 3610 gene locus_tag LOCUS_31760 gene atpF 4110 3610 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_31760 4387 4190 gene locus_tag LOCUS_31770 4387 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 5535 4411 gene locus_tag LOCUS_31780 gene atpB 5535 4411 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_31780 6041 5643 gene locus_tag LOCUS_31790 6041 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 6276 6043 gene locus_tag LOCUS_31800 6276 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 6655 6233 gene locus_tag LOCUS_31810 6655 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 9125 6666 gene locus_tag LOCUS_31820 gene sprE 9125 6666 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_31820 10052 9357 gene locus_tag LOCUS_31830 10052 9357 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_31830 11534 10059 gene locus_tag LOCUS_31840 11534 10059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405190.1 protein_id gnl|my_center|LOCUS_31840 12237 11617 gene locus_tag LOCUS_31850 12237 11617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 12572 12234 gene locus_tag LOCUS_31860 12572 12234 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_31860 12699 13751 gene locus_tag LOCUS_31870 gene paaE 12699 13751 CDS product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_31870 14037 17345 gene locus_tag LOCUS_31880 14037 17345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence60 6011 5190 gene locus_tag LOCUS_31890 gene yeeZ 6011 5190 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962265.1 protein_id gnl|my_center|LOCUS_31890 6247 5996 gene locus_tag LOCUS_31900 6247 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 8486 6249 gene locus_tag LOCUS_31910 8486 6249 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228011.1 protein_id gnl|my_center|LOCUS_31910 8916 8566 gene locus_tag LOCUS_31920 8916 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_31920 9686 9495 gene locus_tag LOCUS_31930 9686 9495 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_31930 10028 9786 gene locus_tag LOCUS_31940 10028 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 11813 10041 gene locus_tag LOCUS_31950 11813 10041 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 protein_id gnl|my_center|LOCUS_31950 13627 11876 gene locus_tag LOCUS_31960 gene aspS 13627 11876 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_31960 13863 14195 gene locus_tag LOCUS_31970 13863 14195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962526.1 protein_id gnl|my_center|LOCUS_31970 <18867 14775 gene locus_tag LOCUS_31980 <18867 14775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein >Feature sequence61 697 122 gene locus_tag LOCUS_31990 gene yceI 697 122 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_31990 1356 724 gene locus_tag LOCUS_32000 1356 724 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_32000 1927 1397 gene locus_tag LOCUS_32010 1927 1397 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_32010 2045 2563 gene locus_tag LOCUS_32020 2045 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 2573 3211 gene locus_tag LOCUS_32030 2573 3211 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_32030 3244 3558 gene locus_tag LOCUS_32040 3244 3558 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_32040 3669 3974 gene locus_tag LOCUS_32050 3669 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 4743 3982 gene locus_tag LOCUS_32060 4743 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 5011 5406 gene locus_tag LOCUS_32070 5011 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 5418 6131 gene locus_tag LOCUS_32080 5418 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 protein_id gnl|my_center|LOCUS_32080 6224 6835 gene locus_tag LOCUS_32090 6224 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 6852 8942 gene locus_tag LOCUS_32100 6852 8942 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121033.1 protein_id gnl|my_center|LOCUS_32100 9255 14123 gene locus_tag LOCUS_32110 9255 14123 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121034.1 protein_id gnl|my_center|LOCUS_32110 14912 15121 gene locus_tag LOCUS_32120 14912 15121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 15270 15491 gene locus_tag LOCUS_32130 15270 15491 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_32130 15478 15810 gene locus_tag LOCUS_32140 15478 15810 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_32140 15800 16744 gene locus_tag LOCUS_32150 15800 16744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_32150 16935 17091 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtgaatacctttccaactaaag >Feature sequence62 2097 793 gene locus_tag LOCUS_32160 gene der 2097 793 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_32160 3072 2188 gene locus_tag LOCUS_32170 gene era 3072 2188 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_32170 5211 3283 gene locus_tag LOCUS_32180 5211 3283 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963992.1 protein_id gnl|my_center|LOCUS_32180 5917 5276 gene locus_tag LOCUS_32190 5917 5276 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_32190 6066 7331 gene locus_tag LOCUS_32200 6066 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_32200 7819 7325 gene locus_tag LOCUS_32210 gene greA 7819 7325 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DN9 protein_id gnl|my_center|LOCUS_32210 8555 7896 gene locus_tag LOCUS_32220 8555 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 8702 9706 gene locus_tag LOCUS_32230 8702 9706 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405029.1 protein_id gnl|my_center|LOCUS_32230 10233 9772 gene locus_tag LOCUS_32240 10233 9772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 10470 10279 gene locus_tag LOCUS_32250 10470 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 12443 12895 gene locus_tag LOCUS_32260 12443 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 12896 13282 gene locus_tag LOCUS_32270 12896 13282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 13599 15077 gene locus_tag LOCUS_32280 13599 15077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 15061 15471 gene locus_tag LOCUS_32290 15061 15471 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_32290 16622 15498 gene locus_tag LOCUS_32300 16622 15498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 >Feature sequence63 425 808 gene locus_tag LOCUS_32310 425 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 838 1314 gene locus_tag LOCUS_32320 838 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 1414 2241 gene locus_tag LOCUS_32330 1414 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 2303 3046 gene locus_tag LOCUS_32340 2303 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966202.1 protein_id gnl|my_center|LOCUS_32340 3329 4435 gene locus_tag LOCUS_32350 3329 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462134.1 protein_id gnl|my_center|LOCUS_32350 4594 5781 gene locus_tag LOCUS_32360 4594 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 5949 6578 gene locus_tag LOCUS_32370 5949 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 6758 7084 gene locus_tag LOCUS_32380 6758 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 7059 8027 gene locus_tag LOCUS_32390 7059 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_32390 8014 8742 gene locus_tag LOCUS_32400 8014 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 8984 9355 gene locus_tag LOCUS_32410 8984 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 9369 9818 gene locus_tag LOCUS_32420 9369 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 9820 10791 gene locus_tag LOCUS_32430 9820 10791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104632.1 protein_id gnl|my_center|LOCUS_32430 10795 12081 gene locus_tag LOCUS_32440 10795 12081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 12323 12562 gene locus_tag LOCUS_32450 12323 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 12562 12843 gene locus_tag LOCUS_32460 12562 12843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 12911 13132 gene locus_tag LOCUS_32470 12911 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 13514 13711 gene locus_tag LOCUS_32480 13514 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 14213 14551 gene locus_tag LOCUS_32490 14213 14551 CDS product UPF0339 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VSB4 protein_id gnl|my_center|LOCUS_32490 16196 14760 gene locus_tag LOCUS_32500 16196 14760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence64 122 670 gene locus_tag LOCUS_32510 122 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 859 1641 gene locus_tag LOCUS_32520 859 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 2062 2607 gene locus_tag LOCUS_32530 2062 2607 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844895.1 protein_id gnl|my_center|LOCUS_32530 2814 3026 gene locus_tag LOCUS_32540 2814 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 3256 3669 gene locus_tag LOCUS_32550 3256 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 3823 4761 gene locus_tag LOCUS_32560 3823 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 5012 5542 gene locus_tag LOCUS_32570 5012 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 5539 6387 gene locus_tag LOCUS_32580 5539 6387 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_32580 6486 6836 gene locus_tag LOCUS_32590 6486 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 7108 8421 gene locus_tag LOCUS_32600 7108 8421 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870113.1 protein_id gnl|my_center|LOCUS_32600 8530 9423 gene locus_tag LOCUS_32610 8530 9423 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_32610 9500 10336 gene locus_tag LOCUS_32620 9500 10336 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727784.1 protein_id gnl|my_center|LOCUS_32620 11601 10342 gene locus_tag LOCUS_32630 11601 10342 CDS product licheninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223397.1 protein_id gnl|my_center|LOCUS_32630 12423 11632 gene locus_tag LOCUS_32640 12423 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 12743 13219 gene locus_tag LOCUS_32650 12743 13219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 13358 14194 gene locus_tag LOCUS_32660 13358 14194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 14569 15156 gene locus_tag LOCUS_32670 14569 15156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 15250 15768 gene locus_tag LOCUS_32680 15250 15768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 >Feature sequence65 403 206 gene locus_tag LOCUS_32690 403 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 868 419 gene locus_tag LOCUS_32700 868 419 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108556.1 protein_id gnl|my_center|LOCUS_32700 1281 943 gene locus_tag LOCUS_32710 1281 943 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_32710 1862 2041 gene locus_tag LOCUS_32720 1862 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 3215 2886 gene locus_tag LOCUS_32730 3215 2886 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966217.1 protein_id gnl|my_center|LOCUS_32730 3314 4240 gene locus_tag LOCUS_32740 3314 4240 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643797.1 protein_id gnl|my_center|LOCUS_32740 5474 4449 gene locus_tag LOCUS_32750 5474 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 5604 5981 gene locus_tag LOCUS_32760 5604 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 5983 7317 gene locus_tag LOCUS_32770 5983 7317 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932440.1 protein_id gnl|my_center|LOCUS_32770 7441 8439 gene locus_tag LOCUS_32780 7441 8439 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963074.1 protein_id gnl|my_center|LOCUS_32780 8545 9681 gene locus_tag LOCUS_32790 gene lolC 8545 9681 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963073.1 protein_id gnl|my_center|LOCUS_32790 9832 10506 gene locus_tag LOCUS_32800 gene lolD 9832 10506 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY43 protein_id gnl|my_center|LOCUS_32800 10536 11387 gene locus_tag LOCUS_32810 10536 11387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 11413 12417 gene locus_tag LOCUS_32820 11413 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 12392 13156 gene locus_tag LOCUS_32830 12392 13156 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence66 2349 610 gene locus_tag LOCUS_32840 2349 610 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789735.1 protein_id gnl|my_center|LOCUS_32840 3473 2694 gene locus_tag LOCUS_32850 3473 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 4358 3687 gene locus_tag LOCUS_32860 4358 3687 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161829.1 protein_id gnl|my_center|LOCUS_32860 5367 4477 gene locus_tag LOCUS_32870 5367 4477 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764904.1 protein_id gnl|my_center|LOCUS_32870 6952 5537 gene locus_tag LOCUS_32880 6952 5537 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813969.1 protein_id gnl|my_center|LOCUS_32880 10182 7036 gene locus_tag LOCUS_32890 gene mexF2 10182 7036 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947887.1 protein_id gnl|my_center|LOCUS_32890 11521 10307 gene locus_tag LOCUS_32900 11521 10307 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947886.1 protein_id gnl|my_center|LOCUS_32900 12132 11677 gene locus_tag LOCUS_32910 12132 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 >Feature sequence67 416 1291 gene locus_tag LOCUS_32920 416 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 2120 1278 gene locus_tag LOCUS_32930 2120 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774874.1 protein_id gnl|my_center|LOCUS_32930 2319 2540 gene locus_tag LOCUS_32940 2319 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 2541 2924 gene locus_tag LOCUS_32950 2541 2924 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_32950 3000 3449 gene locus_tag LOCUS_32960 3000 3449 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107090.1 protein_id gnl|my_center|LOCUS_32960 3436 3657 gene locus_tag LOCUS_32970 3436 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 4089 4469 gene locus_tag LOCUS_32980 4089 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 4480 5511 gene locus_tag LOCUS_32990 4480 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 5521 7107 gene locus_tag LOCUS_33000 5521 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 7203 7394 gene locus_tag LOCUS_33010 7203 7394 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009915104.1 protein_id gnl|my_center|LOCUS_33010 7415 8215 gene locus_tag LOCUS_33020 7415 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 8221 8586 gene locus_tag LOCUS_33030 8221 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 8546 9757 gene locus_tag LOCUS_33040 8546 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 9783 10343 gene locus_tag LOCUS_33050 9783 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 10343 11002 gene locus_tag LOCUS_33060 10343 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 >Feature sequence68 1538 720 gene locus_tag LOCUS_33070 1538 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33070 1723 1505 gene locus_tag LOCUS_33080 1723 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33080 2938 1745 gene locus_tag LOCUS_33090 2938 1745 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100605.1 protein_id gnl|my_center|LOCUS_33090 3588 3013 gene locus_tag LOCUS_33100 3588 3013 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_33100 4085 3750 gene locus_tag LOCUS_33110 4085 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 4131 4289 gene locus_tag LOCUS_33120 4131 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 4738 4310 gene locus_tag LOCUS_33130 4738 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 6004 5171 gene locus_tag LOCUS_33140 6004 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 6640 6341 gene locus_tag LOCUS_33150 6640 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 7362 6787 gene locus_tag LOCUS_33160 7362 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 7627 7809 gene locus_tag LOCUS_33170 7627 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 8795 7740 gene locus_tag LOCUS_33180 8795 7740 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 protein_id gnl|my_center|LOCUS_33180 9251 8799 gene locus_tag LOCUS_33190 9251 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 10154 9579 gene locus_tag LOCUS_33200 10154 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 10823 10206 gene locus_tag LOCUS_33210 10823 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 >Feature sequence69 1418 321 gene locus_tag LOCUS_33220 1418 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 2215 1415 gene locus_tag LOCUS_33230 2215 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 2615 2893 gene locus_tag LOCUS_33240 2615 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 3413 3180 gene locus_tag LOCUS_33250 3413 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 3782 4786 gene locus_tag LOCUS_33260 3782 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 4860 5528 gene locus_tag LOCUS_33270 4860 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 5768 6073 gene locus_tag LOCUS_33280 5768 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 6074 6394 gene locus_tag LOCUS_33290 6074 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 6541 7371 gene locus_tag LOCUS_33300 6541 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 7545 8270 gene locus_tag LOCUS_33310 7545 8270 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461598.1 protein_id gnl|my_center|LOCUS_33310 8564 8938 gene locus_tag LOCUS_33320 8564 8938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 8935 9537 gene locus_tag LOCUS_33330 8935 9537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 9539 10885 gene locus_tag LOCUS_33340 9539 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082551.1 protein_id gnl|my_center|LOCUS_33340 >Feature sequence70 <1 769 gene locus_tag LOCUS_33350 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002212588.1:transporter 1084 1239 gene locus_tag LOCUS_33360 1084 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 1805 1404 gene locus_tag LOCUS_33370 1805 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 2899 1802 gene locus_tag LOCUS_33380 2899 1802 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035292.1 protein_id gnl|my_center|LOCUS_33380 4227 3139 gene locus_tag LOCUS_33390 4227 3139 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_33390 4341 5060 gene locus_tag LOCUS_33400 4341 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_33400 7109 5067 gene locus_tag LOCUS_33410 7109 5067 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_33410 8051 7119 gene locus_tag LOCUS_33420 gene porP 8051 7119 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_33420 10571 8067 gene locus_tag LOCUS_33430 10571 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 >Feature sequence71 297 461 gene locus_tag LOCUS_33440 297 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 682 2472 gene locus_tag LOCUS_33450 682 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_33450 2503 2811 gene locus_tag LOCUS_33460 2503 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_33460 2985 3845 gene locus_tag LOCUS_33470 gene rsmA 2985 3845 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_33470 3829 5181 gene locus_tag LOCUS_33480 gene mgtE 3829 5181 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_33480 5271 5065 gene locus_tag LOCUS_33490 5271 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 5452 5853 gene locus_tag LOCUS_33500 5452 5853 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_33500 5963 6904 gene locus_tag LOCUS_33510 5963 6904 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_33510 6915 7331 gene locus_tag LOCUS_33520 6915 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 7436 7945 gene locus_tag LOCUS_33530 7436 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 7949 8407 gene locus_tag LOCUS_33540 7949 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_33540 8404 8790 gene locus_tag LOCUS_33550 8404 8790 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_33550 >Feature sequence72 51 335 gene locus_tag LOCUS_33560 51 335 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 protein_id gnl|my_center|LOCUS_33560 459 1091 gene locus_tag LOCUS_33570 459 1091 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963684.1 protein_id gnl|my_center|LOCUS_33570 1075 1737 gene locus_tag LOCUS_33580 1075 1737 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_33580 1734 2267 gene locus_tag LOCUS_33590 1734 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 2327 3778 gene locus_tag LOCUS_33600 2327 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 4117 4932 gene locus_tag LOCUS_33610 gene yneD 4117 4932 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 protein_id gnl|my_center|LOCUS_33610 4944 5747 gene locus_tag LOCUS_33620 4944 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 7221 6094 gene locus_tag LOCUS_33630 7221 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 7725 8183 gene locus_tag LOCUS_33640 7725 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 9014 9301 gene locus_tag LOCUS_33650 9014 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 >Feature sequence73 626 78 gene locus_tag LOCUS_33660 626 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_33660 761 1306 gene locus_tag LOCUS_33670 gene sigM 761 1306 CDS product ECF RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07582 protein_id gnl|my_center|LOCUS_33670 1290 1898 gene locus_tag LOCUS_33680 1290 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 1959 3380 gene locus_tag LOCUS_33690 1959 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 3599 4279 gene locus_tag LOCUS_33700 3599 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 4697 4269 gene locus_tag LOCUS_33710 4697 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 8316 4960 gene locus_tag LOCUS_33720 gene secA 8316 4960 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_33720 8619 8398 gene locus_tag LOCUS_33730 8619 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_33730 9333 8758 gene locus_tag LOCUS_33740 9333 8758 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_33740 9714 9529 gene locus_tag LOCUS_33750 9714 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 >Feature sequence74 502 1293 gene locus_tag LOCUS_33760 gene blaA 502 1293 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK2 protein_id gnl|my_center|LOCUS_33760 1217 1555 gene locus_tag LOCUS_33770 1217 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 1751 2809 gene locus_tag LOCUS_33780 1751 2809 CDS product DUF4917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948270.1 protein_id gnl|my_center|LOCUS_33780 3498 4649 gene locus_tag LOCUS_33790 3498 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 4909 5199 gene locus_tag LOCUS_33800 4909 5199 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201974.1 protein_id gnl|my_center|LOCUS_33800 5201 5491 gene locus_tag LOCUS_33810 5201 5491 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201973.1 protein_id gnl|my_center|LOCUS_33810 5881 5642 gene locus_tag LOCUS_33820 5881 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 7239 6799 gene locus_tag LOCUS_33830 7239 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 7519 7229 gene locus_tag LOCUS_33840 7519 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 8159 7596 gene locus_tag LOCUS_33850 8159 7596 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_33850 8407 9057 gene locus_tag LOCUS_33860 8407 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 9160 9867 gene locus_tag LOCUS_33870 9160 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 >Feature sequence75 84 800 gene locus_tag LOCUS_33880 84 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 >Feature sequence76 699 1328 gene locus_tag LOCUS_33890 699 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 1740 1366 gene locus_tag LOCUS_33900 1740 1366 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206336.1 protein_id gnl|my_center|LOCUS_33900 1834 2379 gene locus_tag LOCUS_33910 gene kefF 1834 2379 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206335.1 protein_id gnl|my_center|LOCUS_33910 2671 2925 gene locus_tag LOCUS_33920 2671 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676042.1 protein_id gnl|my_center|LOCUS_33920 2925 3347 gene locus_tag LOCUS_33930 2925 3347 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_33930 3391 3657 gene locus_tag LOCUS_33940 3391 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 3608 3865 gene locus_tag LOCUS_33950 3608 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 4107 4889 gene locus_tag LOCUS_33960 4107 4889 CDS product endopeptidase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815781.1 protein_id gnl|my_center|LOCUS_33960 5066 6055 gene locus_tag LOCUS_33970 5066 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 6237 6797 gene locus_tag LOCUS_33980 6237 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 6801 7433 gene locus_tag LOCUS_33990 6801 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 7465 8463 gene locus_tag LOCUS_34000 7465 8463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 8740 8525 gene locus_tag LOCUS_34010 8740 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 8836 9045 gene locus_tag LOCUS_34020 8836 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 >Feature sequence77 2 685 gene locus_tag LOCUS_34030 2 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 688 2682 gene locus_tag LOCUS_34040 688 2682 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100979.1 protein_id gnl|my_center|LOCUS_34040 2682 3938 gene locus_tag LOCUS_34050 2682 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 3931 5658 gene locus_tag LOCUS_34060 3931 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 6032 5667 gene locus_tag LOCUS_34070 6032 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 6873 6040 gene locus_tag LOCUS_34080 6873 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 7838 6903 gene locus_tag LOCUS_34090 7838 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 8369 7857 gene locus_tag LOCUS_34100 8369 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 >Feature sequence78 756 4 gene locus_tag LOCUS_34110 756 4 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963684.1 protein_id gnl|my_center|LOCUS_34110 1044 760 gene locus_tag LOCUS_34120 1044 760 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 protein_id gnl|my_center|LOCUS_34120 2190 1339 gene locus_tag LOCUS_34130 2190 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963653.1 protein_id gnl|my_center|LOCUS_34130 2762 2217 gene locus_tag LOCUS_34140 2762 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 5605 3473 gene locus_tag LOCUS_34150 5605 3473 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_34150 5917 5624 gene locus_tag LOCUS_34160 5917 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 6524 5928 gene locus_tag LOCUS_34170 6524 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 >Feature sequence79 761 225 gene locus_tag LOCUS_34180 761 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 1592 777 gene locus_tag LOCUS_34190 1592 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 1990 1625 gene locus_tag LOCUS_34200 1990 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 2843 1983 gene locus_tag LOCUS_34210 2843 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 3467 3084 gene locus_tag LOCUS_34220 3467 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 4599 3451 gene locus_tag LOCUS_34230 4599 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 5225 4827 gene locus_tag LOCUS_34240 5225 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 >Feature sequence80 215 1561 gene locus_tag LOCUS_34250 215 1561 CDS product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482890.1 protein_id gnl|my_center|LOCUS_34250 1564 4266 gene locus_tag LOCUS_34260 1564 4266 CDS product glycosyl hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_34260 4277 5401 gene locus_tag LOCUS_34270 4277 5401 CDS product glycosyl hydrolase family 88 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109151.1 protein_id gnl|my_center|LOCUS_34270 5555 5896 gene locus_tag LOCUS_34280 5555 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 >Feature sequence81 1019 1366 gene locus_tag LOCUS_34290 1019 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 1612 2085 gene locus_tag LOCUS_34300 1612 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 2416 2745 gene locus_tag LOCUS_34310 2416 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 3044 3784 gene locus_tag LOCUS_34320 3044 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 3793 4824 gene locus_tag LOCUS_34330 3793 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 5938 5063 gene locus_tag LOCUS_34340 5938 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence82 766 392 gene locus_tag LOCUS_34350 766 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 2395 1049 gene locus_tag LOCUS_34360 2395 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082551.1 protein_id gnl|my_center|LOCUS_34360 3019 2396 gene locus_tag LOCUS_34370 3019 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 3386 3021 gene locus_tag LOCUS_34380 3386 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 4088 4435 gene locus_tag LOCUS_34390 4088 4435 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_34390 4540 4989 gene locus_tag LOCUS_34400 4540 4989 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107090.1 protein_id gnl|my_center|LOCUS_34400 >Feature sequence83 1915 380 gene locus_tag LOCUS_34410 1915 380 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_34410 3060 1924 gene locus_tag LOCUS_34420 3060 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 3163 4641 gene locus_tag LOCUS_34430 gene proS 3163 4641 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_34430 4721 4793 gene locus_tag LOCUS_t00310 4721 4793 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4827 4899 gene locus_tag LOCUS_t00320 4827 4899 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4934 5182 gene locus_tag LOCUS_34440 gene rpsT 4934 5182 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_34440 >Feature sequence84 1170 808 gene locus_tag LOCUS_34450 1170 808 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_34450 1284 1784 gene locus_tag LOCUS_34460 1284 1784 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962389.1 protein_id gnl|my_center|LOCUS_34460 2332 1781 gene locus_tag LOCUS_34470 2332 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 3481 2339 gene locus_tag LOCUS_34480 3481 2339 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_34480 3982 3488 gene locus_tag LOCUS_34490 3982 3488 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203508.1 protein_id gnl|my_center|LOCUS_34490 >Feature sequence85 555 842 gene locus_tag LOCUS_34500 555 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 1272 2039 gene locus_tag LOCUS_34510 1272 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 2032 3141 gene locus_tag LOCUS_34520 2032 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 >Feature sequence86 408 1238 gene locus_tag LOCUS_34530 408 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 1384 2010 gene locus_tag LOCUS_34540 1384 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 2028 2549 gene locus_tag LOCUS_34550 2028 2549 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627261.1 protein_id gnl|my_center|LOCUS_34550 2546 3109 gene locus_tag LOCUS_34560 2546 3109 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_34560 3167 3592 gene locus_tag LOCUS_34570 3167 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 >Feature sequence87 309 2795 gene locus_tag LOCUS_34580 gene lon 309 2795 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_34580 3467 2928 gene locus_tag LOCUS_34590 3467 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 >Feature sequence88 <1 761 gene locus_tag LOCUS_34600 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202327.1:DNA primase 1196 1537 gene locus_tag LOCUS_34610 1196 1537 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_34610 1614 2063 gene locus_tag LOCUS_34620 1614 2063 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108556.1 protein_id gnl|my_center|LOCUS_34620 2937 2503 gene locus_tag LOCUS_34630 2937 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 3274 2930 gene locus_tag LOCUS_34640 3274 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 >Feature sequence89 204 1127 gene locus_tag LOCUS_34650 204 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 2360 1278 gene locus_tag LOCUS_34660 2360 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 2566 2492 gene locus_tag LOCUS_t00330 2566 2492 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38