COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..474893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 551..952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788667.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(949..2220) product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962593.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene cat2 CDS 2343..3161 product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene map CDS 3168..3950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 3956..4726 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 4743..5111 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(5162..5518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(5556..6416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(6569..8647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(8750..9502) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(9513..12425) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963634.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(12520..13503) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(13546..13920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(13974..14846) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903242.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(14911..17781) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962408.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene fpp2 CDS complement(17940..19253) product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene nqrF CDS complement(19255..19968) product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene nqrE CDS complement(19976..20620) product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene nqrD CDS complement(20623..21417) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene nqrC CDS complement(21420..22634) product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K8 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene nqrB CDS complement(22634..23989) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene nqrA CDS 24147..25397 product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 25486..25872 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene apaG CDS 26016..27644 product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene pruA CDS complement(27728..28060) product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene gldC CDS complement(28060..29022) product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene gldB CDS 29114..29902 product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene nadE CDS 30005..30628 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964170.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(30623..32578) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene dnaG CDS complement(32819..33154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(33337..33660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963820.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(33674..34648) product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(34638..35576) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(35566..36963) product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene speA CDS complement(37384..38433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964174.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(38465..39187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(39174..39734) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(39815..40651) product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 40939..42099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(42177..43217) product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene rlmN CDS complement(43463..44512) product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene queA CDS complement(44598..45830) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW83 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene aroA CDS complement(45867..46193) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(46318..48219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(48305..48496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(48498..48950) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene dtd CDS complement(48951..49901) product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene rsgA CDS 50014..50493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(50548..51630) product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(51684..52538) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene tyrA CDS complement(52535..53674) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene aspC3 CDS complement(53674..54501) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene pheA CDS 54844..55737 product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene gldA CDS complement(55738..56481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(56483..57574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(57633..58511) product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene cysM CDS complement(58508..59254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(59385..60632) product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene cysN CDS complement(60710..61627) product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ4 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene cysD CDS complement(61628..62245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(62242..62508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(62582..62989) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(63016..63972) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU8 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(64126..66831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 note possible pseudo, frameshifted CDS complement(66831..67832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 note possible pseudo, frameshifted CDS complement(67829..68845) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW98 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene metX CDS complement(68847..69299) product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867668.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(69393..70685) product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene metY CDS complement(71160..73739) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8N7 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene ppc CDS 74087..75343 product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene metK CDS complement(75404..76036) product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene rsmG CDS 76171..77265 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 77296..78486 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene aspC1 CDS complement(78543..78737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(78826..79092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(79275..79523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(79616..81121) product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(81121..82470) product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 82590..83318 product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene menG CDS 83318..84043 product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene porT CDS complement(84071..84781) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 84990..87482 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 87597..88664 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene fbaA CDS 88985..89842 product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene accD CDS complement(89890..90552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(90559..91797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 91818..92087 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT6 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene rpsO CDS 92258..94510 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H185 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene pnp CDS 94705..96129 product chitin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726975.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 96412..97218 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180C5 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene proC1 CDS 97221..98000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 98017..99216 product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y156 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene proA CDS complement(99273..99935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 100053..101021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 101239..102102 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene rpoD CDS 102242..102649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 102693..103355 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene rpe CDS complement(103421..103840) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(103921..104802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 105086..105322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(105331..106404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084388.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(106570..107202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(107192..108199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(108200..108820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(108824..109054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975469.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(109732..113229) product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123348.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(113292..113486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(113521..114954) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994768.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(115095..115283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(115292..116788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(116916..118091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(118095..119732) product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene hsdM CDS complement(119737..120894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(120887..123334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(123400..129285) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213431.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(129290..132316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(132393..133427) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(133450..133632) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202676.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(135119..136321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 136625..137323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 137389..137568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 137570..139186 product serine type site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023062934.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 tRNA complement(139139..139213) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(139224..139673) product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(139827..141800) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H191 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene ftsZ CDS complement(141872..143197) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene ftsA CDS complement(143201..143920) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964154.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene ftsQ CDS complement(143910..145262) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene murC CDS complement(145262..146368) product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene murG CDS complement(146423..147631) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene ftsW CDS complement(147676..149013) product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene murD CDS complement(149057..150289) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene mraY CDS complement(150355..151818) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene murE CDS complement(151815..153746) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene ftsI CDS complement(153830..154147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964162.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(154150..155049) product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene rsmH CDS complement(155033..155503) product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene mraZ CDS 155783..156547 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene pcbD CDS 156620..157225 product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene engB CDS complement(157312..158160) product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962486.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(158237..159142) product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(159288..160217) product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene mvaK CDS complement(160245..161327) product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene mvaD CDS 161536..162096 product putative HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44923 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(162093..162626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(162628..163839) product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(163836..164522) product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene glpQ CDS 164608..165414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(165409..166695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(166706..170371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 170472..171737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(171734..174115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(174254..175675) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(175736..177412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(177420..180896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(180939..182858) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(182879..185185) product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(185247..185903) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene pgmB2 CDS complement(185907..187280) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(187412..188452) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 188763..191843 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 191850..193397 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 193413..194789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 194865..197783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 197976..198431 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene rplM CDS 198431..198817 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU3 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene rpsI CDS 198998..199768 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene rpsB CDS 199856..200815 product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKH3 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene tsf CDS 200935..201528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 201776..202483 product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene pyrH CDS 202555..203112 product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene frr CDS 203194..203928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 203975..205201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 205264..207678 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 207715..209145 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene asnS CDS 209270..210730 product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene rpoN CDS 210862..211419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(211414..212115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(212239..212709) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(212720..213328) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(213331..213774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(213809..214588) product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 tRNA complement(214732..214820) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(214891..215922) product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene ansA CDS complement(215931..216698) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(216777..217532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(217537..218118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 218261..218761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 218823..219806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 219976..221928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 221959..224532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 224516..224968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 225029..225670 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869549.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(226531..227781) product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene sucB CDS complement(227807..228181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(228199..230955) product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene sucA CDS 231072..231617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964495.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 231715..232206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(232232..232582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964494.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(232592..233566) product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 233694..234302 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 234302..235609 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 235635..236804 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 236817..240329 product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 240424..242178 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene aspS CDS 242225..244006 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 244050..244289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(244429..244878) product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene tadA CDS 244939..246708 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWC0 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene dxs CDS complement(246750..247460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(247467..251402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(251587..252930) product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene dgt CDS 253133..255937 product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 255982..257151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764295.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(257215..257592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962526.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 257965..259167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 259245..261530 product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A666 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 261812..262666 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(262724..263470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(263470..263976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(264105..266585) product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene nrdA CDS complement(266800..267780) product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene nrdB CDS complement(268532..269101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 269256..269837 product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(269818..270057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 270064..270669 product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962631.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(270666..272258) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(272258..272689) product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(272807..273397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 273556..274527 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene manA CDS 274536..275546 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 tRNA complement(275641..275721) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 275866..276807 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene prsA CDS 276860..277495 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene rplY CDS 277573..278208 product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene pth CDS complement(278262..281249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 281434..284172 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962408.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene fpp2 CDS 284254..285168 product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene ribF CDS 285398..286477 product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 286599..287876 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene serS CDS 288355..290094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 290099..290611 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 290615..290938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 290969..291766 product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene rsmA CDS 291771..293144 product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene mgtE CDS 293296..294234 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 294260..294721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 294718..295107 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 295159..295701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 295810..296142 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(296146..297180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(297173..298990) product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(299034..300284) product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene lysC CDS complement(300285..300764) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 300883..301890 product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWD9 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene fbp CDS 301940..302296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 302312..303130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 303117..303608 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 303623..305143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(305194..305625) product fructose 1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962635.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 305861..309229 product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene mfd CDS 309309..310607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(310678..311037) product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(311037..312044) product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 312117..314165 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene metG CDS 314193..315620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 315762..316232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 316238..316945 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963625.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene yiaD CDS 317033..319153 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964572.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(319211..319747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(319805..320149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 320279..321184 product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326200.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 321218..322051 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107849.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 322185..322352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 322379..322927 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULD6 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene mip CDS 322956..323345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(323350..324105) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(324083..324895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(324877..325503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(325512..326060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(326125..326718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(326800..327672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(327752..329515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(329775..330152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(330217..331578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(331618..334425) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 334566..335660 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(335716..336150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(336260..337930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(337943..340474) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(340643..342286) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ0 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene pgi CDS complement(342286..343605) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(343563..344486) product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(344494..345276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(345421..346584) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene hppD CDS complement(346725..347885) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene hmgA CDS complement(348223..350454) product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(350451..352244) product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene uvrC CDS 352393..352815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 352816..353694 product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JS5 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene rimK CDS 353698..354666 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 354673..355236 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene ygfA CDS complement(355233..355859) product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene lspA CDS complement(355883..356509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(356586..356969) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene dksA CDS complement(356974..360381) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene ileS CDS complement(360497..363397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(363425..364360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(364275..369164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 note possible pseudo, frameshifted CDS complement(369567..370928) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene radA CDS complement(370932..372077) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962284.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(372114..373019) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(373071..373421) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene panD CDS complement(373435..374283) product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene panC CDS 374355..375203 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 375278..376867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962289.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 376874..378721 product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene glmS CDS 378920..381697 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 381703..383304 product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 383481..384989 product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene atpD CDS 385007..385285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(385357..385797) product SOS-response transcriptional regulator UmuD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202621.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 386178..386753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 386762..388180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(388238..388444) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(388583..388954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 389103..389516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 389528..390055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(390052..391557) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene mocR CDS 391635..393455 product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207616.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene btuB CDS 393524..394393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525382.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 394395..394889 product OmpA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962318.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(394952..395425) product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene recX CDS 395531..400525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 400644..403127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(403169..405598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(405582..406304) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene recO CDS complement(406304..408625) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(408812..410155) product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene gdhA CDS 410381..411190 product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962446.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(411261..412400) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 412534..413217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(413214..413669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 413758..414240 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971326.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 414306..414662 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 414688..415548 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(415529..416008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 416138..416986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 417065..417652 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene gmk CDS 417686..418264 product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene nadD CDS 418330..418836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 418850..419071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 419091..419264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(419323..419817) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(419994..420944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 421076..422077 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene gpsA CDS complement(422284..422679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(422745..423101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963615.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(423120..425312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(425323..425808) product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202123.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(425815..427278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(427291..428199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963614.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 428292..430433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 430445..431548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(431635..432237) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(432256..433674) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(433679..436816) product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(436839..437978) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(437983..438483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(438616..439635) product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene pheS CDS complement(439778..440134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 440186..440731 product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962305.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(440735..441361) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene cynT CDS complement(441373..443235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(443340..443972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(444045..444671) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(444699..445502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(445513..447102) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(447179..447463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(447525..448280) product BatE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene batE CDS complement(448352..450136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene batD CDS complement(450163..451002) product BatC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962308.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene batC CDS complement(451060..452097) product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene batB CDS complement(452187..453191) product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene batA CDS complement(453191..454864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(454893..455759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(455818..456819) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 456980..457855 product putative oxidoreductase YcsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42972 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene ycsN CDS 457908..458657 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 458661..459791 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962316.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(459996..460640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(460656..461600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(461786..463339) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene pcd CDS 463595..469171 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 469212..469685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(469706..471511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 471678..474029 product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene pbpC sequence02 source 1..427041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 115..306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 307..624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 633..1424 product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 1424..1615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 1647..2870 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765689.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 2882..3367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 3572..6445 product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 6499..7638 product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(7695..8171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(8354..9973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 10134..13022 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(13023..13862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(13919..14764) product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 14947..16008 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene aroC CDS 16047..16625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 16663..17985 product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene gltP CDS 18040..19194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(19476..19892) product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene yuxK CDS 19933..20391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(20555..22729) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG0 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(23157..23531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(23558..23791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(23912..25705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(26050..26760) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836846.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(26757..27356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(27483..28976) product C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253926.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 29160..29825 product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene ung2 CDS complement(30303..30749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(30877..31731) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(31733..32602) product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene udp CDS complement(32603..33556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(33534..33860) product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963176.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(33934..34881) product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 35007..37013 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene bfmBA CDS 37077..37844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(37846..39228) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(39231..40445) product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(40588..42255) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(42248..42934) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(43030..44274) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene mscS2 CDS complement(44348..44935) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H133 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(44925..47231) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(47385..48047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(48149..48595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(48592..49155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(49236..50048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 50158..51711 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 51801..52916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(52981..53283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 53408..56233 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 56482..56730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 56734..57165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 57235..58098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 58285..58791 product thioredoxin peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 58927..60324 product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958071.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 60598..62280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339589.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 62273..63697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 63742..65001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 65138..65329 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene cspC CDS complement(65524..66321) product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268356.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(66443..67600) product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962321.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(67620..68615) product putative NADP-dependent oxidoreductase YfmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34812 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene yfmJ CDS complement(68640..69320) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(69289..69954) product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680175.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(69956..70540) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(70657..71958) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(72289..72936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 73200..73940 product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(73948..74844) product transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790194.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 75023..76537 product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54417 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene opuD CDS 76539..77168 product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 77389..78048 product oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028480.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 78069..79076 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103266.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 79374..79850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 80014..80847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 80967..81833 product transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790194.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 81963..82808 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731540.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 82893..84047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 84268..85251 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 85474..86280 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 86366..86986 product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FS8 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 87037..87633 product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 87637..89529 product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943387.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene kefB CDS 89529..90410 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 90531..90896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 90990..91187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 91195..91572 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902347.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 91665..92516 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 92713..93861 product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088458.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 93865..94812 product histidine N-alpha-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5M8 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene egtD CDS 94809..95465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(95500..96399) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 96881..98692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(98789..99430) product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWR9 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene thiE CDS 99659..100669 product luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524633.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 100725..101771 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(101899..102762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 103066..104406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 104557..104721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 104845..105120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(105124..105486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 105585..106823 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 106940..107539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(107734..109056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 109271..110248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 110249..110947 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 111189..112085 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 112301..113317 product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 113421..116543 product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478455.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 116635..117912 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766603.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 117925..118524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(119120..120193) product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene paaE CDS complement(120193..121389) product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140959.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(121401..121727) product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198610.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(121740..122135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(122198..122437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(122439..122702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(122706..123014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 123174..123563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 123573..124736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 124744..125106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 125123..125665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 125643..126032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 126040..126891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(126930..127508) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762221.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(128388..129260) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262934.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(129340..130008) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(130020..131042) product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(131170..131934) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(131987..133288) product hexuronate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039188.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene exuT CDS complement(133428..134129) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(134272..135177) product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225953.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(135214..136071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(136085..137515) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(137536..138840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(139081..139335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(139350..139730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(139926..141236) product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(141240..142580) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(142758..143354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(143540..144271) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(144275..145309) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(145317..146537) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(146540..147283) product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(147289..148497) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(148509..149828) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786913.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(150023..151081) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198300.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(151084..151509) product osmotically inducible protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene osmC CDS complement(151536..152567) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(152715..153293) product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704887.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(153430..154311) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789633.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(154322..155806) product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118829.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene uxuB CDS complement(155820..156548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 156472..156795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(156808..158331) product ribose import ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E343 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene rbsA CDS complement(158350..159414) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975981.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(159504..160406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 160637..161374 product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787639.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(161455..161910) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292665.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(162115..163035) product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 163126..163398 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene ydzA CDS complement(163427..163816) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963098.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 163936..164352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 164361..164807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(164804..165475) product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(165601..165741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(165765..165965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(166066..166218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(166266..167171) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(167218..167721) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(167897..168676) product tRNA pseudouridine synthase A 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HNW5 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene truA2 CDS 168768..169184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 169247..170044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 170140..171384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(171484..172086) product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene hisIE CDS complement(172539..173294) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene hisF CDS complement(173427..174176) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene hisA CDS complement(174256..174837) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY77 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene hisH CDS complement(174837..175976) product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene hisB CDS complement(176024..177058) product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY79 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene hisC CDS complement(177303..178586) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY80 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene hisD CDS complement(178586..179443) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY81 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene hisG CDS complement(179731..180543) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858687.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(180557..182590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(182591..183136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(183176..183922) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(184086..187055) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963047.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(187162..188034) product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene sucD CDS complement(188131..188523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963120.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(188524..189459) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(189471..190037) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene efp CDS complement(190061..190846) product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene lpxA CDS complement(190857..192263) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene fabZ CDS complement(192250..193278) product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene lpxD CDS complement(193304..194533) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 194571..196124 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene porX CDS 196151..196564 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 196734..196877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 197134..197364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 197402..197545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 197599..198798 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene ald CDS 198821..199204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963214.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(199201..200376) product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene putA CDS 200471..201535 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene aroB CDS 201577..201936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963820.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(201939..202454) product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(202537..203016) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(203090..204232) product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 204540..204977 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 205234..205608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962882.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 205612..206397 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(206459..207499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 207708..208562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(208559..211243) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene parC CDS complement(211244..213103) product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene parE CDS complement(213207..213617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(213757..214851) product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC6 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene engD CDS 215080..217890 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962806.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 218001..218744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(218808..219161) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene fdx1 CDS 219240..220301 product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 220409..221470 product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene serC CDS 221482..222438 product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene serA CDS 222561..223196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962799.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 223330..223728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 223765..224256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 224257..224586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 224704..227016 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 227034..227627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 227771..228508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 228650..229720 product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene gcvT CDS 229730..230644 product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEA1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene glsA CDS 230660..231490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 231514..231807 product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VD93 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 231897..232625 product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(232695..233150) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 233186..233836 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene nth CDS 233879..234424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(234447..234602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(234658..235248) product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 235468..238257 product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene uvrA1 CDS complement(238281..239252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 239699..240346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 240521..241633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(241712..243163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963503.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(243185..244471) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(244508..246946) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(246977..247228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963907.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 247348..248409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963908.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 248425..249543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene yghO CDS complement(249708..250967) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(251152..252192) product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963027.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(252265..254331) product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene ptrB CDS 254471..254785 product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY02 transl_table 11 codon_start 1 locus_tag LOCUS_06480 repeat_region 255629..255942 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttagttacagcaggaatatcaataactcttgttgttg CDS complement(257302..258321) product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene ltaE CDS 258579..259532 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene prfB CDS 259535..259876 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 259917..260294 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 260381..262801 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(262949..263122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963717.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(263263..263775) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071263.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 263907..264212 product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436216.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 264362..265759 product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene fumC CDS complement(265913..266503) product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764900.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 266661..267896 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene hutI CDS complement(267997..268881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963809.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 268976..270004 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963810.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 269997..270287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 270290..270766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(270820..271869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(272112..273875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(273948..274484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(274554..275789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969905.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(275835..276419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(276409..278370) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066525.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(278505..279566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(279627..279824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(279981..281321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 281491..282270 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 282312..282491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 282494..282682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 282724..282927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(282991..284682) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(284712..284894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963197.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(284992..285708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(285721..286161) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(286186..286716) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 286919..288547 product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 288552..290537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765626.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 290568..291419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 291412..292296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(292382..294523) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962713.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene yfbK CDS complement(294618..295676) product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene menE CDS complement(295680..296843) product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene yyaK CDS complement(296847..297881) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene menC CDS 297939..298730 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(298731..299633) product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW2 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene menA CDS complement(299637..300476) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene menB CDS 300778..301221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 301401..301832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(301816..302655) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(302727..303068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963785.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(303187..304938) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene menD CDS complement(304981..306096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene menF CDS complement(306100..306525) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 306569..307147 product GCN5 family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962847.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(307137..308363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(308527..309000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(309010..309957) product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(310161..312056) product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene dnaK CDS 312236..313657 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene sdaA CDS complement(313662..314114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404629.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 314223..315041 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene panB CDS 315089..315784 product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 315929..317299 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY15 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene aldH CDS complement(317310..318131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(318132..318833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(318834..319541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(319551..320051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(320172..320888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(320894..321253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(321324..322859) product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(322907..324784) product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene gaa CDS 325064..325591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(325581..325745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(325849..326772) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(326938..328560) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI0 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene ade CDS complement(328616..331021) product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene dsbD CDS complement(331021..332358) product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene tilS CDS complement(332376..332729) product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(332821..334131) product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene pabB CDS 334208..335098 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966313.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 335141..336490 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene rhlE CDS complement(336543..337034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(337188..338588) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene lpdA1 CDS complement(338855..339625) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765472.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(339675..340133) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 340297..341511 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 341806..343278 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 343420..344064 product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 344071..344379 product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 344461..344718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 344849..345952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 346192..347145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(347256..347882) product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189288.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 347990..348871 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095817.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 348949..350184 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene mauG CDS 350186..351490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 351550..352101 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943336.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 352124..353014 product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229550.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 353210..353785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 353959..354432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 354597..355910 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 355990..357105 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140568.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 357210..357644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(357650..357862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 357747..358844 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 358841..359593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 359598..360320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 360371..361204 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963867.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 361413..362915 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene aldA CDS 363113..364114 product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(364188..364775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113351.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 364862..365767 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962922.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(365803..366273) product ankyrin repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(366448..368679) product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C4 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene katG CDS complement(368797..368976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 368894..369400 product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZY8 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene tpx CDS 369393..369761 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963705.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene dgkA CDS 369822..372245 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene ftsK CDS 372258..372893 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene lolA CDS 372969..375062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 375113..376267 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene ribBA CDS complement(376340..380080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583095.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(380121..381314) product 8-amino-3,8-dideoxy-alpha-D-manno-octulosonate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene kdnA CDS complement(381422..381889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(381957..382628) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 tRNA 382796..382881 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(383015..383758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(384015..385391) product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene xylE CDS 385600..386370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(386436..386900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(386906..387814) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(387822..388118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(388121..389011) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(389012..389245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(389307..389981) product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY43 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene lolD CDS complement(389984..391246) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963073.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene lolC CDS complement(391246..392259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(392322..392705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 392838..393974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 393974..395023 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 395113..395955 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene uspA CDS 395964..396725 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768801.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 396806..398368 product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 398739..399248 product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM41 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene msrA CDS 399284..399724 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 399717..400133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118347.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(400226..400879) product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene tal CDS complement(401163..401963) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 402300..403337 product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 403477..404199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 404227..404610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 404682..406235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 406629..407249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(407317..408591) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene glyA CDS 408736..410028 product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene fahA CDS 410147..411328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963930.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(411594..412196) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082103.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(412207..412476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(412521..412823) product putative HTH-type transcriptional regulator YbzH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S9 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene ybzH CDS complement(413169..413735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(413783..414349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(414357..415064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(415306..415986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(416032..416415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(416503..417114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(417171..418928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119876.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(419194..420849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(421051..421608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(421768..422595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(422758..423279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(423475..423954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(424097..424789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(424982..425455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(425631..426932) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920961.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 sequence03 source 1..313082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(487..735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(725..1543) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene murQ CDS complement(1649..2461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(2468..4879) product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(5038..7263) product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706412.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(7418..7990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(8660..9013) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene rplS CDS complement(9171..9848) product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene trmD CDS complement(9992..11695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(11807..14335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(14434..15513) product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I04 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene corA CDS complement(15523..16053) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071240.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(16086..16994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(17025..17618) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(17622..18533) product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(18554..18865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(18872..19402) product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene kdsC CDS complement(19392..20150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 20210..20620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 20706..23927 product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene ccsBA CDS complement(24007..24849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 25092..25280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 25388..25834 product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1X9 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene mscL CDS 25838..25987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(26018..26389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 26530..27684 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 27715..28608 product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHV5 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene rlmF CDS 28612..29328 product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 tRNA 29407..29481 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(29633..31192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(31502..31831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(31836..32627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 32759..33169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 33238..33969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 33972..36206 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 36219..36575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(36651..38033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 38233..39852 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 40040..40621 product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528503.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(40686..40916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(40999..41196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(41207..41404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(41417..41617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(41620..44049) product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene pheT CDS 44297..44497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 44502..45236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 45344..46552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(46572..47492) product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YX1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(47569..48453) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359341.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(48541..49122) product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene miaE CDS complement(49299..50375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(50379..52481) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene recG CDS 53151..55247 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963153.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 55249..56166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(56239..56757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(56912..58465) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene gltB2 CDS 58669..60237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 60317..62650 product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene uvrD CDS 62668..63288 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(63424..64284) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(64525..65508) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(65561..66010) product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 66081..67085 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene holA CDS 67113..67478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 67642..68202 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528771.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(68269..68739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(68740..69003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 69198..70028 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(70108..72519) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(72673..75501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962879.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(75498..76763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(76772..77461) product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(77534..80416) product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX6 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene uvrA2 CDS 80495..80899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(81093..81806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(81845..83524) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene ggt CDS complement(83521..84120) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 84236..85231 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083056.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 85228..86616 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 86643..88142 product selenocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(88228..89118) product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 89182..89817 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(89814..90326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 90391..91782 product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene mnmE CDS 91815..92174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 92433..93824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 93858..96386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 96463..96843 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545378.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 96850..101334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 101520..101942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 101949..102365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 102434..104395 product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962777.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 104398..105846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 105908..107374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 107610..108374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 108556..108897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 108916..110010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 note possible pseudo, internal stop codon CDS 110020..111348 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148522.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene zraR CDS 111536..111700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 111876..113180 product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEM0 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 113197..113616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 113628..114047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 114051..114437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 114513..115343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(115500..115652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 115594..118359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 118627..121641 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 121645..123111 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 123122..125134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 125183..126814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 126817..129117 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 129114..129923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(130012..130746) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 130798..133170 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene ccoI CDS 133353..133556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 133559..135754 product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene ccoN/ccoO CDS 135761..135952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 135949..136911 product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene ccoP CDS 136922..138346 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene ccoG CDS 138359..138805 product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene ccoH CDS 138805..139506 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 139633..140457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(140483..141118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(141120..141563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(141823..143196) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(143201..144046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423269.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(144050..144883) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene uspA CDS complement(145020..145856) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene uspA CDS complement(145943..147307) product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene hemN CDS complement(147393..148052) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962785.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 148215..148928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 148972..149604 product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257162.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 149669..150463 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 150633..152048 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 152275..152544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 152648..153553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 153565..153861 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 153861..154442 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene tpm CDS 154541..154690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(154770..156821) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880310.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene oprC CDS complement(156932..157351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 157496..158218 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 158291..159637 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 159751..161082 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545853.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 161085..162158 product cytochrome oxidase d subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880873.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene cydB CDS 162174..162470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(162539..163144) product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene pncA CDS complement(163198..164595) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CS0 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(164646..165644) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 165778..167085 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963918.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 167197..168273 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963917.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 168503..171697 product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963916.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 171866..172075 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963915.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 172169..172723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 172725..173138 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 173225..173563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074087.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(173648..174025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(174188..175306) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene dnaN CDS complement(175392..177059) product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene gldG CDS complement(177052..177537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(177539..178252) product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene gldF CDS complement(178280..178576) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene fjo15 CDS complement(178619..179452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene fjo14 CDS 179561..180514 product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene phoH CDS 180566..181513 product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene purC CDS complement(181584..182126) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110142.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(182159..182842) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene chd1 CDS complement(182862..183278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(183289..183951) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123699.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(183979..184635) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(184687..185358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(185362..185676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(185771..186322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(186397..186960) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226768.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(187046..188077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 188199..189575 product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(189572..190492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 190666..192165 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene aldA CDS 192235..192588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701719.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 192747..193166 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362005.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 193273..194520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 194533..194793 product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 194825..196591 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(196701..196913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 196946..199636 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 199653..200018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 200090..200308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 200311..202206 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881100.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 202435..204342 product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene acsA CDS 204679..206388 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921318.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 206427..206999 product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766588.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 207058..207792 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 207979..209613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 209617..210282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 210843..211604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(211633..213534) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963092.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 213656..213919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 214052..214708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 note possible pseudo, internal stop codon CDS complement(214705..216546) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(216588..218084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962728.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 218360..218992 product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ63 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(218999..220210) product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257181.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 220426..223296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 223297..224556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(224546..227389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(227489..228388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 228667..230277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 230402..233455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 233614..236187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(236274..237815) product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene pccB CDS complement(237867..239309) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene accC CDS complement(239311..239796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(239878..240552) product protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584036.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(240562..241113) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(241193..242281) product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 242402..243073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 243084..243710 product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(243741..244610) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 244705..245085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(245082..245510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(245585..246256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(246265..246996) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 247166..248329 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 248329..249963 product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112847.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(249964..250719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(250685..251203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(251216..252628) product tRNA (uracil-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene trmA CDS 252813..254093 product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene rocD CDS complement(254163..255959) product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962777.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 256169..256378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 256378..256938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(256935..257891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 258004..259143 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 259182..259973 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(260025..260393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(260510..262195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(262207..263106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(263108..265573) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(265585..267186) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 267449..267739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963282.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 267755..268048 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 268286..269857 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene rny CDS complement(269888..271027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(271193..272326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(272441..273367) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene xerD CDS 273525..274145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 274599..275189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 275270..275686 product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene aroQ CDS 275887..276525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402867.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(276616..277992) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene lpdA2 CDS 278111..279400 product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene ndh CDS complement(279390..279917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(279910..280305) product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963829.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene mrsB2 CDS complement(280298..280783) product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088596.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 280919..282328 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E079 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene glgA CDS 282331..283596 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene glgC CDS 283600..285510 product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHB1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene glgB CDS 285696..288101 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 288231..289064 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 289150..290454 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 290487..291317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(291391..292125) product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107567.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(292148..293230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(293214..293759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(293765..294283) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005346.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 294613..297060 product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene lon CDS 297044..297565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 297610..298587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 298643..299665 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene porQ CDS 299772..300470 product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene cmk CDS complement(300544..300924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 301309..303141 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963900.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene rpsA CDS 303563..304294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 304424..304963 product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene pyrR1 CDS 304968..305897 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene pyrB CDS 305900..306232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963901.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 306290..307195 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene rnz CDS 307336..307983 product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene pdxH CDS 308216..308635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965528.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(309100..311046) product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(311048..311902) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 misc_feature complement(312005..>313082) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin locus_tag LOCUS_11000 sequence04 source 1..278398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(141..3098) product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0S8 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(3098..4312) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBE5 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene dinB CDS 4365..5138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 5135..6466 product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 6607..11607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016091.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 11727..12140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 12274..12789 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368364.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 12950..13570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 13695..14024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(14168..14596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(14653..15327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(15367..16428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 16916..19402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 19406..20062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 20062..22305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 22333..24300 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 24307..24942 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(24967..25959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 26110..26505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(26659..27087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 27531..32210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 32389..37041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 37286..42655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(42915..44285) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H160 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene hisS CDS complement(44406..44873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(44879..45817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(45905..49021) product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(49151..49594) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene rplI CDS complement(49608..49904) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene rpsR CDS complement(49907..50245) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene rpsF CDS 50458..51153 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(51228..53681) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene priA CDS complement(53711..54130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(54133..55062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene yfkH CDS complement(55099..55959) product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene nadC CDS 56158..56934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 56966..57439 product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene rlmH CDS 57473..58048 product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 58367..60244 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 60359..61204 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(61284..61943) product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene trmH CDS complement(62006..62833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 62939..63610 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene npdA CDS 63613..64539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962217.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 64657..65664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089839.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(65665..67302) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962719.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 67724..68290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 68325..68513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 68639..69085 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(69186..70436) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(70463..70936) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 70972..71535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963491.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 71629..72972 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene purB CDS 72974..73177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(73257..73799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(73804..74370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963571.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(74395..74871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963572.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(74858..75367) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 75477..76913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 76931..77656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(77754..78806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963574.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(78830..80665) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963575.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(80937..81116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 81049..82260 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 82323..83288 product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 83290..84084 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 84413..85798 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene rmuC CDS 85811..86176 product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 86179..86430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 86430..86984 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(87036..87665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(87731..90583) product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene carB CDS complement(90685..90846) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H127 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene rpmH CDS 91058..91636 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(91696..93153) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CT1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene cls CDS complement(93154..94083) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(94135..94794) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 94919..95215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 95438..97057 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(97074..97322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 97321..97485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(97580..97777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(97780..98502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(98613..99788) product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(99933..100184) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene rpmE CDS 100345..100875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963274.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 100912..101865 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 101937..103664 product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 103669..105507 product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene msbA CDS 105778..106323 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 106357..106839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 106851..107300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(107431..108528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(108807..109949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(109974..110507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(110662..111024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(111082..111543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(111546..111860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(111895..112473) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 112642..113853 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene rsmB CDS 113974..115812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 115977..119675 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXH5 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene purL CDS 119745..120551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 120815..122584 product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene fadD CDS 122725..123180 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 123182..125590 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 125595..126785 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 126823..127185 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 127229..129037 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 129130..129876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 129880..131529 product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 131532..132104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 132162..133373 product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(133429..134895) product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(134958..136085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 136248..139394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 139466..140098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 140165..140728 product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D0 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene sodC CDS 140814..141341 product RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027940.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 141343..142140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(142709..144937) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene nicT CDS complement(144948..146192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(146329..146895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(146922..147569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 147726..148907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(148911..149666) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(149726..150073) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877331.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(150085..151431) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(151434..152060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963764.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 152326..154170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 154210..154716 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963327.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 gene dnaQ CDS complement(154731..155018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(155184..157337) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 157606..158100 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 158104..158736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964037.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 158736..159197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(159209..160012) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(160060..160815) product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 160709..161395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 161537..163594 product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 163702..164067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 164175..164501 product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(164498..165100) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 165294..166541 product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 166645..167112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 167250..167669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(167695..168351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088253.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(168475..168954) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 169059..170000 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene oxyR CDS complement(170030..171016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(170994..172040) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(172103..172906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962739.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(172977..173303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(173462..173659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(173807..174637) product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201260.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(174698..175153) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 175298..175744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962834.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 175812..176156 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 176149..177999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 178200..179024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962838.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(179113..180096) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene trxB1 CDS 180275..180658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(180966..182042) product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247147.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(182051..182485) product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762486.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(182508..182711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(182711..183058) product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964582.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(183059..183385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964581.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 183568..184932 product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958071.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 184942..185094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 185184..185669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 tRNA complement(185702..185779) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 186105..186713 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene udk CDS 186776..187021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 187014..188336 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963259.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene mutA CDS 188351..189034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 189094..191217 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene mutB CDS 191224..191814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 192107..192871 product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene parA CDS 192875..193783 product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene parB CDS 193773..194414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 194429..195133 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene dapB CDS 195209..196900 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene lepB CDS 196927..197544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 197545..197856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(197895..198911) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(198928..199785) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963287.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(199788..200615) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(200619..202469) product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene mutL CDS complement(202474..202755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(202765..202983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(203075..203554) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene ribH CDS complement(203563..204333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 204467..205546 product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene recF CDS 205527..205961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 205961..206257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 206368..206559 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene cspC CDS 206728..206919 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene cspC CDS complement(207075..207494) product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene ndk CDS 207637..208656 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene fjo19 CDS 208646..209191 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T4 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene gldI CDS 209211..210419 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963995.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene ppiA CDS complement(211128..211901) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(212010..212432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(212538..213131) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene def CDS complement(213141..213551) product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 213654..214469 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene dapD CDS complement(214545..214901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 215029..215292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 215408..216487 product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016813.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(216484..217305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 217350..218087 product beta 1,4 glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene lgtF CDS 218087..218308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(218305..219003) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017012.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 219105..219851 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(219848..220645) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(220647..221546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 221639..222529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(222519..223739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(223743..224624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 224656..225228 product translation factor Sua5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 225236..226651 product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene cca CDS 226657..227109 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 227133..228149 product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H039 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene ctaA CDS 228189..228707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(228704..229777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 229861..230769 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(230770..231036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 231035..231613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 231696..235037 product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964399.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 235041..237401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 237435..239273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 239449..244215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 244275..246605 product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963773.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 246908..248911 product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY25 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene uvrB CDS complement(248948..249349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963055.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 249783..250115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963057.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(250211..251401) product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene sucC CDS 251596..252807 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 253047..254540 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288614.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(254559..254933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(254948..255469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(255546..256943) product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(257166..258044) product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962727.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(258051..259214) product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(259214..260098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(260129..261058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(261067..262380) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene natB CDS complement(262383..263306) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene natA CDS complement(263632..264753) product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene dnaJ CDS complement(264761..265318) product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene grpE CDS 265485..266135 product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene yceI CDS 266174..266635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(266639..267304) product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX22 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene vanA CDS 267349..267708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281604.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 267712..268305 product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 268686..269615 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682158.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 270042..271349 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 271400..272098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963060.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 tRNA complement(272210..272284) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(272344..272613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963895.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(272708..273118) product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene ygcM CDS complement(273096..273638) product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene idi CDS complement(273759..275672) product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(275692..276624) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 misc_feature complement(276691..>278398) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362020.1:protein of unknown function precursor; adhesin locus_tag LOCUS_13630 sequence05 source 1..248510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 367..1290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707324.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 1436..2146 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 2228..2956 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009901.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 3216..4151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(4203..4673) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(4889..6253) product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 6332..6724 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 6799..8415 product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816Q7 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene pckA CDS complement(8493..9242) product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(9260..9910) product DUF4271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962358.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 10019..10744 product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962342.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 10747..12093 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene pyrC1 CDS 12096..12524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(12487..13506) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 13594..14904 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene tyrS CDS complement(15052..16032) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(16112..17011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(17105..18811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 19179..19862 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene phoP CDS 19936..20910 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene phoR CDS complement(20879..21934) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 22121..22795 product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene trmB CDS 22799..23428 product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962540.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 23433..23768 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene ogt2 CDS 23818..24666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 24920..26059 product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene mrp CDS 26060..26296 product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 26495..27547 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 27815..28147 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(28346..29242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(29455..29643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 30039..31064 product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107718.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 31137..32252 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56872 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene gmd CDS 32288..33250 product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene fcl CDS 33265..34701 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene ugd CDS 34705..35940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 35937..37064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 37054..37998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 37988..39052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 39049..40041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 40180..41379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 41382..42530 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345307.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 42527..43078 product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 43071..43910 product alpha-L-glycero-D-manno-heptose beta-1,4-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942894.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 43924..44679 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208589.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene wbyL CDS 44802..44981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 45039..45824 product polysaccharide export outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766005.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 45832..48192 product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107290.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 48281..48832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(49097..50275) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene gcdH CDS complement(51131..51844) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI6 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(52088..52636) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene rimM CDS complement(52687..53190) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI4 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene rpsP CDS 53334..54026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 54203..54667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 54818..59209 product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene dnaE CDS 59407..59724 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 59877..60422 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW2 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene clpP CDS 60422..61351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 tRNA 61429..61503 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 61926..62105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 62219..64228 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 64232..64909 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(65157..65654) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962389.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 65780..66139 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 66142..67428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 67429..68568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 68719..69402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 69494..69937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962388.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(69947..70684) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(70686..71558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(71618..72751) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(72745..73719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962386.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 73769..74398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 74399..74953 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene ruvC CDS 75064..76116 product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 76119..76868 product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 76869..77477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 77749..78114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 78195..78503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 78625..79038 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 79042..79581 product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262973.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene hnoX CDS 79581..81539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 81542..82675 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963163.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 82675..83739 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963164.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 83726..84043 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963165.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 84056..84769 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 84994..85488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 85614..88229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(88391..88801) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(88788..90302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 90710..91993 product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(91998..94058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963167.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 94211..94489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 94518..95762 product sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963088.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 96073..97320 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963087.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(97466..98980) product glycosyl hydrolase family 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963086.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(98974..100191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963085.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(100191..103280) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963084.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 103460..104644 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963083.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 104665..105159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 105170..106171 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene manA CDS 106236..106814 product PhnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene phnA CDS complement(106868..107968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(108111..109676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 109822..109989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(110075..110440) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761500.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(110881..111771) product EamA/RhaT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021671.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(111868..113256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 tRNA 113371..113453 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(113475..114833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(115004..116437) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(116491..117183) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(117180..118016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(118018..119607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(119620..120924) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812847.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 121123..121842 product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 121884..122747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 122819..123820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 123821..125074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 125111..125869 product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene pphA CDS complement(125882..126577) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(126610..127572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(127569..128450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(128507..129319) product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH2 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene deoD CDS complement(129300..129920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(129927..130439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(130444..131271) product metallophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(131256..132590) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943755.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(132594..134039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(134050..137244) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(137286..137972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(138012..139067) product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(139124..139459) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(139547..140443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 140523..141764 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 141770..142549 product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104656.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 142591..143598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 143595..144080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(144077..144451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(144575..146899) product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene xdhB CDS complement(146892..148301) product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972218.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene xdhA CDS complement(148473..148946) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34598 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene guaD tRNA complement(149074..149149) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 149338..150069 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B4 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene coaX CDS 150066..151358 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 151378..152715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 152715..153269 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 153331..153516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964519.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 153577..154806 product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 154940..157081 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(157147..158052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(158052..159350) product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene mvaA CDS 159534..161681 product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene pepX1 CDS 161706..163295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 163403..163951 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(163959..165989) product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(166010..166624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(166632..167747) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene lpxB CDS complement(167749..168030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(168023..168796) product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene surE CDS 168975..171116 product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 171152..172276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 172346..174298 product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RL0 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 174426..175175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(175186..176097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(176094..178463) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816115.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(178465..179691) product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YH8 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(179773..182628) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene polA CDS complement(182724..183743) product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920217.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(183753..185417) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963720.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(185457..188396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 188660..189889 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 189943..190239 product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(190236..190862) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(190863..194171) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 tRNA 194323..194396 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(194447..195274) product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene uspA CDS 195437..195898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 195912..197144 product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene nusA CDS 197184..199961 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene infB CDS complement(200032..200361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 200598..201950 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene actA CDS 202026..205127 product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene actB CDS 205160..206617 product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene actC CDS 206621..207151 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene actD CDS 207161..207718 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene actE CDS 207745..209124 product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene actF CDS 209212..210231 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene ctaC CDS 210265..212055 product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene ctaD CDS 212186..213214 product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene ruvB CDS 213276..214601 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 214601..215527 product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene queG CDS 215704..218001 product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene maeB CDS 218050..218631 product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene ruvA CDS 218638..225837 product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene sprA CDS 225901..226281 product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene gcvH CDS 226361..226645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 226704..227429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 227673..228350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 228462..230597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964216.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 230889..231506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 231612..232505 product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene ctaB CDS 232507..233091 product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene ctaE CDS 233213..234211 product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 234235..234615 product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 234705..235421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964209.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 235432..236178 product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene ypmQ CDS 236221..236766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene yozB CDS 236802..237023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964212.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 237096..237983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 238121..238822 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 238815..240044 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 240051..241289 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 241361..242476 product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 242466..243854 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769333.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 243857..244528 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(244529..245341) product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene mscS sequence06 source 1..226909 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(150..617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784138.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 689..1792 product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene dinB2 CDS complement(1789..2073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963991.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(2338..3780) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene pykA CDS complement(3780..4265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962379.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(4402..5148) product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene rnc CDS complement(5158..6408) product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene fabF CDS complement(6420..6653) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene acpP CDS 6836..7402 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene purN CDS 7430..8071 product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 8307..9233 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 9308..11206 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene purF CDS complement(11479..12087) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene sodA CDS 12283..15426 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 15494..16687 product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene kbl CDS 16843..18243 product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 18316..21063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 21064..21903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(21900..24266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(24399..25196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 25292..26626 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029304.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 26649..26816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(26905..27546) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022240.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 27640..28092 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 28237..28992 product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene lpxH CDS complement(28989..30260) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene entS CDS complement(30262..31953) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene recJ CDS complement(32000..32419) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 32480..33070 product fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121856.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(33130..33702) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(33719..34063) product type III effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(34079..34753) product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene rsmI CDS 34849..38235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(38224..38607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071058.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(38634..39365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963207.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 39486..40133 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene tdk CDS 40126..41232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 41328..41729 product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI6 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene mscL CDS 41879..42868 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene asd CDS 42949..44040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 44056..46143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 46227..48392 product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 48467..49378 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(49368..49925) product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770360.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(49922..50176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 50301..50633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(50775..51080) product UPF0213 protein YsiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CEL6 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene ysiG CDS complement(51223..52494) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(52555..52995) product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(53063..53623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(53663..54571) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(54591..55643) product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(55645..56358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(56355..57491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(57546..58007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(58000..58686) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H228 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene mtgA CDS complement(58688..59800) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(59823..61181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(61188..63077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(63100..63798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(63865..65217) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene accC CDS complement(65303..65782) product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene accB CDS complement(65816..66811) product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene fabH3 CDS complement(66988..67188) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene rpmF CDS complement(67198..67737) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(67810..68856) product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene pdxA CDS 68923..69513 product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene ribE CDS complement(69502..69711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(69930..71480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 71629..72804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 72807..74189 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L7 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene leuC CDS 74191..74796 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 74793..75911 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M0 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene leuB CDS complement(76051..77109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 note possible pseudo, internal stop codon CDS complement(77304..77642) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(77655..78641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 79087..83583 product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene gltA CDS 83587..85053 product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene gltD CDS complement(85347..86621) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene argH CDS complement(86700..87761) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(87758..88534) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B0 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene argB CDS complement(89108..90043) product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E9 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene argF' CDS complement(90282..91412) product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ6 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene argD CDS complement(91409..92209) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR3 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene proC CDS complement(92528..93511) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A7 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene argC CDS complement(93634..94875) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(94859..95503) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(95905..97173) product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT3 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene ilvA CDS complement(97269..98771) product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN4 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene ilvC CDS complement(98783..99313) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene ilvH CDS complement(99315..101048) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene ilvB CDS complement(101081..102757) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene ilvD CDS 103205..104497 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767676.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 104634..104888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 105462..108494 product type I endonuclease-methyltransferase fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 108484..109155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(109182..110684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(110793..111062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(111895..112509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(112512..122885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(122911..125586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 tRNA complement(126100..126174) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(126231..126632) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 126716..127111 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene rbfA CDS 127112..128317 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(128456..129451) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 129618..130271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963188.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 130367..131758 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963189.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 131761..131976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(131947..132345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(132363..133589) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405434.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 133650..134762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(134871..135422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(135550..135900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(135918..136535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(136800..137033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(137183..138028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(138240..138842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(138913..141276) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 141473..143269 product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene lepA CDS complement(143339..145183) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481446.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 145354..146202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 146199..148385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 148459..149319 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 149339..150955 product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 151020..152846 product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(152958..153104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 153344..153871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 153949..154764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 154767..155132 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene rnpA CDS 155182..156816 product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene prc CDS 156876..157742 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962202.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(157743..158186) product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene elaA CDS complement(158260..158694) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene rpiB CDS 159398..161641 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene rnr CDS 161796..162098 product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLD9 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 162210..162887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 163010..163687 product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 163696..164220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 164213..164563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 tRNA complement(164742..164813) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(164864..165226) product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene folB CDS 165381..167390 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene glnS CDS 167525..168781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 168871..170028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 170114..170323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(170370..171290) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 171368..172051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(172110..173618) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene gltX CDS 173774..177265 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 177258..177674 product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene ybeY CDS 177787..179658 product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene mnmG CDS 179768..180634 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 180857..181357 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962186.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 181532..183262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(183263..183658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962191.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(183691..184608) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(184610..185764) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene holB CDS 185891..187465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 187481..188668 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene pgk CDS 188706..190289 product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962200.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene mltD CDS 190315..191292 product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(191356..191538) product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G3 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene tatA CDS 191655..192524 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 192524..194026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 194055..195746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 195760..196815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 196841..197899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 197889..198905 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5L7 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene rfbB CDS 198919..199782 product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C714 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene rfbA CDS 199786..200331 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene rmlC CDS 200328..201185 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene rmlD CDS 201314..202585 product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene wbpO CDS 202587..203597 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 203649..204656 product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202260.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 204665..205102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 205090..206223 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963418.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene fnlB CDS 206235..207371 product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963417.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene fnlC CDS 207356..208405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 208408..209814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048103.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 gene wzx CDS 210633..211103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(211910..212227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 212321..213406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 213415..214803 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964561.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene capK CDS 214808..215956 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186419.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 215980..216558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 216751..217167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 217174..217815 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775527.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 217819..218949 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 219048..220166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 220261..222222 product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963409.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene wbpM CDS 222237..223535 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 223536..224525 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 224718..225941 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene wcaJ CDS 225944..226720 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964562.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 sequence07 source 1..217693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(666..1529) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene lpqC CDS complement(1624..2400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(2680..3186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(3544..4590) product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482643.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(4593..5228) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene arsC CDS complement(5416..5817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(5845..6069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(6237..8141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963876.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(8236..8979) product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene aroE CDS complement(8972..9991) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(9992..11002) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458367.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(11050..12444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(12587..13774) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene argD CDS complement(13780..15576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(15766..16326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(16395..17522) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(17610..18881) product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene purA CDS complement(18903..19352) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene fur CDS complement(19448..21667) product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene relA CDS complement(21803..22786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(22806..24047) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963811.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(24126..25130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(25142..25804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(25942..26499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(26527..28710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(28837..31149) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(31216..31854) product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(31860..33191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(33240..34193) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2H9 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(34312..35613) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(35618..35965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(35965..37800) product putative Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59825 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(38181..38744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(38931..39686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(39863..40522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(40792..41472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(41710..42600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(42828..43805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(43810..44244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(44483..44875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(45120..45770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(45771..46388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(46665..47018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(47183..49336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(49672..49857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(49880..50311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(50308..50646) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(50761..51984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(52122..52991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(53145..55061) product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene htpG CDS 55236..56318 product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene fabH2 CDS complement(56721..59165) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 59270..59632 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(59616..61103) product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 61273..61890 product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene recR CDS 61899..62705 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194966.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 62706..63284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 63265..63900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 64016..65329 product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene bfmBB CDS complement(65417..65716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(65720..66145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(66194..66790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 66905..67678 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 67682..68293 product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 68297..68638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 68638..69888 product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 69971..70207 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene rpmB CDS 70235..70417 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene rpmG CDS 70452..70604 product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 70898..71872 product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene ftsY CDS 71875..72213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(72219..73295) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(73407..74414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 74618..75925 product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene rimO CDS 76002..76499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 76500..77135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(77142..78401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 78532..80133 product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene bshC CDS 80137..81510 product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803953.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 81592..83124 product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene guaA CDS 83298..85241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 85317..85805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 85807..86037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(86062..87012) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 87218..88834 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene pyrG CDS 88919..90823 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U2 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene yidC CDS 91013..91651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964005.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(91762..93168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 93350..94540 product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene mnmA CDS 94565..96196 product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 96261..97202 product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 97227..97991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 98028..99410 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene norM CDS 99439..99666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 99731..100306 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(100307..101941) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661302.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(101934..102557) product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802698.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(102557..103270) product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789838.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 103365..104306 product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(104401..105471) product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962733.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene argK CDS complement(105524..106072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 106257..106814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 106792..107379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 107399..108937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 108971..109660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(109664..110074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(110251..111882) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117581.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene aceA CDS complement(111956..113554) product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HM57 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene aceB CDS 113674..115149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(115182..115598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(115703..119059) product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene secA CDS complement(119234..119455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(119619..120191) product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(120260..121039) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(121368..123236) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 123456..124256 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene wza CDS 124266..126722 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene wzc CDS 126740..127618 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ30 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 127620..128885 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene rfbB CDS 128870..129544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 129534..130658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 130687..131613 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118537.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene galE CDS 131615..132655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 132685..133827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 133824..134075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 134132..135226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 135227..136111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 136112..137551 product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 137553..138455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 138550..139704 product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023668.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 139713..140588 product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023669.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 140604..141998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963386.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 142002..142673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 142673..143752 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389820.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 143752..144909 product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963384.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 144909..145865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203513.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 145862..147400 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963383.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 147408..148433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 148476..149438 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963382.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 149438..150568 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963379.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 150572..151273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 151278..152369 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963378.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 152369..153700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 153684..154622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 154623..156212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 156219..157229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 157289..158683 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(158684..159865) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(159880..160866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 161071..161820 product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene pssA CDS 161829..162653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(162741..163481) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene lptB CDS complement(163557..163919) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(163903..164739) product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene tatC CDS complement(164739..165704) product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene kdsD CDS 165900..168092 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene recQ1 CDS complement(168133..168627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 168754..169686 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene ppiC CDS 169794..170336 product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 170412..170744 product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene csaA CDS 170762..171790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(171846..172250) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(172337..174079) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 174225..175328 product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene vdh CDS 175441..176385 product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene nusB CDS 176472..176987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 176987..177283 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene yajC CDS complement(177335..177937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291518.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 178101..180479 product ferrichrome-iron receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797093.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 tRNA 180664..180746 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(180922..181299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(181422..181619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(181883..182965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267015.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(182977..184218) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene pepT CDS 184326..185360 product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene pyrD CDS 185361..185987 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 186017..186880 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene mvaB CDS 187098..188306 product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 188361..189488 product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene irpA CDS 189548..190912 product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 190929..193319 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene fecA CDS 193393..194862 product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene guaB CDS 195073..196596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(196593..197240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(197339..198184) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289273.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(198287..198607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(198726..200570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(200786..201022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(201025..201477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 201742..203682 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 203711..204535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 204498..205946 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene surA CDS 205956..206909 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 206911..207099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 207118..208263 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962920.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 208454..210724 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene acnA CDS 211012..211890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 211955..212521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(212518..213660) product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene crtY CDS complement(213683..214132) product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene crtZ CDS complement(214135..214974) product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene crtB CDS complement(214976..216439) product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene crtI CDS complement(216440..217354) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 tRNA complement(217540..217613) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 sequence08 source 1..215023 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(905..1939) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962241.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene tas CDS complement(2119..3072) product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(3088..3849) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene xth CDS 4026..7469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(7466..8425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 8773..9099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 9167..13480 product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 13485..14630 product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 14605..16626 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 16725..17306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(17380..18921) product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2A9 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene glyS CDS complement(18970..19398) product phospholipid N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962328.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 19370..19585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(19644..20549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963809.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(20719..21627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 21781..22464 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 22522..24135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(24122..24901) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(24901..25485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(25542..26234) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(26231..26848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 27386..28282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 28362..30452 product Asp/Glu-specific dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWM2 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene dpp11 CDS complement(30537..31109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(31136..32905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(32911..33879) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(33979..34725) product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene sdhB CDS complement(34735..36732) product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene sdhA CDS complement(36748..37356) product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene sdhC CDS complement(37530..39224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(39280..42090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 42309..43601 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene pepP CDS 43641..44585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(44639..45967) product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 46070..46726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(46707..47072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(47123..48409) product branched-chain amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016106.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(48412..49914) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920922.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 50053..50826 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 50937..51218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(51215..52264) product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene thiL CDS 52439..53992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 53997..55490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 55495..56844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 56847..57611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 57615..58688 product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 58794..59123 product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene sufA CDS 59143..60591 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene sufB CDS 60602..61465 product AttM/AiiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729411.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 61474..61821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 61827..62579 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene sufC CDS 62705..64018 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene sufD CDS 64024..64338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 64352..65566 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene sufS CDS 65738..66772 product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963731.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 66854..67669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 67758..68183 product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene sufE CDS 68186..68512 product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 68525..70360 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036606.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene msbA CDS 70379..70882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 70999..71943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 72026..72523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(72535..74796) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene mrcA CDS complement(75118..76347) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene hflX CDS 76425..77390 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 77430..77930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(77923..79092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887326.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 79405..79683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 79742..80311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 80313..80759 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 80763..82547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 82807..83385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 83397..83858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 84083..84553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 84588..85046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 85084..85296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 85308..85448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 85518..86684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(86745..87077) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 87308..87838 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 87842..88189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(88201..88665) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880837.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 88869..89561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(89628..91724) product endothelin-converting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962266.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene pepO CDS complement(91828..95289) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(95385..95903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(95905..96438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 96600..97547 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene ltd CDS 97646..100420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 100643..103678 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 103681..105222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 105241..106950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 107097..108416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 108419..109780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 109792..110583 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 110576..112891 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 112900..115008 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 115029..116885 product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 tRNA complement(117062..117136) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(117207..118547) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 118645..119388 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 119461..119691 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene feoA CDS 119691..121790 product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene feoB CDS complement(121948..122604) product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene sirR CDS 122732..124960 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765025.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 125002..125913 product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene troA CDS 126067..126822 product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 126822..127949 product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458883.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 127942..129102 product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458884.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(129198..131222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(131235..131768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(131823..132617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 132870..133280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene yqiW CDS 133379..134116 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene plsC CDS 134121..135107 product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 135111..135767 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(135834..136595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(136657..137529) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 137732..138328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(138402..139184) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene crt CDS complement(139196..140587) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(140705..141253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(141292..142632) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(142632..143663) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene hemH CDS 143816..147298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(147335..148228) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 148424..149686 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene hemA CDS 149679..151256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 151336..152361 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene hemE CDS 152392..153144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 153144..153683 product ribosomal-protein-amino-adic N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962220.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 153673..154575 product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene hemF CDS 154577..154966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 154953..155963 product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN2 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene hemB CDS 155994..157067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 157070..157543 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN0 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene ogt1 CDS 157543..158061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810105.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 158114..159271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 159345..161555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108745.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 161562..162275 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(162367..165021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 165204..166892 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene gsiA CDS 166994..167227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(167176..167802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(167805..168458) product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene atoA CDS complement(168470..169171) product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene atoD CDS complement(169248..171608) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene mrcA CDS complement(171624..172106) product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene gldH CDS complement(172093..173460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene fjo17 CDS complement(173650..174714) product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL9 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene yceA CDS 175146..176150 product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene recA CDS 176251..176655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 176685..177227 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 177227..178780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(178861..179598) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 179678..180646 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene trpS CDS complement(180655..181758) product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene smf CDS 181865..182800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 182932..183444 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(183496..184728) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(184732..185505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(185505..186869) product cytochrome c biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964529.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(186899..187918) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(188004..188438) product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene dut CDS complement(188480..189907) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(189972..190394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(190562..191422) product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene atpG CDS complement(191527..193107) product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene atpA CDS complement(193150..193686) product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene atpH CDS complement(193696..194196) product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene atpF CDS complement(194289..194477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(194518..195633) product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene atpB CDS complement(195769..196140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(196133..196375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(196344..196730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791781.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(196742..199252) product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene sprE CDS complement(199435..200145) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(200167..201645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405190.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(201699..202388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(202392..203015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(203017..203385) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986769.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 203466..204521 product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene paaE CDS complement(204719..205699) product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964556.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(205780..206388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 206500..207159 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene upp CDS complement(207148..208071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964559.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 208118..208345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(208349..209620) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene purD CDS 209733..211040 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964561.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene capK CDS complement(211042..213633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(213705..214532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(214599..214898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 sequence09 source 1..194766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(28..101) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(147..229) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(305..379) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(468..782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(808..1698) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene xerC CDS complement(1809..2003) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene rpsU CDS complement(2087..3514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(3618..4787) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(4812..5585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(5718..7313) product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene dagA CDS complement(7427..8452) product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931815.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(8456..8683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(8696..9970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 10126..10842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 11130..12221 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(12318..12746) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G65 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(13118..14098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(14376..15611) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(15613..15783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 15722..16891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(16895..17839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(18183..18677) product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 18699..19397 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(19394..19921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(19955..21577) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(21681..23411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(23452..26472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 26863..27552 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene ftsE CDS complement(27542..28456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 28614..29549 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(29535..29957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963968.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(29959..30798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 30836..31978 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene wbsE CDS complement(31979..33286) product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963976.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene wzxE CDS complement(33287..34390) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963975.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(34387..35262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(35648..37447) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene typA CDS 37687..39444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 39450..40082 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801226.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 40079..41272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795935.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 41303..42121 product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY4 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene kdsA CDS 42144..43007 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962664.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(43009..43356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(43363..43737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 43883..44491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107677.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 44646..44945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 44979..45272 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 45332..45805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 45867..46436 product SanA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886833.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 46436..46819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038472.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 46806..47480 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680079.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(47520..49937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(50002..51207) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(51268..51477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 tmRNA 51613..52005 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(52315..52719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(52722..53717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(53795..54700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205998.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(54724..57831) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706627.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(57834..59009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(59006..60556) product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933539.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene hsdM-2 CDS complement(61154..62353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(62359..62688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(62688..62981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(63189..64361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(64364..65617) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361992.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(65847..66869) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 67035..69653 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037795.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene fhuA CDS 69756..71066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 71089..72696 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933713.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 72705..73838 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207425.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene glxK CDS 73840..74817 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene manA CDS complement(74863..75276) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020791.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(75269..75577) product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(75691..76311) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228051.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(76315..76851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 77177..78571 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene trpE CDS 78568..79131 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene pabA CDS 79133..80125 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene trpD CDS 80125..80910 product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene trpC CDS 80915..81550 product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene trpF CDS 81540..82721 product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene trpB CDS 83146..83910 product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene trpA CDS 83920..84381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 84490..84639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 84707..84931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 84924..85376 product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYB0 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 85380..86294 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(86298..86522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(86522..86737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704507.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(86751..88049) product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MN45 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene rhlE CDS complement(88243..89598) product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 89758..90504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(90507..91451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 91650..98162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 98363..99934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 100030..100284 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070523.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 100289..100927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817114.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 100933..102039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(102415..103410) product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB7 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene obg CDS complement(103488..104603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 104724..105878 product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene purK CDS complement(105879..107303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(107304..107678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(107822..108328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(108335..109906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(109911..110354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 110718..111200 product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene purE CDS 111747..113777 product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene dcp1 CDS 113900..114403 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496869.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 114459..114794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 114791..115228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 115189..115569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 115887..116441 product ECF RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35165 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene sigX CDS 116444..116701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(116684..117511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362021.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 117673..120525 product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene gcvP CDS 120620..121678 product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene fabH1 CDS 121718..122239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 122425..123171 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963505.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(123168..123974) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene nucA CDS complement(123974..126883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(127134..127772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(128091..130730) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H092 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene valS CDS 130916..131341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963807.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(131400..132737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 132865..134055 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene aspC2 CDS 134055..135068 product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene murB CDS 135126..135656 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707772.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 135664..136461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(136529..137218) product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X6K6 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene aqpZ CDS 137422..137625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 137629..138744 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 138735..139283 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 139366..140244 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene lipA CDS 140247..141239 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963588.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene gapA1 CDS 141330..143543 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(143521..144528) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene lpxK CDS 144640..145734 product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX9 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene yqfO CDS 145738..146517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 146661..147308 product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJL3 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene msrA CDS 147441..149348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(149345..150139) product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 150215..150874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 151051..152316 product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene kynU CDS 152324..152668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 152661..154058 product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene kmo CDS 154138..154545 product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124713.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene tdcF CDS 154546..155982 product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095454.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 156053..156373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 156613..157395 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 157577..158113 product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene nbaC CDS 158418..159515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 159515..160156 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 160165..160944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 160934..161338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760453.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 161350..161748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(161749..162801) product putative oxidoreductase CzcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07085 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene czcO CDS 162993..163499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 163611..164141 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119942.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(164213..165727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(165968..166255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 166362..168122 product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964058.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene phhA CDS complement(168119..168721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(168755..169507) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 169593..169898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(169893..170567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(170825..171769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(171913..172230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(172363..174978) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene alaS CDS 175111..176082 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 176082..176411 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 176423..177022 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964048.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 177027..177470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 177467..178336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 178330..178986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 179205..179774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 179871..180026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 180019..180792 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729I7 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene thiM CDS 180789..181433 product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYZ3 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene thiE CDS 181409..182062 product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGB4 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 182050..182865 product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263201.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene thiD CDS complement(183002..185785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962501.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(185898..187208) product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene der CDS 187307..187804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(187863..189392) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258464.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(189480..190361) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene era CDS complement(190389..190847) product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418920.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 190992..191789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 191791..192366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(192453..192731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 192920..194050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 194076..194684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 sequence10 source 1..157114 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 231..331 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS 692..3124 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202769.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(3184..4326) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 4420..5490 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 5702..6928 product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 6930..8324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883648.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 8376..9077 product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 9079..9471 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 9474..10358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 10364..11581 product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene folC CDS 11627..11920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 11927..14416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(14413..16077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 tRNA 16246..16321 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 16422..16497 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(16534..17811) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene murF CDS complement(17878..19560) product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene gldJ CDS 19827..23720 product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene porU CDS 23754..24953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene porV CDS 25034..25516 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene cdd CDS 25615..26616 product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene pdhA CDS 26620..28263 product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene pdhC CDS 28359..29321 product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS 29311..29997 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(30069..30485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(30748..31242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 31377..32258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(32191..34323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 34680..36464 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene argS CDS complement(36597..38453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261759.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(38576..39505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(39583..42120) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(42110..43021) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109054.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(43074..43589) product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791946.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 43923..44981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 45107..45829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 45867..46457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 46620..47219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(47329..47874) product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 48001..48600 product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 48657..49709 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene manC CDS 49719..51200 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(51288..52055) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(52052..52714) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 53035..54558 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene pafA CDS complement(54555..54902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(54910..55176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(55181..55831) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene psd CDS complement(55821..56642) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene cdsA CDS complement(56647..57255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(57367..59331) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene ftsH CDS complement(59341..59712) product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene rsfS CDS 59868..60533 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene birA CDS complement(60517..60924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(60984..61628) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene pyrE CDS 61749..62330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 62499..64670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(64727..65401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(65403..66635) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946127.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(66638..68083) product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(68191..69717) product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(69797..71527) product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070554.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 71624..73285 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(73332..73787) product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene coaD CDS complement(73800..74408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(74448..75422) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD5 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene ddl CDS 75549..76112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 76116..77153 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 77366..78124 product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ8 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 78081..78419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(78409..78546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 78665..79372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(79369..79737) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529121.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(79748..80341) product protease synthase and sporulation protein PAI 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21341 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene paiB CDS 80416..81114 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene radC CDS 81116..82414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 82398..83090 product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 83093..83944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(83941..85218) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 85462..86214 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963478.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(86209..86943) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(87018..88028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(88042..88941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(88961..90448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963330.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(90461..93523) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963331.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(93643..95337) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963474.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 95518..95892 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene rpsL CDS 95914..96390 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene rpsG CDS 96397..98523 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene fusA CDS 98535..98840 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene rpsJ CDS 98986..99603 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ99 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene rplC CDS 99603..100232 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene rplD CDS 100240..100530 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ97 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene rplW CDS 100541..101365 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ96 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene rplB CDS 101372..101650 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ95 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene rpsS CDS 101654..102061 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene rplV CDS 102069..102788 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene rpsC CDS 102809..103228 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ92 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene rplP CDS 103242..103433 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ91 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene rpmC CDS 103447..103704 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene rpsQ CDS 103707..104075 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene rplN CDS 104087..104398 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ88 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene rplX CDS 104401..104952 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene rplE CDS 104956..105225 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene rpsN CDS 105285..105683 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene rpsH CDS 105702..106244 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene rplF CDS 106254..106607 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ83 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene rplR CDS 106614..107138 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ82 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene rpsE CDS 107150..107332 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ81 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene rpmD CDS 107344..107796 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ80 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene rplO CDS 107811..109160 product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ79 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene secY CDS 109171..109386 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ78 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene infA CDS 109510..109884 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ76 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene rpsM CDS 109893..110285 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene rpsK CDS 110471..111076 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ74 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene rpsD CDS 111174..112166 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene rpoA CDS 112227..112691 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ72 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene rplQ CDS 112782..113522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 113570..114277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 114328..115458 product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene carA CDS 115610..116902 product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene eno CDS 117084..118370 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene gltA CDS 118437..119351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(119412..120131) product putative oxidoreductase YoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14802 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene yoxD CDS complement(120240..122516) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(122509..123408) product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767289.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(123476..123991) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 124126..125139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 125336..126664 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene ffh CDS 126715..127605 product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene folD CDS 127649..128350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014109.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(128675..129097) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(129101..129994) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(130001..130840) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(130846..131214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(131219..131551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(131571..132122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(132194..133768) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 133829..134458 product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene queE CDS 134464..135072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(135073..136350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 136543..138216 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene asnB CDS 138519..140468 product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX10 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene gyrB CDS 140560..141531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 141584..142597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 142690..143616 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX11 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene mdh CDS 143715..144365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 144488..145078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 145224..148235 product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene secDF CDS complement(148714..149220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(149220..150149) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX82 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene lgt CDS complement(150349..150570) product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX81 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(150611..152095) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene cysS CDS complement(152106..152783) product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene folE2 CDS 153021..153452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 sequence11 source 1..134694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 102..3116 product type III restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016374.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 3138..4940 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470931.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 4930..6624 product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H9L7 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(6659..7099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(7104..7727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(7712..8311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(8308..8523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(8549..9337) product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071010.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(9353..9823) product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108556.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(9899..11077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(11143..12039) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFZ8 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene xerC CDS complement(12426..13364) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FKE0 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene xerC CDS 13488..13982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 14250..14594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 14584..15093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(15144..16301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 16630..17016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 17019..18122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 18164..18835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 18974..20473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 20466..20828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 20828..21268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 21272..22168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 22204..22698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 tRNA complement(23067..23140) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(23260..23442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(23514..24329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(24515..25831) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403495.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(25821..29024) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(29024..30160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(30241..32145) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 32158..32652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(32659..33699) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene fjo30 CDS complement(33803..34702) product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene gldN CDS complement(34746..36311) product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene gldM CDS complement(36360..36992) product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene gldL CDS complement(37054..38421) product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene gldK CDS complement(38585..39751) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene fjo29 CDS complement(39761..42289) product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene topA CDS 42424..43890 product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene miaB CDS 43917..44840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 44850..46118 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 46149..46655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 46660..47580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 47660..47950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 48093..48371 product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene groS CDS 48489..50120 product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene groL CDS complement(50198..54121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(54362..54790) product exosortase F system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964135.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(54791..55333) product exosortase family protein XrtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964136.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 55413..55868 product GAF domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 55968..57497 product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene purH CDS 57744..58772 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene mreB CDS 58786..59601 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene mreC CDS 59594..60100 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene mreD CDS 60157..62046 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene pbpA CDS 62033..63307 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene rodA CDS complement(63406..66129) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(66163..67068) product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 67225..68004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 68007..68621 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(68708..69751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119948.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(69786..72203) product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(72456..72983) product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH9 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene ppa CDS complement(73245..75746) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(75823..76800) product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene pdhB CDS 77043..77789 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene etfB CDS 77819..78781 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene etfA CDS 78895..79503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 79514..81202 product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene yeiM CDS 81293..82117 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene thyA CDS 82127..83005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(83035..83331) product 1,4-alpha-glucan-branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704632.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 83594..84505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 84608..85210 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143815.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 85262..86062 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119974.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene chd1 CDS 86087..86821 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121677.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene fabG CDS 86877..88433 product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 88571..89470 product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene fabD CDS 89463..89945 product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM5 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene lspA CDS complement(89980..90198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(90336..91355) product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene galE CDS complement(91457..92614) product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene porR CDS 92735..93970 product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene kdtA CDS 94057..94311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 tRNA complement(94446..94530) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(94558..94630) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(94726..97305) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWN3 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene mutS CDS 97438..97971 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(97985..100330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(100455..100937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(100924..102060) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962567.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 102133..102837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 102929..105595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962569.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 105754..106617 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene rpoD CDS 106720..106914 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene rpsU CDS complement(107242..107661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(107661..109307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(109582..110361) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D7 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene murI CDS complement(110425..110934) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964197.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(110977..111960) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964196.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene skp CDS complement(112223..114775) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene bamA CDS complement(114810..115583) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 transl_table 11 codon_start 1 locus_tag LOCUS_26040 gene uppS CDS complement(115552..116241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(116340..117209) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene nadK CDS complement(117212..117871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 117964..118677 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene pdxJ CDS 118684..119445 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(119553..119846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 119956..121284 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene tig CDS 121425..122099 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene clpP CDS 122185..123417 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 transl_table 11 codon_start 1 locus_tag LOCUS_26130 gene clpX CDS complement(123638..124033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(124325..125839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 125882..126676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 126748..126972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 126982..127368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(127456..127971) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(128034..128768) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(128771..130876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 131099..132154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(132217..133227) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 133480..134382 product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 sequence12 source 1..96026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(153..569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(645..1250) product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene ychE CDS complement(1256..1762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085399.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(1767..2147) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene ytxJ CDS 2415..5024 product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0F9 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene clpB CDS 5174..7090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 7395..7808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(7830..9317) product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E6 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene mqo CDS complement(9425..10042) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 10222..10893 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73QJ5 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene deoC CDS 10930..11628 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RG79 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 11696..12145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 12180..12638 product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene smpB CDS 12844..15312 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 15435..16385 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120056.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 16395..17006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 17074..17985 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 17990..18505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(18556..19179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 19419..20351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(20367..20888) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene pcm CDS 21168..22127 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 22286..23173 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 23286..24524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964016.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 24542..25201 product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 25391..26575 product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 26575..28533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 28557..29417 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 29441..30355 product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V8 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene miaA CDS 30352..31347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(31399..32109) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 gene rprY CDS complement(32114..33649) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 gene rprX CDS complement(33756..34355) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene coaE CDS complement(34352..35311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(35315..36319) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(36393..39650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(39897..40721) product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(40819..42471) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene recN CDS complement(42549..43436) product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(43429..44640) product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene coaBC CDS complement(44645..44974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(44981..45781) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene bamD CDS complement(45890..46777) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene dapA CDS complement(46770..47297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 47392..48126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 48134..49051 product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(49054..49776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(49858..51852) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene ligA CDS complement(51854..53455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(53455..54327) product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene prmC CDS complement(54337..54828) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene yjgM CDS 54894..55349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 55352..56446 product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene ribD CDS 56477..57088 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 57088..57951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 57955..58566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(58555..58959) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 59145..60572 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene dnaA CDS 60584..61036 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 61063..61776 product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(61773..62411) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963343.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(62518..63393) product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(63430..64473) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene pabC CDS complement(64463..64996) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(64990..65769) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene dapF CDS 65904..67307 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene degP/Q CDS 67458..68906 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX7 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene gapA2 CDS 69036..69665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(70015..70863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 71006..71335 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 71370..71840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 72245..72901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 72975..74285 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 74286..74903 product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 75161..76585 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 76700..78013 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964143.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene phrB3 CDS 78254..79786 product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964142.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 79877..81361 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964141.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene phrB2 CDS 81473..81901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 81902..82180 product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 82243..82938 product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene folE2 CDS 82943..83167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 83268..83951 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 83956..84498 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97IS0 transl_table 11 codon_start 1 locus_tag LOCUS_27080 gene bsaA CDS 84495..84956 product sensory protein TspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740210.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 84967..85428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 85432..86736 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene phrB1 CDS 86738..86875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(87125..87508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(87514..88830) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene murA CDS complement(88839..89498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(89571..89864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 89954..90496 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 90496..92397 product ATP-dependent DNA helicase RecQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene recQ2 CDS 92394..93344 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H148 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene fmt CDS 93537..93809 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene hupB CDS 93929..94489 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(94486..95328) product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(95381..95767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 tRNA 95910..95984 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 sequence13 source 1..62639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(6..81) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(120..209) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(308..2350) product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 2477..3655 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 3665..4414 product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(4470..5705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(5738..8290) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene gyrA CDS 8551..11106 product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene clpA CDS 11237..11563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(11555..13063) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW5 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene hutH1 CDS 13190..14242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962448.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(14317..15873) product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ4 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 16098..18548 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene thrA CDS 18616..19539 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 transl_table 11 codon_start 1 locus_tag LOCUS_27350 gene thrB CDS 19619..20911 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 20958..21338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(21411..22055) product putative sugar epimerase YhfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07609 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene yhfK CDS 22224..22625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 22709..23176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 23218..23985 product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963758.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(24016..24318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962796.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(24371..24967) product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P85 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene folE CDS complement(24957..25523) product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB5 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene mrsA CDS 25699..28152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 28213..28872 product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene lolD CDS 28876..29424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 29432..30064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 30184..30948 product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 31017..32213 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038285.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(32262..32585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(32687..34576) product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 34728..36656 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 36653..37903 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 gene pyrC2 CDS 37908..38240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 38240..38887 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(38964..39443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963236.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(39476..40237) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene phnP CDS 40331..41785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(41965..42513) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(42515..43597) product 3-deoxy-alpha-D-manno-octulosonate 8-oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB0 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene kdnB CDS complement(43626..44243) product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765580.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(44247..44951) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(44942..45670) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene kdsB CDS complement(45706..47136) product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 47259..47999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 47983..48804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 48804..49361 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 49865..51595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 51598..52134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 52149..52730 product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene miaE CDS complement(52796..53332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(53430..54341) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene ppx CDS complement(54334..56394) product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY90 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene ppk CDS complement(56435..56923) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene sixA sequence14 source 1..39956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..516 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein locus_tag LOCUS_27760 CDS 544..1449 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene porP CDS 1469..3373 product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(3604..5148) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene cafA CDS complement(5502..5792) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene hupA CDS 5930..6970 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene mutY CDS 7061..7510 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H058 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene ssb CDS 7520..8824 product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 8871..9449 product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene gldD CDS complement(9550..10122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS 10220..11119 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene fjo11 CDS complement(11152..13224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(13244..14563) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 14758..15210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 15308..15967 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P9 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene rplU CDS 16011..16271 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P8 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene rpmA CDS complement(16308..16790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(17090..18406) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene ahcY CDS 18539..19165 product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene sfp CDS 19165..19887 product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene pcrB CDS 19891..20151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 20135..20767 product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene pnuC CDS 20728..21306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27980 note possible pseudo, frameshifted CDS 21293..22849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 note possible pseudo, frameshifted CDS 22851..23258 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 23569..25827 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS complement(25882..26328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964454.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 26482..26955 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 transl_table 11 codon_start 1 locus_tag LOCUS_28030 gene greA CDS 27091..27480 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(27475..27822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(27823..29007) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene porY CDS 29129..29983 product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 30029..30406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 30764..31390 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H233 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene aat CDS complement(31387..31950) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene tag CDS complement(31937..32137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 32216..32833 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(32873..33595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(33666..34361) product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene truB CDS complement(34366..35160) product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene uppP CDS complement(35253..35540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(35557..35706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(35831..36706) product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene ftsX CDS 36835..39723 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H244 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene leuS sequence15 source 1..36211 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 839..912 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(1036..1743) product dipeptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene pepE CDS 1853..2662 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 2700..3416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 3476..3976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964227.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 4040..6349 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 6439..6768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 6851..7750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(7809..8354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(8378..10357) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene hutU CDS 10587..10925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964062.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 10915..11826 product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene acdS CDS 11830..12642 product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 12648..13925 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW4 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene hemL CDS complement(14017..14358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(14490..14984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(15100..16086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(16230..17924) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene lysS CDS 18082..18780 product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene lipB CDS complement(18783..19424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(19504..20964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(20964..21689) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(21707..22756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(22866..23435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(23566..23910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(24065..24676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(24703..25509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(25565..25912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 26043..26612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 26614..27336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(27333..30062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(30068..30541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(30660..33050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(33118..33717) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW0 transl_table 11 codon_start 1 locus_tag LOCUS_28520 gene rnhB CDS 33863..35836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 sequence16 source 1..25497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 570..2504 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 transl_table 11 codon_start 1 locus_tag LOCUS_28540 gene thrS CDS 2623..3084 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene infC CDS 3146..3343 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene rpmI CDS 3444..3788 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene rplT CDS 3952..4758 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(4780..5862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(5876..6145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(6321..9179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(9281..9949) product sensory transduction protein LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94514 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene lytT CDS complement(9942..11642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(11644..12903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(12973..13899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(14026..15561) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene dnaB CDS complement(15817..16770) product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene accA CDS complement(16880..17788) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(17775..18809) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(18849..19979) product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene tgt CDS 20191..21036 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene tktA CDS 21057..22010 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene tktC CDS 22153..22794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(22864..23805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963560.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 23885..24259 product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 24264..24767 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene pyrR2 CDS complement(24759..25310) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene aroK tRNA 25401..25474 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 sequence17 source 1..24163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(541..948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(1155..1520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(1532..2068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(2104..3018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(3023..4285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(4288..4683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 5374..6099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(6168..6893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 7287..8636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 8633..9385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 9437..9868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(10197..11549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(11549..14893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(14908..15216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 15565..16614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 16615..17370 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436119.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 17862..21950 product CRISPR-associated endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZR9 transl_table 11 codon_start 1 locus_tag LOCUS_28940 gene cas9 CDS 21955..22842 product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene cas1 CDS 22845..23183 product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 gene cas2 repeat_region 23297..>24163 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttgtgattgctcacgtaaaaatacaatttga sequence18 source 1..21911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 52..126 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 682..999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(996..2186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(2179..3273) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(3300..3806) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(3920..4561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(4565..5269) product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(5275..5904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(5990..7012) product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene tsaD CDS 7198..11589 product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 11747..12733 product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 transl_table 11 codon_start 1 locus_tag LOCUS_29060 gene pfkA CDS 12764..13765 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H007 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene gapA3 CDS 13860..14723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 14724..15086 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ00 transl_table 11 codon_start 1 locus_tag LOCUS_29090 gene mgsA CDS complement(15079..15459) product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 gene yjgF CDS complement(15493..18267) product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 18355..19467 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759762.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 19522..20469 product organic solvent ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 20499..21812 product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 sequence19 source 1..12298 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 362..592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(642..1403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(1447..2493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 2384..2611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 2832..3137 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933390.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 3188..3424 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933389.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 3461..4438 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880897.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 4456..4896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 4897..5607 product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107126.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 5995..6198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 6149..7486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 7509..7778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 7778..8002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 8181..11381 product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 11386..12138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 sequence20 source 1..6332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 830..1978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 2182..2655 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964230.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene yitI CDS 2652..3380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 3406..4170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 4251..5768 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene gpmI