>Feature sequence001 452 3 gene locus_tag LOCUS_00010 gene tadA 452 3 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_00010 564 2336 gene locus_tag LOCUS_00020 gene dxs 564 2336 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWC0 protein_id gnl|my_center|LOCUS_00020 5117 2385 gene locus_tag LOCUS_00030 5117 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6495 5155 gene locus_tag LOCUS_00040 gene dgt 6495 5155 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_00040 9113 6714 gene locus_tag LOCUS_00050 gene nrdA 9113 6714 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_00050 10178 9207 gene locus_tag LOCUS_00060 gene nrdB 10178 9207 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_00060 10586 10777 gene locus_tag LOCUS_00070 10586 10777 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_00070 10869 11906 gene locus_tag LOCUS_00080 gene ctaA 10869 11906 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880041.1 protein_id gnl|my_center|LOCUS_00080 12161 11964 gene locus_tag LOCUS_00090 12161 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12225 12497 gene locus_tag LOCUS_00100 gene ydzA 12225 12497 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_00100 12635 12501 gene locus_tag LOCUS_00110 12635 12501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15184 12752 gene locus_tag LOCUS_00120 15184 12752 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_00120 15461 17743 gene locus_tag LOCUS_00130 gene maeB 15461 17743 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_00130 17709 18356 gene locus_tag LOCUS_00140 gene ruvA 17709 18356 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_00140 18361 25488 gene locus_tag LOCUS_00150 gene sprA 18361 25488 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_00150 25501 25881 gene locus_tag LOCUS_00160 gene gcvH 25501 25881 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_00160 25847 26215 gene locus_tag LOCUS_00170 25847 26215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 26290 27000 gene locus_tag LOCUS_00180 26290 27000 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_00180 27633 27283 gene locus_tag LOCUS_00190 27633 27283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 28545 27859 gene locus_tag LOCUS_00200 28545 27859 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_00200 29936 28656 gene locus_tag LOCUS_00210 29936 28656 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769333.1 protein_id gnl|my_center|LOCUS_00210 30310 30098 gene locus_tag LOCUS_00220 30310 30098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 30842 30303 gene locus_tag LOCUS_00230 gene yozB 30842 30303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_00230 31536 30835 gene locus_tag LOCUS_00240 gene ypmQ 31536 30835 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_00240 32144 31533 gene locus_tag LOCUS_00250 32144 31533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964209.1 protein_id gnl|my_center|LOCUS_00250 32588 32247 gene locus_tag LOCUS_00260 32588 32247 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_00260 33587 32607 gene locus_tag LOCUS_00270 33587 32607 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_00270 34229 33642 gene locus_tag LOCUS_00280 gene ctaE 34229 33642 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_00280 35134 34232 gene locus_tag LOCUS_00290 gene ctaB 35134 34232 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_00290 37407 35341 gene locus_tag LOCUS_00300 37407 35341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964216.1 protein_id gnl|my_center|LOCUS_00300 37982 37404 gene locus_tag LOCUS_00310 37982 37404 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_00310 38743 39525 gene locus_tag LOCUS_00320 38743 39525 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_00320 39529 41445 gene locus_tag LOCUS_00330 39529 41445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 42006 41437 gene locus_tag LOCUS_00340 42006 41437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_00340 42176 41994 gene locus_tag LOCUS_00350 42176 41994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42127 42678 gene locus_tag LOCUS_00360 42127 42678 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_00360 42680 43285 gene locus_tag LOCUS_00370 42680 43285 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962631.1 protein_id gnl|my_center|LOCUS_00370 43572 43291 gene locus_tag LOCUS_00380 43572 43291 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_00380 44140 43565 gene locus_tag LOCUS_00390 44140 43565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 44253 44450 gene locus_tag LOCUS_00400 44253 44450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 46350 44494 gene locus_tag LOCUS_00410 gene glmS 46350 44494 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_00410 47921 46365 gene locus_tag LOCUS_00420 47921 46365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962289.1 protein_id gnl|my_center|LOCUS_00420 48741 47932 gene locus_tag LOCUS_00430 48741 47932 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_00430 48839 49690 gene locus_tag LOCUS_00440 gene panC 48839 49690 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 protein_id gnl|my_center|LOCUS_00440 49714 50064 gene locus_tag LOCUS_00450 gene panD 49714 50064 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 protein_id gnl|my_center|LOCUS_00450 50064 51014 gene locus_tag LOCUS_00460 50064 51014 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_00460 51196 52557 gene locus_tag LOCUS_00470 gene radA 51196 52557 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_00470 53351 52605 gene locus_tag LOCUS_00480 53351 52605 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_00480 54093 54815 gene locus_tag LOCUS_00490 54093 54815 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_00490 54822 55283 gene locus_tag LOCUS_00500 54822 55283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 55287 56627 gene locus_tag LOCUS_00510 gene pyrC1 55287 56627 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_00510 56728 57111 gene locus_tag LOCUS_00520 56728 57111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 58102 57095 gene locus_tag LOCUS_00530 58102 57095 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_00530 58165 59457 gene locus_tag LOCUS_00540 gene tyrS 58165 59457 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 protein_id gnl|my_center|LOCUS_00540 60305 59520 gene locus_tag LOCUS_00550 60305 59520 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_00550 60479 61261 gene locus_tag LOCUS_00560 60479 61261 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 protein_id gnl|my_center|LOCUS_00560 62597 61305 gene locus_tag LOCUS_00570 gene pepP 62597 61305 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_00570 64027 62699 gene locus_tag LOCUS_00580 gene rhlE 64027 62699 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87J63 protein_id gnl|my_center|LOCUS_00580 64290 67010 gene locus_tag LOCUS_00590 64290 67010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 67945 67013 gene locus_tag LOCUS_00600 67945 67013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_00600 70275 68116 gene locus_tag LOCUS_00610 70275 68116 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_00610 70428 70793 gene locus_tag LOCUS_00620 70428 70793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 70914 71252 gene locus_tag LOCUS_00630 70914 71252 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_00630 71266 71973 gene locus_tag LOCUS_00640 71266 71973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 72100 73482 gene locus_tag LOCUS_00650 72100 73482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 73504 74199 gene locus_tag LOCUS_00660 73504 74199 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_00660 74315 76537 gene locus_tag LOCUS_00670 gene sprE 74315 76537 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_00670 76539 76952 gene locus_tag LOCUS_00680 76539 76952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_00680 76915 77133 gene locus_tag LOCUS_00690 76915 77133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 77592 78725 gene locus_tag LOCUS_00700 gene atpB 77592 78725 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_00700 78762 78950 gene locus_tag LOCUS_00710 78762 78950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 79044 79544 gene locus_tag LOCUS_00720 gene atpF 79044 79544 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_00720 79552 80109 gene locus_tag LOCUS_00730 gene atpH 79552 80109 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_00730 80131 81708 gene locus_tag LOCUS_00740 gene atpA 80131 81708 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_00740 81758 82624 gene locus_tag LOCUS_00750 gene atpG 81758 82624 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_00750 82801 83265 gene locus_tag LOCUS_00760 82801 83265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 83391 84302 gene locus_tag LOCUS_00770 83391 84302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 84474 85226 gene locus_tag LOCUS_00780 84474 85226 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_00780 85228 86367 gene locus_tag LOCUS_00790 85228 86367 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962316.1 protein_id gnl|my_center|LOCUS_00790 87367 86636 gene locus_tag LOCUS_00800 87367 86636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_00800 87937 87467 gene locus_tag LOCUS_00810 87937 87467 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110256.1 protein_id gnl|my_center|LOCUS_00810 88474 87977 gene locus_tag LOCUS_00820 88474 87977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 >Feature sequence002 149 721 gene locus_tag LOCUS_00830 gene purN 149 721 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_00830 714 1349 gene locus_tag LOCUS_00840 714 1349 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 protein_id gnl|my_center|LOCUS_00840 2187 1447 gene locus_tag LOCUS_00850 gene sdhB 2187 1447 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_00850 4195 2198 gene locus_tag LOCUS_00860 gene sdhA 4195 2198 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_00860 4883 4200 gene locus_tag LOCUS_00870 gene sdhC 4883 4200 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_00870 5549 5100 gene locus_tag LOCUS_00880 5549 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_00880 6105 5539 gene locus_tag LOCUS_00890 6105 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 6356 6105 gene locus_tag LOCUS_00900 6356 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 7631 6357 gene locus_tag LOCUS_00910 7631 6357 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_00910 8074 7628 gene locus_tag LOCUS_00920 8074 7628 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 protein_id gnl|my_center|LOCUS_00920 9137 8085 gene locus_tag LOCUS_00930 gene bcsA 9137 8085 CDS product putative chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54157 protein_id gnl|my_center|LOCUS_00930 9848 9138 gene locus_tag LOCUS_00940 9848 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 11014 9848 gene locus_tag LOCUS_00950 11014 9848 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_00950 12123 11011 gene locus_tag LOCUS_00960 12123 11011 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_00960 13266 12184 gene locus_tag LOCUS_00970 gene dinB2 13266 12184 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_00970 14105 13257 gene locus_tag LOCUS_00980 14105 13257 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945924.1 protein_id gnl|my_center|LOCUS_00980 15591 14236 gene locus_tag LOCUS_00990 gene gdhA 15591 14236 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_00990 15788 16807 gene locus_tag LOCUS_01000 gene pheS 15788 16807 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_01000 16853 17248 gene locus_tag LOCUS_01010 16853 17248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 18761 17286 gene locus_tag LOCUS_01020 18761 17286 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_01020 22259 18921 gene locus_tag LOCUS_01030 22259 18921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 23751 22495 gene locus_tag LOCUS_01040 gene entS 23751 22495 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_01040 24413 23754 gene locus_tag LOCUS_01050 24413 23754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 25452 24457 gene locus_tag LOCUS_01060 gene gpsA 25452 24457 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_01060 25648 26079 gene locus_tag LOCUS_01070 gene dut 25648 26079 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_01070 26660 26106 gene locus_tag LOCUS_01080 26660 26106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 27736 26729 gene locus_tag LOCUS_01090 gene recA 27736 26729 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_01090 27888 28415 gene locus_tag LOCUS_01100 27888 28415 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H133 protein_id gnl|my_center|LOCUS_01100 28844 28404 gene locus_tag LOCUS_01110 gene elaA 28844 28404 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_01110 29278 28844 gene locus_tag LOCUS_01120 gene rpiB 29278 28844 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_01120 30709 29801 gene locus_tag LOCUS_01130 30709 29801 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_01130 30825 33050 gene locus_tag LOCUS_01140 gene rnr 30825 33050 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_01140 33123 33812 gene locus_tag LOCUS_01150 33123 33812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 33864 34052 gene locus_tag LOCUS_01160 33864 34052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 35052 34132 gene locus_tag LOCUS_01170 35052 34132 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_01170 35656 35111 gene locus_tag LOCUS_01180 35656 35111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 37179 35659 gene locus_tag LOCUS_01190 gene gltX 37179 35659 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 protein_id gnl|my_center|LOCUS_01190 37706 40753 gene locus_tag LOCUS_01200 37706 40753 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_01200 40756 41169 gene locus_tag LOCUS_01210 gene ybeY 40756 41169 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_01210 41214 43091 gene locus_tag LOCUS_01220 gene mnmG 41214 43091 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_01220 43138 44016 gene locus_tag LOCUS_01230 43138 44016 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_01230 44558 44160 gene locus_tag LOCUS_01240 44558 44160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962191.1 protein_id gnl|my_center|LOCUS_01240 45720 44779 gene locus_tag LOCUS_01250 45720 44779 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_01250 46549 45731 gene locus_tag LOCUS_01260 gene panB 46549 45731 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_01260 46878 47522 gene locus_tag LOCUS_01270 46878 47522 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_01270 47807 47526 gene locus_tag LOCUS_01280 47807 47526 CDS product Sec-independent protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964182.1 protein_id gnl|my_center|LOCUS_01280 48197 48973 gene locus_tag LOCUS_01290 48197 48973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 protein_id gnl|my_center|LOCUS_01290 51735 49162 gene locus_tag LOCUS_01300 gene mutS 51735 49162 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWN3 protein_id gnl|my_center|LOCUS_01300 51860 52390 gene locus_tag LOCUS_01310 51860 52390 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_01310 53731 52379 gene locus_tag LOCUS_01320 gene mgtE 53731 52379 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_01320 54524 53721 gene locus_tag LOCUS_01330 gene rsmA 54524 53721 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_01330 54963 54634 gene locus_tag LOCUS_01340 54963 54634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_01340 56711 54993 gene locus_tag LOCUS_01350 56711 54993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_01350 58231 56957 gene locus_tag LOCUS_01360 gene serS 58231 56957 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_01360 59223 58291 gene locus_tag LOCUS_01370 gene ribF 59223 58291 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_01370 59414 62266 gene locus_tag LOCUS_01380 59414 62266 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_01380 >Feature sequence003 697 1704 gene locus_tag LOCUS_01390 gene batA 697 1704 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_01390 1707 2753 gene locus_tag LOCUS_01400 gene batB 1707 2753 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_01400 2791 3555 gene locus_tag LOCUS_01410 2791 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 3574 5337 gene locus_tag LOCUS_01420 gene batD 3574 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_01420 5340 6098 gene locus_tag LOCUS_01430 gene batE 5340 6098 CDS product BatE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_01430 6146 6415 gene locus_tag LOCUS_01440 6146 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 6499 8079 gene locus_tag LOCUS_01450 6499 8079 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 protein_id gnl|my_center|LOCUS_01450 8116 8595 gene locus_tag LOCUS_01460 8116 8595 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_01460 9279 8842 gene locus_tag LOCUS_01470 9279 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 9407 9799 gene locus_tag LOCUS_01480 9407 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_01480 10597 9803 gene locus_tag LOCUS_01490 10597 9803 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_01490 10691 12055 gene locus_tag LOCUS_01500 10691 12055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 12215 13786 gene locus_tag LOCUS_01510 12215 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 13797 15068 gene locus_tag LOCUS_01520 13797 15068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 15443 15084 gene locus_tag LOCUS_01530 15443 15084 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_01530 16483 15446 gene locus_tag LOCUS_01540 16483 15446 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_01540 16591 18645 gene locus_tag LOCUS_01550 gene metG 16591 18645 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_01550 18645 19547 gene locus_tag LOCUS_01560 18645 19547 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326200.1 protein_id gnl|my_center|LOCUS_01560 20359 19781 gene locus_tag LOCUS_01570 gene cysG 20359 19781 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 protein_id gnl|my_center|LOCUS_01570 20493 21266 gene locus_tag LOCUS_01580 20493 21266 CDS product uroporphyrin-III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060761.1 protein_id gnl|my_center|LOCUS_01580 21334 23841 gene locus_tag LOCUS_01590 gene nasB 21334 23841 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207014.1 protein_id gnl|my_center|LOCUS_01590 23863 24240 gene locus_tag LOCUS_01600 23863 24240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 24252 24836 gene locus_tag LOCUS_01610 24252 24836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 24851 26662 gene locus_tag LOCUS_01620 24851 26662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 26711 27259 gene locus_tag LOCUS_01630 26711 27259 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_01630 27345 28004 gene locus_tag LOCUS_01640 27345 28004 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974526.1 protein_id gnl|my_center|LOCUS_01640 28600 32121 gene locus_tag LOCUS_01650 28600 32121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 32118 33299 gene locus_tag LOCUS_01660 32118 33299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 33309 33551 gene locus_tag LOCUS_01670 33309 33551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 33564 34316 gene locus_tag LOCUS_01680 gene ntcA 33564 34316 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057487.1 protein_id gnl|my_center|LOCUS_01680 34779 36164 gene locus_tag LOCUS_01690 34779 36164 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_01690 36234 37340 gene locus_tag LOCUS_01700 36234 37340 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_01700 37367 38215 gene locus_tag LOCUS_01710 gene nrtC 37367 38215 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324928.1 protein_id gnl|my_center|LOCUS_01710 38224 39054 gene locus_tag LOCUS_01720 gene nrtD 38224 39054 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324929.1 protein_id gnl|my_center|LOCUS_01720 39128 40456 gene locus_tag LOCUS_01730 39128 40456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_01730 41608 40589 gene locus_tag LOCUS_01740 gene moaA 41608 40589 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y870 protein_id gnl|my_center|LOCUS_01740 42512 41601 gene locus_tag LOCUS_01750 gene moaCB 42512 41601 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_01750 42957 42514 gene locus_tag LOCUS_01760 42957 42514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 44032 42947 gene locus_tag LOCUS_01770 44032 42947 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_01770 44271 44038 gene locus_tag LOCUS_01780 44271 44038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 44652 44320 gene locus_tag LOCUS_01790 44652 44320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 45874 44660 gene locus_tag LOCUS_01800 45874 44660 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477201.1 protein_id gnl|my_center|LOCUS_01800 46334 46002 gene locus_tag LOCUS_01810 46334 46002 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_01810 46493 46846 gene locus_tag LOCUS_01820 46493 46846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_01820 47315 46848 gene locus_tag LOCUS_01830 47315 46848 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262101.1 protein_id gnl|my_center|LOCUS_01830 48925 47498 gene locus_tag LOCUS_01840 gene pykA 48925 47498 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_01840 49398 48928 gene locus_tag LOCUS_01850 49398 48928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962379.1 protein_id gnl|my_center|LOCUS_01850 50229 49492 gene locus_tag LOCUS_01860 gene rnc 50229 49492 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 protein_id gnl|my_center|LOCUS_01860 51489 50236 gene locus_tag LOCUS_01870 gene fabF 51489 50236 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_01870 >Feature sequence004 224 868 gene locus_tag LOCUS_01880 224 868 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_01880 1738 1064 gene locus_tag LOCUS_01890 1738 1064 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_01890 1795 2607 gene locus_tag LOCUS_01900 1795 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 3588 2635 gene locus_tag LOCUS_01910 3588 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 3724 4392 gene locus_tag LOCUS_01920 3724 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 4592 7045 gene locus_tag LOCUS_01930 gene lon 4592 7045 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_01930 7310 9754 gene locus_tag LOCUS_01940 gene priA 7310 9754 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 protein_id gnl|my_center|LOCUS_01940 10985 9810 gene locus_tag LOCUS_01950 10985 9810 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_01950 11817 11089 gene locus_tag LOCUS_01960 11817 11089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 11816 11953 gene locus_tag LOCUS_01970 11816 11953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 13474 11999 gene locus_tag LOCUS_01980 gene guaB 13474 11999 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_01980 13663 14892 gene locus_tag LOCUS_01990 13663 14892 CDS product lipoprotein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963596.1 protein_id gnl|my_center|LOCUS_01990 14905 16389 gene locus_tag LOCUS_02000 14905 16389 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963595.1 protein_id gnl|my_center|LOCUS_02000 18867 16438 gene locus_tag LOCUS_02010 gene fecA 18867 16438 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_02010 20137 18845 gene locus_tag LOCUS_02020 20137 18845 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_02020 21401 20292 gene locus_tag LOCUS_02030 gene irpA 21401 20292 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_02030 22627 21494 gene locus_tag LOCUS_02040 22627 21494 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_02040 24272 22767 gene locus_tag LOCUS_02050 24272 22767 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338624.1 protein_id gnl|my_center|LOCUS_02050 25173 24319 gene locus_tag LOCUS_02060 gene mvaB 25173 24319 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_02060 25486 28383 gene locus_tag LOCUS_02070 25486 28383 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_02070 28390 29403 gene locus_tag LOCUS_02080 28390 29403 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172178.1 protein_id gnl|my_center|LOCUS_02080 30300 29443 gene locus_tag LOCUS_02090 30300 29443 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_02090 32971 30335 gene locus_tag LOCUS_02100 gene valS 32971 30335 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H092 protein_id gnl|my_center|LOCUS_02100 33099 33503 gene locus_tag LOCUS_02110 33099 33503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 33758 34948 gene locus_tag LOCUS_02120 gene aspC2 33758 34948 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_02120 34949 35959 gene locus_tag LOCUS_02130 gene murB 34949 35959 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_02130 36619 35966 gene locus_tag LOCUS_02140 36619 35966 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_02140 37190 36621 gene locus_tag LOCUS_02150 37190 36621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 38015 37227 gene locus_tag LOCUS_02160 38015 37227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 38189 38449 gene locus_tag LOCUS_02170 38189 38449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 38462 39565 gene locus_tag LOCUS_02180 38462 39565 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_02180 39556 40119 gene locus_tag LOCUS_02190 39556 40119 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_02190 40178 41413 gene locus_tag LOCUS_02200 40178 41413 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_02200 41454 42323 gene locus_tag LOCUS_02210 gene lipA 41454 42323 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_02210 <44095 42410 gene locus_tag LOCUS_02220 <44095 42410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYG2:phenylalanine--tRNA ligase beta subunit >Feature sequence005 143 895 gene locus_tag LOCUS_02230 143 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031368.1 protein_id gnl|my_center|LOCUS_02230 2371 947 gene locus_tag LOCUS_02240 2371 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964329.1 protein_id gnl|my_center|LOCUS_02240 5148 2392 gene locus_tag LOCUS_02250 5148 2392 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_02250 5333 6346 gene locus_tag LOCUS_02260 5333 6346 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_02260 7959 6430 gene locus_tag LOCUS_02270 gene cafA 7959 6430 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_02270 8528 8238 gene locus_tag LOCUS_02280 gene hupA 8528 8238 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_02280 8772 9713 gene locus_tag LOCUS_02290 gene mutY 8772 9713 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_02290 9754 10188 gene locus_tag LOCUS_02300 gene ssb 9754 10188 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H058 protein_id gnl|my_center|LOCUS_02300 10208 11530 gene locus_tag LOCUS_02310 10208 11530 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_02310 11523 12074 gene locus_tag LOCUS_02320 gene gldD 11523 12074 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_02320 12319 12119 gene locus_tag LOCUS_02330 12319 12119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 12535 12362 gene locus_tag LOCUS_02340 12535 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 12492 12971 gene locus_tag LOCUS_02350 12492 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 14030 12972 gene locus_tag LOCUS_02360 14030 12972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 15262 14162 gene locus_tag LOCUS_02370 gene smf 15262 14162 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_02370 15359 16267 gene locus_tag LOCUS_02380 15359 16267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 protein_id gnl|my_center|LOCUS_02380 16337 16846 gene locus_tag LOCUS_02390 16337 16846 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_02390 18146 16905 gene locus_tag LOCUS_02400 18146 16905 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_02400 18916 18146 gene locus_tag LOCUS_02410 18916 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 19899 18925 gene locus_tag LOCUS_02420 19899 18925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 20898 19900 gene locus_tag LOCUS_02430 20898 19900 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_02430 21201 23057 gene locus_tag LOCUS_02440 21201 23057 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_02440 23773 23054 gene locus_tag LOCUS_02450 23773 23054 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_02450 24614 23865 gene locus_tag LOCUS_02460 24614 23865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 24918 25616 gene locus_tag LOCUS_02470 gene phoP 24918 25616 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_02470 25628 26668 gene locus_tag LOCUS_02480 gene phoR 25628 26668 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_02480 27682 26642 gene locus_tag LOCUS_02490 27682 26642 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_02490 28956 27682 gene locus_tag LOCUS_02500 gene purD 28956 27682 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_02500 29745 29008 gene locus_tag LOCUS_02510 29745 29008 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_02510 30749 29748 gene locus_tag LOCUS_02520 30749 29748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 32499 31345 gene locus_tag LOCUS_02530 32499 31345 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937589.1 protein_id gnl|my_center|LOCUS_02530 32663 33703 gene locus_tag LOCUS_02540 32663 33703 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104563.1 protein_id gnl|my_center|LOCUS_02540 35000 33708 gene locus_tag LOCUS_02550 35000 33708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 36154 34997 gene locus_tag LOCUS_02560 36154 34997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 37324 36158 gene locus_tag LOCUS_02570 37324 36158 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085164.1 protein_id gnl|my_center|LOCUS_02570 38283 37324 gene locus_tag LOCUS_02580 38283 37324 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268291.1 protein_id gnl|my_center|LOCUS_02580 39637 38312 gene locus_tag LOCUS_02590 39637 38312 CDS product polysaccharide biosynthesis related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122761.1 protein_id gnl|my_center|LOCUS_02590 40213 39671 gene locus_tag LOCUS_02600 gene rmlC 40213 39671 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_02600 41067 40213 gene locus_tag LOCUS_02610 gene rfbA 41067 40213 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C714 protein_id gnl|my_center|LOCUS_02610 42076 41069 gene locus_tag LOCUS_02620 gene rfbB 42076 41069 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5L7 protein_id gnl|my_center|LOCUS_02620 >Feature sequence006 191 808 gene locus_tag LOCUS_02630 191 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 1363 827 gene locus_tag LOCUS_02640 1363 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 1603 1842 gene locus_tag LOCUS_02650 1603 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 1941 3155 gene locus_tag LOCUS_02660 gene hflX 1941 3155 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 protein_id gnl|my_center|LOCUS_02660 4033 3158 gene locus_tag LOCUS_02670 4033 3158 CDS product protein of unknown function precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362027.1 protein_id gnl|my_center|LOCUS_02670 4583 4074 gene locus_tag LOCUS_02680 4583 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_02680 4922 4602 gene locus_tag LOCUS_02690 4922 4602 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_02690 5358 4933 gene locus_tag LOCUS_02700 gene sufE 5358 4933 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_02700 5539 6465 gene locus_tag LOCUS_02710 5539 6465 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_02710 6529 8427 gene locus_tag LOCUS_02720 gene purF 6529 8427 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_02720 10193 8610 gene locus_tag LOCUS_02730 10193 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 10887 10372 gene locus_tag LOCUS_02740 10887 10372 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_02740 11684 10893 gene locus_tag LOCUS_02750 11684 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_02750 11765 13273 gene locus_tag LOCUS_02760 11765 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_02760 14254 13277 gene locus_tag LOCUS_02770 14254 13277 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_02770 15339 14299 gene locus_tag LOCUS_02780 gene rlmN 15339 14299 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_02780 16454 15405 gene locus_tag LOCUS_02790 gene queA 16454 15405 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_02790 17756 16527 gene locus_tag LOCUS_02800 gene aroA 17756 16527 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW83 protein_id gnl|my_center|LOCUS_02800 18786 18085 gene locus_tag LOCUS_02810 18786 18085 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267293.1 protein_id gnl|my_center|LOCUS_02810 19167 18796 gene locus_tag LOCUS_02820 gene crcB 19167 18796 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZS4 protein_id gnl|my_center|LOCUS_02820 19745 19167 gene locus_tag LOCUS_02830 19745 19167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02830 20129 19833 gene locus_tag LOCUS_02840 20129 19833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02840 20742 20209 gene locus_tag LOCUS_02850 20742 20209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_02850 20825 21406 gene locus_tag LOCUS_02860 20825 21406 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS17 protein_id gnl|my_center|LOCUS_02860 21408 22229 gene locus_tag LOCUS_02870 gene folP 21408 22229 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_02870 22384 23160 gene locus_tag LOCUS_02880 22384 23160 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108919.1 protein_id gnl|my_center|LOCUS_02880 24929 23163 gene locus_tag LOCUS_02890 24929 23163 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_02890 25657 24932 gene locus_tag LOCUS_02900 gene truA 25657 24932 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_02900 25705 26256 gene locus_tag LOCUS_02910 25705 26256 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_02910 27994 26243 gene locus_tag LOCUS_02920 27994 26243 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962869.1 protein_id gnl|my_center|LOCUS_02920 28658 28050 gene locus_tag LOCUS_02930 28658 28050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 29519 28854 gene locus_tag LOCUS_02940 29519 28854 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_02940 30218 29787 gene locus_tag LOCUS_02950 30218 29787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_02950 30417 32117 gene locus_tag LOCUS_02960 gene rho 30417 32117 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_02960 34467 32377 gene locus_tag LOCUS_02970 34467 32377 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_02970 35855 34590 gene locus_tag LOCUS_02980 35855 34590 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_02980 36071 35871 gene locus_tag LOCUS_02990 36071 35871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 36579 36076 gene locus_tag LOCUS_03000 36579 36076 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 protein_id gnl|my_center|LOCUS_03000 37984 36641 gene locus_tag LOCUS_03010 37984 36641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109224.1 protein_id gnl|my_center|LOCUS_03010 39307 37988 gene locus_tag LOCUS_03020 39307 37988 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_03020 40032 39304 gene locus_tag LOCUS_03030 gene coaX 40032 39304 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B4 protein_id gnl|my_center|LOCUS_03030 40130 40203 gene locus_tag LOCUS_t00010 40130 40203 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence007 350 2725 gene locus_tag LOCUS_03040 350 2725 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_03040 2899 4335 gene locus_tag LOCUS_03050 gene asnS 2899 4335 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_03050 4359 5816 gene locus_tag LOCUS_03060 gene rpoN 4359 5816 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_03060 5816 6415 gene locus_tag LOCUS_03070 5816 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 7087 6410 gene locus_tag LOCUS_03080 7087 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_03080 7676 7209 gene locus_tag LOCUS_03090 7676 7209 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_03090 8336 7695 gene locus_tag LOCUS_03100 8336 7695 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_03100 8810 8340 gene locus_tag LOCUS_03110 8810 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 9541 8819 gene locus_tag LOCUS_03120 9541 8819 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_03120 10795 9752 gene locus_tag LOCUS_03130 gene ansA 10795 9752 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_03130 10892 11590 gene locus_tag LOCUS_03140 10892 11590 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_03140 11760 14099 gene locus_tag LOCUS_03150 11760 14099 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_03150 16000 14204 gene locus_tag LOCUS_03160 gene lepA 16000 14204 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_03160 16301 17299 gene locus_tag LOCUS_03170 16301 17299 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_03170 18508 17306 gene locus_tag LOCUS_03180 18508 17306 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_03180 18919 18524 gene locus_tag LOCUS_03190 gene rbfA 18919 18524 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 protein_id gnl|my_center|LOCUS_03190 19318 19025 gene locus_tag LOCUS_03200 19318 19025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 20847 19339 gene locus_tag LOCUS_03210 gene atpD 20847 19339 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_03210 22356 21001 gene locus_tag LOCUS_03220 22356 21001 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_03220 23666 22461 gene locus_tag LOCUS_03230 gene kbl 23666 22461 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_03230 26888 23715 gene locus_tag LOCUS_03240 26888 23715 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_03240 27772 26936 gene locus_tag LOCUS_03250 27772 26936 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_03250 28425 27769 gene locus_tag LOCUS_03260 gene sirR 28425 27769 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_03260 28530 30773 gene locus_tag LOCUS_03270 28530 30773 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765025.1 protein_id gnl|my_center|LOCUS_03270 30985 34227 gene locus_tag LOCUS_03280 gene mfd 30985 34227 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_03280 37678 34337 gene locus_tag LOCUS_03290 37678 34337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 <39645 37828 gene locus_tag LOCUS_03300 <39645 37828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWV8:translation initiation factor IF-2 >Feature sequence008 <1 582 gene locus_tag LOCUS_03310 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963268.1:chromosome partitioning protein ParB 583 1173 gene locus_tag LOCUS_03320 583 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_03320 1175 1879 gene locus_tag LOCUS_03330 gene dapB 1175 1879 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_03330 1941 3644 gene locus_tag LOCUS_03340 gene lepB 1941 3644 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP1 protein_id gnl|my_center|LOCUS_03340 3650 4255 gene locus_tag LOCUS_03350 3650 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 protein_id gnl|my_center|LOCUS_03350 4495 5073 gene locus_tag LOCUS_03360 4495 5073 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_03360 5180 5061 gene locus_tag LOCUS_03370 5180 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 6679 5192 gene locus_tag LOCUS_03380 6679 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7946 6681 gene locus_tag LOCUS_03390 7946 6681 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_03390 9133 7943 gene locus_tag LOCUS_03400 9133 7943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 9597 9130 gene locus_tag LOCUS_03410 9597 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 9982 11634 gene locus_tag LOCUS_03420 9982 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 14070 11635 gene locus_tag LOCUS_03430 14070 11635 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_03430 14389 14129 gene locus_tag LOCUS_03440 14389 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 14556 15545 gene locus_tag LOCUS_03450 14556 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963908.1 protein_id gnl|my_center|LOCUS_03450 15564 16697 gene locus_tag LOCUS_03460 gene yghO 15564 16697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_03460 16681 17388 gene locus_tag LOCUS_03470 16681 17388 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_03470 17427 18068 gene locus_tag LOCUS_03480 17427 18068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_03480 18052 18975 gene locus_tag LOCUS_03490 18052 18975 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_03490 18986 20056 gene locus_tag LOCUS_03500 18986 20056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 22997 20127 gene locus_tag LOCUS_03510 22997 20127 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_03510 23550 23065 gene locus_tag LOCUS_03520 23550 23065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_03520 24377 23550 gene locus_tag LOCUS_03530 24377 23550 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_03530 24721 26277 gene locus_tag LOCUS_03540 24721 26277 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_03540 27191 26331 gene locus_tag LOCUS_03550 27191 26331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_03550 27692 27195 gene locus_tag LOCUS_03560 27692 27195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 28177 27758 gene locus_tag LOCUS_03570 28177 27758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 28529 28188 gene locus_tag LOCUS_03580 28529 28188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 30098 28632 gene locus_tag LOCUS_03590 30098 28632 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_03590 31223 30099 gene locus_tag LOCUS_03600 31223 30099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_03600 31398 34016 gene locus_tag LOCUS_03610 31398 34016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403224.1 protein_id gnl|my_center|LOCUS_03610 34080 34955 gene locus_tag LOCUS_03620 34080 34955 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098128.1 protein_id gnl|my_center|LOCUS_03620 35581 34961 gene locus_tag LOCUS_03630 35581 34961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821257.1 protein_id gnl|my_center|LOCUS_03630 35851 35594 gene locus_tag LOCUS_03640 35851 35594 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962768.1 protein_id gnl|my_center|LOCUS_03640 36513 35857 gene locus_tag LOCUS_03650 gene psd 36513 35857 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_03650 37310 36516 gene locus_tag LOCUS_03660 gene cdsA 37310 36516 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 protein_id gnl|my_center|LOCUS_03660 37902 37312 gene locus_tag LOCUS_03670 37902 37312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_03670 <39211 37921 gene locus_tag LOCUS_03680 <39211 37921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX85:ATP-dependent zinc metalloprotease FtsH >Feature sequence009 2435 468 gene locus_tag LOCUS_03690 2435 468 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963110.1 protein_id gnl|my_center|LOCUS_03690 3409 2465 gene locus_tag LOCUS_03700 3409 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 4545 3490 gene locus_tag LOCUS_03710 4545 3490 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_03710 4708 5172 gene locus_tag LOCUS_03720 4708 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 5226 5909 gene locus_tag LOCUS_03730 5226 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_03730 7237 6125 gene locus_tag LOCUS_03740 7237 6125 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_03740 8151 7234 gene locus_tag LOCUS_03750 8151 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962386.1 protein_id gnl|my_center|LOCUS_03750 8258 8809 gene locus_tag LOCUS_03760 gene ruvC 8258 8809 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_03760 8904 9938 gene locus_tag LOCUS_03770 8904 9938 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_03770 10002 10955 gene locus_tag LOCUS_03780 10002 10955 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_03780 10997 12619 gene locus_tag LOCUS_03790 gene ade 10997 12619 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI0 protein_id gnl|my_center|LOCUS_03790 12663 13259 gene locus_tag LOCUS_03800 gene phnA 12663 13259 CDS product PhnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 protein_id gnl|my_center|LOCUS_03800 14839 13262 gene locus_tag LOCUS_03810 14839 13262 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_03810 17114 14910 gene locus_tag LOCUS_03820 17114 14910 CDS product dipeptidyl peptidase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638894.2 protein_id gnl|my_center|LOCUS_03820 18645 17212 gene locus_tag LOCUS_03830 18645 17212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_03830 18750 18832 gene locus_tag LOCUS_t00020 18750 18832 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20699 19116 gene locus_tag LOCUS_03840 20699 19116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 22926 20803 gene locus_tag LOCUS_03850 22926 20803 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_03850 23166 23936 gene locus_tag LOCUS_03860 gene surE 23166 23936 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_03860 23924 24211 gene locus_tag LOCUS_03870 23924 24211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 24221 25330 gene locus_tag LOCUS_03880 gene lpxB 24221 25330 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_03880 25824 27563 gene locus_tag LOCUS_03890 25824 27563 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_03890 28018 27566 gene locus_tag LOCUS_03900 28018 27566 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_03900 29914 28166 gene locus_tag LOCUS_03910 29914 28166 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700706.1 protein_id gnl|my_center|LOCUS_03910 31484 29946 gene locus_tag LOCUS_03920 gene yclF 31484 29946 CDS product putative transporter YclF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94408 protein_id gnl|my_center|LOCUS_03920 31753 33024 gene locus_tag LOCUS_03930 gene mvaA 31753 33024 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_03930 33021 33950 gene locus_tag LOCUS_03940 33021 33950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_03940 33947 35155 gene locus_tag LOCUS_03950 33947 35155 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_03950 35221 35775 gene locus_tag LOCUS_03960 35221 35775 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_03960 36098 35865 gene locus_tag LOCUS_03970 36098 35865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 protein_id gnl|my_center|LOCUS_03970 36713 36108 gene locus_tag LOCUS_03980 36713 36108 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583622.1 protein_id gnl|my_center|LOCUS_03980 >Feature sequence010 3029 399 gene locus_tag LOCUS_03990 gene bamA 3029 399 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 protein_id gnl|my_center|LOCUS_03990 3705 2962 gene locus_tag LOCUS_04000 gene uppS 3705 2962 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_04000 4345 3710 gene locus_tag LOCUS_04010 4345 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 5402 4503 gene locus_tag LOCUS_04020 gene nadK 5402 4503 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_04020 6097 5438 gene locus_tag LOCUS_04030 6097 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 6158 6874 gene locus_tag LOCUS_04040 gene pdxJ 6158 6874 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 protein_id gnl|my_center|LOCUS_04040 6920 7693 gene locus_tag LOCUS_04050 6920 7693 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_04050 8346 7690 gene locus_tag LOCUS_04060 8346 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 8428 8607 gene locus_tag LOCUS_04070 8428 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 8652 8978 gene locus_tag LOCUS_04080 8652 8978 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_04080 8979 9227 gene locus_tag LOCUS_04090 8979 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 9754 9236 gene locus_tag LOCUS_04100 9754 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_04100 9648 9872 gene locus_tag LOCUS_04110 9648 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 10095 9853 gene locus_tag LOCUS_04120 10095 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 10687 10226 gene locus_tag LOCUS_04130 10687 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 12610 10778 gene locus_tag LOCUS_04140 12610 10778 CDS product putative Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59825 protein_id gnl|my_center|LOCUS_04140 14409 12622 gene locus_tag LOCUS_04150 gene gaa 14409 12622 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_04150 16485 14626 gene locus_tag LOCUS_04160 16485 14626 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_04160 16631 18589 gene locus_tag LOCUS_04170 16631 18589 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RL0 protein_id gnl|my_center|LOCUS_04170 19452 18631 gene locus_tag LOCUS_04180 19452 18631 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964046.1 protein_id gnl|my_center|LOCUS_04180 20026 19487 gene locus_tag LOCUS_04190 gene rpoE2 20026 19487 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261608.1 protein_id gnl|my_center|LOCUS_04190 23756 20316 gene locus_tag LOCUS_04200 gene icmF 23756 20316 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_04200 23885 25873 gene locus_tag LOCUS_04210 gene hutU 23885 25873 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_04210 25885 26427 gene locus_tag LOCUS_04220 25885 26427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_04220 26482 26649 gene locus_tag LOCUS_04230 26482 26649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 27853 28317 gene locus_tag LOCUS_04240 27853 28317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 29474 28653 gene locus_tag LOCUS_04250 gene pyrF 29474 28653 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_04250 29574 30065 gene locus_tag LOCUS_04260 gene tlpA 29574 30065 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963549.1 protein_id gnl|my_center|LOCUS_04260 30184 30942 gene locus_tag LOCUS_04270 gene tpiA 30184 30942 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI2 protein_id gnl|my_center|LOCUS_04270 31018 31854 gene locus_tag LOCUS_04280 gene prmA 31018 31854 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_04280 31865 32140 gene locus_tag LOCUS_04290 gene clpS 31865 32140 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_04290 32143 32415 gene locus_tag LOCUS_04300 32143 32415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 33026 32520 gene locus_tag LOCUS_04310 gene recX 33026 32520 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_04310 <35362 33083 gene locus_tag LOCUS_04320 <35362 33083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964489.1:copper transporter >Feature sequence011 105 536 gene locus_tag LOCUS_04330 105 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 1199 582 gene locus_tag LOCUS_04340 gene recR 1199 582 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_04340 1328 2767 gene locus_tag LOCUS_04350 1328 2767 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_04350 2915 3562 gene locus_tag LOCUS_04360 gene pdxH 2915 3562 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 protein_id gnl|my_center|LOCUS_04360 3599 4087 gene locus_tag LOCUS_04370 gene sixA 3599 4087 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_04370 4094 4990 gene locus_tag LOCUS_04380 gene ppx 4094 4990 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_04380 6084 5029 gene locus_tag LOCUS_04390 gene menE 6084 5029 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_04390 7047 6106 gene locus_tag LOCUS_04400 gene yyaK 7047 6106 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_04400 8087 7047 gene locus_tag LOCUS_04410 gene menC 8087 7047 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_04410 8611 8099 gene locus_tag LOCUS_04420 8611 8099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 9547 8621 gene locus_tag LOCUS_04430 gene menA 9547 8621 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW2 protein_id gnl|my_center|LOCUS_04430 10329 9550 gene locus_tag LOCUS_04440 10329 9550 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_04440 11695 10382 gene locus_tag LOCUS_04450 11695 10382 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_04450 12690 11728 gene locus_tag LOCUS_04460 12690 11728 CDS product organic solvent ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_04460 13756 12743 gene locus_tag LOCUS_04470 13756 12743 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_04470 13927 16623 gene locus_tag LOCUS_04480 13927 16623 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_04480 16641 17021 gene locus_tag LOCUS_04490 gene yjgF 16641 17021 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_04490 18077 17076 gene locus_tag LOCUS_04500 gene gapA 18077 17076 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQH1 protein_id gnl|my_center|LOCUS_04500 19082 18099 gene locus_tag LOCUS_04510 gene pfkA 19082 18099 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_04510 23639 19335 gene locus_tag LOCUS_04520 23639 19335 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_04520 23882 24907 gene locus_tag LOCUS_04530 gene tsaD 23882 24907 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_04530 25215 26768 gene locus_tag LOCUS_04540 25215 26768 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108021.1 protein_id gnl|my_center|LOCUS_04540 27612 26830 gene locus_tag LOCUS_04550 gene phnP 27612 26830 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_04550 27688 29136 gene locus_tag LOCUS_04560 27688 29136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_04560 29759 29499 gene locus_tag LOCUS_04570 29759 29499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963895.1 protein_id gnl|my_center|LOCUS_04570 30502 29801 gene locus_tag LOCUS_04580 30502 29801 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_04580 31232 30495 gene locus_tag LOCUS_04590 gene kdsB 31232 30495 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_04590 31695 31282 gene locus_tag LOCUS_04600 gene ygcM 31695 31282 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_04600 32218 31688 gene locus_tag LOCUS_04610 gene idi 32218 31688 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_04610 32329 33018 gene locus_tag LOCUS_04620 32329 33018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 >Feature sequence012 532 329 gene locus_tag LOCUS_04630 532 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 576 2282 gene locus_tag LOCUS_04640 576 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_04640 2411 3244 gene locus_tag LOCUS_04650 2411 3244 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013490.1 protein_id gnl|my_center|LOCUS_04650 4140 3340 gene locus_tag LOCUS_04660 4140 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 4318 4234 gene locus_tag LOCUS_t00030 4318 4234 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4711 4638 gene locus_tag LOCUS_t00040 4711 4638 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4810 5325 gene locus_tag LOCUS_04670 gene aroK 4810 5325 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 protein_id gnl|my_center|LOCUS_04670 5832 5317 gene locus_tag LOCUS_04680 gene pyrR2 5832 5317 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_04680 6202 5825 gene locus_tag LOCUS_04690 6202 5825 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_04690 6283 7152 gene locus_tag LOCUS_04700 6283 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963560.1 protein_id gnl|my_center|LOCUS_04700 7825 7208 gene locus_tag LOCUS_04710 7825 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 8818 7856 gene locus_tag LOCUS_04720 gene tktC 8818 7856 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_04720 9524 8946 gene locus_tag LOCUS_04730 9524 8946 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_04730 10443 9544 gene locus_tag LOCUS_04740 10443 9544 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_04740 10910 10443 gene locus_tag LOCUS_04750 gene smpB 10910 10443 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 protein_id gnl|my_center|LOCUS_04750 11169 11570 gene locus_tag LOCUS_04760 gene ytxJ 11169 11570 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_04760 11630 13177 gene locus_tag LOCUS_04770 11630 13177 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 protein_id gnl|my_center|LOCUS_04770 13883 13227 gene locus_tag LOCUS_04780 13883 13227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962785.1 protein_id gnl|my_center|LOCUS_04780 14302 13886 gene locus_tag LOCUS_04790 gene yuxK 14302 13886 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_04790 14483 15175 gene locus_tag LOCUS_04800 14483 15175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765150.1 protein_id gnl|my_center|LOCUS_04800 15178 16410 gene locus_tag LOCUS_04810 15178 16410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_04810 16413 17261 gene locus_tag LOCUS_04820 16413 17261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04820 17445 17657 gene locus_tag LOCUS_04830 17445 17657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 17675 18790 gene locus_tag LOCUS_04840 17675 18790 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_04840 18993 19334 gene locus_tag LOCUS_04850 gene rpsF 18993 19334 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 protein_id gnl|my_center|LOCUS_04850 19338 19634 gene locus_tag LOCUS_04860 gene rpsR 19338 19634 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_04860 19648 20094 gene locus_tag LOCUS_04870 gene rplI 19648 20094 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P1 protein_id gnl|my_center|LOCUS_04870 20167 20634 gene locus_tag LOCUS_04880 20167 20634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 protein_id gnl|my_center|LOCUS_04880 20768 21439 gene locus_tag LOCUS_04890 gene trmH 20768 21439 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_04890 21756 21490 gene locus_tag LOCUS_04900 21756 21490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 23102 21906 gene locus_tag LOCUS_04910 gene ald 23102 21906 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_04910 23513 23106 gene locus_tag LOCUS_04920 23513 23106 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_04920 25151 23604 gene locus_tag LOCUS_04930 gene porX 25151 23604 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_04930 25285 26508 gene locus_tag LOCUS_04940 25285 26508 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_04940 26555 27598 gene locus_tag LOCUS_04950 gene lpxD 26555 27598 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_04950 27591 28982 gene locus_tag LOCUS_04960 gene fabZ 27591 28982 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_04960 28985 29773 gene locus_tag LOCUS_04970 gene lpxA 28985 29773 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_04970 29779 30345 gene locus_tag LOCUS_04980 gene efp 29779 30345 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_04980 30378 31142 gene locus_tag LOCUS_04990 30378 31142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 31148 32074 gene locus_tag LOCUS_05000 31148 32074 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_05000 32135 33007 gene locus_tag LOCUS_05010 gene sucD 32135 33007 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_05010 33125 33871 gene locus_tag LOCUS_05020 33125 33871 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence013 386 799 gene locus_tag LOCUS_05030 gene mraZ 386 799 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_05030 786 1685 gene locus_tag LOCUS_05040 gene rsmH 786 1685 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 protein_id gnl|my_center|LOCUS_05040 1687 2013 gene locus_tag LOCUS_05050 1687 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964162.1 protein_id gnl|my_center|LOCUS_05050 2073 4037 gene locus_tag LOCUS_05060 gene ftsI 2073 4037 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_05060 4093 5505 gene locus_tag LOCUS_05070 gene murE 4093 5505 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_05070 5508 6734 gene locus_tag LOCUS_05080 gene mraY 5508 6734 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_05080 6735 8069 gene locus_tag LOCUS_05090 gene murD 6735 8069 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_05090 8081 9265 gene locus_tag LOCUS_05100 gene ftsW 8081 9265 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_05100 9249 10343 gene locus_tag LOCUS_05110 gene murG 9249 10343 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_05110 10340 11692 gene locus_tag LOCUS_05120 gene murC 10340 11692 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_05120 11682 12407 gene locus_tag LOCUS_05130 gene ftsQ 11682 12407 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964154.1 protein_id gnl|my_center|LOCUS_05130 12414 13745 gene locus_tag LOCUS_05140 gene ftsA 12414 13745 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_05140 13819 15726 gene locus_tag LOCUS_05150 gene ftsZ 13819 15726 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H191 protein_id gnl|my_center|LOCUS_05150 17007 15820 gene locus_tag LOCUS_05160 gene aspC1 17007 15820 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_05160 18125 17034 gene locus_tag LOCUS_05170 18125 17034 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_05170 18248 18877 gene locus_tag LOCUS_05180 gene rsmG 18248 18877 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_05180 20747 19110 gene locus_tag LOCUS_05190 20747 19110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_05190 22391 20757 gene locus_tag LOCUS_05200 22391 20757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 24214 22517 gene locus_tag LOCUS_05210 gene lysS 24214 22517 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 protein_id gnl|my_center|LOCUS_05210 24552 25028 gene locus_tag LOCUS_05220 24552 25028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962388.1 protein_id gnl|my_center|LOCUS_05220 26077 25070 gene locus_tag LOCUS_05230 gene obg 26077 25070 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB7 protein_id gnl|my_center|LOCUS_05230 27254 26136 gene locus_tag LOCUS_05240 27254 26136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 30329 27354 gene locus_tag LOCUS_05250 gene secDF 30329 27354 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 protein_id gnl|my_center|LOCUS_05250 31648 30722 gene locus_tag LOCUS_05260 gene mdh 31648 30722 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX11 protein_id gnl|my_center|LOCUS_05260 <32536 31908 gene locus_tag LOCUS_05270 <32536 31908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX10:DNA gyrase subunit B >Feature sequence014 170 84 gene locus_tag LOCUS_t00050 170 84 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 263 191 gene locus_tag LOCUS_t00060 263 191 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1252 644 gene locus_tag LOCUS_05280 gene sodA 1252 644 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_05280 2378 1362 gene locus_tag LOCUS_05290 gene fbp 2378 1362 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWD9 protein_id gnl|my_center|LOCUS_05290 2548 3027 gene locus_tag LOCUS_05300 2548 3027 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_05300 3029 4282 gene locus_tag LOCUS_05310 gene lysC 3029 4282 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_05310 4336 6132 gene locus_tag LOCUS_05320 4336 6132 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_05320 6350 7672 gene locus_tag LOCUS_05330 gene tig 6350 7672 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_05330 7859 8518 gene locus_tag LOCUS_05340 gene clpP 7859 8518 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_05340 8560 9798 gene locus_tag LOCUS_05350 gene clpX 8560 9798 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_05350 9928 11922 gene locus_tag LOCUS_05360 gene dnaG 9928 11922 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_05360 12781 11993 gene locus_tag LOCUS_05370 gene nadE 12781 11993 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 protein_id gnl|my_center|LOCUS_05370 12842 13801 gene locus_tag LOCUS_05380 12842 13801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 13801 14133 gene locus_tag LOCUS_05390 gene gldC 13801 14133 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_05390 15307 14183 gene locus_tag LOCUS_05400 15307 14183 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962567.1 protein_id gnl|my_center|LOCUS_05400 17644 15410 gene locus_tag LOCUS_05410 gene pnp 17644 15410 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H185 protein_id gnl|my_center|LOCUS_05410 18094 17825 gene locus_tag LOCUS_05420 gene rpsO 18094 17825 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H184 protein_id gnl|my_center|LOCUS_05420 19081 18224 gene locus_tag LOCUS_05430 gene accD 19081 18224 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_05430 20312 19245 gene locus_tag LOCUS_05440 gene fbaA 20312 19245 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_05440 22726 20411 gene locus_tag LOCUS_05450 22726 20411 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_05450 22991 23725 gene locus_tag LOCUS_05460 22991 23725 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_05460 24497 23793 gene locus_tag LOCUS_05470 gene porT 24497 23793 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_05470 25225 24497 gene locus_tag LOCUS_05480 gene menG 25225 24497 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_05480 26133 25228 gene locus_tag LOCUS_05490 26133 25228 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 protein_id gnl|my_center|LOCUS_05490 27641 26259 gene locus_tag LOCUS_05500 27641 26259 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_05500 28360 27965 gene locus_tag LOCUS_05510 28360 27965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 28903 30381 gene locus_tag LOCUS_05520 gene proS 28903 30381 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_05520 30479 30551 gene locus_tag LOCUS_t00070 30479 30551 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 31463 30960 gene locus_tag LOCUS_05530 31463 30960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 >Feature sequence015 1205 459 gene locus_tag LOCUS_05540 gene nqrC 1205 459 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 protein_id gnl|my_center|LOCUS_05540 2407 1208 gene locus_tag LOCUS_05550 gene nqrB 2407 1208 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K8 protein_id gnl|my_center|LOCUS_05550 3761 2412 gene locus_tag LOCUS_05560 gene nqrA 3761 2412 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_05560 4016 5230 gene locus_tag LOCUS_05570 4016 5230 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_05570 5378 5665 gene locus_tag LOCUS_05580 5378 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 5885 7510 gene locus_tag LOCUS_05590 gene pruA 5885 7510 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_05590 10823 7581 gene locus_tag LOCUS_05600 gene fpp1 10823 7581 CDS product metalloprotease Fpp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962407.1 protein_id gnl|my_center|LOCUS_05600 10866 11633 gene locus_tag LOCUS_05610 gene lipB 10866 11633 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_05610 12716 11664 gene locus_tag LOCUS_05620 12716 11664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_05620 13374 12775 gene locus_tag LOCUS_05630 gene rnhB 13374 12775 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_05630 13620 15515 gene locus_tag LOCUS_05640 13620 15515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_05640 17105 15621 gene locus_tag LOCUS_05650 17105 15621 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_05650 17184 18206 gene locus_tag LOCUS_05660 17184 18206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 19475 18276 gene locus_tag LOCUS_05670 19475 18276 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_05670 19633 20091 gene locus_tag LOCUS_05680 19633 20091 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_05680 22134 20125 gene locus_tag LOCUS_05690 22134 20125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 24300 22345 gene locus_tag LOCUS_05700 24300 22345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 26262 24340 gene locus_tag LOCUS_05710 26262 24340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 27142 26477 gene locus_tag LOCUS_05720 27142 26477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 27681 27229 gene locus_tag LOCUS_05730 gene dtd 27681 27229 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 protein_id gnl|my_center|LOCUS_05730 28653 27685 gene locus_tag LOCUS_05740 gene rsgA 28653 27685 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 protein_id gnl|my_center|LOCUS_05740 29664 28816 gene locus_tag LOCUS_05750 gene nadC 29664 28816 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_05750 31253 29685 gene locus_tag LOCUS_05760 31253 29685 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650Q3 protein_id gnl|my_center|LOCUS_05760 <31947 31258 gene locus_tag LOCUS_05770 <31947 31258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MG0:quinolinate synthase A >Feature sequence016 363 290 gene locus_tag LOCUS_t00080 363 290 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 476 1360 gene locus_tag LOCUS_05780 gene era 476 1360 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_05780 1450 2760 gene locus_tag LOCUS_05790 gene der 1450 2760 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_05790 3489 2770 gene locus_tag LOCUS_05800 3489 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 4095 3493 gene locus_tag LOCUS_05810 4095 3493 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_05810 4871 4098 gene locus_tag LOCUS_05820 4871 4098 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767683.1 protein_id gnl|my_center|LOCUS_05820 5216 5677 gene locus_tag LOCUS_05830 5216 5677 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_05830 5670 6206 gene locus_tag LOCUS_05840 gene msrA 5670 6206 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTB6 protein_id gnl|my_center|LOCUS_05840 6253 7809 gene locus_tag LOCUS_05850 6253 7809 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 protein_id gnl|my_center|LOCUS_05850 7853 8875 gene locus_tag LOCUS_05860 7853 8875 CDS product xanthine and CO dehydrogenase family maturation factor XdhC/CoxF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072950.1 protein_id gnl|my_center|LOCUS_05860 8879 9469 gene locus_tag LOCUS_05870 8879 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255388.1 protein_id gnl|my_center|LOCUS_05870 9529 9903 gene locus_tag LOCUS_05880 9529 9903 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_05880 10694 9942 gene locus_tag LOCUS_05890 10694 9942 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087367.1 protein_id gnl|my_center|LOCUS_05890 11777 10719 gene locus_tag LOCUS_05900 11777 10719 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_05900 12998 11781 gene locus_tag LOCUS_05910 12998 11781 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085773.1 protein_id gnl|my_center|LOCUS_05910 13783 13010 gene locus_tag LOCUS_05920 13783 13010 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267696.1 protein_id gnl|my_center|LOCUS_05920 15597 13783 gene locus_tag LOCUS_05930 15597 13783 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 protein_id gnl|my_center|LOCUS_05930 15938 15609 gene locus_tag LOCUS_05940 15938 15609 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_05940 16909 15938 gene locus_tag LOCUS_05950 16909 15938 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_05950 17226 16960 gene locus_tag LOCUS_05960 17226 16960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 17150 19687 gene locus_tag LOCUS_05970 gene alaS 17150 19687 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 protein_id gnl|my_center|LOCUS_05970 19769 20716 gene locus_tag LOCUS_05980 19769 20716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_05980 20861 21238 gene locus_tag LOCUS_05990 20861 21238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 21525 21250 gene locus_tag LOCUS_06000 21525 21250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 23309 21561 gene locus_tag LOCUS_06010 gene phhA 23309 21561 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964058.1 protein_id gnl|my_center|LOCUS_06010 23588 25084 gene locus_tag LOCUS_06020 gene gpmI 23588 25084 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_06020 25098 25622 gene locus_tag LOCUS_06030 25098 25622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 25622 26023 gene locus_tag LOCUS_06040 25622 26023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761508.1 protein_id gnl|my_center|LOCUS_06040 26082 26891 gene locus_tag LOCUS_06050 gene map 26082 26891 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_06050 26898 27671 gene locus_tag LOCUS_06060 26898 27671 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_06060 28674 27688 gene locus_tag LOCUS_06070 28674 27688 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_06070 28788 29636 gene locus_tag LOCUS_06080 28788 29636 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence017 431 1810 gene locus_tag LOCUS_06090 gene xylE 431 1810 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_06090 2311 2730 gene locus_tag LOCUS_06100 2311 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 2782 3522 gene locus_tag LOCUS_06110 2782 3522 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963597.1 protein_id gnl|my_center|LOCUS_06110 4907 3633 gene locus_tag LOCUS_06120 4907 3633 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_06120 6282 4897 gene locus_tag LOCUS_06130 6282 4897 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_06130 6931 6275 gene locus_tag LOCUS_06140 gene rpe 6931 6275 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_06140 7887 7024 gene locus_tag LOCUS_06150 gene rpoD 7887 7024 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_06150 8752 8138 gene locus_tag LOCUS_06160 8752 8138 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_06160 9495 8818 gene locus_tag LOCUS_06170 9495 8818 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_06170 11050 9488 gene locus_tag LOCUS_06180 11050 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 11187 12032 gene locus_tag LOCUS_06190 11187 12032 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_06190 12155 12976 gene locus_tag LOCUS_06200 12155 12976 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_06200 13019 15775 gene locus_tag LOCUS_06210 13019 15775 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_06210 15933 16826 gene locus_tag LOCUS_06220 gene gldA 15933 16826 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_06220 17996 16830 gene locus_tag LOCUS_06230 17996 16830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963930.1 protein_id gnl|my_center|LOCUS_06230 22377 18040 gene locus_tag LOCUS_06240 gene dnaE 22377 18040 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_06240 22653 23228 gene locus_tag LOCUS_06250 gene rpsP 22653 23228 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI4 protein_id gnl|my_center|LOCUS_06250 23248 23772 gene locus_tag LOCUS_06260 gene rimM 23248 23772 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_06260 23773 23858 gene locus_tag LOCUS_t00090 23773 23858 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23924 24646 gene locus_tag LOCUS_06270 23924 24646 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI6 protein_id gnl|my_center|LOCUS_06270 26011 24647 gene locus_tag LOCUS_06280 26011 24647 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_06280 26083 26463 gene locus_tag LOCUS_06290 26083 26463 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_06290 26558 28168 gene locus_tag LOCUS_06300 gene pckA 26558 28168 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CS25 protein_id gnl|my_center|LOCUS_06300 <29810 28234 gene locus_tag LOCUS_06310 <29810 28234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945413.1:sodium-translocating pyrophosphatase >Feature sequence018 61 927 gene locus_tag LOCUS_06320 61 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06320 939 1712 gene locus_tag LOCUS_06330 gene crt 939 1712 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_06330 2381 1797 gene locus_tag LOCUS_06340 2381 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 2587 3456 gene locus_tag LOCUS_06350 2587 3456 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_06350 3467 3640 gene locus_tag LOCUS_06360 3467 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 4300 3641 gene locus_tag LOCUS_06370 4300 3641 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_06370 4820 4401 gene locus_tag LOCUS_06380 gene yqiW 4820 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_06380 4965 5723 gene locus_tag LOCUS_06390 4965 5723 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656803.1 protein_id gnl|my_center|LOCUS_06390 5804 9211 gene locus_tag LOCUS_06400 gene ileS 5804 9211 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_06400 9217 9594 gene locus_tag LOCUS_06410 gene dksA 9217 9594 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_06410 9572 10240 gene locus_tag LOCUS_06420 gene lspA 9572 10240 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_06420 10393 12189 gene locus_tag LOCUS_06430 gene uvrC 10393 12189 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_06430 14501 12249 gene locus_tag LOCUS_06440 14501 12249 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PX3 protein_id gnl|my_center|LOCUS_06440 15752 14580 gene locus_tag LOCUS_06450 15752 14580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 16132 18951 gene locus_tag LOCUS_06460 16132 18951 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_06460 19081 21048 gene locus_tag LOCUS_06470 19081 21048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 21663 21166 gene locus_tag LOCUS_06480 21663 21166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 22209 21709 gene locus_tag LOCUS_06490 22209 21709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 25577 22278 gene locus_tag LOCUS_06500 25577 22278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_06500 26209 25715 gene locus_tag LOCUS_06510 gene ogt1 26209 25715 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN0 protein_id gnl|my_center|LOCUS_06510 26973 26209 gene locus_tag LOCUS_06520 26973 26209 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_06520 27074 28423 gene locus_tag LOCUS_06530 gene rhlE 27074 28423 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_06530 28426 28791 gene locus_tag LOCUS_06540 28426 28791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence019 359 1936 gene locus_tag LOCUS_06550 359 1936 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963474.1 protein_id gnl|my_center|LOCUS_06550 2273 5497 gene locus_tag LOCUS_06560 2273 5497 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404904.1 protein_id gnl|my_center|LOCUS_06560 5500 6939 gene locus_tag LOCUS_06570 5500 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_06570 7261 10533 gene locus_tag LOCUS_06580 7261 10533 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_06580 10557 12047 gene locus_tag LOCUS_06590 10557 12047 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202497.1 protein_id gnl|my_center|LOCUS_06590 12099 12815 gene locus_tag LOCUS_06600 12099 12815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 12899 13642 gene locus_tag LOCUS_06610 12899 13642 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_06610 14310 13639 gene locus_tag LOCUS_06620 14310 13639 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963478.1 protein_id gnl|my_center|LOCUS_06620 14388 15659 gene locus_tag LOCUS_06630 14388 15659 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_06630 16456 15656 gene locus_tag LOCUS_06640 16456 15656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 17796 16462 gene locus_tag LOCUS_06650 17796 16462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 18376 17831 gene locus_tag LOCUS_06660 18376 17831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 19243 18551 gene locus_tag LOCUS_06670 19243 18551 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_06670 19323 20528 gene locus_tag LOCUS_06680 19323 20528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 20521 21132 gene locus_tag LOCUS_06690 20521 21132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 22030 21122 gene locus_tag LOCUS_06700 22030 21122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 23336 22032 gene locus_tag LOCUS_06710 23336 22032 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582954.1 protein_id gnl|my_center|LOCUS_06710 24052 23366 gene locus_tag LOCUS_06720 gene radC 24052 23366 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_06720 24324 25670 gene locus_tag LOCUS_06730 24324 25670 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_06730 25744 27174 gene locus_tag LOCUS_06740 25744 27174 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_06740 28749 27664 gene locus_tag LOCUS_06750 28749 27664 CDS product adenosine monophosphate-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSZ0 protein_id gnl|my_center|LOCUS_06750 >Feature sequence020 2161 2745 gene locus_tag LOCUS_06760 2161 2745 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Q0 protein_id gnl|my_center|LOCUS_06760 3402 2878 gene locus_tag LOCUS_06770 3402 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 4305 3490 gene locus_tag LOCUS_06780 4305 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 4881 4306 gene locus_tag LOCUS_06790 4881 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 6150 5047 gene locus_tag LOCUS_06800 gene capI 6150 5047 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 protein_id gnl|my_center|LOCUS_06800 6847 6161 gene locus_tag LOCUS_06810 gene ftsE 6847 6161 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_06810 7005 10067 gene locus_tag LOCUS_06820 7005 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_06820 10074 11837 gene locus_tag LOCUS_06830 10074 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_06830 11891 12334 gene locus_tag LOCUS_06840 11891 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 15610 12506 gene locus_tag LOCUS_06850 15610 12506 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0E1 protein_id gnl|my_center|LOCUS_06850 16529 15762 gene locus_tag LOCUS_06860 gene trpA 16529 15762 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_06860 17717 16533 gene locus_tag LOCUS_06870 gene trpB 17717 16533 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_06870 18333 17719 gene locus_tag LOCUS_06880 gene trpF 18333 17719 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_06880 19124 18336 gene locus_tag LOCUS_06890 gene trpC 19124 18336 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_06890 19673 19155 gene locus_tag LOCUS_06900 19673 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06900 20144 19698 gene locus_tag LOCUS_06910 20144 19698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06910 20719 20144 gene locus_tag LOCUS_06920 gene pabA 20719 20144 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_06920 22112 20721 gene locus_tag LOCUS_06930 gene trpE 22112 20721 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_06930 25673 22338 gene locus_tag LOCUS_06940 25673 22338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 27073 25673 gene locus_tag LOCUS_06950 gene gatA 27073 25673 CDS product aspartyl/glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812377.1 protein_id gnl|my_center|LOCUS_06950 27342 27076 gene locus_tag LOCUS_06960 27342 27076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence021 1 210 gene locus_tag LOCUS_06970 1 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 1722 211 gene locus_tag LOCUS_06980 1722 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_06980 2807 1764 gene locus_tag LOCUS_06990 2807 1764 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_06990 3066 3317 gene locus_tag LOCUS_07000 gene rpmE 3066 3317 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_07000 6235 3395 gene locus_tag LOCUS_07010 gene gcvP 6235 3395 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_07010 6875 6675 gene locus_tag LOCUS_07020 6875 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 7363 9255 gene locus_tag LOCUS_07030 7363 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 10431 9334 gene locus_tag LOCUS_07040 10431 9334 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_07040 11153 10731 gene locus_tag LOCUS_07050 11153 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_07050 11826 11302 gene locus_tag LOCUS_07060 11826 11302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963203.1 protein_id gnl|my_center|LOCUS_07060 13884 11977 gene locus_tag LOCUS_07070 gene dnaK 13884 11977 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_07070 14211 15635 gene locus_tag LOCUS_07080 gene sdaA 14211 15635 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_07080 16457 15735 gene locus_tag LOCUS_07090 16457 15735 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_07090 16550 17434 gene locus_tag LOCUS_07100 16550 17434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 18189 17431 gene locus_tag LOCUS_07110 18189 17431 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ8 protein_id gnl|my_center|LOCUS_07110 18370 18909 gene locus_tag LOCUS_07120 18370 18909 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_07120 18954 19493 gene locus_tag LOCUS_07130 18954 19493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 19574 20446 gene locus_tag LOCUS_07140 19574 20446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 20486 20962 gene locus_tag LOCUS_07150 20486 20962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 21039 21884 gene locus_tag LOCUS_07160 21039 21884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 21944 22408 gene locus_tag LOCUS_07170 21944 22408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_07170 23469 22432 gene locus_tag LOCUS_07180 23469 22432 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_07180 23873 23496 gene locus_tag LOCUS_07190 23873 23496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07190 24171 25130 gene locus_tag LOCUS_07200 gene ddl 24171 25130 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD5 protein_id gnl|my_center|LOCUS_07200 25213 25668 gene locus_tag LOCUS_07210 gene coaD 25213 25668 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_07210 25716 27434 gene locus_tag LOCUS_07220 25716 27434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_07220 27431 27940 gene locus_tag LOCUS_07230 27431 27940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 28053 28517 gene locus_tag LOCUS_07240 28053 28517 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808116.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence022 769 200 gene locus_tag LOCUS_07250 769 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 1616 2461 gene locus_tag LOCUS_07260 1616 2461 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_07260 2475 4118 gene locus_tag LOCUS_07270 2475 4118 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_07270 4132 5967 gene locus_tag LOCUS_07280 4132 5967 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_07280 6688 6026 gene locus_tag LOCUS_07290 6688 6026 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_07290 7755 6709 gene locus_tag LOCUS_07300 gene paaE 7755 6709 CDS product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_07300 8758 7769 gene locus_tag LOCUS_07310 gene asd 8758 7769 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_07310 9042 10076 gene locus_tag LOCUS_07320 gene yceA 9042 10076 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL9 protein_id gnl|my_center|LOCUS_07320 10314 11669 gene locus_tag LOCUS_07330 gene fjo17 10314 11669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_07330 11701 12144 gene locus_tag LOCUS_07340 gene gldH 11701 12144 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_07340 12148 14430 gene locus_tag LOCUS_07350 gene mrcA 12148 14430 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_07350 14497 15198 gene locus_tag LOCUS_07360 gene atoD 14497 15198 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_07360 15201 15854 gene locus_tag LOCUS_07370 gene atoA 15201 15854 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_07370 15856 16083 gene locus_tag LOCUS_07380 15856 16083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 16084 16845 gene locus_tag LOCUS_07390 gene xth 16084 16845 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_07390 16884 18401 gene locus_tag LOCUS_07400 16884 18401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 18406 19389 gene locus_tag LOCUS_07410 18406 19389 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_07410 20387 19419 gene locus_tag LOCUS_07420 gene trpS 20387 19419 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_07420 20558 21265 gene locus_tag LOCUS_07430 20558 21265 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_07430 21262 21900 gene locus_tag LOCUS_07440 21262 21900 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_07440 22390 21917 gene locus_tag LOCUS_07450 22390 21917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_07450 22476 24806 gene locus_tag LOCUS_07460 22476 24806 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_07460 24806 25528 gene locus_tag LOCUS_07470 gene recO 24806 25528 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 protein_id gnl|my_center|LOCUS_07470 25528 28002 gene locus_tag LOCUS_07480 25528 28002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 protein_id gnl|my_center|LOCUS_07480 <28503 27992 gene locus_tag LOCUS_07490 <28503 27992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001031897.1:methyltransferase >Feature sequence023 594 929 gene locus_tag LOCUS_07500 594 929 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 protein_id gnl|my_center|LOCUS_07500 932 1987 gene locus_tag LOCUS_07510 932 1987 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_07510 2045 2698 gene locus_tag LOCUS_07520 2045 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_07520 2710 3525 gene locus_tag LOCUS_07530 gene deoD 2710 3525 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH2 protein_id gnl|my_center|LOCUS_07530 3522 4490 gene locus_tag LOCUS_07540 3522 4490 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_07540 4524 4949 gene locus_tag LOCUS_07550 4524 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403019.1 protein_id gnl|my_center|LOCUS_07550 5032 5730 gene locus_tag LOCUS_07560 5032 5730 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_07560 5787 7220 gene locus_tag LOCUS_07570 5787 7220 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_07570 7370 8575 gene locus_tag LOCUS_07580 7370 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_07580 8641 9669 gene locus_tag LOCUS_07590 8641 9669 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_07590 9694 10506 gene locus_tag LOCUS_07600 9694 10506 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_07600 11344 10514 gene locus_tag LOCUS_07610 11344 10514 CDS product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 protein_id gnl|my_center|LOCUS_07610 12282 11341 gene locus_tag LOCUS_07620 gene acdS 12282 11341 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_07620 14266 12350 gene locus_tag LOCUS_07630 14266 12350 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_07630 14664 14521 gene locus_tag LOCUS_07640 14664 14521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 15743 14703 gene locus_tag LOCUS_07650 gene fjo30 15743 14703 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_07650 16637 15819 gene locus_tag LOCUS_07660 gene gldN 16637 15819 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_07660 18160 16691 gene locus_tag LOCUS_07670 gene gldM 18160 16691 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_07670 18911 18273 gene locus_tag LOCUS_07680 gene gldL 18911 18273 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_07680 20305 18935 gene locus_tag LOCUS_07690 gene gldK 20305 18935 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_07690 21566 20403 gene locus_tag LOCUS_07700 gene fjo29 21566 20403 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_07700 24095 21612 gene locus_tag LOCUS_07710 gene topA 24095 21612 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_07710 24288 25742 gene locus_tag LOCUS_07720 gene miaB 24288 25742 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_07720 25778 27001 gene locus_tag LOCUS_07730 25778 27001 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_07730 27005 27511 gene locus_tag LOCUS_07740 27005 27511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_07740 27505 28257 gene locus_tag LOCUS_07750 27505 28257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence024 <1 819 gene locus_tag LOCUS_07760 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXI6:dihydrolipoyl dehydrogenase 1795 941 gene locus_tag LOCUS_07770 gene rlmF 1795 941 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKF9 protein_id gnl|my_center|LOCUS_07770 3387 1795 gene locus_tag LOCUS_07780 gene bshC 3387 1795 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_07780 4843 3524 gene locus_tag LOCUS_07790 gene rimO 4843 3524 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_07790 5080 6924 gene locus_tag LOCUS_07800 5080 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_07800 6944 7429 gene locus_tag LOCUS_07810 6944 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 8418 7465 gene locus_tag LOCUS_07820 gene ftsY 8418 7465 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 protein_id gnl|my_center|LOCUS_07820 8752 8600 gene locus_tag LOCUS_07830 8752 8600 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_07830 8985 8803 gene locus_tag LOCUS_07840 gene rpmG 8985 8803 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_07840 9252 9013 gene locus_tag LOCUS_07850 gene rpmB 9252 9013 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_07850 10581 9340 gene locus_tag LOCUS_07860 10581 9340 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 protein_id gnl|my_center|LOCUS_07860 10692 11579 gene locus_tag LOCUS_07870 10692 11579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 12243 11635 gene locus_tag LOCUS_07880 12243 11635 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_07880 13120 12251 gene locus_tag LOCUS_07890 gene purU 13120 12251 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67681 protein_id gnl|my_center|LOCUS_07890 14073 13234 gene locus_tag LOCUS_07900 gene menB 14073 13234 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_07900 14141 15298 gene locus_tag LOCUS_07910 14141 15298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 15745 15326 gene locus_tag LOCUS_07920 15745 15326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 17403 15745 gene locus_tag LOCUS_07930 gene menD 17403 15745 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_07930 18131 17478 gene locus_tag LOCUS_07940 gene tal 18131 17478 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_07940 19144 18341 gene locus_tag LOCUS_07950 19144 18341 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_07950 19492 20013 gene locus_tag LOCUS_07960 19492 20013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 20094 21050 gene locus_tag LOCUS_07970 20094 21050 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_07970 21094 22809 gene locus_tag LOCUS_07980 21094 22809 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 protein_id gnl|my_center|LOCUS_07980 22809 24638 gene locus_tag LOCUS_07990 gene msbA 22809 24638 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_07990 26042 24630 gene locus_tag LOCUS_08000 gene cca 26042 24630 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence025 1977 469 gene locus_tag LOCUS_08010 1977 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 3582 2002 gene locus_tag LOCUS_08020 3582 2002 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_08020 6710 3594 gene locus_tag LOCUS_08030 6710 3594 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_08030 9711 6967 gene locus_tag LOCUS_08040 9711 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_08040 11227 10226 gene locus_tag LOCUS_08050 gene holA 11227 10226 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_08050 11245 11691 gene locus_tag LOCUS_08060 11245 11691 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_08060 11757 12755 gene locus_tag LOCUS_08070 11757 12755 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_08070 13415 12798 gene locus_tag LOCUS_08080 13415 12798 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_08080 14185 13484 gene locus_tag LOCUS_08090 gene rprY 14185 13484 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_08090 15770 14202 gene locus_tag LOCUS_08100 gene rprX 15770 14202 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_08100 16470 15871 gene locus_tag LOCUS_08110 gene coaE 16470 15871 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_08110 17410 16472 gene locus_tag LOCUS_08120 17410 16472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 17834 17517 gene locus_tag LOCUS_08130 gene yajC 17834 17517 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_08130 18304 17837 gene locus_tag LOCUS_08140 18304 17837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_08140 19296 18358 gene locus_tag LOCUS_08150 gene nusB 19296 18358 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_08150 19492 21252 gene locus_tag LOCUS_08160 19492 21252 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_08160 21323 21688 gene locus_tag LOCUS_08170 21323 21688 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_08170 22730 21783 gene locus_tag LOCUS_08180 gene menF 22730 21783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 protein_id gnl|my_center|LOCUS_08180 23259 22843 gene locus_tag LOCUS_08190 23259 22843 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_08190 23331 23831 gene locus_tag LOCUS_08200 23331 23831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_08200 23958 24857 gene locus_tag LOCUS_08210 23958 24857 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_08210 24880 25722 gene locus_tag LOCUS_08220 24880 25722 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence026 3992 1563 gene locus_tag LOCUS_08230 3992 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 7073 4242 gene locus_tag LOCUS_08240 7073 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_08240 7733 7293 gene locus_tag LOCUS_08250 7733 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 7957 9093 gene locus_tag LOCUS_08260 7957 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 9592 9422 gene locus_tag LOCUS_08270 9592 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 10293 9796 gene locus_tag LOCUS_08280 10293 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 11340 10411 gene locus_tag LOCUS_08290 11340 10411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 12089 11613 gene locus_tag LOCUS_08300 12089 11613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 13439 12117 gene locus_tag LOCUS_08310 13439 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 14729 13725 gene locus_tag LOCUS_08320 14729 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 15512 15009 gene locus_tag LOCUS_08330 15512 15009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 15687 15496 gene locus_tag LOCUS_08340 15687 15496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 16148 15771 gene locus_tag LOCUS_08350 16148 15771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 16578 17069 gene locus_tag LOCUS_08360 16578 17069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 18124 17225 gene locus_tag LOCUS_08370 18124 17225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 23991 18490 gene locus_tag LOCUS_08380 23991 18490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 24320 25597 gene locus_tag LOCUS_08390 24320 25597 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434922.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence027 63 566 gene locus_tag LOCUS_08400 gene udk 63 566 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 protein_id gnl|my_center|LOCUS_08400 659 889 gene locus_tag LOCUS_08410 659 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 890 2236 gene locus_tag LOCUS_08420 gene mutA 890 2236 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963259.1 protein_id gnl|my_center|LOCUS_08420 2286 4349 gene locus_tag LOCUS_08430 gene mutB 2286 4349 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 protein_id gnl|my_center|LOCUS_08430 4609 7716 gene locus_tag LOCUS_08440 gene ccsBA 4609 7716 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_08440 7775 8290 gene locus_tag LOCUS_08450 7775 8290 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 protein_id gnl|my_center|LOCUS_08450 9813 8359 gene locus_tag LOCUS_08460 9813 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 11486 9951 gene locus_tag LOCUS_08470 gene guaA 11486 9951 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_08470 12650 11586 gene locus_tag LOCUS_08480 gene fabH1 12650 11586 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_08480 13428 12946 gene locus_tag LOCUS_08490 gene cdd 13428 12946 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_08490 14634 13507 gene locus_tag LOCUS_08500 gene porV 14634 13507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_08500 17998 14675 gene locus_tag LOCUS_08510 gene porU 17998 14675 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_08510 18278 19909 gene locus_tag LOCUS_08520 gene gldJ 18278 19909 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_08520 20069 21232 gene locus_tag LOCUS_08530 gene murF 20069 21232 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_08530 22076 21225 gene locus_tag LOCUS_08540 22076 21225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_08540 23258 22167 gene locus_tag LOCUS_08550 23258 22167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 24386 23265 gene locus_tag LOCUS_08560 24386 23265 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_08560 24963 24361 gene locus_tag LOCUS_08570 24963 24361 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence028 309 61 gene locus_tag LOCUS_08580 309 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 484 1563 gene locus_tag LOCUS_08590 484 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2041 3330 gene locus_tag LOCUS_08600 2041 3330 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107431.1 protein_id gnl|my_center|LOCUS_08600 3330 4991 gene locus_tag LOCUS_08610 3330 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 5190 6704 gene locus_tag LOCUS_08620 5190 6704 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_08620 6786 10595 gene locus_tag LOCUS_08630 6786 10595 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_08630 10799 13951 gene locus_tag LOCUS_08640 10799 13951 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_08640 13962 15551 gene locus_tag LOCUS_08650 13962 15551 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_08650 15627 17060 gene locus_tag LOCUS_08660 gene arsB 15627 17060 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122841.1 protein_id gnl|my_center|LOCUS_08660 17191 17517 gene locus_tag LOCUS_08670 17191 17517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 17529 18527 gene locus_tag LOCUS_08680 17529 18527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 18635 20179 gene locus_tag LOCUS_08690 18635 20179 CDS product N-acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109363.1 protein_id gnl|my_center|LOCUS_08690 20179 20316 gene locus_tag LOCUS_08700 20179 20316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 20326 22281 gene locus_tag LOCUS_08710 20326 22281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 22340 23848 gene locus_tag LOCUS_08720 22340 23848 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118737.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence029 1159 494 gene locus_tag LOCUS_08730 gene modB 1159 494 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_08730 1918 1163 gene locus_tag LOCUS_08740 gene modA 1918 1163 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881043.1 protein_id gnl|my_center|LOCUS_08740 2678 1911 gene locus_tag LOCUS_08750 2678 1911 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81AW6 protein_id gnl|my_center|LOCUS_08750 3637 2681 gene locus_tag LOCUS_08760 3637 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 4448 3618 gene locus_tag LOCUS_08770 4448 3618 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979322.1 protein_id gnl|my_center|LOCUS_08770 5253 4450 gene locus_tag LOCUS_08780 gene pyrH 5253 4450 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65938 protein_id gnl|my_center|LOCUS_08780 6261 5761 gene locus_tag LOCUS_08790 6261 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08790 6886 7317 gene locus_tag LOCUS_08800 6886 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 8698 7442 gene locus_tag LOCUS_08810 8698 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 9049 10086 gene locus_tag LOCUS_08820 9049 10086 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_08820 11704 10121 gene locus_tag LOCUS_08830 11704 10121 CDS product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562367.1 protein_id gnl|my_center|LOCUS_08830 12791 11694 gene locus_tag LOCUS_08840 12791 11694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721245.1 protein_id gnl|my_center|LOCUS_08840 13995 12778 gene locus_tag LOCUS_08850 13995 12778 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721244.1 protein_id gnl|my_center|LOCUS_08850 14324 14004 gene locus_tag LOCUS_08860 14324 14004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 16217 14562 gene locus_tag LOCUS_08870 16217 14562 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_08870 18285 16219 gene locus_tag LOCUS_08880 18285 16219 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_08880 19557 18355 gene locus_tag LOCUS_08890 19557 18355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 22303 19931 gene locus_tag LOCUS_08900 22303 19931 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388620.1 protein_id gnl|my_center|LOCUS_08900 25034 22509 gene locus_tag LOCUS_08910 25034 22509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence030 <1 1337 gene locus_tag LOCUS_08920 <1 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A6L7:3-isopropylmalate dehydratase large subunit 1428 2027 gene locus_tag LOCUS_08930 1428 2027 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_08930 2048 3571 gene locus_tag LOCUS_08940 2048 3571 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_08940 3677 4732 gene locus_tag LOCUS_08950 gene leuB 3677 4732 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54354 protein_id gnl|my_center|LOCUS_08950 7017 4810 gene locus_tag LOCUS_08960 7017 4810 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG0 protein_id gnl|my_center|LOCUS_08960 7055 7720 gene locus_tag LOCUS_08970 gene ung2 7055 7720 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_08970 8819 7947 gene locus_tag LOCUS_08980 gene udp 8819 7947 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_08980 9214 8891 gene locus_tag LOCUS_08990 9214 8891 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963176.1 protein_id gnl|my_center|LOCUS_08990 10222 9275 gene locus_tag LOCUS_09000 10222 9275 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_09000 10980 10273 gene locus_tag LOCUS_09010 10980 10273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_09010 11395 10961 gene locus_tag LOCUS_09020 11395 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 11774 11418 gene locus_tag LOCUS_09030 11774 11418 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PF1 protein_id gnl|my_center|LOCUS_09030 13252 11798 gene locus_tag LOCUS_09040 13252 11798 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97J51 protein_id gnl|my_center|LOCUS_09040 13435 14730 gene locus_tag LOCUS_09050 gene rocD 13435 14730 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_09050 14842 15279 gene locus_tag LOCUS_09060 14842 15279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 15367 16440 gene locus_tag LOCUS_09070 15367 16440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09070 16465 17550 gene locus_tag LOCUS_09080 16465 17550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09080 17702 18697 gene locus_tag LOCUS_09090 17702 18697 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963027.1 protein_id gnl|my_center|LOCUS_09090 18782 20029 gene locus_tag LOCUS_09100 18782 20029 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_09100 20300 21001 gene locus_tag LOCUS_09110 20300 21001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 21627 21019 gene locus_tag LOCUS_09120 21627 21019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 22117 21620 gene locus_tag LOCUS_09130 22117 21620 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763967.1 protein_id gnl|my_center|LOCUS_09130 22419 22225 gene locus_tag LOCUS_09140 22419 22225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 22546 23298 gene locus_tag LOCUS_09150 22546 23298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence031 472 1431 gene locus_tag LOCUS_09160 472 1431 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272791.1 protein_id gnl|my_center|LOCUS_09160 1449 3119 gene locus_tag LOCUS_09170 1449 3119 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263346.1 protein_id gnl|my_center|LOCUS_09170 3688 3116 gene locus_tag LOCUS_09180 3688 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4338 3712 gene locus_tag LOCUS_09190 gene aat 4338 3712 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H233 protein_id gnl|my_center|LOCUS_09190 4454 5077 gene locus_tag LOCUS_09200 4454 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 5098 5343 gene locus_tag LOCUS_09210 5098 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 5820 5452 gene locus_tag LOCUS_09220 5820 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_09220 6686 5826 gene locus_tag LOCUS_09230 6686 5826 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_09230 6764 7915 gene locus_tag LOCUS_09240 gene porY 6764 7915 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_09240 8333 7944 gene locus_tag LOCUS_09250 8333 7944 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_09250 8871 8398 gene locus_tag LOCUS_09260 gene greA 8871 8398 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_09260 9061 9486 gene locus_tag LOCUS_09270 9061 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 9540 10697 gene locus_tag LOCUS_09280 gene purK 9540 10697 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_09280 10700 11179 gene locus_tag LOCUS_09290 gene purE 10700 11179 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_09290 11219 13234 gene locus_tag LOCUS_09300 gene dcp1 11219 13234 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_09300 13413 13979 gene locus_tag LOCUS_09310 13413 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 15223 13976 gene locus_tag LOCUS_09320 15223 13976 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_09320 15697 15224 gene locus_tag LOCUS_09330 15697 15224 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_09330 15821 17221 gene locus_tag LOCUS_09340 gene lpdA1 15821 17221 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_09340 17299 18633 gene locus_tag LOCUS_09350 gene pabB 17299 18633 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_09350 18608 18841 gene locus_tag LOCUS_09360 18608 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 18863 20173 gene locus_tag LOCUS_09370 gene tilS 18863 20173 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_09370 20349 22928 gene locus_tag LOCUS_09380 gene ppc 20349 22928 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DPW5 protein_id gnl|my_center|LOCUS_09380 >Feature sequence032 3 623 gene locus_tag LOCUS_09390 3 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 684 1157 gene locus_tag LOCUS_09400 gene rplQ 684 1157 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ72 protein_id gnl|my_center|LOCUS_09400 1256 2374 gene locus_tag LOCUS_09410 gene carA 1256 2374 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_09410 2502 3788 gene locus_tag LOCUS_09420 gene eno 2502 3788 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_09420 3954 5240 gene locus_tag LOCUS_09430 gene gltA 3954 5240 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_09430 5303 6217 gene locus_tag LOCUS_09440 5303 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_09440 7096 6326 gene locus_tag LOCUS_09450 7096 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963060.1 protein_id gnl|my_center|LOCUS_09450 8364 7060 gene locus_tag LOCUS_09460 8364 7060 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_09460 9037 8342 gene locus_tag LOCUS_09470 9037 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 9159 9941 gene locus_tag LOCUS_09480 9159 9941 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_09480 10022 10537 gene locus_tag LOCUS_09490 10022 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 11911 10676 gene locus_tag LOCUS_09500 11911 10676 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963811.1 protein_id gnl|my_center|LOCUS_09500 12667 12026 gene locus_tag LOCUS_09510 12667 12026 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_09510 13019 12693 gene locus_tag LOCUS_09520 13019 12693 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963234.1 protein_id gnl|my_center|LOCUS_09520 14282 13029 gene locus_tag LOCUS_09530 gene pyrC2 14282 13029 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_09530 16228 14279 gene locus_tag LOCUS_09540 16228 14279 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_09540 17058 16294 gene locus_tag LOCUS_09550 17058 16294 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_09550 17731 17063 gene locus_tag LOCUS_09560 gene lolD 17731 17063 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_09560 18026 19225 gene locus_tag LOCUS_09570 gene sucC 18026 19225 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_09570 21296 19308 gene locus_tag LOCUS_09580 gene uvrB 21296 19308 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY25 protein_id gnl|my_center|LOCUS_09580 >Feature sequence033 161 349 gene locus_tag LOCUS_09590 161 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2755 416 gene locus_tag LOCUS_09600 2755 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3032 3457 gene locus_tag LOCUS_09610 3032 3457 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_09610 3645 5330 gene locus_tag LOCUS_09620 gene recJ 3645 5330 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_09620 7739 5334 gene locus_tag LOCUS_09630 7739 5334 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202769.1 protein_id gnl|my_center|LOCUS_09630 9043 7838 gene locus_tag LOCUS_09640 gene sucB 9043 7838 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_09640 11877 9145 gene locus_tag LOCUS_09650 gene sucA 11877 9145 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_09650 12064 12138 gene locus_tag LOCUS_t00100 12064 12138 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 12477 13313 gene locus_tag LOCUS_09660 gene lpqC 12477 13313 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_09660 16245 13945 gene locus_tag LOCUS_09670 gene wzc 16245 13945 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_09670 16919 16245 gene locus_tag LOCUS_09680 16919 16245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 18743 17190 gene locus_tag LOCUS_09690 18743 17190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 20513 19254 gene locus_tag LOCUS_09700 gene metK 20513 19254 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_09700 >Feature sequence034 864 2042 gene locus_tag LOCUS_09710 864 2042 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257181.1 protein_id gnl|my_center|LOCUS_09710 2072 2776 gene locus_tag LOCUS_09720 gene truC 2072 2776 CDS product tRNA pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTL4 protein_id gnl|my_center|LOCUS_09720 3984 2980 gene locus_tag LOCUS_09730 3984 2980 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_09730 6007 4016 gene locus_tag LOCUS_09740 gene bfmBA 6007 4016 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_09740 6601 6122 gene locus_tag LOCUS_09750 6601 6122 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 protein_id gnl|my_center|LOCUS_09750 7734 6685 gene locus_tag LOCUS_09760 7734 6685 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_09760 8080 8421 gene locus_tag LOCUS_09770 8080 8421 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_09770 10849 8453 gene locus_tag LOCUS_09780 10849 8453 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763369.1 protein_id gnl|my_center|LOCUS_09780 11583 11044 gene locus_tag LOCUS_09790 11583 11044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 12152 11655 gene locus_tag LOCUS_09800 12152 11655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 12587 12180 gene locus_tag LOCUS_09810 12587 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 13083 12574 gene locus_tag LOCUS_09820 13083 12574 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_09820 13230 14690 gene locus_tag LOCUS_09830 13230 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 15706 14750 gene locus_tag LOCUS_09840 15706 14750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 15857 16594 gene locus_tag LOCUS_09850 15857 16594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09850 16578 16799 gene locus_tag LOCUS_09860 16578 16799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09860 16801 17355 gene locus_tag LOCUS_09870 16801 17355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 17352 18599 gene locus_tag LOCUS_09880 gene pepT 17352 18599 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W1 protein_id gnl|my_center|LOCUS_09880 19270 18731 gene locus_tag LOCUS_09890 19270 18731 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence035 625 1848 gene locus_tag LOCUS_09900 625 1848 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_09900 1936 2229 gene locus_tag LOCUS_09910 1936 2229 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_09910 2959 2315 gene locus_tag LOCUS_09920 2959 2315 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_09920 6044 2967 gene locus_tag LOCUS_09930 6044 2967 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 protein_id gnl|my_center|LOCUS_09930 6215 6287 gene locus_tag LOCUS_t00110 6215 6287 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7635 6352 gene locus_tag LOCUS_09940 7635 6352 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_09940 8582 7644 gene locus_tag LOCUS_09950 gene thrB 8582 7644 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_09950 11024 8586 gene locus_tag LOCUS_09960 gene thrA 11024 8586 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_09960 12908 11349 gene locus_tag LOCUS_09970 12908 11349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 13039 14214 gene locus_tag LOCUS_09980 13039 14214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 14321 15442 gene locus_tag LOCUS_09990 gene leuB 14321 15442 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M0 protein_id gnl|my_center|LOCUS_09990 15759 17435 gene locus_tag LOCUS_10000 gene ilvD 15759 17435 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 protein_id gnl|my_center|LOCUS_10000 17486 19219 gene locus_tag LOCUS_10010 gene ilvB 17486 19219 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_10010 19222 19752 gene locus_tag LOCUS_10020 gene ilvH 19222 19752 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence036 325 1254 gene locus_tag LOCUS_10030 gene ppiC 325 1254 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_10030 1448 2335 gene locus_tag LOCUS_10040 1448 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 3805 2435 gene locus_tag LOCUS_10050 3805 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_10050 3999 4538 gene locus_tag LOCUS_10060 gene pyrR1 3999 4538 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_10060 4541 5470 gene locus_tag LOCUS_10070 gene pyrB 4541 5470 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_10070 5474 5806 gene locus_tag LOCUS_10080 5474 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963901.1 protein_id gnl|my_center|LOCUS_10080 5855 6772 gene locus_tag LOCUS_10090 gene rnz 5855 6772 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_10090 8224 6929 gene locus_tag LOCUS_10100 8224 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 8372 8839 gene locus_tag LOCUS_10110 8372 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_10110 8803 9174 gene locus_tag LOCUS_10120 gene csaA 8803 9174 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355771.1 protein_id gnl|my_center|LOCUS_10120 9379 9179 gene locus_tag LOCUS_10130 9379 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 10045 9431 gene locus_tag LOCUS_10140 10045 9431 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 protein_id gnl|my_center|LOCUS_10140 11134 10100 gene locus_tag LOCUS_10150 gene pyrD 11134 10100 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_10150 11344 12129 gene locus_tag LOCUS_10160 11344 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231174.2 protein_id gnl|my_center|LOCUS_10160 13393 12158 gene locus_tag LOCUS_10170 13393 12158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_10170 13365 14672 gene locus_tag LOCUS_10180 13365 14672 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_10180 14771 16141 gene locus_tag LOCUS_10190 14771 16141 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963328.1 protein_id gnl|my_center|LOCUS_10190 16373 16185 gene locus_tag LOCUS_10200 16373 16185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 16921 16397 gene locus_tag LOCUS_10210 16921 16397 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_10210 17131 18909 gene locus_tag LOCUS_10220 gene argS 17131 18909 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 protein_id gnl|my_center|LOCUS_10220 >Feature sequence037 <1 899 gene locus_tag LOCUS_10230 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000692504.1:glycosyltransferase family 4 protein 901 2295 gene locus_tag LOCUS_10240 901 2295 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_10240 2292 3509 gene locus_tag LOCUS_10250 2292 3509 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582958.1 protein_id gnl|my_center|LOCUS_10250 3901 4920 gene locus_tag LOCUS_10260 3901 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 6078 4900 gene locus_tag LOCUS_10270 6078 4900 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_10270 7162 6083 gene locus_tag LOCUS_10280 7162 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_10280 8216 7233 gene locus_tag LOCUS_10290 8216 7233 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_10290 8313 9044 gene locus_tag LOCUS_10300 gene pssA 8313 9044 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_10300 9800 9063 gene locus_tag LOCUS_10310 gene lptB 9800 9063 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_10310 10194 9835 gene locus_tag LOCUS_10320 10194 9835 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_10320 10996 10169 gene locus_tag LOCUS_10330 gene tatC 10996 10169 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_10330 12018 10996 gene locus_tag LOCUS_10340 gene kdsD 12018 10996 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_10340 12099 14279 gene locus_tag LOCUS_10350 gene recQ1 12099 14279 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 protein_id gnl|my_center|LOCUS_10350 14974 14297 gene locus_tag LOCUS_10360 14974 14297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_10360 15696 14971 gene locus_tag LOCUS_10370 15696 14971 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_10370 15802 17001 gene locus_tag LOCUS_10380 15802 17001 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_10380 18585 17077 gene locus_tag LOCUS_10390 gene yidC 18585 17077 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U2 protein_id gnl|my_center|LOCUS_10390 >Feature sequence038 1331 657 gene locus_tag LOCUS_10400 gene neuA 1331 657 CDS product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963389.1 protein_id gnl|my_center|LOCUS_10400 2318 1350 gene locus_tag LOCUS_10410 2318 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 2766 2437 gene locus_tag LOCUS_10420 2766 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4182 3022 gene locus_tag LOCUS_10430 gene rffE 4182 3022 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NF91 protein_id gnl|my_center|LOCUS_10430 5096 4179 gene locus_tag LOCUS_10440 5096 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 6373 5495 gene locus_tag LOCUS_10450 6373 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 7221 6370 gene locus_tag LOCUS_10460 7221 6370 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ30 protein_id gnl|my_center|LOCUS_10460 7363 9057 gene locus_tag LOCUS_10470 7363 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 9100 9570 gene locus_tag LOCUS_10480 9100 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 9992 9579 gene locus_tag LOCUS_10490 gene aroQ 9992 9579 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_10490 10315 10073 gene locus_tag LOCUS_10500 10315 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 10725 11621 gene locus_tag LOCUS_10510 gene xerD 10725 11621 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_10510 13161 11668 gene locus_tag LOCUS_10520 gene rny 13161 11668 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 protein_id gnl|my_center|LOCUS_10520 13757 13467 gene locus_tag LOCUS_10530 13757 13467 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 protein_id gnl|my_center|LOCUS_10530 14061 13771 gene locus_tag LOCUS_10540 14061 13771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963282.1 protein_id gnl|my_center|LOCUS_10540 14240 15913 gene locus_tag LOCUS_10550 14240 15913 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_10550 15976 18366 gene locus_tag LOCUS_10560 15976 18366 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence039 <1 1067 gene locus_tag LOCUS_10570 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262768.1:cation acetate symporter 1142 2182 gene locus_tag LOCUS_10580 1142 2182 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_10580 2249 4156 gene locus_tag LOCUS_10590 gene acsA 2249 4156 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_10590 6122 4185 gene locus_tag LOCUS_10600 6122 4185 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_10600 6946 6233 gene locus_tag LOCUS_10610 6946 6233 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_10610 8408 7101 gene locus_tag LOCUS_10620 8408 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 9391 13035 gene locus_tag LOCUS_10630 9391 13035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 13905 13072 gene locus_tag LOCUS_10640 13905 13072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 14862 13945 gene locus_tag LOCUS_10650 14862 13945 CDS product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_10650 15792 14866 gene locus_tag LOCUS_10660 gene mvaK 15792 14866 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_10660 16257 15850 gene locus_tag LOCUS_10670 16257 15850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 16784 16272 gene locus_tag LOCUS_10680 16784 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence040 481 29 gene locus_tag LOCUS_10690 481 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 614 1069 gene locus_tag LOCUS_10700 614 1069 CDS product GAF domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_10700 1430 2956 gene locus_tag LOCUS_10710 gene purH 1430 2956 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_10710 3034 4062 gene locus_tag LOCUS_10720 gene mreB 3034 4062 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_10720 4082 4909 gene locus_tag LOCUS_10730 gene mreC 4082 4909 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 protein_id gnl|my_center|LOCUS_10730 4902 5405 gene locus_tag LOCUS_10740 gene mreD 4902 5405 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_10740 5405 7261 gene locus_tag LOCUS_10750 gene pbpA 5405 7261 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_10750 7276 8556 gene locus_tag LOCUS_10760 gene rodA 7276 8556 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_10760 9746 8670 gene locus_tag LOCUS_10770 gene prfA 9746 8670 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_10770 11122 9944 gene locus_tag LOCUS_10780 gene purM 11122 9944 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_10780 13379 11196 gene locus_tag LOCUS_10790 gene glnA 13379 11196 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_10790 13549 14574 gene locus_tag LOCUS_10800 gene glnII 13549 14574 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_10800 15590 14634 gene locus_tag LOCUS_10810 gene yrbG 15590 14634 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_10810 15645 15908 gene locus_tag LOCUS_10820 15645 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 15916 16146 gene locus_tag LOCUS_10830 15916 16146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 16206 16280 gene locus_tag LOCUS_t00120 16206 16280 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence041 369 1352 gene locus_tag LOCUS_10840 369 1352 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_10840 1929 1417 gene locus_tag LOCUS_10850 1929 1417 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963696.1 protein_id gnl|my_center|LOCUS_10850 2718 1939 gene locus_tag LOCUS_10860 2718 1939 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_10860 2801 5539 gene locus_tag LOCUS_10870 2801 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_10870 5611 6960 gene locus_tag LOCUS_10880 5611 6960 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029304.1 protein_id gnl|my_center|LOCUS_10880 7061 7828 gene locus_tag LOCUS_10890 7061 7828 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_10890 7870 8427 gene locus_tag LOCUS_10900 7870 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 9613 8471 gene locus_tag LOCUS_10910 gene holB 9613 8471 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_10910 9723 10913 gene locus_tag LOCUS_10920 gene pgk 9723 10913 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_10920 11023 12063 gene locus_tag LOCUS_10930 11023 12063 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105677.1 protein_id gnl|my_center|LOCUS_10930 12423 12115 gene locus_tag LOCUS_10940 12423 12115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962578.1 protein_id gnl|my_center|LOCUS_10940 14137 12452 gene locus_tag LOCUS_10950 gene glnS 14137 12452 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_10950 14403 14155 gene locus_tag LOCUS_10960 14403 14155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence042 1864 755 gene locus_tag LOCUS_10970 1864 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2278 1865 gene locus_tag LOCUS_10980 2278 1865 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_10980 2839 2282 gene locus_tag LOCUS_10990 2839 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_10990 4074 2842 gene locus_tag LOCUS_11000 gene kdtA 4074 2842 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_11000 4431 4171 gene locus_tag LOCUS_11010 gene rpmA 4431 4171 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P8 protein_id gnl|my_center|LOCUS_11010 4962 4459 gene locus_tag LOCUS_11020 4962 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 5988 5116 gene locus_tag LOCUS_11030 gene fjo11 5988 5116 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_11030 6143 6433 gene locus_tag LOCUS_11040 6143 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 7258 6500 gene locus_tag LOCUS_11050 7258 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11050 8041 7259 gene locus_tag LOCUS_11060 8041 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11060 8286 8855 gene locus_tag LOCUS_11070 8286 8855 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_11070 8911 10533 gene locus_tag LOCUS_11080 8911 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_11080 10607 11392 gene locus_tag LOCUS_11090 10607 11392 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962446.1 protein_id gnl|my_center|LOCUS_11090 11857 11402 gene locus_tag LOCUS_11100 11857 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_11100 11948 12247 gene locus_tag LOCUS_11110 11948 12247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 13244 12240 gene locus_tag LOCUS_11120 13244 12240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 14234 13245 gene locus_tag LOCUS_11130 14234 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 15023 14244 gene locus_tag LOCUS_11140 15023 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963207.1 protein_id gnl|my_center|LOCUS_11140 15124 15747 gene locus_tag LOCUS_11150 gene tdk 15124 15747 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_11150 >Feature sequence043 223 648 gene locus_tag LOCUS_11160 223 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1474 788 gene locus_tag LOCUS_11170 1474 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 3502 1727 gene locus_tag LOCUS_11180 gene fadD 3502 1727 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_11180 5332 3575 gene locus_tag LOCUS_11190 gene fadD 5332 3575 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_11190 9204 5515 gene locus_tag LOCUS_11200 gene purL 9204 5515 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXH5 protein_id gnl|my_center|LOCUS_11200 11459 9372 gene locus_tag LOCUS_11210 11459 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 13674 11509 gene locus_tag LOCUS_11220 13674 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 14966 13755 gene locus_tag LOCUS_11230 gene rsmB 14966 13755 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence044 1038 136 gene locus_tag LOCUS_11240 1038 136 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_11240 2481 1162 gene locus_tag LOCUS_11250 2481 1162 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_11250 2969 2715 gene locus_tag LOCUS_11260 2969 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11260 3406 2951 gene locus_tag LOCUS_11270 3406 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11270 4583 3729 gene locus_tag LOCUS_11280 4583 3729 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963287.1 protein_id gnl|my_center|LOCUS_11280 5314 4583 gene locus_tag LOCUS_11290 5314 4583 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_11290 7125 5317 gene locus_tag LOCUS_11300 gene mutL 7125 5317 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_11300 7400 7125 gene locus_tag LOCUS_11310 7400 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 8058 7552 gene locus_tag LOCUS_11320 gene ribH 8058 7552 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_11320 8876 8112 gene locus_tag LOCUS_11330 8876 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_11330 8989 10074 gene locus_tag LOCUS_11340 gene recF 8989 10074 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_11340 10161 10460 gene locus_tag LOCUS_11350 10161 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_11350 10940 10521 gene locus_tag LOCUS_11360 gene ndk 10940 10521 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_11360 11040 12068 gene locus_tag LOCUS_11370 gene fjo19 11040 12068 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_11370 12058 12588 gene locus_tag LOCUS_11380 gene gldI 12058 12588 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T4 protein_id gnl|my_center|LOCUS_11380 12590 13294 gene locus_tag LOCUS_11390 gene fklB 12590 13294 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ2 protein_id gnl|my_center|LOCUS_11390 13340 14338 gene locus_tag LOCUS_11400 gene ppiB 13340 14338 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963994.1 protein_id gnl|my_center|LOCUS_11400 14340 14900 gene locus_tag LOCUS_11410 gene lpxF 14340 14900 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M3 protein_id gnl|my_center|LOCUS_11410 >Feature sequence045 396 1466 gene locus_tag LOCUS_11420 396 1466 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_11420 1541 2677 gene locus_tag LOCUS_11430 1541 2677 CDS product vtpJ-therm inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878319.1 protein_id gnl|my_center|LOCUS_11430 3079 2747 gene locus_tag LOCUS_11440 3079 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 5805 3082 gene locus_tag LOCUS_11450 gene parC 5805 3082 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_11450 7668 5809 gene locus_tag LOCUS_11460 gene parE 7668 5809 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_11460 7893 9137 gene locus_tag LOCUS_11470 7893 9137 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_11470 9217 9729 gene locus_tag LOCUS_11480 9217 9729 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966038.1 protein_id gnl|my_center|LOCUS_11480 9932 12271 gene locus_tag LOCUS_11490 9932 12271 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_11490 12530 12309 gene locus_tag LOCUS_11500 12530 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_11500 13192 12527 gene locus_tag LOCUS_11510 13192 12527 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042743.1 protein_id gnl|my_center|LOCUS_11510 13404 14495 gene locus_tag LOCUS_11520 gene gcvT 13404 14495 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_11520 <15424 14606 gene locus_tag LOCUS_11530 <15424 14606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXC6:ribosome-binding ATPase YchF >Feature sequence046 880 302 gene locus_tag LOCUS_11540 880 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_11540 1976 960 gene locus_tag LOCUS_11550 gene hemH 1976 960 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_11550 2535 2017 gene locus_tag LOCUS_11560 2535 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 3431 2547 gene locus_tag LOCUS_11570 3431 2547 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_11570 3639 4874 gene locus_tag LOCUS_11580 gene hemA 3639 4874 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 protein_id gnl|my_center|LOCUS_11580 4885 6474 gene locus_tag LOCUS_11590 4885 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 6482 7447 gene locus_tag LOCUS_11600 gene hemB 6482 7447 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67876 protein_id gnl|my_center|LOCUS_11600 7546 8835 gene locus_tag LOCUS_11610 gene hemL 7546 8835 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHH6 protein_id gnl|my_center|LOCUS_11610 8838 9866 gene locus_tag LOCUS_11620 gene hemE 8838 9866 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 protein_id gnl|my_center|LOCUS_11620 9979 10734 gene locus_tag LOCUS_11630 9979 10734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 10715 11617 gene locus_tag LOCUS_11640 gene hemF 10715 11617 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_11640 11801 13117 gene locus_tag LOCUS_11650 gene bfmBB 11801 13117 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_11650 13201 13935 gene locus_tag LOCUS_11660 13201 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 <15171 14011 gene locus_tag LOCUS_11670 <15171 14011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZQ9:chaperone protein HtpG >Feature sequence047 <1 567 gene locus_tag LOCUS_11680 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582837.1:glucan endo-1,3-beta-D-glucosidase 1138 2445 gene locus_tag LOCUS_11690 1138 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2552 6010 gene locus_tag LOCUS_11700 2552 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 6020 7837 gene locus_tag LOCUS_11710 6020 7837 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223197.1 protein_id gnl|my_center|LOCUS_11710 7857 9143 gene locus_tag LOCUS_11720 7857 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 9154 10641 gene locus_tag LOCUS_11730 gene srfJ 9154 10641 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636452.2 protein_id gnl|my_center|LOCUS_11730 10647 12062 gene locus_tag LOCUS_11740 10647 12062 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096070.1 protein_id gnl|my_center|LOCUS_11740 12159 13070 gene locus_tag LOCUS_11750 12159 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence048 565 125 gene locus_tag LOCUS_11760 565 125 CDS product SOS-response transcriptional regulator UmuD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202621.1 protein_id gnl|my_center|LOCUS_11760 1856 600 gene locus_tag LOCUS_11770 gene umuC 1856 600 CDS product SOS mutagenesis and repair protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_11770 3458 1965 gene locus_tag LOCUS_11780 3458 1965 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337079.1 protein_id gnl|my_center|LOCUS_11780 3766 3512 gene locus_tag LOCUS_11790 3766 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3654 5351 gene locus_tag LOCUS_11800 3654 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 7001 5655 gene locus_tag LOCUS_11810 7001 5655 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A685 protein_id gnl|my_center|LOCUS_11810 7174 7854 gene locus_tag LOCUS_11820 7174 7854 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_11820 7906 8145 gene locus_tag LOCUS_11830 gene feoA 7906 8145 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_11830 8138 10249 gene locus_tag LOCUS_11840 gene feoB 8138 10249 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_11840 10735 10367 gene locus_tag LOCUS_11850 10735 10367 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962542.1 protein_id gnl|my_center|LOCUS_11850 10883 12235 gene locus_tag LOCUS_11860 gene actA 10883 12235 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence049 268 80 gene locus_tag LOCUS_11870 268 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1253 261 gene locus_tag LOCUS_11880 gene ribD 1253 261 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_11880 1704 1342 gene locus_tag LOCUS_11890 1704 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1852 2343 gene locus_tag LOCUS_11900 gene yjgM 1852 2343 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_11900 2322 3206 gene locus_tag LOCUS_11910 gene prmC 2322 3206 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_11910 3627 3208 gene locus_tag LOCUS_11920 3627 3208 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_11920 3933 4733 gene locus_tag LOCUS_11930 3933 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 5226 4819 gene locus_tag LOCUS_11940 5226 4819 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_11940 5353 6036 gene locus_tag LOCUS_11950 gene trmD 5353 6036 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_11950 6160 7548 gene locus_tag LOCUS_11960 6160 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 7659 8009 gene locus_tag LOCUS_11970 gene rplS 7659 8009 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_11970 8776 11001 gene locus_tag LOCUS_11980 gene icd 8776 11001 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225341.1 protein_id gnl|my_center|LOCUS_11980 11136 13514 gene locus_tag LOCUS_11990 11136 13514 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_11990 13519 14337 gene locus_tag LOCUS_12000 13519 14337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence050 1147 797 gene locus_tag LOCUS_12010 gene fdx1 1147 797 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_12010 1217 2278 gene locus_tag LOCUS_12020 1217 2278 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_12020 2322 3389 gene locus_tag LOCUS_12030 gene serC 2322 3389 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 protein_id gnl|my_center|LOCUS_12030 3411 4361 gene locus_tag LOCUS_12040 gene serA 3411 4361 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_12040 4361 5035 gene locus_tag LOCUS_12050 4361 5035 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_12050 5054 6133 gene locus_tag LOCUS_12060 5054 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 6277 7095 gene locus_tag LOCUS_12070 6277 7095 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_12070 7096 8022 gene locus_tag LOCUS_12080 gene miaA 7096 8022 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V8 protein_id gnl|my_center|LOCUS_12080 8077 8595 gene locus_tag LOCUS_12090 8077 8595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 11550 8695 gene locus_tag LOCUS_12100 gene carB 11550 8695 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_12100 12048 13658 gene locus_tag LOCUS_12110 gene pyrG 12048 13658 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence051 1288 338 gene locus_tag LOCUS_12120 gene purC 1288 338 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_12120 2468 1527 gene locus_tag LOCUS_12130 gene phoH 2468 1527 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_12130 2595 3455 gene locus_tag LOCUS_12140 gene fjo14 2595 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_12140 3580 4296 gene locus_tag LOCUS_12150 gene gldF 3580 4296 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_12150 4289 5932 gene locus_tag LOCUS_12160 gene gldG 4289 5932 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_12160 6723 5962 gene locus_tag LOCUS_12170 gene yeeZ 6723 5962 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261981.1 protein_id gnl|my_center|LOCUS_12170 7456 6791 gene locus_tag LOCUS_12180 7456 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 7554 8459 gene locus_tag LOCUS_12190 7554 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_12190 9516 8536 gene locus_tag LOCUS_12200 9516 8536 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_12200 11244 9520 gene locus_tag LOCUS_12210 11244 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 13870 11369 gene locus_tag LOCUS_12220 13870 11369 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383264.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence052 <1 1568 gene locus_tag LOCUS_12230 <1 1568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963187.1:ABC-F family ATPase 2554 1613 gene locus_tag LOCUS_12240 gene oxyR 2554 1613 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_12240 3196 2657 gene locus_tag LOCUS_12250 3196 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4219 3332 gene locus_tag LOCUS_12260 4219 3332 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_12260 5265 4306 gene locus_tag LOCUS_12270 5265 4306 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_12270 5478 6119 gene locus_tag LOCUS_12280 gene pcm 5478 6119 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_12280 6730 6206 gene locus_tag LOCUS_12290 gene kdsC 6730 6206 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_12290 7415 6720 gene locus_tag LOCUS_12300 7415 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_12300 7714 8430 gene locus_tag LOCUS_12310 7714 8430 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_12310 8486 8560 gene locus_tag LOCUS_t00130 8486 8560 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 11505 8719 gene locus_tag LOCUS_12320 gene uvrA1 11505 8719 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_12320 11727 12314 gene locus_tag LOCUS_12330 11727 12314 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_12330 13212 12553 gene locus_tag LOCUS_12340 gene nth 13212 12553 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_12340 >Feature sequence053 1019 486 gene locus_tag LOCUS_12350 1019 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1143 1844 gene locus_tag LOCUS_12360 gene pepE 1143 1844 CDS product dipeptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_12360 3039 1894 gene locus_tag LOCUS_12370 gene ribBA 3039 1894 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_12370 4268 3045 gene locus_tag LOCUS_12380 4268 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963702.1 protein_id gnl|my_center|LOCUS_12380 5209 4553 gene locus_tag LOCUS_12390 gene lolA 5209 4553 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_12390 7650 5212 gene locus_tag LOCUS_12400 gene ftsK 7650 5212 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_12400 8073 7693 gene locus_tag LOCUS_12410 gene dgkA 8073 7693 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963705.1 protein_id gnl|my_center|LOCUS_12410 8574 8077 gene locus_tag LOCUS_12420 gene tpx 8574 8077 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZY8 protein_id gnl|my_center|LOCUS_12420 8701 10086 gene locus_tag LOCUS_12430 gene norM 8701 10086 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_12430 10073 10297 gene locus_tag LOCUS_12440 10073 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_12440 10550 11473 gene locus_tag LOCUS_12450 10550 11473 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_12450 11474 12481 gene locus_tag LOCUS_12460 11474 12481 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_12460 12462 13220 gene locus_tag LOCUS_12470 gene aroE 12462 13220 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence054 1322 891 gene locus_tag LOCUS_12480 1322 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_12480 1952 1371 gene locus_tag LOCUS_12490 gene miaE 1952 1371 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_12490 4147 1958 gene locus_tag LOCUS_12500 4147 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 4981 4148 gene locus_tag LOCUS_12510 4981 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 5227 5006 gene locus_tag LOCUS_12520 5227 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 5112 6929 gene locus_tag LOCUS_12530 5112 6929 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481446.1 protein_id gnl|my_center|LOCUS_12530 8718 6988 gene locus_tag LOCUS_12540 8718 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 8950 9549 gene locus_tag LOCUS_12550 gene msrA 8950 9549 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_12550 10737 9691 gene locus_tag LOCUS_12560 10737 9691 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_12560 11544 10741 gene locus_tag LOCUS_12570 11544 10741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 protein_id gnl|my_center|LOCUS_12570 12573 11545 gene locus_tag LOCUS_12580 12573 11545 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_12580 13178 12597 gene locus_tag LOCUS_12590 13178 12597 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_12590 >Feature sequence055 393 821 gene locus_tag LOCUS_12600 393 821 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_12600 873 1463 gene locus_tag LOCUS_12610 gene def 873 1463 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_12610 1481 1903 gene locus_tag LOCUS_12620 1481 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_12620 1945 2724 gene locus_tag LOCUS_12630 1945 2724 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_12630 3665 2754 gene locus_tag LOCUS_12640 3665 2754 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_12640 4685 3879 gene locus_tag LOCUS_12650 4685 3879 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_12650 6350 4692 gene locus_tag LOCUS_12660 gene recN 6350 4692 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_12660 7310 6420 gene locus_tag LOCUS_12670 7310 6420 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_12670 8514 7303 gene locus_tag LOCUS_12680 gene coaBC 8514 7303 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_12680 8834 8514 gene locus_tag LOCUS_12690 8834 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_12690 9704 8844 gene locus_tag LOCUS_12700 gene bamD 9704 8844 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_12700 10740 9862 gene locus_tag LOCUS_12710 gene dapA 10740 9862 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_12710 11364 10843 gene locus_tag LOCUS_12720 11364 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 12482 11400 gene locus_tag LOCUS_12730 12482 11400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142879.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence056 2184 2981 gene locus_tag LOCUS_12740 2184 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 2981 3685 gene locus_tag LOCUS_12750 2981 3685 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_12750 4610 3753 gene locus_tag LOCUS_12760 4610 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_12760 4919 4614 gene locus_tag LOCUS_12770 4919 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 6927 5014 gene locus_tag LOCUS_12780 6927 5014 CDS product putative glucosamine-6-phosphate deaminase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB53 protein_id gnl|my_center|LOCUS_12780 8691 7693 gene locus_tag LOCUS_12790 8691 7693 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265797.1 protein_id gnl|my_center|LOCUS_12790 11568 8698 gene locus_tag LOCUS_12800 11568 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 11799 13184 gene locus_tag LOCUS_12810 11799 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence057 1007 48 gene locus_tag LOCUS_12820 1007 48 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105758.1 protein_id gnl|my_center|LOCUS_12820 1094 1951 gene locus_tag LOCUS_12830 1094 1951 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 protein_id gnl|my_center|LOCUS_12830 1956 2738 gene locus_tag LOCUS_12840 1956 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 3367 2735 gene locus_tag LOCUS_12850 3367 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998659.1 protein_id gnl|my_center|LOCUS_12850 3423 3977 gene locus_tag LOCUS_12860 3423 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 protein_id gnl|my_center|LOCUS_12860 3993 5135 gene locus_tag LOCUS_12870 3993 5135 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_12870 6342 5161 gene locus_tag LOCUS_12880 6342 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 protein_id gnl|my_center|LOCUS_12880 7433 6351 gene locus_tag LOCUS_12890 7433 6351 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_12890 7990 7430 gene locus_tag LOCUS_12900 7990 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 9152 8289 gene locus_tag LOCUS_12910 9152 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 9568 9152 gene locus_tag LOCUS_12920 9568 9152 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_12920 11266 9608 gene locus_tag LOCUS_12930 gene ggt 11266 9608 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_12930 11892 11296 gene locus_tag LOCUS_12940 11892 11296 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_12940 13120 12002 gene locus_tag LOCUS_12950 gene dnaN 13120 12002 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_12950 >Feature sequence058 686 102 gene locus_tag LOCUS_12960 gene cysG 686 102 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 protein_id gnl|my_center|LOCUS_12960 1461 676 gene locus_tag LOCUS_12970 1461 676 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025533.1 protein_id gnl|my_center|LOCUS_12970 3573 1489 gene locus_tag LOCUS_12980 3573 1489 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_12980 4834 3584 gene locus_tag LOCUS_12990 4834 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 5845 4940 gene locus_tag LOCUS_13000 gene cysD 5845 4940 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ4 protein_id gnl|my_center|LOCUS_13000 6472 5858 gene locus_tag LOCUS_13010 6472 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 6735 6472 gene locus_tag LOCUS_13020 6735 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 7366 6953 gene locus_tag LOCUS_13030 7366 6953 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_13030 8563 7397 gene locus_tag LOCUS_13040 gene metZ 8563 7397 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM6 protein_id gnl|my_center|LOCUS_13040 11994 8593 gene locus_tag LOCUS_13050 11994 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 <13178 12003 gene locus_tag LOCUS_13060 <13178 12003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962432.1:O-acetylhomoserine aminocarboxypropyltransferase >Feature sequence059 90 848 gene locus_tag LOCUS_13070 gene cysE 90 848 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993515.1 protein_id gnl|my_center|LOCUS_13070 850 1743 gene locus_tag LOCUS_13080 gene cysM 850 1743 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_13080 1971 2987 gene locus_tag LOCUS_13090 1971 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13090 2998 5673 gene locus_tag LOCUS_13100 2998 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13100 5743 6699 gene locus_tag LOCUS_13110 5743 6699 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU8 protein_id gnl|my_center|LOCUS_13110 6815 7132 gene locus_tag LOCUS_13120 6815 7132 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_13120 7206 8129 gene locus_tag LOCUS_13130 7206 8129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_13130 8193 8267 gene locus_tag LOCUS_t00140 8193 8267 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8716 9450 gene locus_tag LOCUS_13140 8716 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 9731 9561 gene locus_tag LOCUS_13150 9731 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 9767 10582 gene locus_tag LOCUS_13160 9767 10582 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_13160 11376 10579 gene locus_tag LOCUS_13170 gene murI 11376 10579 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D7 protein_id gnl|my_center|LOCUS_13170 11951 11445 gene locus_tag LOCUS_13180 11951 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 <12607 11973 gene locus_tag LOCUS_13190 <12607 11973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964196.1:membrane protein >Feature sequence060 869 522 gene locus_tag LOCUS_13200 869 522 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_13200 1091 2518 gene locus_tag LOCUS_13210 gene dnaA 1091 2518 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_13210 2589 3023 gene locus_tag LOCUS_13220 2589 3023 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 protein_id gnl|my_center|LOCUS_13220 3025 3729 gene locus_tag LOCUS_13230 3025 3729 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_13230 4347 3730 gene locus_tag LOCUS_13240 4347 3730 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963343.1 protein_id gnl|my_center|LOCUS_13240 5278 4388 gene locus_tag LOCUS_13250 5278 4388 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_13250 6165 5278 gene locus_tag LOCUS_13260 gene pabC 6165 5278 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_13260 6857 6333 gene locus_tag LOCUS_13270 6857 6333 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_13270 7627 6857 gene locus_tag LOCUS_13280 gene dapF 7627 6857 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_13280 7757 9145 gene locus_tag LOCUS_13290 gene degP/Q 7757 9145 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_13290 9283 10725 gene locus_tag LOCUS_13300 gene gapA2 9283 10725 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX7 protein_id gnl|my_center|LOCUS_13300 >Feature sequence061 <1 600 gene locus_tag LOCUS_13310 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVZ1:50S ribosomal protein L25 672 1301 gene locus_tag LOCUS_13320 gene pth 672 1301 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_13320 1920 1375 gene locus_tag LOCUS_13330 1920 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 2428 1979 gene locus_tag LOCUS_13340 2428 1979 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_13340 4030 2531 gene locus_tag LOCUS_13350 4030 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_13350 4896 4030 gene locus_tag LOCUS_13360 4896 4030 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_13360 5529 4945 gene locus_tag LOCUS_13370 gene nadD 5529 4945 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_13370 6157 5576 gene locus_tag LOCUS_13380 gene gmk 6157 5576 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_13380 7024 6158 gene locus_tag LOCUS_13390 7024 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_13390 7300 7953 gene locus_tag LOCUS_13400 gene upp 7300 7953 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_13400 8523 7948 gene locus_tag LOCUS_13410 8523 7948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 8919 9140 gene locus_tag LOCUS_13420 8919 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 9149 9820 gene locus_tag LOCUS_13430 gene trmB 9149 9820 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_13430 9843 10175 gene locus_tag LOCUS_13440 gene ogt2 9843 10175 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_13440 10362 11501 gene locus_tag LOCUS_13450 gene mrp 10362 11501 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 protein_id gnl|my_center|LOCUS_13450 11507 11743 gene locus_tag LOCUS_13460 11507 11743 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence062 <1 1378 gene locus_tag LOCUS_13470 <1 1378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962544.1:quinol:cytochrome C oxidoreductase 1401 2864 gene locus_tag LOCUS_13480 gene actC 1401 2864 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_13480 2867 3394 gene locus_tag LOCUS_13490 gene actD 2867 3394 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_13490 3405 3953 gene locus_tag LOCUS_13500 gene actE 3405 3953 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_13500 3988 5463 gene locus_tag LOCUS_13510 gene actF 3988 5463 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_13510 5500 6513 gene locus_tag LOCUS_13520 gene ctaC 5500 6513 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_13520 6610 8328 gene locus_tag LOCUS_13530 gene ctaD 6610 8328 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_13530 8442 9464 gene locus_tag LOCUS_13540 gene ruvB 8442 9464 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_13540 9464 11032 gene locus_tag LOCUS_13550 9464 11032 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13550 >Feature sequence063 1280 150 gene locus_tag LOCUS_13560 1280 150 CDS product general secretion pathway protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964406.1 protein_id gnl|my_center|LOCUS_13560 1768 1298 gene locus_tag LOCUS_13570 1768 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2117 1761 gene locus_tag LOCUS_13580 2117 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 3376 2105 gene locus_tag LOCUS_13590 3376 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964403.1 protein_id gnl|my_center|LOCUS_13590 3833 3378 gene locus_tag LOCUS_13600 3833 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964402.1 protein_id gnl|my_center|LOCUS_13600 5272 3863 gene locus_tag LOCUS_13610 gene gspE 5272 3863 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964389.1 protein_id gnl|my_center|LOCUS_13610 5673 5374 gene locus_tag LOCUS_13620 5673 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 6190 5780 gene locus_tag LOCUS_13630 6190 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 7466 6294 gene locus_tag LOCUS_13640 7466 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 9511 7466 gene locus_tag LOCUS_13650 gene gspD 9511 7466 CDS product general secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964388.1 protein_id gnl|my_center|LOCUS_13650 9913 9560 gene locus_tag LOCUS_13660 9913 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 10007 10426 gene locus_tag LOCUS_13670 gene gspG 10007 10426 CDS product general secretion pathway protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964391.1 protein_id gnl|my_center|LOCUS_13670 12250 10523 gene locus_tag LOCUS_13680 12250 10523 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence064 3551 1143 gene locus_tag LOCUS_13690 3551 1143 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_13690 6384 3700 gene locus_tag LOCUS_13700 6384 3700 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109377.1 protein_id gnl|my_center|LOCUS_13700 8275 6416 gene locus_tag LOCUS_13710 8275 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 9716 8280 gene locus_tag LOCUS_13720 gene aslA 9716 8280 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_13720 <12234 9929 gene locus_tag LOCUS_13730 <12234 9929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZY5:beta-galactosidase >Feature sequence065 2651 1479 gene locus_tag LOCUS_13740 2651 1479 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_13740 3991 2660 gene locus_tag LOCUS_13750 3991 2660 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_13750 4533 3988 gene locus_tag LOCUS_13760 4533 3988 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_13760 4728 5699 gene locus_tag LOCUS_13770 4728 5699 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_13770 5760 5834 gene locus_tag LOCUS_t00150 5760 5834 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5894 6073 gene locus_tag LOCUS_13780 5894 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 6647 6063 gene locus_tag LOCUS_13790 gene ribE 6647 6063 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_13790 6707 7741 gene locus_tag LOCUS_13800 gene pdxA 6707 7741 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_13800 7813 8349 gene locus_tag LOCUS_13810 7813 8349 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_13810 8351 8545 gene locus_tag LOCUS_13820 gene rpmF 8351 8545 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_13820 8701 9705 gene locus_tag LOCUS_13830 gene fabH3 8701 9705 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_13830 9722 10198 gene locus_tag LOCUS_13840 gene accB 9722 10198 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_13840 10275 11612 gene locus_tag LOCUS_13850 gene accC 10275 11612 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence066 481 720 gene locus_tag LOCUS_13860 481 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1084 2109 gene locus_tag LOCUS_13870 1084 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 2117 3094 gene locus_tag LOCUS_13880 2117 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3106 3630 gene locus_tag LOCUS_13890 3106 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3627 4022 gene locus_tag LOCUS_13900 3627 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 4268 5161 gene locus_tag LOCUS_13910 4268 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 5630 6478 gene locus_tag LOCUS_13920 5630 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 6729 7946 gene locus_tag LOCUS_13930 6729 7946 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757677.1 protein_id gnl|my_center|LOCUS_13930 8144 9994 gene locus_tag LOCUS_13940 8144 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 11055 10048 gene locus_tag LOCUS_13950 gene fabH2 11055 10048 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence067 868 1905 gene locus_tag LOCUS_13960 868 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_13960 2008 2805 gene locus_tag LOCUS_13970 2008 2805 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_13970 2809 4041 gene locus_tag LOCUS_13980 2809 4041 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_13980 4108 6327 gene locus_tag LOCUS_13990 gene relA 4108 6327 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_13990 6400 6846 gene locus_tag LOCUS_14000 gene fur 6400 6846 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_14000 6896 8167 gene locus_tag LOCUS_14010 gene purA 6896 8167 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_14010 8407 9927 gene locus_tag LOCUS_14020 8407 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_14020 9924 11114 gene locus_tag LOCUS_14030 gene argD 9924 11114 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_14030 <11794 11131 gene locus_tag LOCUS_14040 <11794 11131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256767.1:peptidase M23 >Feature sequence068 435 1604 gene locus_tag LOCUS_14050 gene hmgA 435 1604 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_14050 1620 2783 gene locus_tag LOCUS_14060 gene hppD 1620 2783 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_14060 2793 3710 gene locus_tag LOCUS_14070 2793 3710 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_14070 3860 4573 gene locus_tag LOCUS_14080 3860 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_14080 4673 5950 gene locus_tag LOCUS_14090 4673 5950 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_14090 5954 7522 gene locus_tag LOCUS_14100 gene pgi 5954 7522 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ0 protein_id gnl|my_center|LOCUS_14100 7744 10284 gene locus_tag LOCUS_14110 7744 10284 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_14110 10358 11362 gene locus_tag LOCUS_14120 10358 11362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence069 818 428 gene locus_tag LOCUS_tm00010 818 428 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 942 2147 gene locus_tag LOCUS_14130 942 2147 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_14130 2148 2369 gene locus_tag LOCUS_14140 2148 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 protein_id gnl|my_center|LOCUS_14140 2923 2366 gene locus_tag LOCUS_14150 2923 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3852 3034 gene locus_tag LOCUS_14160 gene kdsA 3852 3034 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY4 protein_id gnl|my_center|LOCUS_14160 3921 4904 gene locus_tag LOCUS_14170 3921 4904 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_14170 4999 6351 gene locus_tag LOCUS_14180 4999 6351 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_14180 7802 6465 gene locus_tag LOCUS_14190 7802 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 9257 8052 gene locus_tag LOCUS_14200 9257 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 9982 9251 gene locus_tag LOCUS_14210 9982 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 10760 10035 gene locus_tag LOCUS_14220 10760 10035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence070 255 593 gene locus_tag LOCUS_14230 255 593 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784350.1 protein_id gnl|my_center|LOCUS_14230 599 865 gene locus_tag LOCUS_14240 599 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3254 912 gene locus_tag LOCUS_14250 3254 912 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_14250 3916 3512 gene locus_tag LOCUS_14260 3916 3512 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_14260 4565 3933 gene locus_tag LOCUS_14270 4565 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 5158 4526 gene locus_tag LOCUS_14280 gene pnuC 5158 4526 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_14280 5940 5218 gene locus_tag LOCUS_14290 gene pcrB 5940 5218 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_14290 6652 6020 gene locus_tag LOCUS_14300 gene sfp 6652 6020 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_14300 6715 8022 gene locus_tag LOCUS_14310 gene ahcY 6715 8022 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_14310 9659 8124 gene locus_tag LOCUS_14320 9659 8124 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_14320 10013 10255 gene locus_tag LOCUS_14330 10013 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence071 2938 116 gene locus_tag LOCUS_14340 gene uvrA2 2938 116 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX6 protein_id gnl|my_center|LOCUS_14340 3049 3270 gene locus_tag LOCUS_14350 3049 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_14350 3274 4272 gene locus_tag LOCUS_14360 3274 4272 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_14360 4276 5175 gene locus_tag LOCUS_14370 4276 5175 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_14370 5266 6882 gene locus_tag LOCUS_14380 gene dagA 5266 6882 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_14380 6893 7786 gene locus_tag LOCUS_14390 6893 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963324.1 protein_id gnl|my_center|LOCUS_14390 7808 8974 gene locus_tag LOCUS_14400 7808 8974 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_14400 9168 9365 gene locus_tag LOCUS_14410 gene rpsU 9168 9365 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_14410 9464 10357 gene locus_tag LOCUS_14420 gene xerC 9464 10357 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_14420 10354 10662 gene locus_tag LOCUS_14430 10354 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_14430 10781 10855 gene locus_tag LOCUS_t00160 10781 10855 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence072 76 3 gene locus_tag LOCUS_t00170 76 3 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 906 139 gene locus_tag LOCUS_14440 906 139 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_14440 1650 910 gene locus_tag LOCUS_14450 1650 910 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_14450 1879 3402 gene locus_tag LOCUS_14460 gene pafA 1879 3402 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_14460 4406 3468 gene locus_tag LOCUS_14470 4406 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_14470 4523 5191 gene locus_tag LOCUS_14480 gene vanXB 4523 5191 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q47749 protein_id gnl|my_center|LOCUS_14480 5328 5942 gene locus_tag LOCUS_14490 5328 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 6075 7064 gene locus_tag LOCUS_14500 gene pdhA 6075 7064 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_14500 7068 8690 gene locus_tag LOCUS_14510 gene pdhC 7068 8690 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_14510 8757 9446 gene locus_tag LOCUS_14520 8757 9446 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086801.1 protein_id gnl|my_center|LOCUS_14520 9501 9674 gene locus_tag LOCUS_14530 9501 9674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 9671 10456 gene locus_tag LOCUS_14540 9671 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113828.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence073 <1 683 gene locus_tag LOCUS_14550 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H000:fumarate hydratase class II 829 2067 gene locus_tag LOCUS_14560 gene hutI 829 2067 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_14560 4531 2084 gene locus_tag LOCUS_14570 gene wzc 4531 2084 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_14570 5207 4536 gene locus_tag LOCUS_14580 gene wza 5207 4536 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 protein_id gnl|my_center|LOCUS_14580 5498 6142 gene locus_tag LOCUS_14590 5498 6142 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_14590 6201 6776 gene locus_tag LOCUS_14600 6201 6776 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_14600 6949 7170 gene locus_tag LOCUS_14610 6949 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence074 1448 822 gene locus_tag LOCUS_14620 1448 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 3109 1568 gene locus_tag LOCUS_14630 gene pcd 3109 1568 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_14630 3580 3266 gene locus_tag LOCUS_14640 3580 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 4432 4040 gene locus_tag LOCUS_14650 4432 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 4516 5490 gene locus_tag LOCUS_14660 4516 5490 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_14660 6542 5493 gene locus_tag LOCUS_14670 gene thiL 6542 5493 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_14670 6765 8297 gene locus_tag LOCUS_14680 6765 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 8303 9631 gene locus_tag LOCUS_14690 8303 9631 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583646.1 protein_id gnl|my_center|LOCUS_14690 9634 10368 gene locus_tag LOCUS_14700 9634 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence075 710 366 gene locus_tag LOCUS_14710 710 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1579 713 gene locus_tag LOCUS_14720 gene tesB 1579 713 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167662.1 protein_id gnl|my_center|LOCUS_14720 2753 1566 gene locus_tag LOCUS_14730 2753 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 protein_id gnl|my_center|LOCUS_14730 3048 3656 gene locus_tag LOCUS_14740 gene tpm 3048 3656 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_14740 4854 3676 gene locus_tag LOCUS_14750 gene gcdH 4854 3676 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_14750 5025 5441 gene locus_tag LOCUS_14760 5025 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 5569 7059 gene locus_tag LOCUS_14770 gene prc 5569 7059 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 protein_id gnl|my_center|LOCUS_14770 7085 8764 gene locus_tag LOCUS_14780 7085 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence076 751 1638 gene locus_tag LOCUS_14790 gene fabD 751 1638 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_14790 2705 1692 gene locus_tag LOCUS_14800 gene galE 2705 1692 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_14800 3878 2715 gene locus_tag LOCUS_14810 gene porR 3878 2715 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_14810 3977 6367 gene locus_tag LOCUS_14820 gene pac 3977 6367 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964303.1 protein_id gnl|my_center|LOCUS_14820 7145 6408 gene locus_tag LOCUS_14830 7145 6408 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_14830 7883 7197 gene locus_tag LOCUS_14840 7883 7197 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_14840 8501 7890 gene locus_tag LOCUS_14850 gene engB 8501 7890 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 protein_id gnl|my_center|LOCUS_14850 <9309 8535 gene locus_tag LOCUS_14860 <9309 8535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964165.1:alpha/beta hydrolase >Feature sequence077 1074 181 gene locus_tag LOCUS_14870 1074 181 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097747.1 protein_id gnl|my_center|LOCUS_14870 1794 1177 gene locus_tag LOCUS_14880 gene hisIE 1794 1177 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 protein_id gnl|my_center|LOCUS_14880 2574 1819 gene locus_tag LOCUS_14890 gene hisF 2574 1819 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_14890 3312 2575 gene locus_tag LOCUS_14900 gene hisA 3312 2575 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_14900 3895 3314 gene locus_tag LOCUS_14910 gene hisH 3895 3314 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY77 protein_id gnl|my_center|LOCUS_14910 5051 3912 gene locus_tag LOCUS_14920 gene hisB 5051 3912 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 protein_id gnl|my_center|LOCUS_14920 6150 5095 gene locus_tag LOCUS_14930 gene hisC 6150 5095 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY79 protein_id gnl|my_center|LOCUS_14930 7467 6187 gene locus_tag LOCUS_14940 gene hisD 7467 6187 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY80 protein_id gnl|my_center|LOCUS_14940 8327 7470 gene locus_tag LOCUS_14950 gene hisG 8327 7470 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY81 protein_id gnl|my_center|LOCUS_14950 <9225 8660 gene locus_tag LOCUS_14960 <9225 8660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071202.1:dicarboxylate:amino acid:cation symporter DAACS family protein >Feature sequence078 455 919 gene locus_tag LOCUS_14970 gene nodN 455 919 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086244.1 protein_id gnl|my_center|LOCUS_14970 1132 1584 gene locus_tag LOCUS_14980 1132 1584 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292665.1 protein_id gnl|my_center|LOCUS_14980 1705 4218 gene locus_tag LOCUS_14990 1705 4218 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_14990 5367 4309 gene locus_tag LOCUS_15000 gene aroB 5367 4309 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_15000 5459 6622 gene locus_tag LOCUS_15010 gene putA 5459 6622 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_15010 6622 6909 gene locus_tag LOCUS_15020 6622 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 7158 8930 gene locus_tag LOCUS_15030 gene typA 7158 8930 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence079 786 265 gene locus_tag LOCUS_15040 786 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_15040 1409 783 gene locus_tag LOCUS_15050 1409 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1613 2575 gene locus_tag LOCUS_15060 gene ltd 1613 2575 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_15060 2714 3196 gene locus_tag LOCUS_15070 2714 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_15070 3586 3200 gene locus_tag LOCUS_15080 3586 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_15080 4326 3604 gene locus_tag LOCUS_15090 4326 3604 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815942.1 protein_id gnl|my_center|LOCUS_15090 4449 4655 gene locus_tag LOCUS_15100 4449 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 5214 4639 gene locus_tag LOCUS_15110 gene tag 5214 4639 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_15110 5871 5380 gene locus_tag LOCUS_15120 gene dfrA 5871 5380 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_15120 6743 5919 gene locus_tag LOCUS_15130 gene thyA 6743 5919 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 protein_id gnl|my_center|LOCUS_15130 8263 6860 gene locus_tag LOCUS_15140 gene yeiM 8263 6860 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence080 1275 808 gene locus_tag LOCUS_15150 1275 808 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_15150 1451 2380 gene locus_tag LOCUS_15160 gene natA 1451 2380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_15160 2381 3709 gene locus_tag LOCUS_15170 gene natB 2381 3709 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_15170 3715 4545 gene locus_tag LOCUS_15180 3715 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 4548 5711 gene locus_tag LOCUS_15190 4548 5711 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_15190 5892 6452 gene locus_tag LOCUS_15200 5892 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 6893 7252 gene locus_tag LOCUS_15210 6893 7252 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_15210 7584 8381 gene locus_tag LOCUS_15220 7584 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence081 205 1230 gene locus_tag LOCUS_15230 205 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1276 2772 gene locus_tag LOCUS_15240 1276 2772 CDS product selenocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_15240 3083 3910 gene locus_tag LOCUS_15250 gene pheA 3083 3910 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_15250 3910 5049 gene locus_tag LOCUS_15260 gene aspC3 3910 5049 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 protein_id gnl|my_center|LOCUS_15260 5046 5897 gene locus_tag LOCUS_15270 gene tyrA 5046 5897 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_15270 5918 7000 gene locus_tag LOCUS_15280 5918 7000 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_15280 7226 8227 gene locus_tag LOCUS_15290 gene nadA 7226 8227 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG0 protein_id gnl|my_center|LOCUS_15290 >Feature sequence082 324 980 gene locus_tag LOCUS_15300 324 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_15300 990 2294 gene locus_tag LOCUS_15310 990 2294 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_15310 2294 2911 gene locus_tag LOCUS_15320 2294 2911 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_15320 2922 4343 gene locus_tag LOCUS_15330 2922 4343 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_15330 4456 5766 gene locus_tag LOCUS_15340 gene phrB3 4456 5766 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964143.1 protein_id gnl|my_center|LOCUS_15340 5768 7300 gene locus_tag LOCUS_15350 5768 7300 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964142.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence083 1325 693 gene locus_tag LOCUS_15360 1325 693 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_15360 4032 1576 gene locus_tag LOCUS_15370 4032 1576 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_15370 6997 4187 gene locus_tag LOCUS_15380 6997 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962879.1 protein_id gnl|my_center|LOCUS_15380 7804 7097 gene locus_tag LOCUS_15390 7804 7097 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_15390 >Feature sequence084 296 1924 gene locus_tag LOCUS_15400 296 1924 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_15400 2143 2859 gene locus_tag LOCUS_15410 2143 2859 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_15410 3948 2914 gene locus_tag LOCUS_15420 gene lpxK 3948 2914 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_15420 4025 5119 gene locus_tag LOCUS_15430 gene yqfO 4025 5119 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX9 protein_id gnl|my_center|LOCUS_15430 5122 5895 gene locus_tag LOCUS_15440 5122 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence085 <1 1738 gene locus_tag LOCUS_15450 <1 1738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963833.1:3-hydroxyacyl-CoA dehydrogenase 1743 2933 gene locus_tag LOCUS_15460 1743 2933 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_15460 2958 4766 gene locus_tag LOCUS_15470 2958 4766 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_15470 4952 5827 gene locus_tag LOCUS_15480 4952 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 5899 6162 gene locus_tag LOCUS_15490 5899 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15490 6175 6345 gene locus_tag LOCUS_15500 6175 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 7377 6430 gene locus_tag LOCUS_15510 gene trxB1 7377 6430 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_15510 7566 7641 gene locus_tag LOCUS_t00180 7566 7641 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence086 26 1300 gene locus_tag LOCUS_15520 gene argH 26 1300 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 protein_id gnl|my_center|LOCUS_15520 1571 2776 gene locus_tag LOCUS_15530 1571 2776 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 protein_id gnl|my_center|LOCUS_15530 3930 2791 gene locus_tag LOCUS_15540 gene crtY 3930 2791 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_15540 4442 3996 gene locus_tag LOCUS_15550 gene crtZ 4442 3996 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_15550 5284 4442 gene locus_tag LOCUS_15560 gene crtB 5284 4442 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_15560 6752 5286 gene locus_tag LOCUS_15570 gene crtI 6752 5286 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_15570 <7631 6801 gene locus_tag LOCUS_15580 <7631 6801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963566.1:MerR family transcriptional regulator >Feature sequence087 <1 1643 gene locus_tag LOCUS_15590 <1 1643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXM8:DNA gyrase subunit A 1670 2914 gene locus_tag LOCUS_15600 1670 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962908.1 protein_id gnl|my_center|LOCUS_15600 3758 2988 gene locus_tag LOCUS_15610 3758 2988 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_15610 4953 3778 gene locus_tag LOCUS_15620 4953 3778 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_15620 5088 7151 gene locus_tag LOCUS_15630 5088 7151 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_15630 7255 7338 gene locus_tag LOCUS_t00190 7255 7338 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7353 7428 gene locus_tag LOCUS_t00200 7353 7428 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence088 1780 797 gene locus_tag LOCUS_15640 1780 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 2085 2834 gene locus_tag LOCUS_15650 gene truA2 2085 2834 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7H2 protein_id gnl|my_center|LOCUS_15650 4133 2991 gene locus_tag LOCUS_15660 4133 2991 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_15660 4105 5304 gene locus_tag LOCUS_15670 4105 5304 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_15670 5466 6698 gene locus_tag LOCUS_15680 5466 6698 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence089 <1 913 gene locus_tag LOCUS_15690 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963209.1:bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase 1659 952 gene locus_tag LOCUS_15700 gene truB 1659 952 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_15700 2476 1682 gene locus_tag LOCUS_15710 gene uppP 2476 1682 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_15710 2721 2479 gene locus_tag LOCUS_15720 gene fjo13 2721 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_15720 3517 2726 gene locus_tag LOCUS_15730 gene ftsX 3517 2726 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_15730 4067 3666 gene locus_tag LOCUS_15740 4067 3666 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_15740 4319 4792 gene locus_tag LOCUS_15750 4319 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 5276 5893 gene locus_tag LOCUS_15760 5276 5893 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140910.1 protein_id gnl|my_center|LOCUS_15760 6334 6606 gene locus_tag LOCUS_15770 6334 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence090 <1 1938 gene locus_tag LOCUS_15780 <1 1938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088959.1:aldehyde dehydrogenase 3634 2006 gene locus_tag LOCUS_15790 3634 2006 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_15790 4282 3686 gene locus_tag LOCUS_15800 4282 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 4290 4931 gene locus_tag LOCUS_15810 gene pyrE 4290 4931 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 protein_id gnl|my_center|LOCUS_15810 4915 5331 gene locus_tag LOCUS_15820 4915 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 protein_id gnl|my_center|LOCUS_15820 6059 5328 gene locus_tag LOCUS_15830 gene birA 6059 5328 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_15830 6147 6515 gene locus_tag LOCUS_15840 gene rsfS 6147 6515 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_15840 >Feature sequence091 1281 130 gene locus_tag LOCUS_15850 1281 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 2598 1342 gene locus_tag LOCUS_15860 gene nusA 2598 1342 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_15860 3071 2610 gene locus_tag LOCUS_15870 3071 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 3423 4025 gene locus_tag LOCUS_15880 3423 4025 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578704.1 protein_id gnl|my_center|LOCUS_15880 5722 4130 gene locus_tag LOCUS_15890 5722 4130 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941484.1 protein_id gnl|my_center|LOCUS_15890 <7180 5987 gene locus_tag LOCUS_15900 <7180 5987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87TN4:ketol-acid reductoisomerase (NADP(+)) >Feature sequence092 129 341 gene locus_tag LOCUS_15910 129 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 507 1904 gene locus_tag LOCUS_15920 507 1904 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_15920 2115 3677 gene locus_tag LOCUS_15930 2115 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 3874 4656 gene locus_tag LOCUS_15940 3874 4656 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_15940 5768 4743 gene locus_tag LOCUS_15950 5768 4743 CDS product sugar:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767241.1 protein_id gnl|my_center|LOCUS_15950 <6589 5796 gene locus_tag LOCUS_15960 <6589 5796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704972.1:NAD-dependent succinate-semialdehyde dehydrogenase >Feature sequence093 <1 1539 gene locus_tag LOCUS_15970 <1 1539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807931.1:glutamate synthase subunit alpha 1544 3007 gene locus_tag LOCUS_15980 gene gltD 1544 3007 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_15980 5889 3085 gene locus_tag LOCUS_15990 5889 3085 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_15990 6342 6240 gene locus_tag LOCUS_r00010 6342 6240 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence094 99 2045 gene locus_tag LOCUS_16000 gene btuB 99 2045 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVI9 protein_id gnl|my_center|LOCUS_16000 2212 4533 gene locus_tag LOCUS_16010 gene uvrD 2212 4533 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_16010 4683 5342 gene locus_tag LOCUS_16020 4683 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence095 1754 453 gene locus_tag LOCUS_16030 gene phrB1 1754 453 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_16030 2217 1747 gene locus_tag LOCUS_16040 2217 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_16040 2677 2219 gene locus_tag LOCUS_16050 gene tspO 2677 2219 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021261.1 protein_id gnl|my_center|LOCUS_16050 2858 2682 gene locus_tag LOCUS_16060 2858 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 3333 2860 gene locus_tag LOCUS_16070 gene bsaA 3333 2860 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97IS0 protein_id gnl|my_center|LOCUS_16070 4030 3347 gene locus_tag LOCUS_16080 4030 3347 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_16080 4251 4036 gene locus_tag LOCUS_16090 4251 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 4548 4324 gene locus_tag LOCUS_16100 4548 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 5244 4552 gene locus_tag LOCUS_16110 gene folE2 5244 4552 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_16110 5574 5299 gene locus_tag LOCUS_16120 5574 5299 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_16120 6017 5583 gene locus_tag LOCUS_16130 6017 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence096 853 1026 gene locus_tag LOCUS_16140 853 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963717.1 protein_id gnl|my_center|LOCUS_16140 3593 1146 gene locus_tag LOCUS_16150 3593 1146 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_16150 3998 3657 gene locus_tag LOCUS_16160 3998 3657 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_16160 5117 4020 gene locus_tag LOCUS_16170 gene prfB 5117 4020 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_16170 5302 6327 gene locus_tag LOCUS_16180 gene ltaE 5302 6327 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence097 3454 2015 gene locus_tag LOCUS_16190 3454 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 4182 3451 gene locus_tag LOCUS_16200 4182 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence098 <1 722 gene locus_tag LOCUS_16210 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097180.1:quercetin 2,3-dioxygenase 930 2954 gene locus_tag LOCUS_16220 gene fadH1 930 2954 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_16220 3221 3403 gene locus_tag LOCUS_16230 3221 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963197.1 protein_id gnl|my_center|LOCUS_16230 3454 5145 gene locus_tag LOCUS_16240 3454 5145 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 protein_id gnl|my_center|LOCUS_16240 5408 5166 gene locus_tag LOCUS_16250 5408 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 6217 5405 gene locus_tag LOCUS_16260 gene murQ 6217 5405 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_16260 >Feature sequence099 >Feature sequence100 441 716 gene locus_tag LOCUS_16270 gene groS 441 716 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_16270 818 2452 gene locus_tag LOCUS_16280 gene groL 818 2452 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_16280 2963 2553 gene locus_tag LOCUS_16290 2963 2553 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964132.1 protein_id gnl|my_center|LOCUS_16290 5143 2975 gene locus_tag LOCUS_16300 5143 2975 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_16300 5685 5290 gene locus_tag LOCUS_16310 5685 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence101 497 2374 gene locus_tag LOCUS_16320 497 2374 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_16320 2395 3360 gene locus_tag LOCUS_16330 2395 3360 CDS product 1,4-beta-mannosyl-N-acetylglucosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8Y4 protein_id gnl|my_center|LOCUS_16330 3373 4521 gene locus_tag LOCUS_16340 3373 4521 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405515.1 protein_id gnl|my_center|LOCUS_16340 4819 4989 gene locus_tag LOCUS_16350 4819 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence102 1411 344 gene locus_tag LOCUS_16360 1411 344 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_16360 2195 1413 gene locus_tag LOCUS_16370 gene argB 2195 1413 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT7 protein_id gnl|my_center|LOCUS_16370 3126 2188 gene locus_tag LOCUS_16380 3126 2188 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_16380 3897 3133 gene locus_tag LOCUS_16390 3897 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 5092 3899 gene locus_tag LOCUS_16400 gene proA 5092 3899 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y156 protein_id gnl|my_center|LOCUS_16400 <6155 5112 gene locus_tag LOCUS_16410 <6155 5112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762695.1:acetylornithine aminotransferase >Feature sequence103 281 1624 gene locus_tag LOCUS_16420 281 1624 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_16420 1626 2939 gene locus_tag LOCUS_16430 1626 2939 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_16430 4203 2971 gene locus_tag LOCUS_16440 4203 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 4597 5586 gene locus_tag LOCUS_16450 4597 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence104 3945 3259 gene locus_tag LOCUS_16460 gene folE2 3945 3259 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_16460 5398 4031 gene locus_tag LOCUS_16470 gene hisS 5398 4031 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H160 protein_id gnl|my_center|LOCUS_16470 >Feature sequence105 <1 852 gene locus_tag LOCUS_16480 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108702.1:cell well associated RhsD protein 877 1461 gene locus_tag LOCUS_16490 877 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2481 1684 gene locus_tag LOCUS_16500 2481 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 protein_id gnl|my_center|LOCUS_16500 3190 2642 gene locus_tag LOCUS_16510 3190 2642 CDS product putative Nudix hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y9Z9 protein_id gnl|my_center|LOCUS_16510 4367 3279 gene locus_tag LOCUS_16520 4367 3279 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_16520 4637 5566 gene locus_tag LOCUS_16530 4637 5566 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence106 <1 1915 gene locus_tag LOCUS_16540 <1 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964202.1:thioredoxin 1941 3155 gene locus_tag LOCUS_16550 gene manA 1941 3155 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DZL6 protein_id gnl|my_center|LOCUS_16550 4295 3171 gene locus_tag LOCUS_16560 4295 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 5094 4741 gene locus_tag LOCUS_16570 5094 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 <5814 5095 gene locus_tag LOCUS_16580 <5814 5095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXB2:tRNA modification GTPase MnmE >Feature sequence107 3 308 gene locus_tag LOCUS_16590 3 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 5122 386 gene locus_tag LOCUS_16600 5122 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence108 2654 651 gene locus_tag LOCUS_16610 2654 651 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_16610 4100 2766 gene locus_tag LOCUS_16620 gene fucP 4100 2766 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44776 protein_id gnl|my_center|LOCUS_16620 <5471 4164 gene locus_tag LOCUS_16630 <5471 4164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762490.1:alpha-1 2-mannosidase >Feature sequence109 1216 1998 gene locus_tag LOCUS_16640 1216 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16640 2214 3605 gene locus_tag LOCUS_16650 2214 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_16650 3615 4805 gene locus_tag LOCUS_16660 3615 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence110 <1 2967 gene locus_tag LOCUS_16670 <1 2967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYT9:DNA-directed RNA polymerase subunit beta' 3023 3334 gene locus_tag LOCUS_16680 3023 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_16680 3747 3391 gene locus_tag LOCUS_16690 3747 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 <5427 4538 gene locus_tag LOCUS_16700 <5427 4538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXP5:chorismate synthase >Feature sequence111 <1 1309 gene locus_tag LOCUS_16710 <1 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX80:cysteine--tRNA ligase 1275 1541 gene locus_tag LOCUS_16720 1275 1541 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX81 protein_id gnl|my_center|LOCUS_16720 1566 2399 gene locus_tag LOCUS_16730 gene lgt 1566 2399 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX82 protein_id gnl|my_center|LOCUS_16730 2404 2709 gene locus_tag LOCUS_16740 2404 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 protein_id gnl|my_center|LOCUS_16740 2762 3406 gene locus_tag LOCUS_16750 2762 3406 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_16750 3465 4283 gene locus_tag LOCUS_16760 3465 4283 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_16760 5083 4706 gene locus_tag LOCUS_16770 5083 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence112 <1 1227 gene locus_tag LOCUS_16780 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118057.1:iduronate-2-sulfatase 1235 2692 gene locus_tag LOCUS_16790 1235 2692 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_16790 2854 4470 gene locus_tag LOCUS_16800 2854 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 4592 5062 gene locus_tag LOCUS_16810 4592 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16810 >Feature sequence113 770 201 gene locus_tag LOCUS_16820 770 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1393 1959 gene locus_tag LOCUS_16830 1393 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1983 3158 gene locus_tag LOCUS_16840 1983 3158 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_16840 3161 4138 gene locus_tag LOCUS_16850 gene argC 3161 4138 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ5 protein_id gnl|my_center|LOCUS_16850 4176 4967 gene locus_tag LOCUS_16860 gene proC 4176 4967 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR3 protein_id gnl|my_center|LOCUS_16860 4972 5097 gene locus_tag LOCUS_16870 4972 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence114 1342 386 gene locus_tag LOCUS_16880 gene etfA 1342 386 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_16880 2166 1420 gene locus_tag LOCUS_16890 gene etfB 2166 1420 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_16890 2381 3358 gene locus_tag LOCUS_16900 gene pdhB 2381 3358 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_16900 3533 4060 gene locus_tag LOCUS_16910 gene ppa 3533 4060 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH9 protein_id gnl|my_center|LOCUS_16910 >Feature sequence115 931 377 gene locus_tag LOCUS_16920 931 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_16920 1167 1946 gene locus_tag LOCUS_16930 1167 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 2130 3167 gene locus_tag LOCUS_16940 2130 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107178.1 protein_id gnl|my_center|LOCUS_16940 3489 3298 gene locus_tag LOCUS_16950 3489 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 4297 3500 gene locus_tag LOCUS_16960 4297 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 4431 4601 gene locus_tag LOCUS_16970 4431 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence116 357 854 gene locus_tag LOCUS_16980 357 854 CDS product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_16980 903 2378 gene locus_tag LOCUS_16990 903 2378 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_16990 3037 2423 gene locus_tag LOCUS_17000 3037 2423 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_17000 3724 3044 gene locus_tag LOCUS_17010 3724 3044 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence117 44 793 gene locus_tag LOCUS_17020 gene sufC 44 793 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_17020 810 2123 gene locus_tag LOCUS_17030 gene sufD 810 2123 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_17030 3460 2183 gene locus_tag LOCUS_17040 3460 2183 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_17040 3597 4811 gene locus_tag LOCUS_17050 gene sufS 3597 4811 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_17050 >Feature sequence118 380 652 gene locus_tag LOCUS_17060 gene hupB 380 652 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_17060 751 1299 gene locus_tag LOCUS_17070 751 1299 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_17070 2129 1296 gene locus_tag LOCUS_17080 2129 1296 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_17080 2614 2231 gene locus_tag LOCUS_17090 2614 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_17090 2725 2799 gene locus_tag LOCUS_t00210 2725 2799 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2939 3385 gene locus_tag LOCUS_17100 2939 3385 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461775.1 protein_id gnl|my_center|LOCUS_17100 3448 3521 gene locus_tag LOCUS_t00220 3448 3521 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4217 3561 gene locus_tag LOCUS_17110 4217 3561 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence119 349 1920 gene locus_tag LOCUS_17120 349 1920 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_17120 2016 3032 gene locus_tag LOCUS_17130 2016 3032 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_17130 3154 3483 gene locus_tag LOCUS_17140 gene sufA 3154 3483 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence120 1515 3023 gene locus_tag LOCUS_17150 1515 3023 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767373.1 protein_id gnl|my_center|LOCUS_17150 3197 4264 gene locus_tag LOCUS_17160 3197 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence121 530 655 gene locus_tag LOCUS_17170 530 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 823 1953 gene locus_tag LOCUS_17180 823 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 3782 2457 gene locus_tag LOCUS_17190 3782 2457 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence122 35 202 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtggtttgattaaagattagaaaaaacgatatt 641 312 gene locus_tag LOCUS_17200 gene cas2 641 312 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 protein_id gnl|my_center|LOCUS_17200 1516 632 gene locus_tag LOCUS_17210 gene cas1 1516 632 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_17210 1903 3330 gene locus_tag LOCUS_17220 1903 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence123 562 20 gene locus_tag LOCUS_17230 562 20 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_17230 658 939 gene locus_tag LOCUS_17240 658 939 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_17240 950 2584 gene locus_tag LOCUS_17250 950 2584 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_17250 2584 3429 gene locus_tag LOCUS_17260 2584 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence124 >Feature sequence125 504 88 gene locus_tag LOCUS_17270 504 88 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964292.1 protein_id gnl|my_center|LOCUS_17270 2116 686 gene locus_tag LOCUS_17280 2116 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 2778 2200 gene locus_tag LOCUS_17290 2778 2200 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_17290 4019 3934 gene locus_tag LOCUS_t00230 4019 3934 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence126 524 1822 gene locus_tag LOCUS_17300 gene fucP 524 1822 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44776 protein_id gnl|my_center|LOCUS_17300 1853 3667 gene locus_tag LOCUS_17310 gene sglT 1853 3667 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_17310 3696 3950 gene locus_tag LOCUS_17320 3696 3950 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence127 1003 209 gene locus_tag LOCUS_17330 1003 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_17330 2475 1195 gene locus_tag LOCUS_17340 gene fahA 2475 1195 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_17340 2664 3938 gene locus_tag LOCUS_17350 gene glyA 2664 3938 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_17350 4280 4071 gene locus_tag LOCUS_17360 4280 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17360 >Feature sequence128 248 1231 gene locus_tag LOCUS_17370 248 1231 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_17370 1288 2574 gene locus_tag LOCUS_17380 gene wbpO 1288 2574 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_17380 2579 3514 gene locus_tag LOCUS_17390 2579 3514 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_17390 3533 3967 gene locus_tag LOCUS_17400 3533 3967 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364507.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence129 243 629 gene locus_tag LOCUS_17410 gene rpsI 243 629 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU3 protein_id gnl|my_center|LOCUS_17410 779 1687 gene locus_tag LOCUS_17420 gene rpsB 779 1687 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_17420 1711 2682 gene locus_tag LOCUS_17430 gene tsf 1711 2682 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKH3 protein_id gnl|my_center|LOCUS_17430 2796 3503 gene locus_tag LOCUS_17440 gene pyrH 2796 3503 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_17440 3535 4089 gene locus_tag LOCUS_17450 gene frr 3535 4089 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_17450 >Feature sequence130 193 118 gene locus_tag LOCUS_t00240 193 118 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1461 253 gene locus_tag LOCUS_17460 gene folC 1461 253 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_17460 2312 1479 gene locus_tag LOCUS_17470 2312 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964028.1 protein_id gnl|my_center|LOCUS_17470 2622 2314 gene locus_tag LOCUS_17480 2622 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3400 2711 gene locus_tag LOCUS_17490 3400 2711 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence131 698 150 gene locus_tag LOCUS_17500 698 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2480 789 gene locus_tag LOCUS_17510 2480 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3108 2467 gene locus_tag LOCUS_17520 3108 2467 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_17520 <3971 3109 gene locus_tag LOCUS_17530 <3971 3109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001117536.1:carbohydrate kinase >Feature sequence132 364 149 gene locus_tag LOCUS_17540 gene infA 364 149 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ78 protein_id gnl|my_center|LOCUS_17540 1691 366 gene locus_tag LOCUS_17550 gene secY 1691 366 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ79 protein_id gnl|my_center|LOCUS_17550 2152 1703 gene locus_tag LOCUS_17560 gene rplO 2152 1703 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ80 protein_id gnl|my_center|LOCUS_17560 2348 2166 gene locus_tag LOCUS_17570 gene rpmD 2348 2166 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ81 protein_id gnl|my_center|LOCUS_17570 2881 2360 gene locus_tag LOCUS_17580 gene rpsE 2881 2360 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ82 protein_id gnl|my_center|LOCUS_17580 3238 2888 gene locus_tag LOCUS_17590 gene rplR 3238 2888 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ83 protein_id gnl|my_center|LOCUS_17590 3795 3250 gene locus_tag LOCUS_17600 gene rplF 3795 3250 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 protein_id gnl|my_center|LOCUS_17600 >Feature sequence133 1247 426 gene locus_tag LOCUS_17610 1247 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 protein_id gnl|my_center|LOCUS_17610 1968 1234 gene locus_tag LOCUS_17620 1968 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2160 3497 gene locus_tag LOCUS_17630 2160 3497 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence134 >Feature sequence135 1528 659 gene locus_tag LOCUS_17640 1528 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_17640 2559 1570 gene locus_tag LOCUS_17650 2559 1570 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence136 2381 693 gene locus_tag LOCUS_17660 2381 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 <3641 2490 gene locus_tag LOCUS_17670 <3641 2490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775423.1:surface-anchored protein >Feature sequence137 679 500 gene locus_tag LOCUS_17680 679 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 3495 706 gene locus_tag LOCUS_17690 3495 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence138 3152 1953 gene locus_tag LOCUS_17700 3152 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766595.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence139 702 13 gene locus_tag LOCUS_17710 702 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1972 695 gene locus_tag LOCUS_17720 1972 695 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_17720 3099 2020 gene locus_tag LOCUS_17730 3099 2020 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963378.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence140 201 2978 gene locus_tag LOCUS_17740 gene acnB 201 2978 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence141 >Feature sequence142 2346 2783 gene locus_tag LOCUS_17750 2346 2783 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence143 <1 551 gene locus_tag LOCUS_17760 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962300.1:T9SS C-terminal target domain-containing protein 628 933 gene locus_tag LOCUS_17770 628 933 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_17770 1068 2204 gene locus_tag LOCUS_17780 gene gci 1068 2204 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CEQ8 protein_id gnl|my_center|LOCUS_17780 >Feature sequence144 1259 1429 gene locus_tag LOCUS_17790 1259 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence145 937 266 gene locus_tag LOCUS_17800 gene rsmI 937 266 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 protein_id gnl|my_center|LOCUS_17800 1299 940 gene locus_tag LOCUS_17810 1299 940 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence146 <1 1883 gene locus_tag LOCUS_17820 <1 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362014.1:ATP-dependent DNA helicase RecQ2 1886 2830 gene locus_tag LOCUS_17830 gene fmt 1886 2830 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H148 protein_id gnl|my_center|LOCUS_17830 >Feature sequence147 <3058 603 gene locus_tag LOCUS_17840 <3058 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108168.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence148 100 1251 gene locus_tag LOCUS_17850 100 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2103 1405 gene locus_tag LOCUS_17860 gene cutC 2103 1405 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZEV5 protein_id gnl|my_center|LOCUS_17860 <3041 2106 gene locus_tag LOCUS_17870 <3041 2106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202543.1:beta-N-acetylhexosaminidase >Feature sequence149 952 2352 gene locus_tag LOCUS_17880 952 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2972 2673 gene locus_tag LOCUS_17890 2972 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence150 <1 951 gene locus_tag LOCUS_17900 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UWS0:Na(+)-translocating NADH-quinone reductase subunit F 1103 1900 gene locus_tag LOCUS_17910 1103 1900 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089860.1 protein_id gnl|my_center|LOCUS_17910 1945 2403 gene locus_tag LOCUS_17920 1945 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2410 2859 gene locus_tag LOCUS_17930 2410 2859 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_17930 2870 2943 gene locus_tag LOCUS_t00250 2870 2943 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence151 332 2155 gene locus_tag LOCUS_17940 332 2155 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_17940 2690 2247 gene locus_tag LOCUS_17950 2690 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence152 1 408 gene locus_tag LOCUS_17960 1 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 380 793 gene locus_tag LOCUS_17970 380 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1044 1505 gene locus_tag LOCUS_17980 1044 1505 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974879.1 protein_id gnl|my_center|LOCUS_17980 1496 2092 gene locus_tag LOCUS_17990 gene fic 1496 2092 CDS product cell filamentation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974878.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence153 <1 825 gene locus_tag LOCUS_18000 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX96:replicative DNA helicase 930 2153 gene locus_tag LOCUS_18010 930 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence154 2370 1243 gene locus_tag LOCUS_18020 2370 1243 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence155 <2675 1220 gene locus_tag LOCUS_18030 <2675 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766062.1:MFS transporter >Feature sequence156 <1 716 gene locus_tag LOCUS_18040 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VDS3:ammonium transporter 868 1206 gene locus_tag LOCUS_18050 868 1206 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_18050 1226 2443 gene locus_tag LOCUS_18060 1226 2443 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_18060 >Feature sequence157 221 1117 gene locus_tag LOCUS_18070 221 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 <2612 1255 gene locus_tag LOCUS_18080 <2612 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022389.1:restriction endonuclease subunit R >Feature sequence158 2080 497 gene locus_tag LOCUS_18090 2080 497 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803769.1 protein_id gnl|my_center|LOCUS_18090 >Feature sequence159 24 764 gene locus_tag LOCUS_18100 24 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 825 1592 gene locus_tag LOCUS_18110 gene lpxH 825 1592 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_18110 <2578 1642 gene locus_tag LOCUS_18120 <2578 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405034.1:collagen-binding protein >Feature sequence160 <1 2037 gene locus_tag LOCUS_18130 <1 2037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767190.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence161 >Feature sequence162 <1 992 gene locus_tag LOCUS_18140 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964033.1:aminoacyl-histidine dipeptidase 1184 1780 gene locus_tag LOCUS_18150 gene parA 1184 1780 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18150 1802 1948 gene locus_tag LOCUS_18160 1802 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18160 >Feature sequence163 802 1164 gene locus_tag LOCUS_18170 802 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence164 385 1134 gene locus_tag LOCUS_18180 gene lgtF 385 1134 CDS product beta 1,4 glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 protein_id gnl|my_center|LOCUS_18180 1135 2115 gene locus_tag LOCUS_18190 1135 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003607.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence165 1198 257 gene locus_tag LOCUS_18200 gene prsA 1198 257 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence166 585 1214 gene locus_tag LOCUS_18210 gene queE 585 1214 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_18210 2005 1307 gene locus_tag LOCUS_18220 gene cmk 2005 1307 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 protein_id gnl|my_center|LOCUS_18220 >Feature sequence167 587 219 gene locus_tag LOCUS_18230 587 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_18230 1062 580 gene locus_tag LOCUS_18240 1062 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_18240 <2291 1158 gene locus_tag LOCUS_18250 <2291 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0N4:enoyl-[acyl-carrier-protein] reductase [NADH] >Feature sequence168 <1 2229 gene locus_tag LOCUS_18260 <1 2229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962462.1:DNA polymerase I >Feature sequence169 <2250 1481 gene locus_tag LOCUS_18270 <2250 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256962.1:glycosyl hydrolase family 16 >Feature sequence170 >Feature sequence171 2027 333 gene locus_tag LOCUS_18280 2027 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence172 <2185 1311 gene locus_tag LOCUS_18290 <2185 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760507.1:membrane protein >Feature sequence173 >Feature sequence174 <1 998 gene locus_tag LOCUS_18300 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963900.1:30S ribosomal protein S1 >Feature sequence175 <1 670 gene locus_tag LOCUS_18310 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963017.1:lipid A biosynthesis protein 1521 724 gene locus_tag LOCUS_18320 1521 724 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962664.1 protein_id gnl|my_center|LOCUS_18320 <2090 1583 gene locus_tag LOCUS_18330 <2090 1583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963010.1:phosphoglucosamine mutase >Feature sequence176 >Feature sequence177 818 501 gene locus_tag LOCUS_18340 818 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 <2049 826 gene locus_tag LOCUS_18350 <2049 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108535.1:cell wall-associated protein >Feature sequence178 671 339 gene locus_tag LOCUS_18360 671 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1063 674 gene locus_tag LOCUS_18370 1063 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036007.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence179 953 1384 gene locus_tag LOCUS_18380 953 1384 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964139.1 protein_id gnl|my_center|LOCUS_18380 1386 1742 gene locus_tag LOCUS_18390 gene folB 1386 1742 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_18390 1804 1875 gene locus_tag LOCUS_t00260 1804 1875 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence180 803 141 gene locus_tag LOCUS_18400 803 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1205 852 gene locus_tag LOCUS_18410 1205 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1857 1309 gene locus_tag LOCUS_18420 1857 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence181 1258 395 gene locus_tag LOCUS_18430 1258 395 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207096.1 protein_id gnl|my_center|LOCUS_18430 1866 1255 gene locus_tag LOCUS_18440 1866 1255 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence182 <1943 462 gene locus_tag LOCUS_18450 <1943 462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964226.1:aminopeptidase >Feature sequence183 >Feature sequence184 299 601 gene locus_tag LOCUS_18460 gene rplX 299 601 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ88 protein_id gnl|my_center|LOCUS_18460 610 1161 gene locus_tag LOCUS_18470 gene rplE 610 1161 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_18470 1165 1434 gene locus_tag LOCUS_18480 gene rpsN 1165 1434 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_18480 >Feature sequence185 >Feature sequence186 1069 1728 gene locus_tag LOCUS_18490 1069 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence187 >Feature sequence188 472 1077 gene locus_tag LOCUS_18500 gene rpsD 472 1077 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ74 protein_id gnl|my_center|LOCUS_18500 >Feature sequence189 2 1138 gene locus_tag LOCUS_18510 2 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence190 3 440 gene locus_tag LOCUS_18520 3 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence191 674 255 gene locus_tag LOCUS_18530 674 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 <1735 687 gene locus_tag LOCUS_18540 <1735 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108080.1:cell wall-associated protein >Feature sequence192 >Feature sequence193 953 6 gene locus_tag LOCUS_18550 gene yfkH 953 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_18550 1179 958 gene locus_tag LOCUS_18560 1179 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence194 1302 349 gene locus_tag LOCUS_18570 1302 349 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence195 1061 342 gene locus_tag LOCUS_18580 1061 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence196 >Feature sequence197 >Feature sequence198 >Feature sequence199 <1 755 gene locus_tag LOCUS_18590 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108702.1:cell well associated RhsD protein 976 1155 gene locus_tag LOCUS_18600 976 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence200 562 344 gene locus_tag LOCUS_18610 562 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence201 100 618 gene locus_tag LOCUS_18620 gene rplJ 100 618 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU2 protein_id gnl|my_center|LOCUS_18620 670 1044 gene locus_tag LOCUS_18630 gene rplL 670 1044 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence202 <1 1073 gene locus_tag LOCUS_18640 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767190.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence203 >Feature sequence204 240 881 gene locus_tag LOCUS_18650 240 881 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963839.1 protein_id gnl|my_center|LOCUS_18650 895 1203 gene locus_tag LOCUS_18660 895 1203 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence205 1119 394 gene locus_tag LOCUS_18670 gene nqrE 1119 394 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence206 >Feature sequence207 >Feature sequence208 <1 1270 gene locus_tag LOCUS_18680 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760375.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence209 >Feature sequence210 >Feature sequence211 <1237 723 gene locus_tag LOCUS_18690 <1237 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120414.1:aryl-sulfate sulfohydrolase >Feature sequence212 288 836 gene locus_tag LOCUS_18700 gene grpE 288 836 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_18700 >Feature sequence213 914 282 gene locus_tag LOCUS_18710 914 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence214 796 245 gene locus_tag LOCUS_18720 gene nusG 796 245 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU5 protein_id gnl|my_center|LOCUS_18720 996 799 gene locus_tag LOCUS_18730 996 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1090 1017 gene locus_tag LOCUS_t00270 1090 1017 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence215 >Feature sequence216 >Feature sequence217 >Feature sequence218 >Feature sequence219 577 38 gene locus_tag LOCUS_18740 577 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence220 >Feature sequence221 <1 544 gene locus_tag LOCUS_18750 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202116.1:membrane protein 996 496 gene locus_tag LOCUS_18760 996 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence222 >Feature sequence223 1 840 gene locus_tag LOCUS_18770 1 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 840 1067 gene locus_tag LOCUS_18780 840 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 >Feature sequence224 >Feature sequence225 <1025 274 gene locus_tag LOCUS_18790 <1025 274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXF1:chaperone protein DnaJ >Feature sequence226 >Feature sequence227 >Feature sequence228 51 575 gene locus_tag LOCUS_18800 51 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence229 388 999 gene locus_tag LOCUS_18810 388 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence230