>Feature sequence01 3 1496 gene locus_tag LOCUS_00010 3 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2024 3178 gene locus_tag LOCUS_00020 2024 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3221 3880 gene locus_tag LOCUS_00030 3221 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879076.1 protein_id gnl|my_center|LOCUS_00030 3940 4113 gene locus_tag LOCUS_00040 3940 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4052 4264 gene locus_tag LOCUS_00050 4052 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4436 4257 gene locus_tag LOCUS_00060 4436 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4602 4528 gene locus_tag LOCUS_t00010 4602 4528 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5506 4640 gene locus_tag LOCUS_00070 5506 4640 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274369.1 protein_id gnl|my_center|LOCUS_00070 6176 5481 gene locus_tag LOCUS_00080 6176 5481 CDS product phosphoglycerol geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877910.1 protein_id gnl|my_center|LOCUS_00080 6391 6218 gene locus_tag LOCUS_00090 6391 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7264 6395 gene locus_tag LOCUS_00100 7264 6395 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877908.1 protein_id gnl|my_center|LOCUS_00100 7456 7638 gene locus_tag LOCUS_00110 7456 7638 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878073.1 protein_id gnl|my_center|LOCUS_00110 7652 8812 gene locus_tag LOCUS_00120 gene ftsZ 7652 8812 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878074.1 protein_id gnl|my_center|LOCUS_00120 8847 9140 gene locus_tag LOCUS_00130 8847 9140 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878075.1 protein_id gnl|my_center|LOCUS_00130 9137 9745 gene locus_tag LOCUS_00140 9137 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878076.1 protein_id gnl|my_center|LOCUS_00140 9751 9912 gene locus_tag LOCUS_00150 9751 9912 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878077.1 protein_id gnl|my_center|LOCUS_00150 9922 10188 gene locus_tag LOCUS_00160 9922 10188 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878078.1 protein_id gnl|my_center|LOCUS_00160 10185 10814 gene locus_tag LOCUS_00170 10185 10814 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_00170 10811 11074 gene locus_tag LOCUS_00180 10811 11074 CDS product TIGR04140 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296878.1 protein_id gnl|my_center|LOCUS_00180 11652 11449 gene locus_tag LOCUS_00190 11652 11449 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066352.1 protein_id gnl|my_center|LOCUS_00190 13320 12472 gene locus_tag LOCUS_00200 13320 12472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812228.1 protein_id gnl|my_center|LOCUS_00200 13944 15566 gene locus_tag LOCUS_00210 13944 15566 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879349.1 protein_id gnl|my_center|LOCUS_00210 16726 15569 gene locus_tag LOCUS_00220 16726 15569 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878082.1 protein_id gnl|my_center|LOCUS_00220 16811 17002 gene locus_tag LOCUS_00230 16811 17002 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879729.1 protein_id gnl|my_center|LOCUS_00230 18029 16980 gene locus_tag LOCUS_00240 18029 16980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879728.1 protein_id gnl|my_center|LOCUS_00240 18863 18066 gene locus_tag LOCUS_00250 18863 18066 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878847.1 protein_id gnl|my_center|LOCUS_00250 19017 19202 gene locus_tag LOCUS_00260 19017 19202 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878510.1 protein_id gnl|my_center|LOCUS_00260 19279 19527 gene locus_tag LOCUS_00270 19279 19527 CDS product AF1514 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064400.1 protein_id gnl|my_center|LOCUS_00270 19617 19781 gene locus_tag LOCUS_00280 19617 19781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 19787 20044 gene locus_tag LOCUS_00290 19787 20044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878845.1 protein_id gnl|my_center|LOCUS_00290 20049 20210 gene locus_tag LOCUS_00300 20049 20210 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064374.1 protein_id gnl|my_center|LOCUS_00300 20566 20246 gene locus_tag LOCUS_00310 20566 20246 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064406.1 protein_id gnl|my_center|LOCUS_00310 20826 20578 gene locus_tag LOCUS_00320 20826 20578 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879033.1 protein_id gnl|my_center|LOCUS_00320 20900 22426 gene locus_tag LOCUS_00330 20900 22426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 22512 24908 gene locus_tag LOCUS_00340 gene cdhA 22512 24908 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878596.1 protein_id gnl|my_center|LOCUS_00340 24915 25460 gene locus_tag LOCUS_00350 gene cdhB 24915 25460 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095236.1 protein_id gnl|my_center|LOCUS_00350 25485 25724 gene locus_tag LOCUS_00360 25485 25724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319687.1 protein_id gnl|my_center|LOCUS_00360 25711 26028 gene locus_tag LOCUS_00370 25711 26028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 26530 26147 gene locus_tag LOCUS_00380 gene cbiX 26530 26147 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878224.1 protein_id gnl|my_center|LOCUS_00380 29767 27125 gene locus_tag LOCUS_00390 gene copA 29767 27125 CDS product copper-translocating P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877980.1 protein_id gnl|my_center|LOCUS_00390 29822 30367 gene locus_tag LOCUS_00400 29822 30367 CDS product TRASH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877981.1 protein_id gnl|my_center|LOCUS_00400 30691 30491 gene locus_tag LOCUS_00410 30691 30491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094841.1 protein_id gnl|my_center|LOCUS_00410 31016 30681 gene locus_tag LOCUS_00420 31016 30681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878070.1 protein_id gnl|my_center|LOCUS_00420 31499 31038 gene locus_tag LOCUS_00430 gene nifU 31499 31038 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_00430 32666 31506 gene locus_tag LOCUS_00440 32666 31506 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064599.1 protein_id gnl|my_center|LOCUS_00440 33046 32687 gene locus_tag LOCUS_00450 33046 32687 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318897.1 protein_id gnl|my_center|LOCUS_00450 33280 33047 gene locus_tag LOCUS_00460 33280 33047 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877700.1 protein_id gnl|my_center|LOCUS_00460 33392 33817 gene locus_tag LOCUS_00470 33392 33817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877667.1 protein_id gnl|my_center|LOCUS_00470 33820 34113 gene locus_tag LOCUS_00480 33820 34113 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877668.1 protein_id gnl|my_center|LOCUS_00480 34158 35351 gene locus_tag LOCUS_00490 34158 35351 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274347.1 protein_id gnl|my_center|LOCUS_00490 35420 36706 gene locus_tag LOCUS_00500 35420 36706 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877676.1 protein_id gnl|my_center|LOCUS_00500 36708 36941 gene locus_tag LOCUS_00510 36708 36941 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877677.1 protein_id gnl|my_center|LOCUS_00510 37074 37886 gene locus_tag LOCUS_00520 37074 37886 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064595.1 protein_id gnl|my_center|LOCUS_00520 38192 38007 gene locus_tag LOCUS_00530 38192 38007 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877678.1 protein_id gnl|my_center|LOCUS_00530 39354 38197 gene locus_tag LOCUS_00540 39354 38197 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065687.1 protein_id gnl|my_center|LOCUS_00540 39639 39361 gene locus_tag LOCUS_00550 39639 39361 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877680.1 protein_id gnl|my_center|LOCUS_00550 40144 39686 gene locus_tag LOCUS_00560 40144 39686 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877681.1 protein_id gnl|my_center|LOCUS_00560 40252 41553 gene locus_tag LOCUS_00570 40252 41553 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042680609.1 protein_id gnl|my_center|LOCUS_00570 41820 41620 gene locus_tag LOCUS_00580 41820 41620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 41762 42271 gene locus_tag LOCUS_00590 41762 42271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 42771 42298 gene locus_tag LOCUS_00600 42771 42298 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877685.1 protein_id gnl|my_center|LOCUS_00600 43982 42768 gene locus_tag LOCUS_00610 gene nrfD 43982 42768 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320695.1 protein_id gnl|my_center|LOCUS_00610 44734 43979 gene locus_tag LOCUS_00620 44734 43979 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320694.1 protein_id gnl|my_center|LOCUS_00620 47444 44751 gene locus_tag LOCUS_00630 47444 44751 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877688.1 protein_id gnl|my_center|LOCUS_00630 48093 47515 gene locus_tag LOCUS_00640 48093 47515 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877689.1 protein_id gnl|my_center|LOCUS_00640 48220 49506 gene locus_tag LOCUS_00650 48220 49506 CDS product DUF22 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877690.1 protein_id gnl|my_center|LOCUS_00650 49503 50219 gene locus_tag LOCUS_00660 49503 50219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064181.1 protein_id gnl|my_center|LOCUS_00660 51129 50206 gene locus_tag LOCUS_00670 51129 50206 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064182.1 protein_id gnl|my_center|LOCUS_00670 52286 51126 gene locus_tag LOCUS_00680 gene pscS 52286 51126 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966499.1 protein_id gnl|my_center|LOCUS_00680 52685 52365 gene locus_tag LOCUS_00690 52685 52365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 53127 52687 gene locus_tag LOCUS_00700 53127 52687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 54139 53519 gene locus_tag LOCUS_00710 54139 53519 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274356.1 protein_id gnl|my_center|LOCUS_00710 56055 54139 gene locus_tag LOCUS_00720 gene feoB 56055 54139 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877757.1 protein_id gnl|my_center|LOCUS_00720 56307 56999 gene locus_tag LOCUS_00730 gene fdhD 56307 56999 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877879.1 protein_id gnl|my_center|LOCUS_00730 57793 56996 gene locus_tag LOCUS_00740 gene larE 57793 56996 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878066.1 protein_id gnl|my_center|LOCUS_00740 58276 57863 gene locus_tag LOCUS_00750 58276 57863 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878065.1 protein_id gnl|my_center|LOCUS_00750 59428 58286 gene locus_tag LOCUS_00760 59428 58286 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_00760 59651 59430 gene locus_tag LOCUS_00770 59651 59430 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878063.1 protein_id gnl|my_center|LOCUS_00770 60055 59672 gene locus_tag LOCUS_00780 60055 59672 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878062.1 protein_id gnl|my_center|LOCUS_00780 60331 61935 gene locus_tag LOCUS_00790 60331 61935 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942936.1 protein_id gnl|my_center|LOCUS_00790 62200 61943 gene locus_tag LOCUS_00800 62200 61943 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423249.1 protein_id gnl|my_center|LOCUS_00800 62978 62169 gene locus_tag LOCUS_00810 62978 62169 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878060.1 protein_id gnl|my_center|LOCUS_00810 63258 62995 gene locus_tag LOCUS_00820 63258 62995 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878059.1 protein_id gnl|my_center|LOCUS_00820 64481 63255 gene locus_tag LOCUS_00830 gene thrC 64481 63255 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878058.1 protein_id gnl|my_center|LOCUS_00830 64590 64976 gene locus_tag LOCUS_00840 64590 64976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319306.1 protein_id gnl|my_center|LOCUS_00840 65029 65565 gene locus_tag LOCUS_00850 65029 65565 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064183.1 protein_id gnl|my_center|LOCUS_00850 65980 66291 gene locus_tag LOCUS_00860 65980 66291 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879039.1 protein_id gnl|my_center|LOCUS_00860 66293 67444 gene locus_tag LOCUS_00870 66293 67444 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879038.1 protein_id gnl|my_center|LOCUS_00870 67885 67508 gene locus_tag LOCUS_00880 67885 67508 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877656.1 protein_id gnl|my_center|LOCUS_00880 69752 67890 gene locus_tag LOCUS_00890 69752 67890 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877655.1 protein_id gnl|my_center|LOCUS_00890 70066 69773 gene locus_tag LOCUS_00900 70066 69773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877653.1 protein_id gnl|my_center|LOCUS_00900 70809 70078 gene locus_tag LOCUS_00910 70809 70078 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274345.1 protein_id gnl|my_center|LOCUS_00910 71204 70806 gene locus_tag LOCUS_00920 71204 70806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 73141 71201 gene locus_tag LOCUS_00930 73141 71201 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_00930 73472 73128 gene locus_tag LOCUS_00940 73472 73128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 73612 74067 gene locus_tag LOCUS_00950 73612 74067 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320645.1 protein_id gnl|my_center|LOCUS_00950 74118 74477 gene locus_tag LOCUS_00960 74118 74477 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867699.1 protein_id gnl|my_center|LOCUS_00960 74464 75117 gene locus_tag LOCUS_00970 74464 75117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 76198 75101 gene locus_tag LOCUS_00980 76198 75101 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903552.1 protein_id gnl|my_center|LOCUS_00980 77669 76386 gene locus_tag LOCUS_00990 77669 76386 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249937.1 protein_id gnl|my_center|LOCUS_00990 79835 77784 gene locus_tag LOCUS_01000 79835 77784 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146750.1 protein_id gnl|my_center|LOCUS_01000 80161 79832 gene locus_tag LOCUS_01010 80161 79832 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868054.1 protein_id gnl|my_center|LOCUS_01010 80304 80639 gene locus_tag LOCUS_01020 80304 80639 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423239.1 protein_id gnl|my_center|LOCUS_01020 80652 82682 gene locus_tag LOCUS_01030 80652 82682 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_01030 82761 83138 gene locus_tag LOCUS_01040 82761 83138 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877851.1 protein_id gnl|my_center|LOCUS_01040 83920 83144 gene locus_tag LOCUS_01050 83920 83144 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878193.1 protein_id gnl|my_center|LOCUS_01050 83969 85729 gene locus_tag LOCUS_01060 83969 85729 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878194.1 protein_id gnl|my_center|LOCUS_01060 85968 85777 gene locus_tag LOCUS_01070 85968 85777 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877934.1 protein_id gnl|my_center|LOCUS_01070 86712 86041 gene locus_tag LOCUS_01080 gene sfsA 86712 86041 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879013.1 protein_id gnl|my_center|LOCUS_01080 87213 86719 gene locus_tag LOCUS_01090 87213 86719 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879014.1 protein_id gnl|my_center|LOCUS_01090 87810 87238 gene locus_tag LOCUS_01100 gene afpA 87810 87238 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064401.1 protein_id gnl|my_center|LOCUS_01100 88399 87812 gene locus_tag LOCUS_01110 88399 87812 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879016.1 protein_id gnl|my_center|LOCUS_01110 89565 88396 gene locus_tag LOCUS_01120 89565 88396 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064402.1 protein_id gnl|my_center|LOCUS_01120 89667 90083 gene locus_tag LOCUS_01130 89667 90083 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878858.1 protein_id gnl|my_center|LOCUS_01130 90406 90068 gene locus_tag LOCUS_01140 90406 90068 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878413.1 protein_id gnl|my_center|LOCUS_01140 90519 91592 gene locus_tag LOCUS_01150 90519 91592 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_01150 91679 91867 gene locus_tag LOCUS_01160 91679 91867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 92610 91873 gene locus_tag LOCUS_01170 92610 91873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 92732 93310 gene locus_tag LOCUS_01180 92732 93310 CDS product [protein ADP-ribosylglutamate] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064404.1 protein_id gnl|my_center|LOCUS_01180 94026 93394 gene locus_tag LOCUS_01190 94026 93394 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878479.1 protein_id gnl|my_center|LOCUS_01190 94582 94016 gene locus_tag LOCUS_01200 94582 94016 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878480.1 protein_id gnl|my_center|LOCUS_01200 94935 94642 gene locus_tag LOCUS_01210 94935 94642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01210 95254 94904 gene locus_tag LOCUS_01220 95254 94904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01220 95746 95303 gene locus_tag LOCUS_01230 95746 95303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01230 96250 95759 gene locus_tag LOCUS_01240 96250 95759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01240 96567 96253 gene locus_tag LOCUS_01250 96567 96253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01250 96725 97786 gene locus_tag LOCUS_01260 96725 97786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 97835 98713 gene locus_tag LOCUS_01270 97835 98713 CDS product DNA primase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879787.1 protein_id gnl|my_center|LOCUS_01270 99364 98813 gene locus_tag LOCUS_01280 99364 98813 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258961.1 protein_id gnl|my_center|LOCUS_01280 99926 99327 gene locus_tag LOCUS_01290 99926 99327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318956.1 protein_id gnl|my_center|LOCUS_01290 100432 99923 gene locus_tag LOCUS_01300 gene feR 100432 99923 CDS product ferric-chelate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878333.1 protein_id gnl|my_center|LOCUS_01300 101023 100448 gene locus_tag LOCUS_01310 101023 100448 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878334.1 protein_id gnl|my_center|LOCUS_01310 101419 101042 gene locus_tag LOCUS_01320 101419 101042 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_01320 101961 101437 gene locus_tag LOCUS_01330 101961 101437 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_01330 102134 101949 gene locus_tag LOCUS_01340 102134 101949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 102446 102374 gene locus_tag LOCUS_t00020 102446 102374 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 102545 103726 gene locus_tag LOCUS_01350 102545 103726 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_01350 103865 103785 gene locus_tag LOCUS_t00030 103865 103785 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 103977 104231 gene locus_tag LOCUS_01360 103977 104231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064198.1 protein_id gnl|my_center|LOCUS_01360 105349 104228 gene locus_tag LOCUS_01370 105349 104228 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877767.1 protein_id gnl|my_center|LOCUS_01370 105424 105495 gene locus_tag LOCUS_t00040 105424 105495 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 105580 105828 gene locus_tag LOCUS_01380 105580 105828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 106460 105810 gene locus_tag LOCUS_01390 106460 105810 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877913.1 protein_id gnl|my_center|LOCUS_01390 106957 106448 gene locus_tag LOCUS_01400 106957 106448 CDS product DUF531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877914.1 protein_id gnl|my_center|LOCUS_01400 107784 106954 gene locus_tag LOCUS_01410 107784 106954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877915.1 protein_id gnl|my_center|LOCUS_01410 107875 109011 gene locus_tag LOCUS_01420 107875 109011 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877916.1 protein_id gnl|my_center|LOCUS_01420 109071 111728 gene locus_tag LOCUS_01430 109071 111728 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877917.1 protein_id gnl|my_center|LOCUS_01430 111760 113160 gene locus_tag LOCUS_01440 gene cysS 111760 113160 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877918.1 protein_id gnl|my_center|LOCUS_01440 113157 113594 gene locus_tag LOCUS_01450 113157 113594 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274370.1 protein_id gnl|my_center|LOCUS_01450 113581 114588 gene locus_tag LOCUS_01460 113581 114588 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877920.1 protein_id gnl|my_center|LOCUS_01460 115107 114556 gene locus_tag LOCUS_01470 115107 114556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877925.1 protein_id gnl|my_center|LOCUS_01470 115804 115058 gene locus_tag LOCUS_01480 115804 115058 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877926.1 protein_id gnl|my_center|LOCUS_01480 116025 115789 gene locus_tag LOCUS_01490 116025 115789 CDS product RNA repair domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012939633.1 protein_id gnl|my_center|LOCUS_01490 116527 116012 gene locus_tag LOCUS_01500 116527 116012 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877928.1 protein_id gnl|my_center|LOCUS_01500 117305 116553 gene locus_tag LOCUS_01510 gene cobA 117305 116553 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877929.1 protein_id gnl|my_center|LOCUS_01510 117468 118724 gene locus_tag LOCUS_01520 gene dsrA 117468 118724 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877930.1 protein_id gnl|my_center|LOCUS_01520 118724 119824 gene locus_tag LOCUS_01530 gene dsrB 118724 119824 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064231.1 protein_id gnl|my_center|LOCUS_01530 119867 120100 gene locus_tag LOCUS_01540 119867 120100 CDS product dissimilatory sulfite reductase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877932.1 protein_id gnl|my_center|LOCUS_01540 120118 121086 gene locus_tag LOCUS_01550 120118 121086 CDS product DUF483 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877933.1 protein_id gnl|my_center|LOCUS_01550 121133 121324 gene locus_tag LOCUS_01560 121133 121324 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877934.1 protein_id gnl|my_center|LOCUS_01560 122247 121258 gene locus_tag LOCUS_01570 122247 121258 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877935.1 protein_id gnl|my_center|LOCUS_01570 123280 122270 gene locus_tag LOCUS_01580 123280 122270 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064232.1 protein_id gnl|my_center|LOCUS_01580 124031 123282 gene locus_tag LOCUS_01590 124031 123282 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877937.1 protein_id gnl|my_center|LOCUS_01590 125062 124046 gene locus_tag LOCUS_01600 125062 124046 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877938.1 protein_id gnl|my_center|LOCUS_01600 126159 125059 gene locus_tag LOCUS_01610 126159 125059 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877939.1 protein_id gnl|my_center|LOCUS_01610 126902 126156 gene locus_tag LOCUS_01620 126902 126156 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869576.1 protein_id gnl|my_center|LOCUS_01620 128015 127098 gene locus_tag LOCUS_01630 128015 127098 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877941.1 protein_id gnl|my_center|LOCUS_01630 128795 128025 gene locus_tag LOCUS_01640 128795 128025 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_01640 129946 128798 gene locus_tag LOCUS_01650 129946 128798 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877943.1 protein_id gnl|my_center|LOCUS_01650 130338 129946 gene locus_tag LOCUS_01660 130338 129946 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877944.1 protein_id gnl|my_center|LOCUS_01660 131506 130343 gene locus_tag LOCUS_01670 131506 130343 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877945.1 protein_id gnl|my_center|LOCUS_01670 132086 131598 gene locus_tag LOCUS_01680 132086 131598 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877946.1 protein_id gnl|my_center|LOCUS_01680 132515 132171 gene locus_tag LOCUS_01690 gene queD 132515 132171 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320165.1 protein_id gnl|my_center|LOCUS_01690 133193 132516 gene locus_tag LOCUS_01700 133193 132516 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877948.1 protein_id gnl|my_center|LOCUS_01700 133887 133174 gene locus_tag LOCUS_01710 gene queC 133887 133174 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_01710 133980 134063 gene locus_tag LOCUS_t00050 133980 134063 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 135758 134085 gene locus_tag LOCUS_01720 135758 134085 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_01720 135861 136568 gene locus_tag LOCUS_01730 135861 136568 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846139.1 protein_id gnl|my_center|LOCUS_01730 136616 137458 gene locus_tag LOCUS_01740 136616 137458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 137448 138530 gene locus_tag LOCUS_01750 137448 138530 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250930.1 protein_id gnl|my_center|LOCUS_01750 138532 139410 gene locus_tag LOCUS_01760 gene porB 138532 139410 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762255.1 protein_id gnl|my_center|LOCUS_01760 139400 139684 gene locus_tag LOCUS_01770 139400 139684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 140321 139686 gene locus_tag LOCUS_01780 140321 139686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249947.1 protein_id gnl|my_center|LOCUS_01780 141229 140321 gene locus_tag LOCUS_01790 141229 140321 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868361.1 protein_id gnl|my_center|LOCUS_01790 141507 141238 gene locus_tag LOCUS_01800 141507 141238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249944.1 protein_id gnl|my_center|LOCUS_01800 143244 141547 gene locus_tag LOCUS_01810 143244 141547 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249942.1 protein_id gnl|my_center|LOCUS_01810 143372 144508 gene locus_tag LOCUS_01820 143372 144508 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879900.1 protein_id gnl|my_center|LOCUS_01820 144652 145341 gene locus_tag LOCUS_01830 144652 145341 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879901.1 protein_id gnl|my_center|LOCUS_01830 145338 146369 gene locus_tag LOCUS_01840 145338 146369 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871070.1 protein_id gnl|my_center|LOCUS_01840 146366 147520 gene locus_tag LOCUS_01850 146366 147520 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879903.1 protein_id gnl|my_center|LOCUS_01850 147525 147893 gene locus_tag LOCUS_01860 147525 147893 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879904.1 protein_id gnl|my_center|LOCUS_01860 148531 147890 gene locus_tag LOCUS_01870 148531 147890 CDS product ERCC4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879905.1 protein_id gnl|my_center|LOCUS_01870 148869 148528 gene locus_tag LOCUS_01880 148869 148528 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879906.1 protein_id gnl|my_center|LOCUS_01880 150583 148850 gene locus_tag LOCUS_01890 150583 148850 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879907.1 protein_id gnl|my_center|LOCUS_01890 153432 150631 gene locus_tag LOCUS_01900 gene leuS 153432 150631 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879908.1 protein_id gnl|my_center|LOCUS_01900 153955 153467 gene locus_tag LOCUS_01910 153955 153467 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879909.1 protein_id gnl|my_center|LOCUS_01910 154911 154003 gene locus_tag LOCUS_01920 154911 154003 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_01920 155830 154913 gene locus_tag LOCUS_01930 155830 154913 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 protein_id gnl|my_center|LOCUS_01930 156975 155827 gene locus_tag LOCUS_01940 gene agl3 156975 155827 CDS product UDP-sulfoquinovose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846779.1 protein_id gnl|my_center|LOCUS_01940 157049 157870 gene locus_tag LOCUS_01950 157049 157870 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061059.1 protein_id gnl|my_center|LOCUS_01950 <158919 157888 gene locus_tag LOCUS_01960 <158919 157888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878050.1:(Fe-S)-binding protein >Feature sequence02 2174 2545 gene locus_tag LOCUS_01970 2174 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 2550 2888 gene locus_tag LOCUS_01980 2550 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 2890 3042 gene locus_tag LOCUS_01990 2890 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 3046 3342 gene locus_tag LOCUS_02000 3046 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250300.1 protein_id gnl|my_center|LOCUS_02000 3374 4339 gene locus_tag LOCUS_02010 3374 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 4877 4383 gene locus_tag LOCUS_02020 4877 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 5333 4974 gene locus_tag LOCUS_02030 5333 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 5473 5402 gene locus_tag LOCUS_t00060 5473 5402 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5572 6759 gene locus_tag LOCUS_02040 5572 6759 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879532.1 protein_id gnl|my_center|LOCUS_02040 7732 6767 gene locus_tag LOCUS_02050 7732 6767 CDS product NOL1/NOP2/sun family putative RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879531.1 protein_id gnl|my_center|LOCUS_02050 9599 7719 gene locus_tag LOCUS_02060 gene rqcH 9599 7719 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879530.1 protein_id gnl|my_center|LOCUS_02060 9655 10596 gene locus_tag LOCUS_02070 9655 10596 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879529.1 protein_id gnl|my_center|LOCUS_02070 11170 12411 gene locus_tag LOCUS_02080 11170 12411 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546645.1 protein_id gnl|my_center|LOCUS_02080 12411 13079 gene locus_tag LOCUS_02090 12411 13079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 13178 13390 gene locus_tag LOCUS_02100 13178 13390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 13963 13439 gene locus_tag LOCUS_02110 13963 13439 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197030939.1 protein_id gnl|my_center|LOCUS_02110 15216 13969 gene locus_tag LOCUS_02120 15216 13969 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877645.1 protein_id gnl|my_center|LOCUS_02120 16352 15213 gene locus_tag LOCUS_02130 16352 15213 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064172.1 protein_id gnl|my_center|LOCUS_02130 16836 16357 gene locus_tag LOCUS_02140 16836 16357 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877647.1 protein_id gnl|my_center|LOCUS_02140 18205 16895 gene locus_tag LOCUS_02150 18205 16895 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879505.1 protein_id gnl|my_center|LOCUS_02150 18340 18414 gene locus_tag LOCUS_t00070 18340 18414 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19293 18787 gene locus_tag LOCUS_02160 19293 18787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 19365 19592 gene locus_tag LOCUS_02170 19365 19592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 19671 19796 gene locus_tag LOCUS_02180 19671 19796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 21706 19838 gene locus_tag LOCUS_02190 21706 19838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 22040 21750 gene locus_tag LOCUS_02200 22040 21750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 22305 22027 gene locus_tag LOCUS_02210 22305 22027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 22741 22358 gene locus_tag LOCUS_02220 22741 22358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 23001 22735 gene locus_tag LOCUS_02230 23001 22735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 23259 23008 gene locus_tag LOCUS_02240 23259 23008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 24177 23335 gene locus_tag LOCUS_02250 24177 23335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 24550 24248 gene locus_tag LOCUS_02260 24550 24248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 24696 24953 gene locus_tag LOCUS_02270 24696 24953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 27530 25317 gene locus_tag LOCUS_02280 27530 25317 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879109.1 protein_id gnl|my_center|LOCUS_02280 28371 27562 gene locus_tag LOCUS_02290 28371 27562 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879187.1 protein_id gnl|my_center|LOCUS_02290 28996 28373 gene locus_tag LOCUS_02300 28996 28373 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879188.1 protein_id gnl|my_center|LOCUS_02300 29056 30045 gene locus_tag LOCUS_02310 gene purM 29056 30045 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879189.1 protein_id gnl|my_center|LOCUS_02310 31326 30055 gene locus_tag LOCUS_02320 31326 30055 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879190.1 protein_id gnl|my_center|LOCUS_02320 31376 32248 gene locus_tag LOCUS_02330 31376 32248 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879191.1 protein_id gnl|my_center|LOCUS_02330 32250 32711 gene locus_tag LOCUS_02340 32250 32711 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318917.1 protein_id gnl|my_center|LOCUS_02340 32756 33205 gene locus_tag LOCUS_02350 32756 33205 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879193.1 protein_id gnl|my_center|LOCUS_02350 33242 33772 gene locus_tag LOCUS_02360 33242 33772 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064441.1 protein_id gnl|my_center|LOCUS_02360 33942 34517 gene locus_tag LOCUS_02370 33942 34517 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879195.1 protein_id gnl|my_center|LOCUS_02370 34514 34807 gene locus_tag LOCUS_02380 34514 34807 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879196.1 protein_id gnl|my_center|LOCUS_02380 34819 35994 gene locus_tag LOCUS_02390 34819 35994 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879197.1 protein_id gnl|my_center|LOCUS_02390 35991 36881 gene locus_tag LOCUS_02400 35991 36881 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879198.1 protein_id gnl|my_center|LOCUS_02400 36898 37521 gene locus_tag LOCUS_02410 36898 37521 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879199.1 protein_id gnl|my_center|LOCUS_02410 38325 37513 gene locus_tag LOCUS_02420 38325 37513 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879200.1 protein_id gnl|my_center|LOCUS_02420 40666 38357 gene locus_tag LOCUS_02430 gene hdrA2 40666 38357 CDS product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878733.1 protein_id gnl|my_center|LOCUS_02430 40744 41268 gene locus_tag LOCUS_02440 40744 41268 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879700.1 protein_id gnl|my_center|LOCUS_02440 41288 41527 gene locus_tag LOCUS_02450 41288 41527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274475.1 protein_id gnl|my_center|LOCUS_02450 41535 42299 gene locus_tag LOCUS_02460 41535 42299 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_02460 42997 42296 gene locus_tag LOCUS_02470 42997 42296 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879697.1 protein_id gnl|my_center|LOCUS_02470 43950 43057 gene locus_tag LOCUS_02480 gene fhcD 43950 43057 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879696.1 protein_id gnl|my_center|LOCUS_02480 44953 44507 gene locus_tag LOCUS_02490 44953 44507 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879695.1 protein_id gnl|my_center|LOCUS_02490 46018 44969 gene locus_tag LOCUS_02500 46018 44969 CDS product SPOUT family RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879715.1 protein_id gnl|my_center|LOCUS_02500 46129 46881 gene locus_tag LOCUS_02510 46129 46881 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_02510 46920 49511 gene locus_tag LOCUS_02520 gene valS 46920 49511 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879713.1 protein_id gnl|my_center|LOCUS_02520 49560 50552 gene locus_tag LOCUS_02530 49560 50552 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139344285.1 protein_id gnl|my_center|LOCUS_02530 50549 52675 gene locus_tag LOCUS_02540 50549 52675 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683854.1 protein_id gnl|my_center|LOCUS_02540 52782 53009 gene locus_tag LOCUS_02550 52782 53009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879114.1 protein_id gnl|my_center|LOCUS_02550 53021 54493 gene locus_tag LOCUS_02560 53021 54493 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459002.1 protein_id gnl|my_center|LOCUS_02560 54516 54767 gene locus_tag LOCUS_02570 54516 54767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 55630 54764 gene locus_tag LOCUS_02580 55630 54764 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879112.1 protein_id gnl|my_center|LOCUS_02580 55827 57155 gene locus_tag LOCUS_02590 gene rbcL 55827 57155 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879134.1 protein_id gnl|my_center|LOCUS_02590 57609 57160 gene locus_tag LOCUS_02600 57609 57160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270476.1 protein_id gnl|my_center|LOCUS_02600 58481 57591 gene locus_tag LOCUS_02610 58481 57591 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879058.1 protein_id gnl|my_center|LOCUS_02610 58620 59939 gene locus_tag LOCUS_02620 58620 59939 CDS product DUF22 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879024.1 protein_id gnl|my_center|LOCUS_02620 59961 60386 gene locus_tag LOCUS_02630 59961 60386 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879023.1 protein_id gnl|my_center|LOCUS_02630 60388 61251 gene locus_tag LOCUS_02640 60388 61251 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879022.1 protein_id gnl|my_center|LOCUS_02640 61248 61505 gene locus_tag LOCUS_02650 61248 61505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 61526 62524 gene locus_tag LOCUS_02660 61526 62524 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877749.1 protein_id gnl|my_center|LOCUS_02660 63906 62494 gene locus_tag LOCUS_02670 63906 62494 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590803.1 protein_id gnl|my_center|LOCUS_02670 64368 64180 gene locus_tag LOCUS_02680 64368 64180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 64316 65188 gene locus_tag LOCUS_02690 64316 65188 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877746.1 protein_id gnl|my_center|LOCUS_02690 65229 65831 gene locus_tag LOCUS_02700 65229 65831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 65848 66480 gene locus_tag LOCUS_02710 gene pyrF 65848 66480 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064309.1 protein_id gnl|my_center|LOCUS_02710 66473 67060 gene locus_tag LOCUS_02720 66473 67060 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878428.1 protein_id gnl|my_center|LOCUS_02720 67057 67809 gene locus_tag LOCUS_02730 67057 67809 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867813.1 protein_id gnl|my_center|LOCUS_02730 68233 67817 gene locus_tag LOCUS_02740 68233 67817 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064308.1 protein_id gnl|my_center|LOCUS_02740 69330 68332 gene locus_tag LOCUS_02750 gene mer 69330 68332 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_02750 70741 69386 gene locus_tag LOCUS_02760 70741 69386 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_02760 71940 70777 gene locus_tag LOCUS_02770 71940 70777 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878861.1 protein_id gnl|my_center|LOCUS_02770 72196 71933 gene locus_tag LOCUS_02780 72196 71933 CDS product DUF2095 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878860.1 protein_id gnl|my_center|LOCUS_02780 73133 72156 gene locus_tag LOCUS_02790 73133 72156 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878859.1 protein_id gnl|my_center|LOCUS_02790 73727 73173 gene locus_tag LOCUS_02800 73727 73173 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064451.1 protein_id gnl|my_center|LOCUS_02800 74304 73729 gene locus_tag LOCUS_02810 74304 73729 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879239.1 protein_id gnl|my_center|LOCUS_02810 74576 74761 gene locus_tag LOCUS_02820 74576 74761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 75617 75234 gene locus_tag LOCUS_02830 75617 75234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877610.1 protein_id gnl|my_center|LOCUS_02830 76740 75610 gene locus_tag LOCUS_02840 76740 75610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 77477 77719 gene locus_tag LOCUS_02850 77477 77719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02850 77984 78298 gene locus_tag LOCUS_02860 77984 78298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 79409 78285 gene locus_tag LOCUS_02870 79409 78285 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064319.1 protein_id gnl|my_center|LOCUS_02870 80094 79411 gene locus_tag LOCUS_02880 80094 79411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_02880 81461 80091 gene locus_tag LOCUS_02890 81461 80091 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878519.1 protein_id gnl|my_center|LOCUS_02890 82189 81638 gene locus_tag LOCUS_02900 82189 81638 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878520.1 protein_id gnl|my_center|LOCUS_02900 82214 83017 gene locus_tag LOCUS_02910 82214 83017 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878521.1 protein_id gnl|my_center|LOCUS_02910 84329 83103 gene locus_tag LOCUS_02920 gene gatD 84329 83103 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319255.1 protein_id gnl|my_center|LOCUS_02920 85743 84322 gene locus_tag LOCUS_02930 gene argH 85743 84322 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878383.1 protein_id gnl|my_center|LOCUS_02930 85847 86128 gene locus_tag LOCUS_02940 85847 86128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878384.1 protein_id gnl|my_center|LOCUS_02940 86118 86525 gene locus_tag LOCUS_02950 86118 86525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 86557 86646 gene locus_tag LOCUS_t00080 86557 86646 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 86790 88325 gene locus_tag LOCUS_02960 gene lcfB 86790 88325 CDS product long-chain-fatty-acid--CoA ligase LcfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244686.1 protein_id gnl|my_center|LOCUS_02960 88988 88329 gene locus_tag LOCUS_02970 88988 88329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878189.1 protein_id gnl|my_center|LOCUS_02970 89767 88994 gene locus_tag LOCUS_02980 gene gctB 89767 88994 CDS product glutaconate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902656.1 protein_id gnl|my_center|LOCUS_02980 90738 89770 gene locus_tag LOCUS_02990 90738 89770 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_02990 91594 90731 gene locus_tag LOCUS_03000 91594 90731 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064266.1 protein_id gnl|my_center|LOCUS_03000 92216 91653 gene locus_tag LOCUS_03010 92216 91653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 93130 92405 gene locus_tag LOCUS_03020 93130 92405 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064549.1 protein_id gnl|my_center|LOCUS_03020 93180 93704 gene locus_tag LOCUS_03030 93180 93704 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879756.1 protein_id gnl|my_center|LOCUS_03030 94473 93670 gene locus_tag LOCUS_03040 94473 93670 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879755.1 protein_id gnl|my_center|LOCUS_03040 94528 95121 gene locus_tag LOCUS_03050 gene hisH 94528 95121 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879754.1 protein_id gnl|my_center|LOCUS_03050 95170 95508 gene locus_tag LOCUS_03060 95170 95508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879004.1 protein_id gnl|my_center|LOCUS_03060 95575 96570 gene locus_tag LOCUS_03070 gene asd 95575 96570 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 protein_id gnl|my_center|LOCUS_03070 96618 97790 gene locus_tag LOCUS_03080 96618 97790 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064399.1 protein_id gnl|my_center|LOCUS_03080 97938 98570 gene locus_tag LOCUS_03090 97938 98570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064398.1 protein_id gnl|my_center|LOCUS_03090 98567 99577 gene locus_tag LOCUS_03100 98567 99577 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879000.1 protein_id gnl|my_center|LOCUS_03100 99574 99780 gene locus_tag LOCUS_03110 99574 99780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878999.1 protein_id gnl|my_center|LOCUS_03110 100523 99777 gene locus_tag LOCUS_03120 100523 99777 CDS product DUF2226 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878998.1 protein_id gnl|my_center|LOCUS_03120 100871 100527 gene locus_tag LOCUS_03130 100871 100527 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878997.1 protein_id gnl|my_center|LOCUS_03130 101741 100917 gene locus_tag LOCUS_03140 101741 100917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274430.1 protein_id gnl|my_center|LOCUS_03140 102037 102876 gene locus_tag LOCUS_03150 102037 102876 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878995.1 protein_id gnl|my_center|LOCUS_03150 104122 102866 gene locus_tag LOCUS_03160 gene aroA 104122 102866 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878994.1 protein_id gnl|my_center|LOCUS_03160 105156 104113 gene locus_tag LOCUS_03170 105156 104113 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878993.1 protein_id gnl|my_center|LOCUS_03170 105566 105153 gene locus_tag LOCUS_03180 105566 105153 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878992.1 protein_id gnl|my_center|LOCUS_03180 106153 105578 gene locus_tag LOCUS_03190 106153 105578 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878293.1 protein_id gnl|my_center|LOCUS_03190 106343 106134 gene locus_tag LOCUS_03200 106343 106134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 107868 106420 gene locus_tag LOCUS_03210 gene glnA 107868 106420 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318802.1 protein_id gnl|my_center|LOCUS_03210 108102 108557 gene locus_tag LOCUS_03220 108102 108557 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064659.1 protein_id gnl|my_center|LOCUS_03220 108554 109843 gene locus_tag LOCUS_03230 108554 109843 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878451.1 protein_id gnl|my_center|LOCUS_03230 109840 110979 gene locus_tag LOCUS_03240 109840 110979 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878452.1 protein_id gnl|my_center|LOCUS_03240 110980 112512 gene locus_tag LOCUS_03250 110980 112512 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878453.1 protein_id gnl|my_center|LOCUS_03250 112509 113351 gene locus_tag LOCUS_03260 112509 113351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878454.1 protein_id gnl|my_center|LOCUS_03260 113478 115034 gene locus_tag LOCUS_03270 113478 115034 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879889.1 protein_id gnl|my_center|LOCUS_03270 >Feature sequence03 217 690 gene locus_tag LOCUS_03280 217 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879759.1 protein_id gnl|my_center|LOCUS_03280 723 1487 gene locus_tag LOCUS_03290 723 1487 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879758.1 protein_id gnl|my_center|LOCUS_03290 1523 2182 gene locus_tag LOCUS_03300 gene pyrH 1523 2182 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879534.1 protein_id gnl|my_center|LOCUS_03300 2507 2172 gene locus_tag LOCUS_03310 2507 2172 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319505.1 protein_id gnl|my_center|LOCUS_03310 3127 2462 gene locus_tag LOCUS_03320 gene pssA 3127 2462 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879536.1 protein_id gnl|my_center|LOCUS_03320 3692 3105 gene locus_tag LOCUS_03330 3692 3105 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879537.1 protein_id gnl|my_center|LOCUS_03330 4438 3689 gene locus_tag LOCUS_03340 gene artA 4438 3689 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879538.1 protein_id gnl|my_center|LOCUS_03340 5929 4652 gene locus_tag LOCUS_03350 5929 4652 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096703.1 protein_id gnl|my_center|LOCUS_03350 6027 6938 gene locus_tag LOCUS_03360 6027 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096210.1 protein_id gnl|my_center|LOCUS_03360 6928 8073 gene locus_tag LOCUS_03370 6928 8073 CDS product Clp1/GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879541.1 protein_id gnl|my_center|LOCUS_03370 8080 8463 gene locus_tag LOCUS_03380 8080 8463 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879542.1 protein_id gnl|my_center|LOCUS_03380 8460 9035 gene locus_tag LOCUS_03390 8460 9035 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879543.1 protein_id gnl|my_center|LOCUS_03390 9858 9022 gene locus_tag LOCUS_03400 9858 9022 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879544.1 protein_id gnl|my_center|LOCUS_03400 10970 9855 gene locus_tag LOCUS_03410 10970 9855 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096516.1 protein_id gnl|my_center|LOCUS_03410 11182 10934 gene locus_tag LOCUS_03420 11182 10934 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879546.1 protein_id gnl|my_center|LOCUS_03420 11688 11173 gene locus_tag LOCUS_03430 11688 11173 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879547.1 protein_id gnl|my_center|LOCUS_03430 12013 11720 gene locus_tag LOCUS_03440 gene tatA 12013 11720 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879548.1 protein_id gnl|my_center|LOCUS_03440 12128 13303 gene locus_tag LOCUS_03450 12128 13303 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064757.1 protein_id gnl|my_center|LOCUS_03450 13334 14368 gene locus_tag LOCUS_03460 13334 14368 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879550.1 protein_id gnl|my_center|LOCUS_03460 14915 14349 gene locus_tag LOCUS_03470 14915 14349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683780.1 protein_id gnl|my_center|LOCUS_03470 15874 14915 gene locus_tag LOCUS_03480 15874 14915 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_03480 16509 15889 gene locus_tag LOCUS_03490 gene cofC 16509 15889 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879553.1 protein_id gnl|my_center|LOCUS_03490 17525 16506 gene locus_tag LOCUS_03500 gene ftsY 17525 16506 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879554.1 protein_id gnl|my_center|LOCUS_03500 17945 17526 gene locus_tag LOCUS_03510 gene pfdA 17945 17526 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879555.1 protein_id gnl|my_center|LOCUS_03510 18122 17946 gene locus_tag LOCUS_03520 gene rpl18a 18122 17946 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879556.1 protein_id gnl|my_center|LOCUS_03520 18780 18133 gene locus_tag LOCUS_03530 18780 18133 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879557.1 protein_id gnl|my_center|LOCUS_03530 19047 18781 gene locus_tag LOCUS_03540 19047 18781 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879558.1 protein_id gnl|my_center|LOCUS_03540 19212 19060 gene locus_tag LOCUS_03550 19212 19060 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879559.1 protein_id gnl|my_center|LOCUS_03550 19543 19217 gene locus_tag LOCUS_03560 19543 19217 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064758.1 protein_id gnl|my_center|LOCUS_03560 19997 19554 gene locus_tag LOCUS_03570 19997 19554 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879561.1 protein_id gnl|my_center|LOCUS_03570 20235 20002 gene locus_tag LOCUS_03580 20235 20002 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064523.1 protein_id gnl|my_center|LOCUS_03580 21305 20307 gene locus_tag LOCUS_03590 gene argC 21305 20307 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879563.1 protein_id gnl|my_center|LOCUS_03590 21352 21660 gene locus_tag LOCUS_03600 21352 21660 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060863.1 protein_id gnl|my_center|LOCUS_03600 21816 22430 gene locus_tag LOCUS_03610 21816 22430 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877878.1 protein_id gnl|my_center|LOCUS_03610 22557 23576 gene locus_tag LOCUS_03620 22557 23576 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877877.1 protein_id gnl|my_center|LOCUS_03620 24411 23674 gene locus_tag LOCUS_03630 24411 23674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 24690 24618 gene locus_tag LOCUS_t00090 24690 24618 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25325 24729 gene locus_tag LOCUS_03640 25325 24729 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878379.1 protein_id gnl|my_center|LOCUS_03640 26450 25326 gene locus_tag LOCUS_03650 gene thiI 26450 25326 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878380.1 protein_id gnl|my_center|LOCUS_03650 26524 26685 gene locus_tag LOCUS_03660 26524 26685 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878381.1 protein_id gnl|my_center|LOCUS_03660 27035 28528 gene locus_tag LOCUS_03670 27035 28528 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064305.1 protein_id gnl|my_center|LOCUS_03670 29863 28634 gene locus_tag LOCUS_03680 29863 28634 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877755.1 protein_id gnl|my_center|LOCUS_03680 31583 29976 gene locus_tag LOCUS_03690 31583 29976 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877754.1 protein_id gnl|my_center|LOCUS_03690 32578 31580 gene locus_tag LOCUS_03700 32578 31580 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877753.1 protein_id gnl|my_center|LOCUS_03700 32644 33063 gene locus_tag LOCUS_03710 gene tsaA 32644 33063 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877752.1 protein_id gnl|my_center|LOCUS_03710 34732 33056 gene locus_tag LOCUS_03720 gene ade 34732 33056 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877751.1 protein_id gnl|my_center|LOCUS_03720 35300 34713 gene locus_tag LOCUS_03730 35300 34713 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877750.1 protein_id gnl|my_center|LOCUS_03730 36147 35341 gene locus_tag LOCUS_03740 36147 35341 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095630.1 protein_id gnl|my_center|LOCUS_03740 36994 36110 gene locus_tag LOCUS_03750 36994 36110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878797.1 protein_id gnl|my_center|LOCUS_03750 37104 37187 gene locus_tag LOCUS_t00100 37104 37187 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 38296 37232 gene locus_tag LOCUS_03760 38296 37232 CDS product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 protein_id gnl|my_center|LOCUS_03760 39925 38366 gene locus_tag LOCUS_03770 39925 38366 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762356.1 protein_id gnl|my_center|LOCUS_03770 40272 39997 gene locus_tag LOCUS_03780 40272 39997 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064285.1 protein_id gnl|my_center|LOCUS_03780 42061 40274 gene locus_tag LOCUS_03790 gene infB 42061 40274 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878271.1 protein_id gnl|my_center|LOCUS_03790 42513 42058 gene locus_tag LOCUS_03800 gene ndk 42513 42058 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_03800 42694 42518 gene locus_tag LOCUS_03810 42694 42518 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878269.1 protein_id gnl|my_center|LOCUS_03810 42915 42700 gene locus_tag LOCUS_03820 42915 42700 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878268.1 protein_id gnl|my_center|LOCUS_03820 43289 42930 gene locus_tag LOCUS_03830 gene rpl7ae 43289 42930 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878267.1 protein_id gnl|my_center|LOCUS_03830 43628 44926 gene locus_tag LOCUS_03840 43628 44926 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879310.1 protein_id gnl|my_center|LOCUS_03840 44923 45828 gene locus_tag LOCUS_03850 44923 45828 CDS product DUF6206 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879311.1 protein_id gnl|my_center|LOCUS_03850 45990 46283 gene locus_tag LOCUS_03860 45990 46283 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879026.1 protein_id gnl|my_center|LOCUS_03860 46285 46635 gene locus_tag LOCUS_03870 46285 46635 CDS product RNA polymerase Rpb4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064405.1 protein_id gnl|my_center|LOCUS_03870 46684 47271 gene locus_tag LOCUS_03880 46684 47271 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879028.1 protein_id gnl|my_center|LOCUS_03880 47306 47617 gene locus_tag LOCUS_03890 47306 47617 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879029.1 protein_id gnl|my_center|LOCUS_03890 48425 47592 gene locus_tag LOCUS_03900 48425 47592 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879030.1 protein_id gnl|my_center|LOCUS_03900 48646 48996 gene locus_tag LOCUS_03910 48646 48996 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879031.1 protein_id gnl|my_center|LOCUS_03910 49138 49854 gene locus_tag LOCUS_03920 49138 49854 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183444.1 protein_id gnl|my_center|LOCUS_03920 49838 50773 gene locus_tag LOCUS_03930 49838 50773 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_03930 50922 51131 gene locus_tag LOCUS_03940 50922 51131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 51327 52748 gene locus_tag LOCUS_03950 gene proS 51327 52748 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064425.1 protein_id gnl|my_center|LOCUS_03950 53076 53414 gene locus_tag LOCUS_03960 gene speD 53076 53414 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879107.1 protein_id gnl|my_center|LOCUS_03960 53419 54441 gene locus_tag LOCUS_03970 53419 54441 CDS product bis-aminopropyl spermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064426.1 protein_id gnl|my_center|LOCUS_03970 55443 54442 gene locus_tag LOCUS_03980 55443 54442 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274448.1 protein_id gnl|my_center|LOCUS_03980 56992 55436 gene locus_tag LOCUS_03990 56992 55436 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064447.1 protein_id gnl|my_center|LOCUS_03990 57065 57256 gene locus_tag LOCUS_04000 57065 57256 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064446.1 protein_id gnl|my_center|LOCUS_04000 57246 58265 gene locus_tag LOCUS_04010 57246 58265 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013682815.1 protein_id gnl|my_center|LOCUS_04010 58288 58599 gene locus_tag LOCUS_04020 58288 58599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879227.1 protein_id gnl|my_center|LOCUS_04020 58613 59398 gene locus_tag LOCUS_04030 gene truA 58613 59398 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064445.1 protein_id gnl|my_center|LOCUS_04030 60317 59385 gene locus_tag LOCUS_04040 60317 59385 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879225.1 protein_id gnl|my_center|LOCUS_04040 61272 60340 gene locus_tag LOCUS_04050 61272 60340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 62525 61269 gene locus_tag LOCUS_04060 62525 61269 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_04060 62623 63642 gene locus_tag LOCUS_04070 62623 63642 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683404.1 protein_id gnl|my_center|LOCUS_04070 63901 63635 gene locus_tag LOCUS_04080 63901 63635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879719.1 protein_id gnl|my_center|LOCUS_04080 63976 65358 gene locus_tag LOCUS_04090 gene cobB 63976 65358 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320008.1 protein_id gnl|my_center|LOCUS_04090 65702 65355 gene locus_tag LOCUS_04100 65702 65355 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879717.1 protein_id gnl|my_center|LOCUS_04100 65849 65922 gene locus_tag LOCUS_t00110 65849 65922 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 65954 66781 gene locus_tag LOCUS_04110 gene aroE 65954 66781 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879816.1 protein_id gnl|my_center|LOCUS_04110 66791 67072 gene locus_tag LOCUS_04120 gene gatC 66791 67072 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879817.1 protein_id gnl|my_center|LOCUS_04120 67069 68436 gene locus_tag LOCUS_04130 gene gatA 67069 68436 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879818.1 protein_id gnl|my_center|LOCUS_04130 68822 68433 gene locus_tag LOCUS_04140 68822 68433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879819.1 protein_id gnl|my_center|LOCUS_04140 69097 68819 gene locus_tag LOCUS_04150 69097 68819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879820.1 protein_id gnl|my_center|LOCUS_04150 69301 69780 gene locus_tag LOCUS_04160 69301 69780 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879821.1 protein_id gnl|my_center|LOCUS_04160 70891 69770 gene locus_tag LOCUS_04170 70891 69770 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064561.1 protein_id gnl|my_center|LOCUS_04170 71691 70891 gene locus_tag LOCUS_04180 gene speE 71691 70891 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879823.1 protein_id gnl|my_center|LOCUS_04180 71725 72240 gene locus_tag LOCUS_04190 71725 72240 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879824.1 protein_id gnl|my_center|LOCUS_04190 72980 72237 gene locus_tag LOCUS_04200 72980 72237 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879825.1 protein_id gnl|my_center|LOCUS_04200 73060 73815 gene locus_tag LOCUS_04210 73060 73815 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319512.1 protein_id gnl|my_center|LOCUS_04210 73812 74624 gene locus_tag LOCUS_04220 73812 74624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274381.1 protein_id gnl|my_center|LOCUS_04220 74667 76055 gene locus_tag LOCUS_04230 74667 76055 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878203.1 protein_id gnl|my_center|LOCUS_04230 76033 77349 gene locus_tag LOCUS_04240 76033 77349 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878202.1 protein_id gnl|my_center|LOCUS_04240 77328 77543 gene locus_tag LOCUS_04250 77328 77543 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878201.1 protein_id gnl|my_center|LOCUS_04250 77728 77540 gene locus_tag LOCUS_04260 77728 77540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 78527 77733 gene locus_tag LOCUS_04270 78527 77733 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878199.1 protein_id gnl|my_center|LOCUS_04270 78981 79862 gene locus_tag LOCUS_04280 78981 79862 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877602.1 protein_id gnl|my_center|LOCUS_04280 79859 80596 gene locus_tag LOCUS_04290 79859 80596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877601.1 protein_id gnl|my_center|LOCUS_04290 80554 81297 gene locus_tag LOCUS_04300 80554 81297 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877600.1 protein_id gnl|my_center|LOCUS_04300 81577 81774 gene locus_tag LOCUS_04310 81577 81774 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878411.1 protein_id gnl|my_center|LOCUS_04310 81767 82633 gene locus_tag LOCUS_04320 gene dapA 81767 82633 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878410.1 protein_id gnl|my_center|LOCUS_04320 82664 83440 gene locus_tag LOCUS_04330 gene dapB 82664 83440 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878409.1 protein_id gnl|my_center|LOCUS_04330 83453 83959 gene locus_tag LOCUS_04340 gene mobB 83453 83959 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879742.1 protein_id gnl|my_center|LOCUS_04340 83991 84569 gene locus_tag LOCUS_04350 83991 84569 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877617.1 protein_id gnl|my_center|LOCUS_04350 84985 84566 gene locus_tag LOCUS_04360 84985 84566 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877618.1 protein_id gnl|my_center|LOCUS_04360 85380 85018 gene locus_tag LOCUS_04370 85380 85018 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870963.1 protein_id gnl|my_center|LOCUS_04370 85888 85382 gene locus_tag LOCUS_04380 85888 85382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 87214 85973 gene locus_tag LOCUS_04390 87214 85973 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877563.1 protein_id gnl|my_center|LOCUS_04390 87360 88559 gene locus_tag LOCUS_04400 87360 88559 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877564.1 protein_id gnl|my_center|LOCUS_04400 89682 88546 gene locus_tag LOCUS_04410 89682 88546 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877565.1 protein_id gnl|my_center|LOCUS_04410 89810 90286 gene locus_tag LOCUS_04420 89810 90286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877566.1 protein_id gnl|my_center|LOCUS_04420 90330 91304 gene locus_tag LOCUS_04430 90330 91304 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879135.1 protein_id gnl|my_center|LOCUS_04430 92584 91301 gene locus_tag LOCUS_04440 gene thiC 92584 91301 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879899.1 protein_id gnl|my_center|LOCUS_04440 93715 92624 gene locus_tag LOCUS_04450 93715 92624 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879898.1 protein_id gnl|my_center|LOCUS_04450 94243 93761 gene locus_tag LOCUS_04460 94243 93761 CDS product DUF2299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270501.1 protein_id gnl|my_center|LOCUS_04460 94943 94260 gene locus_tag LOCUS_04470 94943 94260 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879896.1 protein_id gnl|my_center|LOCUS_04470 95049 95663 gene locus_tag LOCUS_04480 95049 95663 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879894.1 protein_id gnl|my_center|LOCUS_04480 95820 98003 gene locus_tag LOCUS_04490 95820 98003 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868573.1 protein_id gnl|my_center|LOCUS_04490 98278 98000 gene locus_tag LOCUS_04500 98278 98000 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879892.1 protein_id gnl|my_center|LOCUS_04500 98667 98377 gene locus_tag LOCUS_04510 98667 98377 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879891.1 protein_id gnl|my_center|LOCUS_04510 98843 99085 gene locus_tag LOCUS_04520 98843 99085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879890.1 protein_id gnl|my_center|LOCUS_04520 99665 99069 gene locus_tag LOCUS_04530 99665 99069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 99791 100972 gene locus_tag LOCUS_04540 99791 100972 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064691.1 protein_id gnl|my_center|LOCUS_04540 100944 102197 gene locus_tag LOCUS_04550 100944 102197 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_04550 102207 103490 gene locus_tag LOCUS_04560 102207 103490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 103487 104599 gene locus_tag LOCUS_04570 103487 104599 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811019.1 protein_id gnl|my_center|LOCUS_04570 >Feature sequence04 334 44 gene locus_tag LOCUS_04580 334 44 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870729.1 protein_id gnl|my_center|LOCUS_04580 1933 338 gene locus_tag LOCUS_04590 1933 338 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890090.1 protein_id gnl|my_center|LOCUS_04590 1999 2439 gene locus_tag LOCUS_04600 1999 2439 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879842.1 protein_id gnl|my_center|LOCUS_04600 2436 3458 gene locus_tag LOCUS_04610 2436 3458 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879843.1 protein_id gnl|my_center|LOCUS_04610 4343 3525 gene locus_tag LOCUS_04620 4343 3525 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015858271.1 protein_id gnl|my_center|LOCUS_04620 4646 5287 gene locus_tag LOCUS_04630 gene npdG 4646 5287 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_04630 5323 8040 gene locus_tag LOCUS_04640 gene alaS 5323 8040 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879744.1 protein_id gnl|my_center|LOCUS_04640 8033 8788 gene locus_tag LOCUS_04650 gene cofE 8033 8788 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879745.1 protein_id gnl|my_center|LOCUS_04650 8770 9816 gene locus_tag LOCUS_04660 8770 9816 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879746.1 protein_id gnl|my_center|LOCUS_04660 10674 9892 gene locus_tag LOCUS_04670 10674 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 11297 10671 gene locus_tag LOCUS_04680 11297 10671 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878220.1 protein_id gnl|my_center|LOCUS_04680 12231 11269 gene locus_tag LOCUS_04690 12231 11269 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095265.1 protein_id gnl|my_center|LOCUS_04690 13049 12228 gene locus_tag LOCUS_04700 13049 12228 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878217.1 protein_id gnl|my_center|LOCUS_04700 13122 13793 gene locus_tag LOCUS_04710 13122 13793 CDS product HisA/HisF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878216.1 protein_id gnl|my_center|LOCUS_04710 13846 14175 gene locus_tag LOCUS_04720 13846 14175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 14905 14531 gene locus_tag LOCUS_04730 14905 14531 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064272.1 protein_id gnl|my_center|LOCUS_04730 14989 17250 gene locus_tag LOCUS_04740 gene ppsA 14989 17250 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878213.1 protein_id gnl|my_center|LOCUS_04740 17642 17241 gene locus_tag LOCUS_04750 17642 17241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878212.1 protein_id gnl|my_center|LOCUS_04750 18106 17639 gene locus_tag LOCUS_04760 18106 17639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878211.1 protein_id gnl|my_center|LOCUS_04760 18674 18096 gene locus_tag LOCUS_04770 18674 18096 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064638.1 protein_id gnl|my_center|LOCUS_04770 18695 19909 gene locus_tag LOCUS_04780 18695 19909 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878209.1 protein_id gnl|my_center|LOCUS_04780 21686 19872 gene locus_tag LOCUS_04790 21686 19872 CDS product PGF-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878208.1 protein_id gnl|my_center|LOCUS_04790 22542 21718 gene locus_tag LOCUS_04800 22542 21718 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878207.1 protein_id gnl|my_center|LOCUS_04800 22579 23193 gene locus_tag LOCUS_04810 gene thiE 22579 23193 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879566.1 protein_id gnl|my_center|LOCUS_04810 23252 23434 gene locus_tag LOCUS_04820 23252 23434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064271.1 protein_id gnl|my_center|LOCUS_04820 23427 24746 gene locus_tag LOCUS_04830 23427 24746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 24765 25175 gene locus_tag LOCUS_04840 24765 25175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 25185 27155 gene locus_tag LOCUS_04850 25185 27155 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950408.1 protein_id gnl|my_center|LOCUS_04850 27142 28011 gene locus_tag LOCUS_04860 27142 28011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 28048 28932 gene locus_tag LOCUS_04870 gene twy1 28048 28932 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879750.1 protein_id gnl|my_center|LOCUS_04870 28937 29527 gene locus_tag LOCUS_04880 28937 29527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879749.1 protein_id gnl|my_center|LOCUS_04880 29505 30770 gene locus_tag LOCUS_04890 gene tiaS 29505 30770 CDS product tRNA(Ile2) 2-agmatinylcytidine synthetase TiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879748.1 protein_id gnl|my_center|LOCUS_04890 30802 31503 gene locus_tag LOCUS_04900 30802 31503 CDS product pyrroline-5-carboxylate reductase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240485.1 protein_id gnl|my_center|LOCUS_04900 31547 31621 gene locus_tag LOCUS_t00120 31547 31621 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31802 32098 gene locus_tag LOCUS_04910 31802 32098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 32180 32350 gene locus_tag LOCUS_04920 32180 32350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 32340 32750 gene locus_tag LOCUS_04930 32340 32750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 32954 32769 gene locus_tag LOCUS_04940 32954 32769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 33582 33154 gene locus_tag LOCUS_04950 33582 33154 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877783.1 protein_id gnl|my_center|LOCUS_04950 33733 35334 gene locus_tag LOCUS_04960 33733 35334 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877784.1 protein_id gnl|my_center|LOCUS_04960 35331 35813 gene locus_tag LOCUS_04970 35331 35813 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064203.1 protein_id gnl|my_center|LOCUS_04970 35819 36100 gene locus_tag LOCUS_04980 35819 36100 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064609.1 protein_id gnl|my_center|LOCUS_04980 36097 37170 gene locus_tag LOCUS_04990 36097 37170 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877785.1 protein_id gnl|my_center|LOCUS_04990 37237 38253 gene locus_tag LOCUS_05000 37237 38253 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877787.1 protein_id gnl|my_center|LOCUS_05000 38311 40233 gene locus_tag LOCUS_05010 38311 40233 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877788.1 protein_id gnl|my_center|LOCUS_05010 40277 40492 gene locus_tag LOCUS_05020 40277 40492 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318485.1 protein_id gnl|my_center|LOCUS_05020 40804 40505 gene locus_tag LOCUS_05030 40804 40505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877792.1 protein_id gnl|my_center|LOCUS_05030 41212 40871 gene locus_tag LOCUS_05040 41212 40871 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877793.1 protein_id gnl|my_center|LOCUS_05040 41396 42589 gene locus_tag LOCUS_05050 41396 42589 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064205.1 protein_id gnl|my_center|LOCUS_05050 42589 43077 gene locus_tag LOCUS_05060 42589 43077 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094877.1 protein_id gnl|my_center|LOCUS_05060 43087 45063 gene locus_tag LOCUS_05070 43087 45063 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877796.1 protein_id gnl|my_center|LOCUS_05070 45139 45882 gene locus_tag LOCUS_05080 45139 45882 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_05080 45882 46838 gene locus_tag LOCUS_05090 45882 46838 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_05090 47196 48002 gene locus_tag LOCUS_05100 gene hmeA 47196 48002 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_05100 48003 49193 gene locus_tag LOCUS_05110 gene hmeB 48003 49193 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_05110 49190 50191 gene locus_tag LOCUS_05120 gene dsrM 49190 50191 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878008.1 protein_id gnl|my_center|LOCUS_05120 50202 51872 gene locus_tag LOCUS_05130 gene hmeD 50202 51872 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878009.1 protein_id gnl|my_center|LOCUS_05130 51862 52290 gene locus_tag LOCUS_05140 gene hmeE 51862 52290 CDS product Hdr-like menaquinol oxidoreductase cytochrome c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064247.1 protein_id gnl|my_center|LOCUS_05140 53168 52287 gene locus_tag LOCUS_05150 53168 52287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064248.1 protein_id gnl|my_center|LOCUS_05150 53217 53843 gene locus_tag LOCUS_05160 53217 53843 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878012.1 protein_id gnl|my_center|LOCUS_05160 54900 53794 gene locus_tag LOCUS_05170 54900 53794 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878013.1 protein_id gnl|my_center|LOCUS_05170 56003 54897 gene locus_tag LOCUS_05180 56003 54897 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095032.1 protein_id gnl|my_center|LOCUS_05180 56226 57353 gene locus_tag LOCUS_05190 56226 57353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274449.1 protein_id gnl|my_center|LOCUS_05190 58545 57334 gene locus_tag LOCUS_05200 58545 57334 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879234.1 protein_id gnl|my_center|LOCUS_05200 58619 59527 gene locus_tag LOCUS_05210 58619 59527 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183452.1 protein_id gnl|my_center|LOCUS_05210 59558 60793 gene locus_tag LOCUS_05220 59558 60793 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879139.1 protein_id gnl|my_center|LOCUS_05220 60802 62118 gene locus_tag LOCUS_05230 60802 62118 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879140.1 protein_id gnl|my_center|LOCUS_05230 62093 63298 gene locus_tag LOCUS_05240 gene coaBC 62093 63298 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274444.1 protein_id gnl|my_center|LOCUS_05240 63295 64098 gene locus_tag LOCUS_05250 63295 64098 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879142.1 protein_id gnl|my_center|LOCUS_05250 64082 64867 gene locus_tag LOCUS_05260 64082 64867 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320045.1 protein_id gnl|my_center|LOCUS_05260 64908 65849 gene locus_tag LOCUS_05270 64908 65849 CDS product UbiA prenyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879144.1 protein_id gnl|my_center|LOCUS_05270 65939 66409 gene locus_tag LOCUS_05280 65939 66409 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879145.1 protein_id gnl|my_center|LOCUS_05280 66412 67611 gene locus_tag LOCUS_05290 66412 67611 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590401.1 protein_id gnl|my_center|LOCUS_05290 67611 67970 gene locus_tag LOCUS_05300 67611 67970 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064435.1 protein_id gnl|my_center|LOCUS_05300 68017 69120 gene locus_tag LOCUS_05310 68017 69120 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_05310 69131 70303 gene locus_tag LOCUS_05320 69131 70303 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868281.1 protein_id gnl|my_center|LOCUS_05320 70307 71305 gene locus_tag LOCUS_05330 70307 71305 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884438.1 protein_id gnl|my_center|LOCUS_05330 71500 71994 gene locus_tag LOCUS_05340 71500 71994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 72186 72500 gene locus_tag LOCUS_05350 72186 72500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 72497 72838 gene locus_tag LOCUS_05360 72497 72838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 73251 72808 gene locus_tag LOCUS_05370 73251 72808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 74520 73333 gene locus_tag LOCUS_05380 74520 73333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 74761 76176 gene locus_tag LOCUS_05390 74761 76176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 76179 76802 gene locus_tag LOCUS_05400 76179 76802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 76839 77672 gene locus_tag LOCUS_05410 76839 77672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 77788 78690 gene locus_tag LOCUS_05420 77788 78690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 78718 79779 gene locus_tag LOCUS_05430 78718 79779 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_05430 80388 81131 gene locus_tag LOCUS_05440 80388 81131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 81145 82548 gene locus_tag LOCUS_05450 81145 82548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 82550 83575 gene locus_tag LOCUS_05460 82550 83575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 83572 84057 gene locus_tag LOCUS_05470 83572 84057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 84137 85069 gene locus_tag LOCUS_05480 84137 85069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 85637 85353 gene locus_tag LOCUS_05490 85637 85353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 85909 86484 gene locus_tag LOCUS_05500 85909 86484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 89867 86481 gene locus_tag LOCUS_05510 89867 86481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 >Feature sequence05 180 329 gene locus_tag LOCUS_05520 180 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05520 643 789 gene locus_tag LOCUS_05530 643 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 791 2047 gene locus_tag LOCUS_05540 791 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2025 2960 gene locus_tag LOCUS_05550 2025 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05550 3401 7435 gene locus_tag LOCUS_05560 3401 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 7432 8886 gene locus_tag LOCUS_05570 7432 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 10043 8985 gene locus_tag LOCUS_05580 10043 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 10199 10336 gene locus_tag LOCUS_05590 10199 10336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 10380 10526 gene locus_tag LOCUS_05600 10380 10526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 10923 10850 gene locus_tag LOCUS_t00130 10923 10850 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11738 11001 gene locus_tag LOCUS_05610 11738 11001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879584.1 protein_id gnl|my_center|LOCUS_05610 16578 11746 gene locus_tag LOCUS_05620 16578 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879582.1 protein_id gnl|my_center|LOCUS_05620 16698 17642 gene locus_tag LOCUS_05630 16698 17642 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879581.1 protein_id gnl|my_center|LOCUS_05630 17632 18414 gene locus_tag LOCUS_05640 17632 18414 CDS product RNA-processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064527.1 protein_id gnl|my_center|LOCUS_05640 18411 19049 gene locus_tag LOCUS_05650 18411 19049 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879579.1 protein_id gnl|my_center|LOCUS_05650 19074 19361 gene locus_tag LOCUS_05660 19074 19361 CDS product OadG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879578.1 protein_id gnl|my_center|LOCUS_05660 19358 19777 gene locus_tag LOCUS_05670 19358 19777 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879577.1 protein_id gnl|my_center|LOCUS_05670 19774 20838 gene locus_tag LOCUS_05680 19774 20838 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879576.1 protein_id gnl|my_center|LOCUS_05680 20947 21147 gene locus_tag LOCUS_05690 20947 21147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 21144 22877 gene locus_tag LOCUS_05700 21144 22877 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146547.1 protein_id gnl|my_center|LOCUS_05700 22882 23913 gene locus_tag LOCUS_05710 22882 23913 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879345.1 protein_id gnl|my_center|LOCUS_05710 23915 25288 gene locus_tag LOCUS_05720 23915 25288 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066616.1 protein_id gnl|my_center|LOCUS_05720 25288 26403 gene locus_tag LOCUS_05730 25288 26403 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879490.1 protein_id gnl|my_center|LOCUS_05730 26439 27344 gene locus_tag LOCUS_05740 26439 27344 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879565.1 protein_id gnl|my_center|LOCUS_05740 27718 27356 gene locus_tag LOCUS_05750 27718 27356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274380.1 protein_id gnl|my_center|LOCUS_05750 28568 27867 gene locus_tag LOCUS_05760 28568 27867 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878152.1 protein_id gnl|my_center|LOCUS_05760 29506 28565 gene locus_tag LOCUS_05770 29506 28565 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878151.1 protein_id gnl|my_center|LOCUS_05770 30741 29503 gene locus_tag LOCUS_05780 gene icd 30741 29503 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878150.1 protein_id gnl|my_center|LOCUS_05780 31781 30795 gene locus_tag LOCUS_05790 31781 30795 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879012.1 protein_id gnl|my_center|LOCUS_05790 33410 31854 gene locus_tag LOCUS_05800 33410 31854 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879854.1 protein_id gnl|my_center|LOCUS_05800 34630 33413 gene locus_tag LOCUS_05810 34630 33413 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006824761.1 protein_id gnl|my_center|LOCUS_05810 35596 34718 gene locus_tag LOCUS_05820 35596 34718 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879765.1 protein_id gnl|my_center|LOCUS_05820 36192 35593 gene locus_tag LOCUS_05830 gene udg 36192 35593 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879766.1 protein_id gnl|my_center|LOCUS_05830 37344 36229 gene locus_tag LOCUS_05840 gene pscS 37344 36229 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877542.1 protein_id gnl|my_center|LOCUS_05840 37424 38197 gene locus_tag LOCUS_05850 gene xth 37424 38197 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878084.1 protein_id gnl|my_center|LOCUS_05850 38235 39818 gene locus_tag LOCUS_05860 38235 39818 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064253.1 protein_id gnl|my_center|LOCUS_05860 39821 41719 gene locus_tag LOCUS_05870 39821 41719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 41739 42182 gene locus_tag LOCUS_05880 41739 42182 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878088.1 protein_id gnl|my_center|LOCUS_05880 42182 42454 gene locus_tag LOCUS_05890 42182 42454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878089.1 protein_id gnl|my_center|LOCUS_05890 42451 42879 gene locus_tag LOCUS_05900 42451 42879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878090.1 protein_id gnl|my_center|LOCUS_05900 44469 42880 gene locus_tag LOCUS_05910 gene arcS 44469 42880 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878091.1 protein_id gnl|my_center|LOCUS_05910 45967 44456 gene locus_tag LOCUS_05920 gene tgtA 45967 44456 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878092.1 protein_id gnl|my_center|LOCUS_05920 45976 46833 gene locus_tag LOCUS_05930 45976 46833 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064254.1 protein_id gnl|my_center|LOCUS_05930 46858 47772 gene locus_tag LOCUS_05940 gene hisG 46858 47772 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013682994.1 protein_id gnl|my_center|LOCUS_05940 48186 47776 gene locus_tag LOCUS_05950 gene vapC9 48186 47776 CDS product type II toxin-antitoxin system toxin ribonuclease VapC9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878095.1 protein_id gnl|my_center|LOCUS_05950 49376 48153 gene locus_tag LOCUS_05960 49376 48153 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064633.1 protein_id gnl|my_center|LOCUS_05960 49781 50212 gene locus_tag LOCUS_05970 49781 50212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 50821 50243 gene locus_tag LOCUS_05980 50821 50243 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023903.1 protein_id gnl|my_center|LOCUS_05980 52805 50826 gene locus_tag LOCUS_05990 gene acs 52805 50826 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 protein_id gnl|my_center|LOCUS_05990 53034 53561 gene locus_tag LOCUS_06000 53034 53561 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877872.1 protein_id gnl|my_center|LOCUS_06000 55427 53562 gene locus_tag LOCUS_06010 gene lonB 55427 53562 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877871.1 protein_id gnl|my_center|LOCUS_06010 55847 55461 gene locus_tag LOCUS_06020 55847 55461 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877870.1 protein_id gnl|my_center|LOCUS_06020 56068 55844 gene locus_tag LOCUS_06030 56068 55844 CDS product Like-Sm ribonucleoprotein core inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094490.1 protein_id gnl|my_center|LOCUS_06030 56132 57049 gene locus_tag LOCUS_06040 56132 57049 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877868.1 protein_id gnl|my_center|LOCUS_06040 57730 57032 gene locus_tag LOCUS_06050 57730 57032 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877867.1 protein_id gnl|my_center|LOCUS_06050 57966 57727 gene locus_tag LOCUS_06060 57966 57727 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877866.1 protein_id gnl|my_center|LOCUS_06060 58969 58016 gene locus_tag LOCUS_06070 58969 58016 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096340.1 protein_id gnl|my_center|LOCUS_06070 60014 58971 gene locus_tag LOCUS_06080 gene fni 60014 58971 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064552.1 protein_id gnl|my_center|LOCUS_06080 60736 60011 gene locus_tag LOCUS_06090 60736 60011 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012965876.1 protein_id gnl|my_center|LOCUS_06090 61583 60723 gene locus_tag LOCUS_06100 gene mvk 61583 60723 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879778.1 protein_id gnl|my_center|LOCUS_06100 61633 62364 gene locus_tag LOCUS_06110 61633 62364 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879779.1 protein_id gnl|my_center|LOCUS_06110 63217 62336 gene locus_tag LOCUS_06120 63217 62336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879781.1 protein_id gnl|my_center|LOCUS_06120 63440 63207 gene locus_tag LOCUS_06130 63440 63207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879782.1 protein_id gnl|my_center|LOCUS_06130 64275 63442 gene locus_tag LOCUS_06140 64275 63442 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197030918.1 protein_id gnl|my_center|LOCUS_06140 65259 64321 gene locus_tag LOCUS_06150 65259 64321 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878284.1 protein_id gnl|my_center|LOCUS_06150 65339 66277 gene locus_tag LOCUS_06160 65339 66277 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878283.1 protein_id gnl|my_center|LOCUS_06160 66279 66956 gene locus_tag LOCUS_06170 66279 66956 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878282.1 protein_id gnl|my_center|LOCUS_06170 67883 66960 gene locus_tag LOCUS_06180 67883 66960 CDS product DUF1152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878281.1 protein_id gnl|my_center|LOCUS_06180 68121 67885 gene locus_tag LOCUS_06190 gene eif1A 68121 67885 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064286.1 protein_id gnl|my_center|LOCUS_06190 69146 68175 gene locus_tag LOCUS_06200 69146 68175 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878279.1 protein_id gnl|my_center|LOCUS_06200 69249 69533 gene locus_tag LOCUS_06210 69249 69533 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094744.1 protein_id gnl|my_center|LOCUS_06210 70473 69556 gene locus_tag LOCUS_06220 70473 69556 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_06220 70777 70475 gene locus_tag LOCUS_06230 70777 70475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879132.1 protein_id gnl|my_center|LOCUS_06230 70814 71953 gene locus_tag LOCUS_06240 70814 71953 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274443.1 protein_id gnl|my_center|LOCUS_06240 71991 73001 gene locus_tag LOCUS_06250 71991 73001 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089142.1 protein_id gnl|my_center|LOCUS_06250 73026 74039 gene locus_tag LOCUS_06260 73026 74039 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878344.1 protein_id gnl|my_center|LOCUS_06260 75763 74036 gene locus_tag LOCUS_06270 75763 74036 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878343.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence06 <1 780 gene locus_tag LOCUS_06280 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878464.1:acyl-CoA dehydrogenase family protein 785 1564 gene locus_tag LOCUS_06290 785 1564 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878463.1 protein_id gnl|my_center|LOCUS_06290 1561 2712 gene locus_tag LOCUS_06300 1561 2712 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319790.1 protein_id gnl|my_center|LOCUS_06300 2700 3431 gene locus_tag LOCUS_06310 2700 3431 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064311.1 protein_id gnl|my_center|LOCUS_06310 3419 4276 gene locus_tag LOCUS_06320 3419 4276 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878460.1 protein_id gnl|my_center|LOCUS_06320 4260 4904 gene locus_tag LOCUS_06330 4260 4904 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878459.1 protein_id gnl|my_center|LOCUS_06330 4879 5544 gene locus_tag LOCUS_06340 4879 5544 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095442.1 protein_id gnl|my_center|LOCUS_06340 7233 5521 gene locus_tag LOCUS_06350 7233 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 7374 7976 gene locus_tag LOCUS_06360 7374 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 7986 9362 gene locus_tag LOCUS_06370 7986 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 9400 9780 gene locus_tag LOCUS_06380 9400 9780 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274453.1 protein_id gnl|my_center|LOCUS_06380 10083 11228 gene locus_tag LOCUS_06390 10083 11228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 11691 11275 gene locus_tag LOCUS_06400 11691 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 11878 11669 gene locus_tag LOCUS_06410 11878 11669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 12159 11875 gene locus_tag LOCUS_06420 12159 11875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 12313 12161 gene locus_tag LOCUS_06430 12313 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 12711 12310 gene locus_tag LOCUS_06440 12711 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 14774 12708 gene locus_tag LOCUS_06450 14774 12708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 15932 14931 gene locus_tag LOCUS_06460 15932 14931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250304.1 protein_id gnl|my_center|LOCUS_06460 16065 15943 gene locus_tag LOCUS_06470 16065 15943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 16793 16569 gene locus_tag LOCUS_06480 16793 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 17116 16802 gene locus_tag LOCUS_06490 17116 16802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 17810 17109 gene locus_tag LOCUS_06500 17810 17109 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250307.1 protein_id gnl|my_center|LOCUS_06500 18428 17856 gene locus_tag LOCUS_06510 18428 17856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 18655 18425 gene locus_tag LOCUS_06520 18655 18425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 18815 18639 gene locus_tag LOCUS_06530 18815 18639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 19498 18836 gene locus_tag LOCUS_06540 19498 18836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 19977 19594 gene locus_tag LOCUS_06550 19977 19594 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878976.1 protein_id gnl|my_center|LOCUS_06550 20179 19964 gene locus_tag LOCUS_06560 20179 19964 CDS product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878975.1 protein_id gnl|my_center|LOCUS_06560 20453 20253 gene locus_tag LOCUS_06570 20453 20253 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249455.1 protein_id gnl|my_center|LOCUS_06570 20722 20450 gene locus_tag LOCUS_06580 20722 20450 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249456.1 protein_id gnl|my_center|LOCUS_06580 21006 20719 gene locus_tag LOCUS_06590 21006 20719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 21063 21371 gene locus_tag LOCUS_06600 21063 21371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 21368 21610 gene locus_tag LOCUS_06610 21368 21610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 21723 22094 gene locus_tag LOCUS_06620 21723 22094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 22209 22574 gene locus_tag LOCUS_06630 22209 22574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 22580 23140 gene locus_tag LOCUS_06640 22580 23140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 23408 23148 gene locus_tag LOCUS_06650 23408 23148 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_06650 23617 23405 gene locus_tag LOCUS_06660 23617 23405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966853.1 protein_id gnl|my_center|LOCUS_06660 23671 23847 gene locus_tag LOCUS_06670 23671 23847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 23852 24049 gene locus_tag LOCUS_06680 23852 24049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 24281 24796 gene locus_tag LOCUS_06690 24281 24796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 24793 24993 gene locus_tag LOCUS_06700 24793 24993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 24990 25127 gene locus_tag LOCUS_06710 24990 25127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 25127 25345 gene locus_tag LOCUS_06720 25127 25345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 25701 25627 gene locus_tag LOCUS_t00140 25701 25627 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 26261 25737 gene locus_tag LOCUS_06730 26261 25737 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878985.1 protein_id gnl|my_center|LOCUS_06730 28158 26287 gene locus_tag LOCUS_06740 gene iorA 28158 26287 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878986.1 protein_id gnl|my_center|LOCUS_06740 28653 28258 gene locus_tag LOCUS_06750 28653 28258 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_06750 29420 28650 gene locus_tag LOCUS_06760 29420 28650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06760 29874 29632 gene locus_tag LOCUS_06770 29874 29632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06770 30107 30754 gene locus_tag LOCUS_06780 30107 30754 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_06780 30755 31777 gene locus_tag LOCUS_06790 30755 31777 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878988.1 protein_id gnl|my_center|LOCUS_06790 31794 32114 gene locus_tag LOCUS_06800 gene rpl12p 31794 32114 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878989.1 protein_id gnl|my_center|LOCUS_06800 32328 32531 gene locus_tag LOCUS_06810 32328 32531 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878990.1 protein_id gnl|my_center|LOCUS_06810 33276 32557 gene locus_tag LOCUS_06820 33276 32557 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878991.1 protein_id gnl|my_center|LOCUS_06820 33333 35399 gene locus_tag LOCUS_06830 33333 35399 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_06830 35426 35519 gene locus_tag LOCUS_t00150 35426 35519 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35703 36524 gene locus_tag LOCUS_06840 35703 36524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 37870 36764 gene locus_tag LOCUS_06850 37870 36764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 38017 38301 gene locus_tag LOCUS_06860 38017 38301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878771.1 protein_id gnl|my_center|LOCUS_06860 38946 38266 gene locus_tag LOCUS_06870 gene larB 38946 38266 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878770.1 protein_id gnl|my_center|LOCUS_06870 42163 38930 gene locus_tag LOCUS_06880 gene carB 42163 38930 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_06880 43244 42168 gene locus_tag LOCUS_06890 gene carA 43244 42168 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878768.1 protein_id gnl|my_center|LOCUS_06890 44236 43241 gene locus_tag LOCUS_06900 gene purC 44236 43241 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878767.1 protein_id gnl|my_center|LOCUS_06900 44705 44241 gene locus_tag LOCUS_06910 44705 44241 CDS product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319908.1 protein_id gnl|my_center|LOCUS_06910 44859 46088 gene locus_tag LOCUS_06920 44859 46088 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877984.1 protein_id gnl|my_center|LOCUS_06920 46090 46854 gene locus_tag LOCUS_06930 46090 46854 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877985.1 protein_id gnl|my_center|LOCUS_06930 46835 47782 gene locus_tag LOCUS_06940 46835 47782 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064243.1 protein_id gnl|my_center|LOCUS_06940 48298 47759 gene locus_tag LOCUS_06950 48298 47759 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270468.1 protein_id gnl|my_center|LOCUS_06950 48392 49027 gene locus_tag LOCUS_06960 gene psmB 48392 49027 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094873.1 protein_id gnl|my_center|LOCUS_06960 49029 50927 gene locus_tag LOCUS_06970 49029 50927 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546184.1 protein_id gnl|my_center|LOCUS_06970 51963 50929 gene locus_tag LOCUS_06980 51963 50929 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878740.1 protein_id gnl|my_center|LOCUS_06980 52441 51968 gene locus_tag LOCUS_06990 52441 51968 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064355.1 protein_id gnl|my_center|LOCUS_06990 53216 52479 gene locus_tag LOCUS_07000 gene cobA 53216 52479 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878738.1 protein_id gnl|my_center|LOCUS_07000 54075 53206 gene locus_tag LOCUS_07010 gene hemC 54075 53206 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878737.1 protein_id gnl|my_center|LOCUS_07010 55346 54072 gene locus_tag LOCUS_07020 gene hemL 55346 54072 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878736.1 protein_id gnl|my_center|LOCUS_07020 55435 56748 gene locus_tag LOCUS_07030 55435 56748 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064354.1 protein_id gnl|my_center|LOCUS_07030 56767 57687 gene locus_tag LOCUS_07040 56767 57687 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402219.1 protein_id gnl|my_center|LOCUS_07040 57684 57815 gene locus_tag LOCUS_07050 57684 57815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 57826 58707 gene locus_tag LOCUS_07060 57826 58707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270489.1 protein_id gnl|my_center|LOCUS_07060 59202 58666 gene locus_tag LOCUS_07070 gene pyrE 59202 58666 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318736.1 protein_id gnl|my_center|LOCUS_07070 59746 59207 gene locus_tag LOCUS_07080 59746 59207 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879236.1 protein_id gnl|my_center|LOCUS_07080 60130 60993 gene locus_tag LOCUS_07090 60130 60993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 61654 60902 gene locus_tag LOCUS_07100 61654 60902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 62552 61635 gene locus_tag LOCUS_07110 62552 61635 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990629.1 protein_id gnl|my_center|LOCUS_07110 63294 62539 gene locus_tag LOCUS_07120 63294 62539 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_07120 64330 63401 gene locus_tag LOCUS_07130 64330 63401 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023386.1 protein_id gnl|my_center|LOCUS_07130 65910 64330 gene locus_tag LOCUS_07140 65910 64330 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459110.1 protein_id gnl|my_center|LOCUS_07140 66650 65907 gene locus_tag LOCUS_07150 66650 65907 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020355.1 protein_id gnl|my_center|LOCUS_07150 67534 66773 gene locus_tag LOCUS_07160 67534 66773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 68740 67598 gene locus_tag LOCUS_07170 68740 67598 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879595.1 protein_id gnl|my_center|LOCUS_07170 69009 68737 gene locus_tag LOCUS_07180 69009 68737 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879596.1 protein_id gnl|my_center|LOCUS_07180 69796 69032 gene locus_tag LOCUS_07190 69796 69032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 70111 69809 gene locus_tag LOCUS_07200 70111 69809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 70538 70101 gene locus_tag LOCUS_07210 70538 70101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 70735 71391 gene locus_tag LOCUS_07220 70735 71391 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_07220 71388 72104 gene locus_tag LOCUS_07230 gene ribB 71388 72104 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879598.1 protein_id gnl|my_center|LOCUS_07230 72862 72119 gene locus_tag LOCUS_07240 72862 72119 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868772.1 protein_id gnl|my_center|LOCUS_07240 73600 72905 gene locus_tag LOCUS_07250 73600 72905 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878760.1 protein_id gnl|my_center|LOCUS_07250 73714 74223 gene locus_tag LOCUS_07260 73714 74223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878761.1 protein_id gnl|my_center|LOCUS_07260 75183 74707 gene locus_tag LOCUS_07270 75183 74707 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042684410.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence07 136 1620 gene locus_tag LOCUS_07280 136 1620 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156029477.1 protein_id gnl|my_center|LOCUS_07280 1895 1635 gene locus_tag LOCUS_07290 1895 1635 CDS product RpoL/Rpb11 RNA polymerase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877718.1 protein_id gnl|my_center|LOCUS_07290 2445 1897 gene locus_tag LOCUS_07300 2445 1897 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877717.1 protein_id gnl|my_center|LOCUS_07300 3025 2411 gene locus_tag LOCUS_07310 3025 2411 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877716.1 protein_id gnl|my_center|LOCUS_07310 3581 2994 gene locus_tag LOCUS_07320 3581 2994 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877715.1 protein_id gnl|my_center|LOCUS_07320 5181 3607 gene locus_tag LOCUS_07330 5181 3607 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064316.1 protein_id gnl|my_center|LOCUS_07330 6265 5174 gene locus_tag LOCUS_07340 6265 5174 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878505.1 protein_id gnl|my_center|LOCUS_07340 7128 6268 gene locus_tag LOCUS_07350 7128 6268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878506.1 protein_id gnl|my_center|LOCUS_07350 7182 7943 gene locus_tag LOCUS_07360 7182 7943 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878509.1 protein_id gnl|my_center|LOCUS_07360 8717 8013 gene locus_tag LOCUS_07370 8717 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 9427 8714 gene locus_tag LOCUS_07380 9427 8714 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546597.1 protein_id gnl|my_center|LOCUS_07380 10395 9415 gene locus_tag LOCUS_07390 10395 9415 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876118.1 protein_id gnl|my_center|LOCUS_07390 11418 10504 gene locus_tag LOCUS_07400 11418 10504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 12868 11441 gene locus_tag LOCUS_07410 12868 11441 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462139.1 protein_id gnl|my_center|LOCUS_07410 15120 13027 gene locus_tag LOCUS_07420 15120 13027 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683854.1 protein_id gnl|my_center|LOCUS_07420 16037 15117 gene locus_tag LOCUS_07430 16037 15117 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157630.1 protein_id gnl|my_center|LOCUS_07430 18233 16155 gene locus_tag LOCUS_07440 18233 16155 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878834.1 protein_id gnl|my_center|LOCUS_07440 19106 18246 gene locus_tag LOCUS_07450 gene cbiB 19106 18246 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878833.1 protein_id gnl|my_center|LOCUS_07450 19556 19143 gene locus_tag LOCUS_07460 19556 19143 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879738.1 protein_id gnl|my_center|LOCUS_07460 20783 19575 gene locus_tag LOCUS_07470 20783 19575 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879739.1 protein_id gnl|my_center|LOCUS_07470 21459 20770 gene locus_tag LOCUS_07480 21459 20770 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879740.1 protein_id gnl|my_center|LOCUS_07480 22619 21489 gene locus_tag LOCUS_07490 22619 21489 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879741.1 protein_id gnl|my_center|LOCUS_07490 23358 23044 gene locus_tag LOCUS_07500 23358 23044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878292.1 protein_id gnl|my_center|LOCUS_07500 24249 23434 gene locus_tag LOCUS_07510 24249 23434 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318575.1 protein_id gnl|my_center|LOCUS_07510 24342 25130 gene locus_tag LOCUS_07520 24342 25130 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_07520 25171 25845 gene locus_tag LOCUS_07530 25171 25845 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877743.1 protein_id gnl|my_center|LOCUS_07530 25884 26846 gene locus_tag LOCUS_07540 25884 26846 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296899.1 protein_id gnl|my_center|LOCUS_07540 26924 28108 gene locus_tag LOCUS_07550 26924 28108 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878491.1 protein_id gnl|my_center|LOCUS_07550 28110 29309 gene locus_tag LOCUS_07560 28110 29309 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095472.1 protein_id gnl|my_center|LOCUS_07560 29374 30693 gene locus_tag LOCUS_07570 29374 30693 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240446.1 protein_id gnl|my_center|LOCUS_07570 30727 31614 gene locus_tag LOCUS_07580 30727 31614 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763253.1 protein_id gnl|my_center|LOCUS_07580 31616 32596 gene locus_tag LOCUS_07590 31616 32596 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763252.1 protein_id gnl|my_center|LOCUS_07590 32606 33334 gene locus_tag LOCUS_07600 32606 33334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_07600 33334 34038 gene locus_tag LOCUS_07610 33334 34038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763250.1 protein_id gnl|my_center|LOCUS_07610 34041 34433 gene locus_tag LOCUS_07620 34041 34433 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878487.1 protein_id gnl|my_center|LOCUS_07620 34464 35180 gene locus_tag LOCUS_07630 gene hisA 34464 35180 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878486.1 protein_id gnl|my_center|LOCUS_07630 35167 35706 gene locus_tag LOCUS_07640 35167 35706 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878485.1 protein_id gnl|my_center|LOCUS_07640 35706 36362 gene locus_tag LOCUS_07650 35706 36362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878484.1 protein_id gnl|my_center|LOCUS_07650 36349 36981 gene locus_tag LOCUS_07660 36349 36981 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064313.1 protein_id gnl|my_center|LOCUS_07660 38398 36995 gene locus_tag LOCUS_07670 38398 36995 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878457.1 protein_id gnl|my_center|LOCUS_07670 38537 38692 gene locus_tag LOCUS_07680 38537 38692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878456.1 protein_id gnl|my_center|LOCUS_07680 38682 39767 gene locus_tag LOCUS_07690 38682 39767 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878455.1 protein_id gnl|my_center|LOCUS_07690 39804 40988 gene locus_tag LOCUS_07700 39804 40988 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878802.1 protein_id gnl|my_center|LOCUS_07700 40998 41660 gene locus_tag LOCUS_07710 gene tpiA 40998 41660 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064694.1 protein_id gnl|my_center|LOCUS_07710 41816 41664 gene locus_tag LOCUS_07720 41816 41664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 41902 42162 gene locus_tag LOCUS_07730 41902 42162 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944701.1 protein_id gnl|my_center|LOCUS_07730 42197 42871 gene locus_tag LOCUS_07740 42197 42871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 43999 42848 gene locus_tag LOCUS_07750 43999 42848 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_07750 44840 44172 gene locus_tag LOCUS_07760 44840 44172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 45477 44830 gene locus_tag LOCUS_07770 45477 44830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 46177 45461 gene locus_tag LOCUS_07780 46177 45461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 46401 47348 gene locus_tag LOCUS_07790 46401 47348 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113106.1 protein_id gnl|my_center|LOCUS_07790 47475 47391 gene locus_tag LOCUS_t00160 47475 47391 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 47551 48684 gene locus_tag LOCUS_07800 47551 48684 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878621.1 protein_id gnl|my_center|LOCUS_07800 49103 48657 gene locus_tag LOCUS_07810 49103 48657 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320322.1 protein_id gnl|my_center|LOCUS_07810 49228 49605 gene locus_tag LOCUS_07820 49228 49605 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095548.1 protein_id gnl|my_center|LOCUS_07820 49615 50085 gene locus_tag LOCUS_07830 gene rplM 49615 50085 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878624.1 protein_id gnl|my_center|LOCUS_07830 50087 50485 gene locus_tag LOCUS_07840 50087 50485 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064334.1 protein_id gnl|my_center|LOCUS_07840 50492 50722 gene locus_tag LOCUS_07850 50492 50722 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878626.1 protein_id gnl|my_center|LOCUS_07850 50707 50782 gene locus_tag LOCUS_t00170 50707 50782 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 50812 51027 gene locus_tag LOCUS_07860 50812 51027 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878627.1 protein_id gnl|my_center|LOCUS_07860 51037 52236 gene locus_tag LOCUS_07870 gene eno 51037 52236 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064335.1 protein_id gnl|my_center|LOCUS_07870 52233 52826 gene locus_tag LOCUS_07880 gene rpsB 52233 52826 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878629.1 protein_id gnl|my_center|LOCUS_07880 52896 54278 gene locus_tag LOCUS_07890 52896 54278 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878630.1 protein_id gnl|my_center|LOCUS_07890 54324 54707 gene locus_tag LOCUS_07900 54324 54707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 55180 54704 gene locus_tag LOCUS_07910 55180 54704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 56151 55252 gene locus_tag LOCUS_07920 56151 55252 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877625.1 protein_id gnl|my_center|LOCUS_07920 57022 56267 gene locus_tag LOCUS_07930 gene cobB2 57022 56267 CDS product NAD-dependent protein deacylase Cob2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877626.1 protein_id gnl|my_center|LOCUS_07930 58125 57055 gene locus_tag LOCUS_07940 58125 57055 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320294.1 protein_id gnl|my_center|LOCUS_07940 59070 58237 gene locus_tag LOCUS_07950 gene nadC 59070 58237 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319001.1 protein_id gnl|my_center|LOCUS_07950 59819 59067 gene locus_tag LOCUS_07960 gene nadX 59819 59067 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879332.1 protein_id gnl|my_center|LOCUS_07960 60733 59816 gene locus_tag LOCUS_07970 gene nadA 60733 59816 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877429.1 protein_id gnl|my_center|LOCUS_07970 60822 61091 gene locus_tag LOCUS_07980 60822 61091 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877628.1 protein_id gnl|my_center|LOCUS_07980 61078 61851 gene locus_tag LOCUS_07990 61078 61851 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877629.1 protein_id gnl|my_center|LOCUS_07990 61848 62534 gene locus_tag LOCUS_08000 61848 62534 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877630.1 protein_id gnl|my_center|LOCUS_08000 63458 62514 gene locus_tag LOCUS_08010 63458 62514 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877631.1 protein_id gnl|my_center|LOCUS_08010 63799 63455 gene locus_tag LOCUS_08020 63799 63455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877632.1 protein_id gnl|my_center|LOCUS_08020 65602 63839 gene locus_tag LOCUS_08030 65602 63839 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877518.1 protein_id gnl|my_center|LOCUS_08030 65699 66373 gene locus_tag LOCUS_08040 65699 66373 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877951.1 protein_id gnl|my_center|LOCUS_08040 66800 66306 gene locus_tag LOCUS_08050 66800 66306 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877952.1 protein_id gnl|my_center|LOCUS_08050 66909 67451 gene locus_tag LOCUS_08060 66909 67451 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320297.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence08 247 1731 gene locus_tag LOCUS_08070 247 1731 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879907.1 protein_id gnl|my_center|LOCUS_08070 1755 3323 gene locus_tag LOCUS_08080 1755 3323 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064281.1 protein_id gnl|my_center|LOCUS_08080 3922 3320 gene locus_tag LOCUS_08090 3922 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 4434 3919 gene locus_tag LOCUS_08100 4434 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 5842 4427 gene locus_tag LOCUS_08110 5842 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 5883 6305 gene locus_tag LOCUS_08120 gene nikR 5883 6305 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878246.1 protein_id gnl|my_center|LOCUS_08120 7327 6302 gene locus_tag LOCUS_08130 gene priS 7327 6302 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064280.1 protein_id gnl|my_center|LOCUS_08130 7739 7329 gene locus_tag LOCUS_08140 7739 7329 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_08140 8119 7736 gene locus_tag LOCUS_08150 8119 7736 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878243.1 protein_id gnl|my_center|LOCUS_08150 8156 8605 gene locus_tag LOCUS_08160 gene rimI 8156 8605 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208657.1 protein_id gnl|my_center|LOCUS_08160 8858 8577 gene locus_tag LOCUS_08170 8858 8577 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878241.1 protein_id gnl|my_center|LOCUS_08170 9206 9003 gene locus_tag LOCUS_08180 9206 9003 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878240.1 protein_id gnl|my_center|LOCUS_08180 9451 9203 gene locus_tag LOCUS_08190 9451 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 9764 9435 gene locus_tag LOCUS_08200 9764 9435 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064277.1 protein_id gnl|my_center|LOCUS_08200 11148 9772 gene locus_tag LOCUS_08210 11148 9772 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878238.1 protein_id gnl|my_center|LOCUS_08210 11214 11861 gene locus_tag LOCUS_08220 gene nep1 11214 11861 CDS product 16S rRNA (pseudouridine-N1-)-methyltransferase Nep1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878237.1 protein_id gnl|my_center|LOCUS_08220 11845 12714 gene locus_tag LOCUS_08230 gene thiL 11845 12714 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064276.1 protein_id gnl|my_center|LOCUS_08230 13429 12866 gene locus_tag LOCUS_08240 13429 12866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 15642 13426 gene locus_tag LOCUS_08250 15642 13426 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650637.1 protein_id gnl|my_center|LOCUS_08250 17992 15647 gene locus_tag LOCUS_08260 17992 15647 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285084.1 protein_id gnl|my_center|LOCUS_08260 18213 19265 gene locus_tag LOCUS_08270 18213 19265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08270 19250 20032 gene locus_tag LOCUS_08280 19250 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08280 20592 20029 gene locus_tag LOCUS_08290 20592 20029 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249239.1 protein_id gnl|my_center|LOCUS_08290 20865 20792 gene locus_tag LOCUS_t00180 20865 20792 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 20944 22188 gene locus_tag LOCUS_08300 20944 22188 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878430.1 protein_id gnl|my_center|LOCUS_08300 22185 24146 gene locus_tag LOCUS_08310 22185 24146 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878431.1 protein_id gnl|my_center|LOCUS_08310 25519 24158 gene locus_tag LOCUS_08320 25519 24158 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_08320 25590 27008 gene locus_tag LOCUS_08330 25590 27008 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879447.1 protein_id gnl|my_center|LOCUS_08330 27081 27353 gene locus_tag LOCUS_08340 gene albA 27081 27353 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879448.1 protein_id gnl|my_center|LOCUS_08340 27394 28383 gene locus_tag LOCUS_08350 27394 28383 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879449.1 protein_id gnl|my_center|LOCUS_08350 28380 29555 gene locus_tag LOCUS_08360 28380 29555 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_08360 29560 30321 gene locus_tag LOCUS_08370 29560 30321 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_08370 30900 30325 gene locus_tag LOCUS_08380 30900 30325 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013684103.1 protein_id gnl|my_center|LOCUS_08380 30968 31696 gene locus_tag LOCUS_08390 30968 31696 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878638.1 protein_id gnl|my_center|LOCUS_08390 31880 33043 gene locus_tag LOCUS_08400 31880 33043 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878637.1 protein_id gnl|my_center|LOCUS_08400 34239 33061 gene locus_tag LOCUS_08410 34239 33061 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879290.1 protein_id gnl|my_center|LOCUS_08410 35280 34306 gene locus_tag LOCUS_08420 35280 34306 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064463.1 protein_id gnl|my_center|LOCUS_08420 35916 35350 gene locus_tag LOCUS_08430 gene hxlB 35916 35350 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879292.1 protein_id gnl|my_center|LOCUS_08430 36919 35954 gene locus_tag LOCUS_08440 36919 35954 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879293.1 protein_id gnl|my_center|LOCUS_08440 37008 38015 gene locus_tag LOCUS_08450 37008 38015 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879294.1 protein_id gnl|my_center|LOCUS_08450 38012 38692 gene locus_tag LOCUS_08460 38012 38692 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064464.1 protein_id gnl|my_center|LOCUS_08460 39683 38667 gene locus_tag LOCUS_08470 39683 38667 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879296.1 protein_id gnl|my_center|LOCUS_08470 40395 39688 gene locus_tag LOCUS_08480 40395 39688 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064465.1 protein_id gnl|my_center|LOCUS_08480 40483 41220 gene locus_tag LOCUS_08490 40483 41220 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879273.1 protein_id gnl|my_center|LOCUS_08490 41812 41195 gene locus_tag LOCUS_08500 gene engB 41812 41195 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878823.1 protein_id gnl|my_center|LOCUS_08500 41978 41796 gene locus_tag LOCUS_08510 41978 41796 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064461.1 protein_id gnl|my_center|LOCUS_08510 42016 42984 gene locus_tag LOCUS_08520 42016 42984 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064460.1 protein_id gnl|my_center|LOCUS_08520 44580 42985 gene locus_tag LOCUS_08530 44580 42985 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_08530 44746 45948 gene locus_tag LOCUS_08540 gene nrfD 44746 45948 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255935.1 protein_id gnl|my_center|LOCUS_08540 45945 46682 gene locus_tag LOCUS_08550 45945 46682 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_08550 46695 47108 gene locus_tag LOCUS_08560 46695 47108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 47182 47538 gene locus_tag LOCUS_08570 47182 47538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 47535 47978 gene locus_tag LOCUS_08580 47535 47978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 47971 49899 gene locus_tag LOCUS_08590 47971 49899 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878258.1 protein_id gnl|my_center|LOCUS_08590 51611 49905 gene locus_tag LOCUS_08600 51611 49905 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_08600 51723 52019 gene locus_tag LOCUS_08610 51723 52019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877760.1 protein_id gnl|my_center|LOCUS_08610 52006 52341 gene locus_tag LOCUS_08620 52006 52341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877761.1 protein_id gnl|my_center|LOCUS_08620 53357 52344 gene locus_tag LOCUS_08630 53357 52344 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877762.1 protein_id gnl|my_center|LOCUS_08630 53605 53787 gene locus_tag LOCUS_08640 53605 53787 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064196.1 protein_id gnl|my_center|LOCUS_08640 53784 55388 gene locus_tag LOCUS_08650 gene pyrG 53784 55388 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877763.1 protein_id gnl|my_center|LOCUS_08650 55378 56289 gene locus_tag LOCUS_08660 gene guaA 55378 56289 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877764.1 protein_id gnl|my_center|LOCUS_08660 57040 56273 gene locus_tag LOCUS_08670 57040 56273 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878408.1 protein_id gnl|my_center|LOCUS_08670 57130 57750 gene locus_tag LOCUS_08680 57130 57750 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878665.1 protein_id gnl|my_center|LOCUS_08680 57743 58846 gene locus_tag LOCUS_08690 57743 58846 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320500.1 protein_id gnl|my_center|LOCUS_08690 58843 59490 gene locus_tag LOCUS_08700 58843 59490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878667.1 protein_id gnl|my_center|LOCUS_08700 60176 59460 gene locus_tag LOCUS_08710 60176 59460 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878668.1 protein_id gnl|my_center|LOCUS_08710 60304 60870 gene locus_tag LOCUS_08720 60304 60870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878669.1 protein_id gnl|my_center|LOCUS_08720 60981 61604 gene locus_tag LOCUS_08730 60981 61604 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878670.1 protein_id gnl|my_center|LOCUS_08730 61630 62946 gene locus_tag LOCUS_08740 61630 62946 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064343.1 protein_id gnl|my_center|LOCUS_08740 62953 63699 gene locus_tag LOCUS_08750 62953 63699 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878672.1 protein_id gnl|my_center|LOCUS_08750 63710 64525 gene locus_tag LOCUS_08760 63710 64525 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878672.1 protein_id gnl|my_center|LOCUS_08760 65256 64636 gene locus_tag LOCUS_08770 65256 64636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 65831 65253 gene locus_tag LOCUS_08780 65831 65253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 <66768 66031 gene locus_tag LOCUS_08790 <66768 66031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932353.1:molybdate ABC transporter substrate-binding protein >Feature sequence09 148 807 gene locus_tag LOCUS_08800 148 807 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878130.1 protein_id gnl|my_center|LOCUS_08800 1637 804 gene locus_tag LOCUS_08810 1637 804 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878129.1 protein_id gnl|my_center|LOCUS_08810 2185 1634 gene locus_tag LOCUS_08820 2185 1634 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878128.1 protein_id gnl|my_center|LOCUS_08820 3849 2182 gene locus_tag LOCUS_08830 3849 2182 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320246.1 protein_id gnl|my_center|LOCUS_08830 3921 5219 gene locus_tag LOCUS_08840 gene srp54 3921 5219 CDS product signal recognition particle protein SRP54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878126.1 protein_id gnl|my_center|LOCUS_08840 5219 5836 gene locus_tag LOCUS_08850 gene rnhB 5219 5836 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878125.1 protein_id gnl|my_center|LOCUS_08850 5892 5964 gene locus_tag LOCUS_t00190 5892 5964 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6040 6174 gene locus_tag LOCUS_08860 6040 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 7647 6217 gene locus_tag LOCUS_08870 7647 6217 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870658.1 protein_id gnl|my_center|LOCUS_08870 8017 7670 gene locus_tag LOCUS_08880 8017 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 8155 8373 gene locus_tag LOCUS_08890 8155 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 9121 8315 gene locus_tag LOCUS_08900 9121 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 9494 9144 gene locus_tag LOCUS_08910 9494 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 10044 9787 gene locus_tag LOCUS_08920 10044 9787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 10214 10041 gene locus_tag LOCUS_08930 10214 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 10529 10248 gene locus_tag LOCUS_08940 10529 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 10669 10848 gene locus_tag LOCUS_08950 10669 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 11075 10854 gene locus_tag LOCUS_08960 11075 10854 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545805.1 protein_id gnl|my_center|LOCUS_08960 11285 11076 gene locus_tag LOCUS_08970 11285 11076 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_08970 11650 11318 gene locus_tag LOCUS_08980 11650 11318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 11732 11914 gene locus_tag LOCUS_08990 11732 11914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 12290 12610 gene locus_tag LOCUS_09000 12290 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 12702 12529 gene locus_tag LOCUS_09010 12702 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 13194 14192 gene locus_tag LOCUS_09020 gene comC 13194 14192 CDS product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870943.1 protein_id gnl|my_center|LOCUS_09020 14179 15369 gene locus_tag LOCUS_09030 14179 15369 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112480.1 protein_id gnl|my_center|LOCUS_09030 15993 15355 gene locus_tag LOCUS_09040 15993 15355 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435816.1 protein_id gnl|my_center|LOCUS_09040 17272 16022 gene locus_tag LOCUS_09050 gene larA 17272 16022 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816966.1 protein_id gnl|my_center|LOCUS_09050 18396 17278 gene locus_tag LOCUS_09060 gene nrfD 18396 17278 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541886.1 protein_id gnl|my_center|LOCUS_09060 19152 18406 gene locus_tag LOCUS_09070 19152 18406 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938583.1 protein_id gnl|my_center|LOCUS_09070 19872 19165 gene locus_tag LOCUS_09080 gene sdhB 19872 19165 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878185.1 protein_id gnl|my_center|LOCUS_09080 21588 19876 gene locus_tag LOCUS_09090 21588 19876 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_09090 22211 21594 gene locus_tag LOCUS_09100 22211 21594 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 protein_id gnl|my_center|LOCUS_09100 23115 22222 gene locus_tag LOCUS_09110 23115 22222 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870811.1 protein_id gnl|my_center|LOCUS_09110 24286 23126 gene locus_tag LOCUS_09120 24286 23126 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582864.1 protein_id gnl|my_center|LOCUS_09120 24580 24302 gene locus_tag LOCUS_09130 24580 24302 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_09130 25394 24669 gene locus_tag LOCUS_09140 25394 24669 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221295.1 protein_id gnl|my_center|LOCUS_09140 26195 25437 gene locus_tag LOCUS_09150 26195 25437 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339088.1 protein_id gnl|my_center|LOCUS_09150 28092 26200 gene locus_tag LOCUS_09160 28092 26200 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_09160 29162 28131 gene locus_tag LOCUS_09170 29162 28131 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064624.1 protein_id gnl|my_center|LOCUS_09170 29505 29431 gene locus_tag LOCUS_t00200 29505 29431 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 30115 29588 gene locus_tag LOCUS_09180 30115 29588 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878792.1 protein_id gnl|my_center|LOCUS_09180 32339 30138 gene locus_tag LOCUS_09190 32339 30138 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_09190 33026 32355 gene locus_tag LOCUS_09200 33026 32355 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270482.1 protein_id gnl|my_center|LOCUS_09200 33613 33113 gene locus_tag LOCUS_09210 33613 33113 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878604.1 protein_id gnl|my_center|LOCUS_09210 33981 33640 gene locus_tag LOCUS_09220 33981 33640 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878605.1 protein_id gnl|my_center|LOCUS_09220 34516 33965 gene locus_tag LOCUS_09230 34516 33965 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878606.1 protein_id gnl|my_center|LOCUS_09230 34603 34914 gene locus_tag LOCUS_09240 34603 34914 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878607.1 protein_id gnl|my_center|LOCUS_09240 35128 36219 gene locus_tag LOCUS_09250 35128 36219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 37194 36223 gene locus_tag LOCUS_09260 37194 36223 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878608.1 protein_id gnl|my_center|LOCUS_09260 37361 37191 gene locus_tag LOCUS_09270 37361 37191 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878609.1 protein_id gnl|my_center|LOCUS_09270 37721 37377 gene locus_tag LOCUS_09280 37721 37377 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064676.1 protein_id gnl|my_center|LOCUS_09280 38292 37699 gene locus_tag LOCUS_09290 38292 37699 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878611.1 protein_id gnl|my_center|LOCUS_09290 38485 38297 gene locus_tag LOCUS_09300 38485 38297 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878612.1 protein_id gnl|my_center|LOCUS_09300 39054 38485 gene locus_tag LOCUS_09310 gene rpoE 39054 38485 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878613.1 protein_id gnl|my_center|LOCUS_09310 39194 39616 gene locus_tag LOCUS_09320 39194 39616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878615.1 protein_id gnl|my_center|LOCUS_09320 39643 40149 gene locus_tag LOCUS_09330 39643 40149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064331.1 protein_id gnl|my_center|LOCUS_09330 40181 40648 gene locus_tag LOCUS_09340 40181 40648 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878617.1 protein_id gnl|my_center|LOCUS_09340 40763 42715 gene locus_tag LOCUS_09350 40763 42715 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878618.1 protein_id gnl|my_center|LOCUS_09350 42913 43224 gene locus_tag LOCUS_09360 42913 43224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 43249 44169 gene locus_tag LOCUS_09370 43249 44169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 44166 45137 gene locus_tag LOCUS_09380 44166 45137 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_09380 45137 45592 gene locus_tag LOCUS_09390 45137 45592 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274404.1 protein_id gnl|my_center|LOCUS_09390 45629 46093 gene locus_tag LOCUS_09400 45629 46093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878902.1 protein_id gnl|my_center|LOCUS_09400 46123 46356 gene locus_tag LOCUS_09410 46123 46356 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_09410 46356 47015 gene locus_tag LOCUS_09420 46356 47015 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878900.1 protein_id gnl|my_center|LOCUS_09420 48409 47012 gene locus_tag LOCUS_09430 48409 47012 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_09430 48529 48849 gene locus_tag LOCUS_09440 48529 48849 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879500.1 protein_id gnl|my_center|LOCUS_09440 49515 48850 gene locus_tag LOCUS_09450 49515 48850 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879499.1 protein_id gnl|my_center|LOCUS_09450 50402 49512 gene locus_tag LOCUS_09460 gene moaA 50402 49512 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879498.1 protein_id gnl|my_center|LOCUS_09460 50974 50372 gene locus_tag LOCUS_09470 50974 50372 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879497.1 protein_id gnl|my_center|LOCUS_09470 51050 52078 gene locus_tag LOCUS_09480 51050 52078 CDS product IS110-like element ISMac14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022688.1 protein_id gnl|my_center|LOCUS_09480 52247 53365 gene locus_tag LOCUS_09490 gene mfnA 52247 53365 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879496.1 protein_id gnl|my_center|LOCUS_09490 53376 53525 gene locus_tag LOCUS_09500 53376 53525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 53522 54577 gene locus_tag LOCUS_09510 gene hisC 53522 54577 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423302.1 protein_id gnl|my_center|LOCUS_09510 54574 55098 gene locus_tag LOCUS_09520 54574 55098 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879493.1 protein_id gnl|my_center|LOCUS_09520 55102 56322 gene locus_tag LOCUS_09530 gene ahcY 55102 56322 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879492.1 protein_id gnl|my_center|LOCUS_09530 56319 56729 gene locus_tag LOCUS_09540 56319 56729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064510.1 protein_id gnl|my_center|LOCUS_09540 56829 57836 gene locus_tag LOCUS_09550 56829 57836 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879490.1 protein_id gnl|my_center|LOCUS_09550 57886 58593 gene locus_tag LOCUS_09560 57886 58593 CDS product DUF432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879042.1 protein_id gnl|my_center|LOCUS_09560 58590 59435 gene locus_tag LOCUS_09570 58590 59435 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064408.1 protein_id gnl|my_center|LOCUS_09570 59404 60204 gene locus_tag LOCUS_09580 59404 60204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 60586 60197 gene locus_tag LOCUS_09590 60586 60197 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878487.1 protein_id gnl|my_center|LOCUS_09590 61236 60583 gene locus_tag LOCUS_09600 61236 60583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877732.1 protein_id gnl|my_center|LOCUS_09600 61998 61246 gene locus_tag LOCUS_09610 61998 61246 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_09610 62915 61986 gene locus_tag LOCUS_09620 62915 61986 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086817.1 protein_id gnl|my_center|LOCUS_09620 63775 62912 gene locus_tag LOCUS_09630 63775 62912 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085968.1 protein_id gnl|my_center|LOCUS_09630 <65028 63785 gene locus_tag LOCUS_09640 <65028 63785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063921521.1:substrate-binding domain-containing protein >Feature sequence10 338 102 gene locus_tag LOCUS_09650 338 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 515 766 gene locus_tag LOCUS_09660 515 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1127 1055 gene locus_tag LOCUS_t00210 1127 1055 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1430 1819 gene locus_tag LOCUS_09670 1430 1819 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878018.1 protein_id gnl|my_center|LOCUS_09670 1821 2438 gene locus_tag LOCUS_09680 1821 2438 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878019.1 protein_id gnl|my_center|LOCUS_09680 2470 2865 gene locus_tag LOCUS_09690 2470 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878020.1 protein_id gnl|my_center|LOCUS_09690 3406 2846 gene locus_tag LOCUS_09700 3406 2846 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878021.1 protein_id gnl|my_center|LOCUS_09700 4325 3399 gene locus_tag LOCUS_09710 4325 3399 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878022.1 protein_id gnl|my_center|LOCUS_09710 4376 6472 gene locus_tag LOCUS_09720 4376 6472 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_09720 6511 7215 gene locus_tag LOCUS_09730 6511 7215 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878025.1 protein_id gnl|my_center|LOCUS_09730 7212 7670 gene locus_tag LOCUS_09740 gene cgi121 7212 7670 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878026.1 protein_id gnl|my_center|LOCUS_09740 7667 8506 gene locus_tag LOCUS_09750 7667 8506 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064249.1 protein_id gnl|my_center|LOCUS_09750 8951 8493 gene locus_tag LOCUS_09760 8951 8493 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878028.1 protein_id gnl|my_center|LOCUS_09760 8991 9965 gene locus_tag LOCUS_09770 8991 9965 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878029.1 protein_id gnl|my_center|LOCUS_09770 10608 9934 gene locus_tag LOCUS_09780 10608 9934 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878031.1 protein_id gnl|my_center|LOCUS_09780 11384 10605 gene locus_tag LOCUS_09790 11384 10605 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_09790 11568 11368 gene locus_tag LOCUS_09800 11568 11368 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878033.1 protein_id gnl|my_center|LOCUS_09800 12368 11565 gene locus_tag LOCUS_09810 12368 11565 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878034.1 protein_id gnl|my_center|LOCUS_09810 13233 12394 gene locus_tag LOCUS_09820 13233 12394 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878035.1 protein_id gnl|my_center|LOCUS_09820 13375 14271 gene locus_tag LOCUS_09830 13375 14271 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878274.1 protein_id gnl|my_center|LOCUS_09830 15517 14255 gene locus_tag LOCUS_09840 15517 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878275.1 protein_id gnl|my_center|LOCUS_09840 15854 15510 gene locus_tag LOCUS_09850 15854 15510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 16648 15851 gene locus_tag LOCUS_09860 16648 15851 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878278.1 protein_id gnl|my_center|LOCUS_09860 17065 17280 gene locus_tag LOCUS_09870 17065 17280 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878036.1 protein_id gnl|my_center|LOCUS_09870 18221 17244 gene locus_tag LOCUS_09880 18221 17244 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064291.1 protein_id gnl|my_center|LOCUS_09880 19010 20905 gene locus_tag LOCUS_09890 gene gyrB 19010 20905 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_09890 20895 21656 gene locus_tag LOCUS_09900 20895 21656 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683937.1 protein_id gnl|my_center|LOCUS_09900 21725 22948 gene locus_tag LOCUS_09910 21725 22948 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318432.1 protein_id gnl|my_center|LOCUS_09910 22945 23571 gene locus_tag LOCUS_09920 22945 23571 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878040.1 protein_id gnl|my_center|LOCUS_09920 24548 23580 gene locus_tag LOCUS_09930 24548 23580 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878041.1 protein_id gnl|my_center|LOCUS_09930 24669 25775 gene locus_tag LOCUS_09940 gene ftsZ 24669 25775 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064630.1 protein_id gnl|my_center|LOCUS_09940 25808 25993 gene locus_tag LOCUS_09950 25808 25993 CDS product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318428.1 protein_id gnl|my_center|LOCUS_09950 25990 26442 gene locus_tag LOCUS_09960 25990 26442 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878044.1 protein_id gnl|my_center|LOCUS_09960 26448 26918 gene locus_tag LOCUS_09970 26448 26918 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878045.1 protein_id gnl|my_center|LOCUS_09970 27620 26919 gene locus_tag LOCUS_09980 27620 26919 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878046.1 protein_id gnl|my_center|LOCUS_09980 28309 27623 gene locus_tag LOCUS_09990 28309 27623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878047.1 protein_id gnl|my_center|LOCUS_09990 28719 28306 gene locus_tag LOCUS_10000 28719 28306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878048.1 protein_id gnl|my_center|LOCUS_10000 29532 28804 gene locus_tag LOCUS_10010 29532 28804 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_10010 29689 31386 gene locus_tag LOCUS_10020 29689 31386 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_10020 31396 32106 gene locus_tag LOCUS_10030 gene sdhB 31396 32106 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878185.1 protein_id gnl|my_center|LOCUS_10030 32108 32482 gene locus_tag LOCUS_10040 32108 32482 CDS product succinate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878186.1 protein_id gnl|my_center|LOCUS_10040 32484 32828 gene locus_tag LOCUS_10050 gene sdhC 32484 32828 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094801.1 protein_id gnl|my_center|LOCUS_10050 33121 33393 gene locus_tag LOCUS_10060 33121 33393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 34885 34232 gene locus_tag LOCUS_10070 34885 34232 CDS product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879439.1 protein_id gnl|my_center|LOCUS_10070 37545 34882 gene locus_tag LOCUS_10080 37545 34882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 39784 38342 gene locus_tag LOCUS_10090 39784 38342 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064301.1 protein_id gnl|my_center|LOCUS_10090 40649 39807 gene locus_tag LOCUS_10100 40649 39807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 41023 40646 gene locus_tag LOCUS_10110 41023 40646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274390.1 protein_id gnl|my_center|LOCUS_10110 41854 41066 gene locus_tag LOCUS_10120 41854 41066 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878366.1 protein_id gnl|my_center|LOCUS_10120 43373 41895 gene locus_tag LOCUS_10130 43373 41895 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878367.1 protein_id gnl|my_center|LOCUS_10130 44383 43370 gene locus_tag LOCUS_10140 44383 43370 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878368.1 protein_id gnl|my_center|LOCUS_10140 45720 44380 gene locus_tag LOCUS_10150 45720 44380 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_10150 46046 45717 gene locus_tag LOCUS_10160 46046 45717 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_10160 46207 46043 gene locus_tag LOCUS_10170 46207 46043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 47262 46237 gene locus_tag LOCUS_10180 gene gpsA 47262 46237 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878372.1 protein_id gnl|my_center|LOCUS_10180 47334 47528 gene locus_tag LOCUS_10190 47334 47528 CDS product DUF2116 family Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878373.1 protein_id gnl|my_center|LOCUS_10190 48896 47520 gene locus_tag LOCUS_10200 gene purF 48896 47520 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878374.1 protein_id gnl|my_center|LOCUS_10200 49309 49076 gene locus_tag LOCUS_10210 49309 49076 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878376.1 protein_id gnl|my_center|LOCUS_10210 49411 49481 gene locus_tag LOCUS_t00220 49411 49481 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 50717 49539 gene locus_tag LOCUS_10220 50717 49539 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763006.1 protein_id gnl|my_center|LOCUS_10220 52020 50707 gene locus_tag LOCUS_10230 52020 50707 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763005.1 protein_id gnl|my_center|LOCUS_10230 52724 52017 gene locus_tag LOCUS_10240 52724 52017 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763250.1 protein_id gnl|my_center|LOCUS_10240 53453 52725 gene locus_tag LOCUS_10250 53453 52725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185981.1 protein_id gnl|my_center|LOCUS_10250 54528 53455 gene locus_tag LOCUS_10260 54528 53455 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064223.1 protein_id gnl|my_center|LOCUS_10260 55405 54533 gene locus_tag LOCUS_10270 55405 54533 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878328.1 protein_id gnl|my_center|LOCUS_10270 56785 55415 gene locus_tag LOCUS_10280 56785 55415 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089186.1 protein_id gnl|my_center|LOCUS_10280 57349 57071 gene locus_tag LOCUS_10290 57349 57071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 57786 57346 gene locus_tag LOCUS_10300 57786 57346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 58205 57783 gene locus_tag LOCUS_10310 58205 57783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 60231 58210 gene locus_tag LOCUS_10320 60231 58210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 61388 60228 gene locus_tag LOCUS_10330 61388 60228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 62039 61392 gene locus_tag LOCUS_10340 62039 61392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 <63819 62023 gene locus_tag LOCUS_10350 <63819 62023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193487114.1:nitrate reductase subunit alpha >Feature sequence11 55 1464 gene locus_tag LOCUS_10360 55 1464 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879259.1 protein_id gnl|my_center|LOCUS_10360 1928 1473 gene locus_tag LOCUS_10370 1928 1473 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_10370 2586 1930 gene locus_tag LOCUS_10380 2586 1930 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879261.1 protein_id gnl|my_center|LOCUS_10380 2653 2883 gene locus_tag LOCUS_10390 2653 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2849 4558 gene locus_tag LOCUS_10400 2849 4558 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879262.1 protein_id gnl|my_center|LOCUS_10400 4742 6382 gene locus_tag LOCUS_10410 4742 6382 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877603.1 protein_id gnl|my_center|LOCUS_10410 7628 6372 gene locus_tag LOCUS_10420 7628 6372 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064606.1 protein_id gnl|my_center|LOCUS_10420 7682 8692 gene locus_tag LOCUS_10430 gene fen 7682 8692 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877775.1 protein_id gnl|my_center|LOCUS_10430 8692 9201 gene locus_tag LOCUS_10440 8692 9201 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064607.1 protein_id gnl|my_center|LOCUS_10440 9385 9209 gene locus_tag LOCUS_10450 9385 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 10277 9450 gene locus_tag LOCUS_10460 10277 9450 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877777.1 protein_id gnl|my_center|LOCUS_10460 10362 10796 gene locus_tag LOCUS_10470 10362 10796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 10793 11980 gene locus_tag LOCUS_10480 10793 11980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 13118 11985 gene locus_tag LOCUS_10490 13118 11985 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064307.1 protein_id gnl|my_center|LOCUS_10490 14082 13150 gene locus_tag LOCUS_10500 14082 13150 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_10500 15084 14083 gene locus_tag LOCUS_10510 15084 14083 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878388.1 protein_id gnl|my_center|LOCUS_10510 16586 15081 gene locus_tag LOCUS_10520 16586 15081 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236609685.1 protein_id gnl|my_center|LOCUS_10520 16675 17676 gene locus_tag LOCUS_10530 16675 17676 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086975767.1 protein_id gnl|my_center|LOCUS_10530 17726 19138 gene locus_tag LOCUS_10540 17726 19138 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878385.1 protein_id gnl|my_center|LOCUS_10540 20158 19148 gene locus_tag LOCUS_10550 20158 19148 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879345.1 protein_id gnl|my_center|LOCUS_10550 21030 20155 gene locus_tag LOCUS_10560 21030 20155 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879344.1 protein_id gnl|my_center|LOCUS_10560 21129 21734 gene locus_tag LOCUS_10570 21129 21734 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096121.1 protein_id gnl|my_center|LOCUS_10570 23721 21739 gene locus_tag LOCUS_10580 gene acs 23721 21739 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 protein_id gnl|my_center|LOCUS_10580 23828 24046 gene locus_tag LOCUS_10590 23828 24046 CDS product TIGR00304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319492.1 protein_id gnl|my_center|LOCUS_10590 24048 24341 gene locus_tag LOCUS_10600 24048 24341 CDS product TIGR00304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879769.1 protein_id gnl|my_center|LOCUS_10600 24423 26249 gene locus_tag LOCUS_10610 24423 26249 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319085.1 protein_id gnl|my_center|LOCUS_10610 27048 26254 gene locus_tag LOCUS_10620 27048 26254 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879771.1 protein_id gnl|my_center|LOCUS_10620 27449 27048 gene locus_tag LOCUS_10630 27449 27048 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879772.1 protein_id gnl|my_center|LOCUS_10630 27973 27449 gene locus_tag LOCUS_10640 gene rpsD 27973 27449 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879773.1 protein_id gnl|my_center|LOCUS_10640 28418 27978 gene locus_tag LOCUS_10650 28418 27978 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879774.1 protein_id gnl|my_center|LOCUS_10650 29074 28610 gene locus_tag LOCUS_10660 gene sixA 29074 28610 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_10660 29173 31476 gene locus_tag LOCUS_10670 29173 31476 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877994.1 protein_id gnl|my_center|LOCUS_10670 31473 31793 gene locus_tag LOCUS_10680 31473 31793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877995.1 protein_id gnl|my_center|LOCUS_10680 31790 32122 gene locus_tag LOCUS_10690 31790 32122 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064245.1 protein_id gnl|my_center|LOCUS_10690 32125 32865 gene locus_tag LOCUS_10700 gene psmA 32125 32865 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 protein_id gnl|my_center|LOCUS_10700 32874 33578 gene locus_tag LOCUS_10710 32874 33578 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877998.1 protein_id gnl|my_center|LOCUS_10710 33578 34249 gene locus_tag LOCUS_10720 gene rrp4 33578 34249 CDS product exosome complex protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877999.1 protein_id gnl|my_center|LOCUS_10720 34233 35009 gene locus_tag LOCUS_10730 gene rrp41 34233 35009 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878000.1 protein_id gnl|my_center|LOCUS_10730 35002 35781 gene locus_tag LOCUS_10740 gene rrp42 35002 35781 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878001.1 protein_id gnl|my_center|LOCUS_10740 36382 35768 gene locus_tag LOCUS_10750 36382 35768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879910.1 protein_id gnl|my_center|LOCUS_10750 37602 36379 gene locus_tag LOCUS_10760 37602 36379 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879911.1 protein_id gnl|my_center|LOCUS_10760 38542 37592 gene locus_tag LOCUS_10770 38542 37592 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064578.1 protein_id gnl|my_center|LOCUS_10770 39110 38751 gene locus_tag LOCUS_10780 39110 38751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 40265 39111 gene locus_tag LOCUS_10790 40265 39111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 40500 41348 gene locus_tag LOCUS_10800 gene rio2 40500 41348 CDS product RIO-type serine/threonine-protein kinase Rio2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879913.1 protein_id gnl|my_center|LOCUS_10800 41345 43231 gene locus_tag LOCUS_10810 41345 43231 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879914.1 protein_id gnl|my_center|LOCUS_10810 43234 44022 gene locus_tag LOCUS_10820 43234 44022 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879915.1 protein_id gnl|my_center|LOCUS_10820 44888 44025 gene locus_tag LOCUS_10830 44888 44025 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878017.1 protein_id gnl|my_center|LOCUS_10830 45471 44878 gene locus_tag LOCUS_10840 gene pdxT 45471 44878 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878016.1 protein_id gnl|my_center|LOCUS_10840 46478 45468 gene locus_tag LOCUS_10850 gene pdxS 46478 45468 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878015.1 protein_id gnl|my_center|LOCUS_10850 46698 50132 gene locus_tag LOCUS_10860 gene polC 46698 50132 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879218.1 protein_id gnl|my_center|LOCUS_10860 50169 50585 gene locus_tag LOCUS_10870 50169 50585 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879219.1 protein_id gnl|my_center|LOCUS_10870 50621 51538 gene locus_tag LOCUS_10880 50621 51538 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_10880 52478 51525 gene locus_tag LOCUS_10890 gene ligD 52478 51525 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879221.1 protein_id gnl|my_center|LOCUS_10890 53242 52475 gene locus_tag LOCUS_10900 53242 52475 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064443.1 protein_id gnl|my_center|LOCUS_10900 53398 54732 gene locus_tag LOCUS_10910 53398 54732 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064444.1 protein_id gnl|my_center|LOCUS_10910 56102 54810 gene locus_tag LOCUS_10920 gene aspS 56102 54810 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_10920 57368 56133 gene locus_tag LOCUS_10930 gene cbpB 57368 56133 CDS product peptide-modifying radical SAM enzyme CbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879693.1 protein_id gnl|my_center|LOCUS_10930 57574 57963 gene locus_tag LOCUS_10940 57574 57963 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878522.1 protein_id gnl|my_center|LOCUS_10940 59041 57947 gene locus_tag LOCUS_10950 59041 57947 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878523.1 protein_id gnl|my_center|LOCUS_10950 59069 62284 gene locus_tag LOCUS_10960 gene rgy 59069 62284 CDS product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878524.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence12 <1 1388 gene locus_tag LOCUS_10970 <1 1388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879727.1:thermosome subunit beta 1936 1394 gene locus_tag LOCUS_10980 1936 1394 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879726.1 protein_id gnl|my_center|LOCUS_10980 2015 2650 gene locus_tag LOCUS_10990 2015 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879725.1 protein_id gnl|my_center|LOCUS_10990 3075 2668 gene locus_tag LOCUS_11000 gene mce 3075 2668 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289162.1 protein_id gnl|my_center|LOCUS_11000 3653 3231 gene locus_tag LOCUS_11010 3653 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3877 3650 gene locus_tag LOCUS_11020 3877 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 5158 4010 gene locus_tag LOCUS_11030 5158 4010 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064691.1 protein_id gnl|my_center|LOCUS_11030 5573 5148 gene locus_tag LOCUS_11040 5573 5148 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878788.1 protein_id gnl|my_center|LOCUS_11040 6765 5578 gene locus_tag LOCUS_11050 6765 5578 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878787.1 protein_id gnl|my_center|LOCUS_11050 7263 6778 gene locus_tag LOCUS_11060 7263 6778 CDS product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878786.1 protein_id gnl|my_center|LOCUS_11060 8287 7247 gene locus_tag LOCUS_11070 gene meaB 8287 7247 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878785.1 protein_id gnl|my_center|LOCUS_11070 8699 8277 gene locus_tag LOCUS_11080 8699 8277 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878784.1 protein_id gnl|my_center|LOCUS_11080 10388 8709 gene locus_tag LOCUS_11090 10388 8709 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878783.1 protein_id gnl|my_center|LOCUS_11090 10523 12283 gene locus_tag LOCUS_11100 10523 12283 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878782.1 protein_id gnl|my_center|LOCUS_11100 12290 13114 gene locus_tag LOCUS_11110 12290 13114 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846769.1 protein_id gnl|my_center|LOCUS_11110 14719 13124 gene locus_tag LOCUS_11120 14719 13124 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878469.1 protein_id gnl|my_center|LOCUS_11120 14937 14719 gene locus_tag LOCUS_11130 14937 14719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319805.1 protein_id gnl|my_center|LOCUS_11130 15102 16913 gene locus_tag LOCUS_11140 15102 16913 CDS product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878471.1 protein_id gnl|my_center|LOCUS_11140 16913 17530 gene locus_tag LOCUS_11150 16913 17530 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878472.1 protein_id gnl|my_center|LOCUS_11150 17621 18943 gene locus_tag LOCUS_11160 17621 18943 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878473.1 protein_id gnl|my_center|LOCUS_11160 18953 20305 gene locus_tag LOCUS_11170 18953 20305 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878474.1 protein_id gnl|my_center|LOCUS_11170 20329 22248 gene locus_tag LOCUS_11180 20329 22248 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013267177.1 protein_id gnl|my_center|LOCUS_11180 22253 23908 gene locus_tag LOCUS_11190 22253 23908 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878476.1 protein_id gnl|my_center|LOCUS_11190 24313 24762 gene locus_tag LOCUS_11200 24313 24762 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878644.1 protein_id gnl|my_center|LOCUS_11200 25902 24763 gene locus_tag LOCUS_11210 gene argJ 25902 24763 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878643.1 protein_id gnl|my_center|LOCUS_11210 26003 27232 gene locus_tag LOCUS_11220 gene pgk 26003 27232 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064339.1 protein_id gnl|my_center|LOCUS_11220 27351 28778 gene locus_tag LOCUS_11230 27351 28778 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319699.1 protein_id gnl|my_center|LOCUS_11230 28832 30190 gene locus_tag LOCUS_11240 28832 30190 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878640.1 protein_id gnl|my_center|LOCUS_11240 30222 31190 gene locus_tag LOCUS_11250 30222 31190 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590540.1 protein_id gnl|my_center|LOCUS_11250 31187 32410 gene locus_tag LOCUS_11260 31187 32410 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878898.1 protein_id gnl|my_center|LOCUS_11260 32382 32948 gene locus_tag LOCUS_11270 32382 32948 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878897.1 protein_id gnl|my_center|LOCUS_11270 33016 34872 gene locus_tag LOCUS_11280 33016 34872 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878896.1 protein_id gnl|my_center|LOCUS_11280 34872 37319 gene locus_tag LOCUS_11290 34872 37319 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878895.1 protein_id gnl|my_center|LOCUS_11290 37316 38266 gene locus_tag LOCUS_11300 37316 38266 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_11300 38298 39170 gene locus_tag LOCUS_11310 38298 39170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 39192 41489 gene locus_tag LOCUS_11320 39192 41489 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879019.1 protein_id gnl|my_center|LOCUS_11320 41476 41790 gene locus_tag LOCUS_11330 41476 41790 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879020.1 protein_id gnl|my_center|LOCUS_11330 42916 41756 gene locus_tag LOCUS_11340 42916 41756 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064776.1 protein_id gnl|my_center|LOCUS_11340 44277 42913 gene locus_tag LOCUS_11350 44277 42913 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879784.1 protein_id gnl|my_center|LOCUS_11350 46091 44424 gene locus_tag LOCUS_11360 46091 44424 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877907.1 protein_id gnl|my_center|LOCUS_11360 46508 46128 gene locus_tag LOCUS_11370 46508 46128 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878405.1 protein_id gnl|my_center|LOCUS_11370 47979 46501 gene locus_tag LOCUS_11380 47979 46501 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878406.1 protein_id gnl|my_center|LOCUS_11380 49153 48020 gene locus_tag LOCUS_11390 49153 48020 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270475.1 protein_id gnl|my_center|LOCUS_11390 49302 51701 gene locus_tag LOCUS_11400 49302 51701 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878004.1 protein_id gnl|my_center|LOCUS_11400 52202 51690 gene locus_tag LOCUS_11410 gene amzA 52202 51690 CDS product archaemetzincin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877837.1 protein_id gnl|my_center|LOCUS_11410 53374 52199 gene locus_tag LOCUS_11420 53374 52199 CDS product TraB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877838.1 protein_id gnl|my_center|LOCUS_11420 54438 53359 gene locus_tag LOCUS_11430 54438 53359 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877839.1 protein_id gnl|my_center|LOCUS_11430 54590 56062 gene locus_tag LOCUS_11440 54590 56062 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064616.1 protein_id gnl|my_center|LOCUS_11440 56059 56322 gene locus_tag LOCUS_11450 56059 56322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877841.1 protein_id gnl|my_center|LOCUS_11450 56351 57088 gene locus_tag LOCUS_11460 56351 57088 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877842.1 protein_id gnl|my_center|LOCUS_11460 57088 58224 gene locus_tag LOCUS_11470 gene priL 57088 58224 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877843.1 protein_id gnl|my_center|LOCUS_11470 58430 58227 gene locus_tag LOCUS_11480 58430 58227 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877844.1 protein_id gnl|my_center|LOCUS_11480 59144 58626 gene locus_tag LOCUS_11490 59144 58626 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978732.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence13 164 1411 gene locus_tag LOCUS_11500 164 1411 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879732.1 protein_id gnl|my_center|LOCUS_11500 1473 2807 gene locus_tag LOCUS_11510 gene purB 1473 2807 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879731.1 protein_id gnl|my_center|LOCUS_11510 2804 3181 gene locus_tag LOCUS_11520 2804 3181 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064546.1 protein_id gnl|my_center|LOCUS_11520 3587 3393 gene locus_tag LOCUS_11530 3587 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4846 3905 gene locus_tag LOCUS_11540 4846 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 5501 5286 gene locus_tag LOCUS_11550 5501 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 7301 5691 gene locus_tag LOCUS_11560 7301 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 7509 7303 gene locus_tag LOCUS_11570 7509 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 7878 7516 gene locus_tag LOCUS_11580 7878 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 9564 7963 gene locus_tag LOCUS_11590 9564 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 9784 9551 gene locus_tag LOCUS_11600 9784 9551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 10877 9786 gene locus_tag LOCUS_11610 10877 9786 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951745.1 protein_id gnl|my_center|LOCUS_11610 11227 10874 gene locus_tag LOCUS_11620 11227 10874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 11806 11264 gene locus_tag LOCUS_11630 11806 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 12639 11803 gene locus_tag LOCUS_11640 12639 11803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 12925 12644 gene locus_tag LOCUS_11650 12925 12644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 13471 12926 gene locus_tag LOCUS_11660 13471 12926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 16090 13523 gene locus_tag LOCUS_11670 16090 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 16153 16341 gene locus_tag LOCUS_11680 16153 16341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 16343 16744 gene locus_tag LOCUS_11690 16343 16744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 18358 16859 gene locus_tag LOCUS_11700 18358 16859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 18571 18389 gene locus_tag LOCUS_11710 18571 18389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 18831 18568 gene locus_tag LOCUS_11720 18831 18568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 19279 18878 gene locus_tag LOCUS_11730 19279 18878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 20357 19290 gene locus_tag LOCUS_11740 20357 19290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 20951 20616 gene locus_tag LOCUS_11750 20951 20616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 21216 20992 gene locus_tag LOCUS_11760 21216 20992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 21751 21254 gene locus_tag LOCUS_11770 21751 21254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 22192 21755 gene locus_tag LOCUS_11780 22192 21755 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869828.1 protein_id gnl|my_center|LOCUS_11780 22500 22189 gene locus_tag LOCUS_11790 22500 22189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 22909 22619 gene locus_tag LOCUS_11800 22909 22619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 23079 22906 gene locus_tag LOCUS_11810 23079 22906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 23796 23320 gene locus_tag LOCUS_11820 23796 23320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 24081 23797 gene locus_tag LOCUS_11830 24081 23797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 24376 24083 gene locus_tag LOCUS_11840 24376 24083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 24813 24373 gene locus_tag LOCUS_11850 24813 24373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 24984 24820 gene locus_tag LOCUS_11860 24984 24820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 25327 24998 gene locus_tag LOCUS_11870 25327 24998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 26248 25349 gene locus_tag LOCUS_11880 26248 25349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 27610 26249 gene locus_tag LOCUS_11890 27610 26249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 27980 27651 gene locus_tag LOCUS_11900 27980 27651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 29498 28005 gene locus_tag LOCUS_11910 29498 28005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 30684 29500 gene locus_tag LOCUS_11920 30684 29500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 32079 30751 gene locus_tag LOCUS_11930 32079 30751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 32443 32072 gene locus_tag LOCUS_11940 32443 32072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 32638 32919 gene locus_tag LOCUS_11950 32638 32919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 33597 32932 gene locus_tag LOCUS_11960 33597 32932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 34864 33578 gene locus_tag LOCUS_11970 34864 33578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 35012 34851 gene locus_tag LOCUS_11980 35012 34851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 35253 35002 gene locus_tag LOCUS_11990 35253 35002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 35927 35244 gene locus_tag LOCUS_12000 35927 35244 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080803342.1 protein_id gnl|my_center|LOCUS_12000 36750 35965 gene locus_tag LOCUS_12010 36750 35965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 38279 36747 gene locus_tag LOCUS_12020 38279 36747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 39308 38283 gene locus_tag LOCUS_12030 39308 38283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 39504 39295 gene locus_tag LOCUS_12040 39504 39295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 40129 39482 gene locus_tag LOCUS_12050 40129 39482 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869864.1 protein_id gnl|my_center|LOCUS_12050 40566 40126 gene locus_tag LOCUS_12060 40566 40126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 40777 40580 gene locus_tag LOCUS_12070 40777 40580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 41262 40774 gene locus_tag LOCUS_12080 41262 40774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 41966 41262 gene locus_tag LOCUS_12090 41966 41262 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142947.1 protein_id gnl|my_center|LOCUS_12090 42150 41959 gene locus_tag LOCUS_12100 42150 41959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 42520 42278 gene locus_tag LOCUS_12110 42520 42278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 43245 42523 gene locus_tag LOCUS_12120 43245 42523 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877842.1 protein_id gnl|my_center|LOCUS_12120 43520 43242 gene locus_tag LOCUS_12130 43520 43242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 43885 43517 gene locus_tag LOCUS_12140 43885 43517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 44481 43882 gene locus_tag LOCUS_12150 44481 43882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 44747 44478 gene locus_tag LOCUS_12160 44747 44478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 45310 44753 gene locus_tag LOCUS_12170 45310 44753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 45512 45300 gene locus_tag LOCUS_12180 45512 45300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 46579 45488 gene locus_tag LOCUS_12190 46579 45488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 46781 46709 gene locus_tag LOCUS_t00230 46781 46709 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 47509 46826 gene locus_tag LOCUS_12200 47509 46826 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879376.1 protein_id gnl|my_center|LOCUS_12200 48579 47578 gene locus_tag LOCUS_12210 48579 47578 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064482.1 protein_id gnl|my_center|LOCUS_12210 48757 48539 gene locus_tag LOCUS_12220 48757 48539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 48892 48966 gene locus_tag LOCUS_t00240 48892 48966 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 48989 49219 gene locus_tag LOCUS_12230 48989 49219 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296894.1 protein_id gnl|my_center|LOCUS_12230 49255 50793 gene locus_tag LOCUS_12240 49255 50793 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879379.1 protein_id gnl|my_center|LOCUS_12240 50795 52609 gene locus_tag LOCUS_12250 gene rpoB 50795 52609 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879380.1 protein_id gnl|my_center|LOCUS_12250 52621 55224 gene locus_tag LOCUS_12260 52621 55224 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879381.1 protein_id gnl|my_center|LOCUS_12260 55221 56366 gene locus_tag LOCUS_12270 gene rpoA2 55221 56366 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879382.1 protein_id gnl|my_center|LOCUS_12270 56363 56626 gene locus_tag LOCUS_12280 56363 56626 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879383.1 protein_id gnl|my_center|LOCUS_12280 56646 57065 gene locus_tag LOCUS_12290 56646 57065 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879384.1 protein_id gnl|my_center|LOCUS_12290 57071 57499 gene locus_tag LOCUS_12300 57071 57499 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064744.1 protein_id gnl|my_center|LOCUS_12300 57504 58088 gene locus_tag LOCUS_12310 gene rpsG 57504 58088 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879386.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence14 715 149 gene locus_tag LOCUS_12320 715 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274474.1 protein_id gnl|my_center|LOCUS_12320 1452 805 gene locus_tag LOCUS_12330 1452 805 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879673.1 protein_id gnl|my_center|LOCUS_12330 2312 1449 gene locus_tag LOCUS_12340 gene sucD 2312 1449 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879674.1 protein_id gnl|my_center|LOCUS_12340 3450 2314 gene locus_tag LOCUS_12350 gene sucC 3450 2314 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879675.1 protein_id gnl|my_center|LOCUS_12350 3555 4394 gene locus_tag LOCUS_12360 3555 4394 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879330.1 protein_id gnl|my_center|LOCUS_12360 4391 4960 gene locus_tag LOCUS_12370 4391 4960 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879329.1 protein_id gnl|my_center|LOCUS_12370 6027 4957 gene locus_tag LOCUS_12380 6027 4957 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274451.1 protein_id gnl|my_center|LOCUS_12380 6788 6024 gene locus_tag LOCUS_12390 6788 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 7882 6776 gene locus_tag LOCUS_12400 gene nuoH 7882 6776 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591312.1 protein_id gnl|my_center|LOCUS_12400 9124 7892 gene locus_tag LOCUS_12410 9124 7892 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064737.1 protein_id gnl|my_center|LOCUS_12410 10181 9129 gene locus_tag LOCUS_12420 gene nuoB 10181 9129 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064471.1 protein_id gnl|my_center|LOCUS_12420 10548 10174 gene locus_tag LOCUS_12430 gene ndhC 10548 10174 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879323.1 protein_id gnl|my_center|LOCUS_12430 11766 10552 gene locus_tag LOCUS_12440 11766 10552 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064736.1 protein_id gnl|my_center|LOCUS_12440 13718 11763 gene locus_tag LOCUS_12450 13718 11763 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879321.1 protein_id gnl|my_center|LOCUS_12450 15178 13715 gene locus_tag LOCUS_12460 15178 13715 CDS product complex I subunit 5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879320.1 protein_id gnl|my_center|LOCUS_12460 15495 15175 gene locus_tag LOCUS_12470 15495 15175 CDS product F420H(2):quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064470.1 protein_id gnl|my_center|LOCUS_12470 15956 15492 gene locus_tag LOCUS_12480 15956 15492 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879318.1 protein_id gnl|my_center|LOCUS_12480 16844 16029 gene locus_tag LOCUS_12490 16844 16029 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879317.1 protein_id gnl|my_center|LOCUS_12490 17691 16963 gene locus_tag LOCUS_12500 17691 16963 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879916.1 protein_id gnl|my_center|LOCUS_12500 18016 17723 gene locus_tag LOCUS_12510 18016 17723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 17952 18896 gene locus_tag LOCUS_12520 17952 18896 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878294.1 protein_id gnl|my_center|LOCUS_12520 19563 18868 gene locus_tag LOCUS_12530 19563 18868 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318933.1 protein_id gnl|my_center|LOCUS_12530 19677 20303 gene locus_tag LOCUS_12540 19677 20303 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878296.1 protein_id gnl|my_center|LOCUS_12540 21246 20239 gene locus_tag LOCUS_12550 21246 20239 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878297.1 protein_id gnl|my_center|LOCUS_12550 21354 22217 gene locus_tag LOCUS_12560 21354 22217 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878298.1 protein_id gnl|my_center|LOCUS_12560 22232 22837 gene locus_tag LOCUS_12570 22232 22837 CDS product KaiC associated regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064643.1 protein_id gnl|my_center|LOCUS_12570 22977 23849 gene locus_tag LOCUS_12580 gene cofG 22977 23849 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878300.1 protein_id gnl|my_center|LOCUS_12580 23836 24840 gene locus_tag LOCUS_12590 gene cofH 23836 24840 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878301.1 protein_id gnl|my_center|LOCUS_12590 25475 24921 gene locus_tag LOCUS_12600 25475 24921 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878302.1 protein_id gnl|my_center|LOCUS_12600 26722 25463 gene locus_tag LOCUS_12610 gene lysA 26722 25463 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878303.1 protein_id gnl|my_center|LOCUS_12610 27211 26753 gene locus_tag LOCUS_12620 27211 26753 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878304.1 protein_id gnl|my_center|LOCUS_12620 27421 27346 gene locus_tag LOCUS_t00250 27421 27346 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27958 27449 gene locus_tag LOCUS_12630 27958 27449 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878776.1 protein_id gnl|my_center|LOCUS_12630 27991 28578 gene locus_tag LOCUS_12640 27991 28578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064361.1 protein_id gnl|my_center|LOCUS_12640 28601 28906 gene locus_tag LOCUS_12650 28601 28906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878778.1 protein_id gnl|my_center|LOCUS_12650 28930 29361 gene locus_tag LOCUS_12660 gene trxA 28930 29361 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_12660 30416 29358 gene locus_tag LOCUS_12670 30416 29358 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878780.1 protein_id gnl|my_center|LOCUS_12670 30650 32098 gene locus_tag LOCUS_12680 30650 32098 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878099.1 protein_id gnl|my_center|LOCUS_12680 33289 32087 gene locus_tag LOCUS_12690 33289 32087 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147298.1 protein_id gnl|my_center|LOCUS_12690 34209 33286 gene locus_tag LOCUS_12700 34209 33286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 34935 34234 gene locus_tag LOCUS_12710 34935 34234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 35947 34910 gene locus_tag LOCUS_12720 35947 34910 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061496.1 protein_id gnl|my_center|LOCUS_12720 36830 35937 gene locus_tag LOCUS_12730 36830 35937 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_12730 37570 36827 gene locus_tag LOCUS_12740 37570 36827 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061495.1 protein_id gnl|my_center|LOCUS_12740 38575 37583 gene locus_tag LOCUS_12750 38575 37583 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067556.1 protein_id gnl|my_center|LOCUS_12750 39742 38576 gene locus_tag LOCUS_12760 39742 38576 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_12760 40812 39763 gene locus_tag LOCUS_12770 40812 39763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 42825 41920 gene locus_tag LOCUS_12780 gene aglG 42825 41920 CDS product glucosyl-dolichyl phosphate glucuronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289272.1 protein_id gnl|my_center|LOCUS_12780 43675 43274 gene locus_tag LOCUS_12790 43675 43274 CDS product DUF473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878745.1 protein_id gnl|my_center|LOCUS_12790 44387 43620 gene locus_tag LOCUS_12800 44387 43620 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878746.1 protein_id gnl|my_center|LOCUS_12800 45852 44413 gene locus_tag LOCUS_12810 45852 44413 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878747.1 protein_id gnl|my_center|LOCUS_12810 45932 46135 gene locus_tag LOCUS_12820 45932 46135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 46218 46748 gene locus_tag LOCUS_12830 46218 46748 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878749.1 protein_id gnl|my_center|LOCUS_12830 47668 46745 gene locus_tag LOCUS_12840 gene argF 47668 46745 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_12840 48073 47693 gene locus_tag LOCUS_12850 48073 47693 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274411.1 protein_id gnl|my_center|LOCUS_12850 49067 48102 gene locus_tag LOCUS_12860 49067 48102 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878752.1 protein_id gnl|my_center|LOCUS_12860 49372 49064 gene locus_tag LOCUS_12870 gene srp19 49372 49064 CDS product signal recognition particle SRP19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878753.1 protein_id gnl|my_center|LOCUS_12870 50155 49376 gene locus_tag LOCUS_12880 50155 49376 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878754.1 protein_id gnl|my_center|LOCUS_12880 50970 50191 gene locus_tag LOCUS_12890 gene purQ 50970 50191 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878755.1 protein_id gnl|my_center|LOCUS_12890 51127 51384 gene locus_tag LOCUS_12900 51127 51384 CDS product septation protein SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879274.1 protein_id gnl|my_center|LOCUS_12900 51467 52441 gene locus_tag LOCUS_12910 51467 52441 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879275.1 protein_id gnl|my_center|LOCUS_12910 52446 54083 gene locus_tag LOCUS_12920 52446 54083 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879276.1 protein_id gnl|my_center|LOCUS_12920 54118 55386 gene locus_tag LOCUS_12930 54118 55386 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064462.1 protein_id gnl|my_center|LOCUS_12930 55376 55615 gene locus_tag LOCUS_12940 55376 55615 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879278.1 protein_id gnl|my_center|LOCUS_12940 55608 56345 gene locus_tag LOCUS_12950 gene rsmA 55608 56345 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879279.1 protein_id gnl|my_center|LOCUS_12950 56326 56859 gene locus_tag LOCUS_12960 56326 56859 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879280.1 protein_id gnl|my_center|LOCUS_12960 57448 56840 gene locus_tag LOCUS_12970 57448 56840 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879281.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence15 1213 704 gene locus_tag LOCUS_12980 gene cyaB 1213 704 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879480.1 protein_id gnl|my_center|LOCUS_12980 1261 2013 gene locus_tag LOCUS_12990 1261 2013 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879481.1 protein_id gnl|my_center|LOCUS_12990 3896 2241 gene locus_tag LOCUS_13000 gene gltX 3896 2241 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868499.1 protein_id gnl|my_center|LOCUS_13000 3968 5134 gene locus_tag LOCUS_13010 3968 5134 CDS product TIGR00529 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094870.1 protein_id gnl|my_center|LOCUS_13010 6794 5136 gene locus_tag LOCUS_13020 6794 5136 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877773.1 protein_id gnl|my_center|LOCUS_13020 6924 6997 gene locus_tag LOCUS_t00260 6924 6997 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7260 8033 gene locus_tag LOCUS_13030 7260 8033 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064192.1 protein_id gnl|my_center|LOCUS_13030 8008 8982 gene locus_tag LOCUS_13040 8008 8982 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877740.1 protein_id gnl|my_center|LOCUS_13040 8979 9587 gene locus_tag LOCUS_13050 gene aroD 8979 9587 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877739.1 protein_id gnl|my_center|LOCUS_13050 9593 11452 gene locus_tag LOCUS_13060 gene pheA 9593 11452 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683139.1 protein_id gnl|my_center|LOCUS_13060 11922 11455 gene locus_tag LOCUS_13070 11922 11455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 12430 11909 gene locus_tag LOCUS_13080 12430 11909 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_13080 13418 12468 gene locus_tag LOCUS_13090 13418 12468 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274355.1 protein_id gnl|my_center|LOCUS_13090 14269 13415 gene locus_tag LOCUS_13100 14269 13415 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877735.1 protein_id gnl|my_center|LOCUS_13100 15562 14303 gene locus_tag LOCUS_13110 15562 14303 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877734.1 protein_id gnl|my_center|LOCUS_13110 15615 16304 gene locus_tag LOCUS_13120 15615 16304 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096431.1 protein_id gnl|my_center|LOCUS_13120 16285 16965 gene locus_tag LOCUS_13130 16285 16965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877732.1 protein_id gnl|my_center|LOCUS_13130 18534 17026 gene locus_tag LOCUS_13140 18534 17026 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877731.1 protein_id gnl|my_center|LOCUS_13140 18723 20237 gene locus_tag LOCUS_13150 18723 20237 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064191.1 protein_id gnl|my_center|LOCUS_13150 21705 20239 gene locus_tag LOCUS_13160 21705 20239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 22814 21702 gene locus_tag LOCUS_13170 22814 21702 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878673.1 protein_id gnl|my_center|LOCUS_13170 22892 24061 gene locus_tag LOCUS_13180 22892 24061 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877729.1 protein_id gnl|my_center|LOCUS_13180 24058 25194 gene locus_tag LOCUS_13190 24058 25194 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877728.1 protein_id gnl|my_center|LOCUS_13190 25907 25164 gene locus_tag LOCUS_13200 25907 25164 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877727.1 protein_id gnl|my_center|LOCUS_13200 26239 25910 gene locus_tag LOCUS_13210 26239 25910 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877726.1 protein_id gnl|my_center|LOCUS_13210 28350 26275 gene locus_tag LOCUS_13220 28350 26275 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877725.1 protein_id gnl|my_center|LOCUS_13220 28404 29129 gene locus_tag LOCUS_13230 28404 29129 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064189.1 protein_id gnl|my_center|LOCUS_13230 29160 30371 gene locus_tag LOCUS_13240 gene hisD 29160 30371 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877723.1 protein_id gnl|my_center|LOCUS_13240 30495 31211 gene locus_tag LOCUS_13250 gene cas6 30495 31211 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877586.1 protein_id gnl|my_center|LOCUS_13250 31259 32578 gene locus_tag LOCUS_13260 31259 32578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 32568 33452 gene locus_tag LOCUS_13270 gene cas7i 32568 33452 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861770.1 protein_id gnl|my_center|LOCUS_13270 33458 34150 gene locus_tag LOCUS_13280 33458 34150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 34138 36255 gene locus_tag LOCUS_13290 34138 36255 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065767.1 protein_id gnl|my_center|LOCUS_13290 36838 36416 gene locus_tag LOCUS_13300 36838 36416 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846620.1 protein_id gnl|my_center|LOCUS_13300 37124 36819 gene locus_tag LOCUS_13310 37124 36819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 37570 37145 gene locus_tag LOCUS_13320 37570 37145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 37852 37589 gene locus_tag LOCUS_13330 gene cas2 37852 37589 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064580.1 protein_id gnl|my_center|LOCUS_13330 38822 37854 gene locus_tag LOCUS_13340 gene cas1b 38822 37854 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879922.1 protein_id gnl|my_center|LOCUS_13340 39327 38827 gene locus_tag LOCUS_13350 gene cas4 39327 38827 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879923.1 protein_id gnl|my_center|LOCUS_13350 39750 49196 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgaaatcagaccaaagtgggattgaaag 49250 49801 gene locus_tag LOCUS_13360 49250 49801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 49957 50142 gene locus_tag LOCUS_13370 49957 50142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 50139 50789 gene locus_tag LOCUS_13380 50139 50789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 52141 50972 gene locus_tag LOCUS_13390 52141 50972 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064188.1 protein_id gnl|my_center|LOCUS_13390 53255 52188 gene locus_tag LOCUS_13400 53255 52188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 53404 53655 gene locus_tag LOCUS_13410 53404 53655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 55120 53675 gene locus_tag LOCUS_13420 55120 53675 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877720.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence16 520 792 gene locus_tag LOCUS_13430 520 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13430 854 2275 gene locus_tag LOCUS_13440 854 2275 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064393.1 protein_id gnl|my_center|LOCUS_13440 2250 3485 gene locus_tag LOCUS_13450 2250 3485 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878941.1 protein_id gnl|my_center|LOCUS_13450 4099 3482 gene locus_tag LOCUS_13460 4099 3482 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 protein_id gnl|my_center|LOCUS_13460 4010 4240 gene locus_tag LOCUS_13470 4010 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 4283 5395 gene locus_tag LOCUS_13480 gene fbp 4283 5395 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878939.1 protein_id gnl|my_center|LOCUS_13480 5395 5997 gene locus_tag LOCUS_13490 5395 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878938.1 protein_id gnl|my_center|LOCUS_13490 5998 7845 gene locus_tag LOCUS_13500 gene gatE 5998 7845 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878937.1 protein_id gnl|my_center|LOCUS_13500 7885 9000 gene locus_tag LOCUS_13510 7885 9000 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878936.1 protein_id gnl|my_center|LOCUS_13510 8934 9422 gene locus_tag LOCUS_13520 8934 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 9386 10312 gene locus_tag LOCUS_13530 9386 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878934.1 protein_id gnl|my_center|LOCUS_13530 10314 10979 gene locus_tag LOCUS_13540 10314 10979 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878933.1 protein_id gnl|my_center|LOCUS_13540 11977 10976 gene locus_tag LOCUS_13550 gene rtcA 11977 10976 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878932.1 protein_id gnl|my_center|LOCUS_13550 12614 12009 gene locus_tag LOCUS_13560 12614 12009 CDS product DUF4203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878931.1 protein_id gnl|my_center|LOCUS_13560 13234 12689 gene locus_tag LOCUS_13570 13234 12689 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878930.1 protein_id gnl|my_center|LOCUS_13570 13268 13771 gene locus_tag LOCUS_13580 13268 13771 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064391.1 protein_id gnl|my_center|LOCUS_13580 13768 14238 gene locus_tag LOCUS_13590 13768 14238 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878928.1 protein_id gnl|my_center|LOCUS_13590 14348 14593 gene locus_tag LOCUS_13600 14348 14593 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250242.1 protein_id gnl|my_center|LOCUS_13600 14580 14996 gene locus_tag LOCUS_13610 14580 14996 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248971.1 protein_id gnl|my_center|LOCUS_13610 15247 15420 gene locus_tag LOCUS_13620 15247 15420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 15570 15421 gene locus_tag LOCUS_13630 15570 15421 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878927.1 protein_id gnl|my_center|LOCUS_13630 15697 16347 gene locus_tag LOCUS_13640 15697 16347 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878926.1 protein_id gnl|my_center|LOCUS_13640 16488 17966 gene locus_tag LOCUS_13650 16488 17966 CDS product DUF2193 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878925.1 protein_id gnl|my_center|LOCUS_13650 18002 18211 gene locus_tag LOCUS_13660 18002 18211 CDS product DUF2180 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064700.1 protein_id gnl|my_center|LOCUS_13660 18216 18950 gene locus_tag LOCUS_13670 18216 18950 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064390.1 protein_id gnl|my_center|LOCUS_13670 20126 18981 gene locus_tag LOCUS_13680 20126 18981 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878922.1 protein_id gnl|my_center|LOCUS_13680 21766 20123 gene locus_tag LOCUS_13690 gene pheT 21766 20123 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_13690 22100 23089 gene locus_tag LOCUS_13700 22100 23089 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061129.1 protein_id gnl|my_center|LOCUS_13700 23196 23435 gene locus_tag LOCUS_13710 23196 23435 CDS product HgcAB-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877983.1 protein_id gnl|my_center|LOCUS_13710 23432 23995 gene locus_tag LOCUS_13720 23432 23995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13720 23928 24380 gene locus_tag LOCUS_13730 23928 24380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13730 25445 24654 gene locus_tag LOCUS_13740 25445 24654 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878804.1 protein_id gnl|my_center|LOCUS_13740 25525 26316 gene locus_tag LOCUS_13750 25525 26316 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765762.1 protein_id gnl|my_center|LOCUS_13750 26393 27190 gene locus_tag LOCUS_13760 26393 27190 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085668.1 protein_id gnl|my_center|LOCUS_13760 27187 28008 gene locus_tag LOCUS_13770 27187 28008 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878803.1 protein_id gnl|my_center|LOCUS_13770 28572 28009 gene locus_tag LOCUS_13780 28572 28009 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879853.1 protein_id gnl|my_center|LOCUS_13780 29623 28553 gene locus_tag LOCUS_13790 29623 28553 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879852.1 protein_id gnl|my_center|LOCUS_13790 30920 29823 gene locus_tag LOCUS_13800 30920 29823 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096393.1 protein_id gnl|my_center|LOCUS_13800 31654 30890 gene locus_tag LOCUS_13810 31654 30890 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879850.1 protein_id gnl|my_center|LOCUS_13810 32162 31698 gene locus_tag LOCUS_13820 32162 31698 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878419.1 protein_id gnl|my_center|LOCUS_13820 33042 32197 gene locus_tag LOCUS_13830 33042 32197 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868873.1 protein_id gnl|my_center|LOCUS_13830 33932 33039 gene locus_tag LOCUS_13840 gene cofD 33932 33039 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878417.1 protein_id gnl|my_center|LOCUS_13840 35629 33932 gene locus_tag LOCUS_13850 gene glyS 35629 33932 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096515.1 protein_id gnl|my_center|LOCUS_13850 35695 36147 gene locus_tag LOCUS_13860 35695 36147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878415.1 protein_id gnl|my_center|LOCUS_13860 36442 36137 gene locus_tag LOCUS_13870 gene yciH 36442 36137 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878414.1 protein_id gnl|my_center|LOCUS_13870 36673 37137 gene locus_tag LOCUS_13880 36673 37137 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879426.1 protein_id gnl|my_center|LOCUS_13880 38326 37112 gene locus_tag LOCUS_13890 38326 37112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13890 38642 38280 gene locus_tag LOCUS_13900 38642 38280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13900 39044 38688 gene locus_tag LOCUS_13910 39044 38688 CDS product DUF5658 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064372.1 protein_id gnl|my_center|LOCUS_13910 39546 39061 gene locus_tag LOCUS_13920 39546 39061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 39545 40387 gene locus_tag LOCUS_13930 39545 40387 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879599.1 protein_id gnl|my_center|LOCUS_13930 40459 41868 gene locus_tag LOCUS_13940 40459 41868 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256148.1 protein_id gnl|my_center|LOCUS_13940 43289 41865 gene locus_tag LOCUS_13950 43289 41865 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878949.1 protein_id gnl|my_center|LOCUS_13950 43323 44054 gene locus_tag LOCUS_13960 43323 44054 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879601.1 protein_id gnl|my_center|LOCUS_13960 44089 44304 gene locus_tag LOCUS_13970 44089 44304 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877990.1 protein_id gnl|my_center|LOCUS_13970 44352 45488 gene locus_tag LOCUS_13980 gene ribA 44352 45488 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877991.1 protein_id gnl|my_center|LOCUS_13980 45473 46204 gene locus_tag LOCUS_13990 45473 46204 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013682933.1 protein_id gnl|my_center|LOCUS_13990 46188 46592 gene locus_tag LOCUS_14000 46188 46592 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877993.1 protein_id gnl|my_center|LOCUS_14000 46639 47436 gene locus_tag LOCUS_14010 46639 47436 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877622.1 protein_id gnl|my_center|LOCUS_14010 47890 47429 gene locus_tag LOCUS_14020 gene pyrI 47890 47429 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877621.1 protein_id gnl|my_center|LOCUS_14020 48783 47887 gene locus_tag LOCUS_14030 gene pyrB 48783 47887 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064165.1 protein_id gnl|my_center|LOCUS_14030 49791 49351 gene locus_tag LOCUS_14040 49791 49351 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095528.1 protein_id gnl|my_center|LOCUS_14040 49983 49792 gene locus_tag LOCUS_14050 49983 49792 CDS product antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064330.1 protein_id gnl|my_center|LOCUS_14050 50441 50136 gene locus_tag LOCUS_14060 50441 50136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14060 51026 50793 gene locus_tag LOCUS_14070 51026 50793 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_14070 51219 51019 gene locus_tag LOCUS_14080 51219 51019 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250462.1 protein_id gnl|my_center|LOCUS_14080 51456 51304 gene locus_tag LOCUS_14090 51456 51304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 51920 51492 gene locus_tag LOCUS_14100 51920 51492 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878585.1 protein_id gnl|my_center|LOCUS_14100 52102 51920 gene locus_tag LOCUS_14110 52102 51920 CDS product antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878586.1 protein_id gnl|my_center|LOCUS_14110 52698 52540 gene locus_tag LOCUS_14120 52698 52540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 53221 52763 gene locus_tag LOCUS_14130 53221 52763 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052747714.1 protein_id gnl|my_center|LOCUS_14130 53417 53214 gene locus_tag LOCUS_14140 53417 53214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence17 89 1366 gene locus_tag LOCUS_14150 89 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1425 3068 gene locus_tag LOCUS_14160 gene ilvD 1425 3068 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878514.1 protein_id gnl|my_center|LOCUS_14160 3052 3459 gene locus_tag LOCUS_14170 3052 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878513.1 protein_id gnl|my_center|LOCUS_14170 4127 3504 gene locus_tag LOCUS_14180 4127 3504 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879174.1 protein_id gnl|my_center|LOCUS_14180 4240 5607 gene locus_tag LOCUS_14190 4240 5607 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879180.1 protein_id gnl|my_center|LOCUS_14190 5630 6376 gene locus_tag LOCUS_14200 5630 6376 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879181.1 protein_id gnl|my_center|LOCUS_14200 6373 7023 gene locus_tag LOCUS_14210 6373 7023 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879183.1 protein_id gnl|my_center|LOCUS_14210 7440 7015 gene locus_tag LOCUS_14220 7440 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 7535 7834 gene locus_tag LOCUS_14230 7535 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 7882 8415 gene locus_tag LOCUS_14240 7882 8415 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879119.1 protein_id gnl|my_center|LOCUS_14240 8405 9553 gene locus_tag LOCUS_14250 8405 9553 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879120.1 protein_id gnl|my_center|LOCUS_14250 9540 9809 gene locus_tag LOCUS_14260 9540 9809 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879121.1 protein_id gnl|my_center|LOCUS_14260 9869 11602 gene locus_tag LOCUS_14270 9869 11602 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879122.1 protein_id gnl|my_center|LOCUS_14270 11993 11622 gene locus_tag LOCUS_14280 11993 11622 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879186.1 protein_id gnl|my_center|LOCUS_14280 12202 11966 gene locus_tag LOCUS_14290 12202 11966 CDS product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146550.1 protein_id gnl|my_center|LOCUS_14290 12350 12706 gene locus_tag LOCUS_14300 12350 12706 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879082.1 protein_id gnl|my_center|LOCUS_14300 12699 13028 gene locus_tag LOCUS_14310 12699 13028 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879083.1 protein_id gnl|my_center|LOCUS_14310 13809 13036 gene locus_tag LOCUS_14320 13809 13036 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096160.1 protein_id gnl|my_center|LOCUS_14320 15575 13806 gene locus_tag LOCUS_14330 15575 13806 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064494.1 protein_id gnl|my_center|LOCUS_14330 15891 15559 gene locus_tag LOCUS_14340 gene hisI 15891 15559 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879442.1 protein_id gnl|my_center|LOCUS_14340 16005 16247 gene locus_tag LOCUS_14350 gene purS 16005 16247 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879434.1 protein_id gnl|my_center|LOCUS_14350 16252 18552 gene locus_tag LOCUS_14360 gene purL 16252 18552 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879433.1 protein_id gnl|my_center|LOCUS_14360 18618 19445 gene locus_tag LOCUS_14370 18618 19445 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064685.1 protein_id gnl|my_center|LOCUS_14370 19446 20333 gene locus_tag LOCUS_14380 19446 20333 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878686.1 protein_id gnl|my_center|LOCUS_14380 20428 21903 gene locus_tag LOCUS_14390 20428 21903 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878682.1 protein_id gnl|my_center|LOCUS_14390 21910 22296 gene locus_tag LOCUS_14400 21910 22296 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064682.1 protein_id gnl|my_center|LOCUS_14400 23671 22280 gene locus_tag LOCUS_14410 23671 22280 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878680.1 protein_id gnl|my_center|LOCUS_14410 24051 23719 gene locus_tag LOCUS_14420 24051 23719 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878679.1 protein_id gnl|my_center|LOCUS_14420 24398 24051 gene locus_tag LOCUS_14430 24398 24051 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064681.1 protein_id gnl|my_center|LOCUS_14430 25044 24409 gene locus_tag LOCUS_14440 25044 24409 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878677.1 protein_id gnl|my_center|LOCUS_14440 26400 25081 gene locus_tag LOCUS_14450 26400 25081 CDS product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878676.1 protein_id gnl|my_center|LOCUS_14450 27304 26354 gene locus_tag LOCUS_14460 gene mptA 27304 26354 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878675.1 protein_id gnl|my_center|LOCUS_14460 29098 27452 gene locus_tag LOCUS_14470 29098 27452 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_14470 29524 29108 gene locus_tag LOCUS_14480 29524 29108 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879705.1 protein_id gnl|my_center|LOCUS_14480 29646 29521 gene locus_tag LOCUS_14490 29646 29521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 31206 29656 gene locus_tag LOCUS_14500 gene mmdA 31206 29656 CDS product methylmalonyl-CoA decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879706.1 protein_id gnl|my_center|LOCUS_14500 31611 31216 gene locus_tag LOCUS_14510 gene mce 31611 31216 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879707.1 protein_id gnl|my_center|LOCUS_14510 32041 31616 gene locus_tag LOCUS_14520 32041 31616 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879708.1 protein_id gnl|my_center|LOCUS_14520 33741 32119 gene locus_tag LOCUS_14530 33741 32119 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064497.1 protein_id gnl|my_center|LOCUS_14530 34748 33738 gene locus_tag LOCUS_14540 34748 33738 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064498.1 protein_id gnl|my_center|LOCUS_14540 36207 34924 gene locus_tag LOCUS_14550 36207 34924 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877765.1 protein_id gnl|my_center|LOCUS_14550 36320 36412 gene locus_tag LOCUS_t00270 36320 36412 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 36593 37237 gene locus_tag LOCUS_14560 36593 37237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 37234 38064 gene locus_tag LOCUS_14570 37234 38064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14570 39375 38077 gene locus_tag LOCUS_14580 39375 38077 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878362.1 protein_id gnl|my_center|LOCUS_14580 39452 39724 gene locus_tag LOCUS_14590 39452 39724 CDS product NMD3-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208643.1 protein_id gnl|my_center|LOCUS_14590 39721 40665 gene locus_tag LOCUS_14600 39721 40665 CDS product TPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095346.1 protein_id gnl|my_center|LOCUS_14600 41533 40658 gene locus_tag LOCUS_14610 41533 40658 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064299.1 protein_id gnl|my_center|LOCUS_14610 42468 41584 gene locus_tag LOCUS_14620 gene mdh 42468 41584 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878358.1 protein_id gnl|my_center|LOCUS_14620 42961 42500 gene locus_tag LOCUS_14630 42961 42500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012940349.1 protein_id gnl|my_center|LOCUS_14630 43845 42892 gene locus_tag LOCUS_14640 43845 42892 CDS product NOL1/NOP2/sun family putative RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878356.1 protein_id gnl|my_center|LOCUS_14640 45136 43871 gene locus_tag LOCUS_14650 45136 43871 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064652.1 protein_id gnl|my_center|LOCUS_14650 45185 46588 gene locus_tag LOCUS_14660 45185 46588 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878354.1 protein_id gnl|my_center|LOCUS_14660 47595 46585 gene locus_tag LOCUS_14670 47595 46585 CDS product DUF1464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878353.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence18 924 94 gene locus_tag LOCUS_14680 924 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1289 885 gene locus_tag LOCUS_14690 1289 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1452 3821 gene locus_tag LOCUS_14700 1452 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 4248 3859 gene locus_tag LOCUS_14710 4248 3859 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 protein_id gnl|my_center|LOCUS_14710 4750 4229 gene locus_tag LOCUS_14720 4750 4229 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071747924.1 protein_id gnl|my_center|LOCUS_14720 5229 4747 gene locus_tag LOCUS_14730 5229 4747 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393698.1 protein_id gnl|my_center|LOCUS_14730 5714 5226 gene locus_tag LOCUS_14740 5714 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 5922 6386 gene locus_tag LOCUS_14750 5922 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 7014 6790 gene locus_tag LOCUS_14760 7014 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 8693 7407 gene locus_tag LOCUS_14770 8693 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 9117 8680 gene locus_tag LOCUS_14780 9117 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 9456 9127 gene locus_tag LOCUS_14790 9456 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 9573 11258 gene locus_tag LOCUS_14800 9573 11258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 11258 14611 gene locus_tag LOCUS_14810 11258 14611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 15740 14652 gene locus_tag LOCUS_14820 15740 14652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 16866 15808 gene locus_tag LOCUS_14830 16866 15808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 17735 17223 gene locus_tag LOCUS_14840 17735 17223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 17807 18640 gene locus_tag LOCUS_14850 17807 18640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 18637 20499 gene locus_tag LOCUS_14860 18637 20499 CDS product VirB4 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289607.1 protein_id gnl|my_center|LOCUS_14860 20514 23141 gene locus_tag LOCUS_14870 20514 23141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 23132 24175 gene locus_tag LOCUS_14880 23132 24175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 24474 25736 gene locus_tag LOCUS_14890 24474 25736 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064499.1 protein_id gnl|my_center|LOCUS_14890 26066 25737 gene locus_tag LOCUS_14900 26066 25737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064500.1 protein_id gnl|my_center|LOCUS_14900 26108 26509 gene locus_tag LOCUS_14910 gene hjc 26108 26509 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879457.1 protein_id gnl|my_center|LOCUS_14910 26562 27137 gene locus_tag LOCUS_14920 26562 27137 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879458.1 protein_id gnl|my_center|LOCUS_14920 27139 28113 gene locus_tag LOCUS_14930 27139 28113 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879459.1 protein_id gnl|my_center|LOCUS_14930 28849 28073 gene locus_tag LOCUS_14940 28849 28073 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879460.1 protein_id gnl|my_center|LOCUS_14940 28893 29501 gene locus_tag LOCUS_14950 28893 29501 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879461.1 protein_id gnl|my_center|LOCUS_14950 30460 29498 gene locus_tag LOCUS_14960 30460 29498 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879462.1 protein_id gnl|my_center|LOCUS_14960 30894 30505 gene locus_tag LOCUS_14970 30894 30505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 31952 30912 gene locus_tag LOCUS_14980 31952 30912 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878318.1 protein_id gnl|my_center|LOCUS_14980 32443 31949 gene locus_tag LOCUS_14990 32443 31949 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878317.1 protein_id gnl|my_center|LOCUS_14990 32518 34101 gene locus_tag LOCUS_15000 gene serA 32518 34101 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878316.1 protein_id gnl|my_center|LOCUS_15000 34150 35052 gene locus_tag LOCUS_15010 gene manA 34150 35052 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877549.1 protein_id gnl|my_center|LOCUS_15010 36208 35057 gene locus_tag LOCUS_15020 36208 35057 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064155.1 protein_id gnl|my_center|LOCUS_15020 37583 36141 gene locus_tag LOCUS_15030 37583 36141 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296871.1 protein_id gnl|my_center|LOCUS_15030 39743 37851 gene locus_tag LOCUS_15040 39743 37851 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_15040 39891 40340 gene locus_tag LOCUS_15050 39891 40340 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877963.1 protein_id gnl|my_center|LOCUS_15050 41118 40426 gene locus_tag LOCUS_15060 41118 40426 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762274.1 protein_id gnl|my_center|LOCUS_15060 41415 42014 gene locus_tag LOCUS_15070 41415 42014 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877964.1 protein_id gnl|my_center|LOCUS_15070 43346 42009 gene locus_tag LOCUS_15080 gene glmM 43346 42009 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877965.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence19 2192 102 gene locus_tag LOCUS_15090 2192 102 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878656.1 protein_id gnl|my_center|LOCUS_15090 2514 2185 gene locus_tag LOCUS_15100 gene ahaH 2514 2185 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591748.1 protein_id gnl|my_center|LOCUS_15100 2685 4109 gene locus_tag LOCUS_15110 gene purD 2685 4109 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878654.1 protein_id gnl|my_center|LOCUS_15110 4796 4110 gene locus_tag LOCUS_15120 4796 4110 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878652.1 protein_id gnl|my_center|LOCUS_15120 4867 5451 gene locus_tag LOCUS_15130 4867 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878651.1 protein_id gnl|my_center|LOCUS_15130 5448 6536 gene locus_tag LOCUS_15140 5448 6536 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878650.1 protein_id gnl|my_center|LOCUS_15140 7621 6512 gene locus_tag LOCUS_15150 7621 6512 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878649.1 protein_id gnl|my_center|LOCUS_15150 7604 8002 gene locus_tag LOCUS_15160 7604 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878648.1 protein_id gnl|my_center|LOCUS_15160 8333 7983 gene locus_tag LOCUS_15170 8333 7983 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878647.1 protein_id gnl|my_center|LOCUS_15170 8550 8326 gene locus_tag LOCUS_15180 8550 8326 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270479.1 protein_id gnl|my_center|LOCUS_15180 8806 8597 gene locus_tag LOCUS_15190 8806 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 9474 10832 gene locus_tag LOCUS_15200 9474 10832 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868288.1 protein_id gnl|my_center|LOCUS_15200 10829 11347 gene locus_tag LOCUS_15210 gene cysC 10829 11347 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868289.1 protein_id gnl|my_center|LOCUS_15210 14115 11356 gene locus_tag LOCUS_15220 14115 11356 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878645.1 protein_id gnl|my_center|LOCUS_15220 14125 14394 gene locus_tag LOCUS_15230 14125 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 14505 15677 gene locus_tag LOCUS_15240 14505 15677 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022964.1 protein_id gnl|my_center|LOCUS_15240 15682 16836 gene locus_tag LOCUS_15250 15682 16836 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 protein_id gnl|my_center|LOCUS_15250 16840 18621 gene locus_tag LOCUS_15260 gene glmS 16840 18621 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249760.1 protein_id gnl|my_center|LOCUS_15260 18658 19305 gene locus_tag LOCUS_15270 18658 19305 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878772.1 protein_id gnl|my_center|LOCUS_15270 20551 19313 gene locus_tag LOCUS_15280 20551 19313 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878773.1 protein_id gnl|my_center|LOCUS_15280 21315 20551 gene locus_tag LOCUS_15290 21315 20551 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320550.1 protein_id gnl|my_center|LOCUS_15290 22202 21312 gene locus_tag LOCUS_15300 gene argB 22202 21312 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878775.1 protein_id gnl|my_center|LOCUS_15300 22336 24264 gene locus_tag LOCUS_15310 22336 24264 CDS product IGHMBP2 family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878885.1 protein_id gnl|my_center|LOCUS_15310 24959 24261 gene locus_tag LOCUS_15320 24959 24261 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546217.1 protein_id gnl|my_center|LOCUS_15320 25710 24937 gene locus_tag LOCUS_15330 25710 24937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095657.1 protein_id gnl|my_center|LOCUS_15330 27084 25714 gene locus_tag LOCUS_15340 27084 25714 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878888.1 protein_id gnl|my_center|LOCUS_15340 27134 28054 gene locus_tag LOCUS_15350 27134 28054 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496774.1 protein_id gnl|my_center|LOCUS_15350 28030 29061 gene locus_tag LOCUS_15360 28030 29061 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095662.1 protein_id gnl|my_center|LOCUS_15360 29058 29480 gene locus_tag LOCUS_15370 29058 29480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878891.1 protein_id gnl|my_center|LOCUS_15370 29440 30396 gene locus_tag LOCUS_15380 29440 30396 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878892.1 protein_id gnl|my_center|LOCUS_15380 30393 30890 gene locus_tag LOCUS_15390 30393 30890 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878893.1 protein_id gnl|my_center|LOCUS_15390 32528 30891 gene locus_tag LOCUS_15400 32528 30891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 33606 32626 gene locus_tag LOCUS_15410 33606 32626 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_15410 33841 33524 gene locus_tag LOCUS_15420 33841 33524 CDS product H/ACA ribonucleoprotein complex subunit GAR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878795.1 protein_id gnl|my_center|LOCUS_15420 35211 34267 gene locus_tag LOCUS_15430 35211 34267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 35267 35740 gene locus_tag LOCUS_15440 35267 35740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 35795 36535 gene locus_tag LOCUS_15450 35795 36535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 36547 37260 gene locus_tag LOCUS_15460 36547 37260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 39117 37294 gene locus_tag LOCUS_15470 39117 37294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 39411 39118 gene locus_tag LOCUS_15480 39411 39118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 39402 39872 gene locus_tag LOCUS_15490 39402 39872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 40172 40918 gene locus_tag LOCUS_15500 gene tatC 40172 40918 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879009.1 protein_id gnl|my_center|LOCUS_15500 40944 42596 gene locus_tag LOCUS_15510 40944 42596 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879007.1 protein_id gnl|my_center|LOCUS_15510 42617 43405 gene locus_tag LOCUS_15520 42617 43405 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879006.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence20 <1 1230 gene locus_tag LOCUS_15530 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877901.1:D-lactate dehydrogenase 2239 1268 gene locus_tag LOCUS_15540 2239 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2805 2275 gene locus_tag LOCUS_15550 2805 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 4055 3045 gene locus_tag LOCUS_15560 gene amrS 4055 3045 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879767.1 protein_id gnl|my_center|LOCUS_15560 4514 4065 gene locus_tag LOCUS_15570 4514 4065 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270466.1 protein_id gnl|my_center|LOCUS_15570 5575 4514 gene locus_tag LOCUS_15580 gene mqnC 5575 4514 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877897.1 protein_id gnl|my_center|LOCUS_15580 6281 5535 gene locus_tag LOCUS_15590 6281 5535 CDS product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064224.1 protein_id gnl|my_center|LOCUS_15590 7276 6269 gene locus_tag LOCUS_15600 7276 6269 CDS product CofH family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064223.1 protein_id gnl|my_center|LOCUS_15600 8174 7257 gene locus_tag LOCUS_15610 gene aglJ 8174 7257 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877894.1 protein_id gnl|my_center|LOCUS_15610 8761 8174 gene locus_tag LOCUS_15620 8761 8174 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877893.1 protein_id gnl|my_center|LOCUS_15620 9236 8748 gene locus_tag LOCUS_15630 gene nob1 9236 8748 CDS product type II toxin-antitoxin system toxin endoribonuclease Nob1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877892.1 protein_id gnl|my_center|LOCUS_15630 10224 9268 gene locus_tag LOCUS_15640 10224 9268 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877891.1 protein_id gnl|my_center|LOCUS_15640 10169 10624 gene locus_tag LOCUS_15650 10169 10624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 11250 10585 gene locus_tag LOCUS_15660 11250 10585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064222.1 protein_id gnl|my_center|LOCUS_15660 12067 11336 gene locus_tag LOCUS_15670 gene dph5 12067 11336 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877888.1 protein_id gnl|my_center|LOCUS_15670 12132 14717 gene locus_tag LOCUS_15680 gene aglB3 12132 14717 CDS product dolichyl-phosphooligosaccharide-protein glycotransferase AglB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877887.1 protein_id gnl|my_center|LOCUS_15680 14986 16551 gene locus_tag LOCUS_15690 gene cdhC 14986 16551 CDS product CO dehydrogenase/CO-methylating acetyl-CoA synthase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877886.1 protein_id gnl|my_center|LOCUS_15690 16634 17410 gene locus_tag LOCUS_15700 16634 17410 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877885.1 protein_id gnl|my_center|LOCUS_15700 17407 18774 gene locus_tag LOCUS_15710 gene cdhD 17407 18774 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877884.1 protein_id gnl|my_center|LOCUS_15710 18777 20186 gene locus_tag LOCUS_15720 gene acsC 18777 20186 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877883.1 protein_id gnl|my_center|LOCUS_15720 20834 20187 gene locus_tag LOCUS_15730 20834 20187 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877882.1 protein_id gnl|my_center|LOCUS_15730 21625 20837 gene locus_tag LOCUS_15740 21625 20837 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877881.1 protein_id gnl|my_center|LOCUS_15740 22177 21626 gene locus_tag LOCUS_15750 22177 21626 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877880.1 protein_id gnl|my_center|LOCUS_15750 22281 22754 gene locus_tag LOCUS_15760 22281 22754 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877595.1 protein_id gnl|my_center|LOCUS_15760 22782 22887 gene locus_tag LOCUS_r00010 22782 22887 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 24061 22934 gene locus_tag LOCUS_15770 24061 22934 CDS product acetylornithine/succinylornithine family transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877594.1 protein_id gnl|my_center|LOCUS_15770 25380 24091 gene locus_tag LOCUS_15780 25380 24091 CDS product DUF22 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877593.1 protein_id gnl|my_center|LOCUS_15780 25452 26195 gene locus_tag LOCUS_15790 25452 26195 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877592.1 protein_id gnl|my_center|LOCUS_15790 27931 26192 gene locus_tag LOCUS_15800 27931 26192 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877591.1 protein_id gnl|my_center|LOCUS_15800 28338 27928 gene locus_tag LOCUS_15810 28338 27928 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877590.1 protein_id gnl|my_center|LOCUS_15810 29567 28341 gene locus_tag LOCUS_15820 29567 28341 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318502.1 protein_id gnl|my_center|LOCUS_15820 30536 29601 gene locus_tag LOCUS_15830 30536 29601 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877588.1 protein_id gnl|my_center|LOCUS_15830 30594 30670 gene locus_tag LOCUS_t00280 30594 30670 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 30802 31443 gene locus_tag LOCUS_15840 30802 31443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 31554 31471 gene locus_tag LOCUS_t00290 31554 31471 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31628 31969 gene locus_tag LOCUS_15850 31628 31969 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064543.1 protein_id gnl|my_center|LOCUS_15850 31970 33517 gene locus_tag LOCUS_15860 31970 33517 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879681.1 protein_id gnl|my_center|LOCUS_15860 33572 33988 gene locus_tag LOCUS_15870 33572 33988 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064560.1 protein_id gnl|my_center|LOCUS_15870 33988 34284 gene locus_tag LOCUS_15880 33988 34284 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064559.1 protein_id gnl|my_center|LOCUS_15880 34281 35570 gene locus_tag LOCUS_15890 34281 35570 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274480.1 protein_id gnl|my_center|LOCUS_15890 36230 35556 gene locus_tag LOCUS_15900 gene cobS 36230 35556 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879812.1 protein_id gnl|my_center|LOCUS_15900 36893 36237 gene locus_tag LOCUS_15910 36893 36237 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879811.1 protein_id gnl|my_center|LOCUS_15910 37399 36851 gene locus_tag LOCUS_15920 37399 36851 CDS product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879810.1 protein_id gnl|my_center|LOCUS_15920 37452 38087 gene locus_tag LOCUS_15930 37452 38087 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879809.1 protein_id gnl|my_center|LOCUS_15930 38104 38688 gene locus_tag LOCUS_15940 38104 38688 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879808.1 protein_id gnl|my_center|LOCUS_15940 38685 39122 gene locus_tag LOCUS_15950 38685 39122 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879807.1 protein_id gnl|my_center|LOCUS_15950 39107 39718 gene locus_tag LOCUS_15960 39107 39718 CDS product RNase P subunit p30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879806.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence21 890 105 gene locus_tag LOCUS_15970 890 105 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879799.1 protein_id gnl|my_center|LOCUS_15970 977 1966 gene locus_tag LOCUS_15980 977 1966 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867916.1 protein_id gnl|my_center|LOCUS_15980 1970 2467 gene locus_tag LOCUS_15990 1970 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 2497 3747 gene locus_tag LOCUS_16000 2497 3747 CDS product homoaconitate hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879688.1 protein_id gnl|my_center|LOCUS_16000 3744 4109 gene locus_tag LOCUS_16010 3744 4109 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879687.1 protein_id gnl|my_center|LOCUS_16010 4138 5325 gene locus_tag LOCUS_16020 4138 5325 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879686.1 protein_id gnl|my_center|LOCUS_16020 5989 5303 gene locus_tag LOCUS_16030 5989 5303 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879685.1 protein_id gnl|my_center|LOCUS_16030 6082 6990 gene locus_tag LOCUS_16040 6082 6990 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879684.1 protein_id gnl|my_center|LOCUS_16040 6993 7544 gene locus_tag LOCUS_16050 6993 7544 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879683.1 protein_id gnl|my_center|LOCUS_16050 7726 7541 gene locus_tag LOCUS_16060 7726 7541 CDS product DUF5350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879682.1 protein_id gnl|my_center|LOCUS_16060 9624 7804 gene locus_tag LOCUS_16070 9624 7804 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878320.1 protein_id gnl|my_center|LOCUS_16070 9728 9997 gene locus_tag LOCUS_16080 9728 9997 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878321.1 protein_id gnl|my_center|LOCUS_16080 10067 10885 gene locus_tag LOCUS_16090 gene hisF 10067 10885 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878322.1 protein_id gnl|my_center|LOCUS_16090 10924 11208 gene locus_tag LOCUS_16100 10924 11208 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878323.1 protein_id gnl|my_center|LOCUS_16100 11205 12353 gene locus_tag LOCUS_16110 11205 12353 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878324.1 protein_id gnl|my_center|LOCUS_16110 12825 12343 gene locus_tag LOCUS_16120 12825 12343 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879689.1 protein_id gnl|my_center|LOCUS_16120 13135 12929 gene locus_tag LOCUS_16130 13135 12929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 13026 13811 gene locus_tag LOCUS_16140 gene cyoE 13026 13811 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879528.1 protein_id gnl|my_center|LOCUS_16140 13833 15209 gene locus_tag LOCUS_16150 gene serS 13833 15209 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879527.1 protein_id gnl|my_center|LOCUS_16150 16297 15206 gene locus_tag LOCUS_16160 16297 15206 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879526.1 protein_id gnl|my_center|LOCUS_16160 16415 18031 gene locus_tag LOCUS_16170 16415 18031 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879525.1 protein_id gnl|my_center|LOCUS_16170 18249 18037 gene locus_tag LOCUS_16180 18249 18037 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879289.1 protein_id gnl|my_center|LOCUS_16180 18611 18246 gene locus_tag LOCUS_16190 18611 18246 CDS product DUF2178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879123.1 protein_id gnl|my_center|LOCUS_16190 18804 19664 gene locus_tag LOCUS_16200 18804 19664 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879523.1 protein_id gnl|my_center|LOCUS_16200 20241 19636 gene locus_tag LOCUS_16210 20241 19636 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879522.1 protein_id gnl|my_center|LOCUS_16210 21701 20274 gene locus_tag LOCUS_16220 21701 20274 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879521.1 protein_id gnl|my_center|LOCUS_16220 21860 23716 gene locus_tag LOCUS_16230 21860 23716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064516.1 protein_id gnl|my_center|LOCUS_16230 23747 24466 gene locus_tag LOCUS_16240 23747 24466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064515.1 protein_id gnl|my_center|LOCUS_16240 24463 25905 gene locus_tag LOCUS_16250 24463 25905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156029582.1 protein_id gnl|my_center|LOCUS_16250 25910 26446 gene locus_tag LOCUS_16260 25910 26446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274466.1 protein_id gnl|my_center|LOCUS_16260 27463 26438 gene locus_tag LOCUS_16270 gene hisC 27463 26438 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879516.1 protein_id gnl|my_center|LOCUS_16270 28339 27467 gene locus_tag LOCUS_16280 28339 27467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879515.1 protein_id gnl|my_center|LOCUS_16280 28862 28329 gene locus_tag LOCUS_16290 28862 28329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879514.1 protein_id gnl|my_center|LOCUS_16290 29878 28859 gene locus_tag LOCUS_16300 29878 28859 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064754.1 protein_id gnl|my_center|LOCUS_16300 29954 30526 gene locus_tag LOCUS_16310 29954 30526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879512.1 protein_id gnl|my_center|LOCUS_16310 31658 30513 gene locus_tag LOCUS_16320 31658 30513 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064512.1 protein_id gnl|my_center|LOCUS_16320 32385 31651 gene locus_tag LOCUS_16330 32385 31651 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879510.1 protein_id gnl|my_center|LOCUS_16330 33245 32382 gene locus_tag LOCUS_16340 33245 32382 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879509.1 protein_id gnl|my_center|LOCUS_16340 34171 33245 gene locus_tag LOCUS_16350 34171 33245 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879508.1 protein_id gnl|my_center|LOCUS_16350 35819 34173 gene locus_tag LOCUS_16360 35819 34173 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879507.1 protein_id gnl|my_center|LOCUS_16360 37040 35829 gene locus_tag LOCUS_16370 37040 35829 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879506.1 protein_id gnl|my_center|LOCUS_16370 37165 37410 gene locus_tag LOCUS_16380 37165 37410 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878287.1 protein_id gnl|my_center|LOCUS_16380 37951 37367 gene locus_tag LOCUS_16390 37951 37367 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878286.1 protein_id gnl|my_center|LOCUS_16390 38316 37948 gene locus_tag LOCUS_16400 gene sepF 38316 37948 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878285.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence22 121 1281 gene locus_tag LOCUS_16410 121 1281 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878920.1 protein_id gnl|my_center|LOCUS_16410 1337 2017 gene locus_tag LOCUS_16420 1337 2017 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878919.1 protein_id gnl|my_center|LOCUS_16420 2044 4683 gene locus_tag LOCUS_16430 2044 4683 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878918.1 protein_id gnl|my_center|LOCUS_16430 4726 5472 gene locus_tag LOCUS_16440 4726 5472 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878917.1 protein_id gnl|my_center|LOCUS_16440 5498 6316 gene locus_tag LOCUS_16450 5498 6316 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878916.1 protein_id gnl|my_center|LOCUS_16450 6352 6780 gene locus_tag LOCUS_16460 6352 6780 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064389.1 protein_id gnl|my_center|LOCUS_16460 6780 7898 gene locus_tag LOCUS_16470 6780 7898 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878914.1 protein_id gnl|my_center|LOCUS_16470 7895 8356 gene locus_tag LOCUS_16480 gene ribC 7895 8356 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878913.1 protein_id gnl|my_center|LOCUS_16480 8515 10284 gene locus_tag LOCUS_16490 8515 10284 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_16490 10281 11714 gene locus_tag LOCUS_16500 10281 11714 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878911.1 protein_id gnl|my_center|LOCUS_16500 11828 12952 gene locus_tag LOCUS_16510 11828 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183457.1 protein_id gnl|my_center|LOCUS_16510 12963 13187 gene locus_tag LOCUS_16520 12963 13187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 13278 14036 gene locus_tag LOCUS_16530 13278 14036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 14757 14038 gene locus_tag LOCUS_16540 14757 14038 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978111.1 protein_id gnl|my_center|LOCUS_16540 16012 14759 gene locus_tag LOCUS_16550 16012 14759 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_16550 16361 16050 gene locus_tag LOCUS_16560 16361 16050 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878730.1 protein_id gnl|my_center|LOCUS_16560 16752 16345 gene locus_tag LOCUS_16570 16752 16345 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878729.1 protein_id gnl|my_center|LOCUS_16570 17384 16749 gene locus_tag LOCUS_16580 17384 16749 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878728.1 protein_id gnl|my_center|LOCUS_16580 18097 17405 gene locus_tag LOCUS_16590 18097 17405 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878727.1 protein_id gnl|my_center|LOCUS_16590 18163 19974 gene locus_tag LOCUS_16600 18163 19974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 19971 22250 gene locus_tag LOCUS_16610 19971 22250 CDS product hydrophobe/amphiphile efflux-3 (HAE3) family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878724.1 protein_id gnl|my_center|LOCUS_16610 22307 22612 gene locus_tag LOCUS_16620 22307 22612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878723.1 protein_id gnl|my_center|LOCUS_16620 22581 22913 gene locus_tag LOCUS_16630 22581 22913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878722.1 protein_id gnl|my_center|LOCUS_16630 22918 23427 gene locus_tag LOCUS_16640 22918 23427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878721.1 protein_id gnl|my_center|LOCUS_16640 23424 24047 gene locus_tag LOCUS_16650 23424 24047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878720.1 protein_id gnl|my_center|LOCUS_16650 24561 24049 gene locus_tag LOCUS_16660 24561 24049 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064733.1 protein_id gnl|my_center|LOCUS_16660 25506 24574 gene locus_tag LOCUS_16670 25506 24574 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879283.1 protein_id gnl|my_center|LOCUS_16670 26284 25562 gene locus_tag LOCUS_16680 gene mtnP 26284 25562 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879284.1 protein_id gnl|my_center|LOCUS_16680 26907 26281 gene locus_tag LOCUS_16690 26907 26281 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879285.1 protein_id gnl|my_center|LOCUS_16690 28369 26900 gene locus_tag LOCUS_16700 28369 26900 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879286.1 protein_id gnl|my_center|LOCUS_16700 28389 28958 gene locus_tag LOCUS_16710 28389 28958 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879287.1 protein_id gnl|my_center|LOCUS_16710 30565 28955 gene locus_tag LOCUS_16720 gene sepS 30565 28955 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877624.1 protein_id gnl|my_center|LOCUS_16720 30616 30915 gene locus_tag LOCUS_16730 30616 30915 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877623.1 protein_id gnl|my_center|LOCUS_16730 31742 31188 gene locus_tag LOCUS_16740 31742 31188 CDS product ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879690.1 protein_id gnl|my_center|LOCUS_16740 31934 33709 gene locus_tag LOCUS_16750 31934 33709 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064321.1 protein_id gnl|my_center|LOCUS_16750 33710 34900 gene locus_tag LOCUS_16760 33710 34900 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878528.1 protein_id gnl|my_center|LOCUS_16760 34948 36390 gene locus_tag LOCUS_16770 34948 36390 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878527.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence23 146 376 gene locus_tag LOCUS_16780 146 376 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878154.1 protein_id gnl|my_center|LOCUS_16780 373 2184 gene locus_tag LOCUS_16790 gene top6B 373 2184 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878155.1 protein_id gnl|my_center|LOCUS_16790 2530 2186 gene locus_tag LOCUS_16800 2530 2186 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877543.1 protein_id gnl|my_center|LOCUS_16800 3385 2564 gene locus_tag LOCUS_16810 gene speB 3385 2564 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878149.1 protein_id gnl|my_center|LOCUS_16810 3771 3385 gene locus_tag LOCUS_16820 gene eif5A 3771 3385 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878148.1 protein_id gnl|my_center|LOCUS_16820 3870 4118 gene locus_tag LOCUS_16830 3870 4118 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318823.1 protein_id gnl|my_center|LOCUS_16830 4578 4108 gene locus_tag LOCUS_16840 4578 4108 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423253.1 protein_id gnl|my_center|LOCUS_16840 4674 5687 gene locus_tag LOCUS_16850 4674 5687 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064263.1 protein_id gnl|my_center|LOCUS_16850 5684 6430 gene locus_tag LOCUS_16860 5684 6430 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878143.1 protein_id gnl|my_center|LOCUS_16860 6421 7116 gene locus_tag LOCUS_16870 6421 7116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878142.1 protein_id gnl|my_center|LOCUS_16870 8103 7117 gene locus_tag LOCUS_16880 8103 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 8230 9654 gene locus_tag LOCUS_16890 8230 9654 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879747.1 protein_id gnl|my_center|LOCUS_16890 9684 10151 gene locus_tag LOCUS_16900 9684 10151 CDS product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878141.1 protein_id gnl|my_center|LOCUS_16900 10144 12171 gene locus_tag LOCUS_16910 10144 12171 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064637.1 protein_id gnl|my_center|LOCUS_16910 12172 13161 gene locus_tag LOCUS_16920 12172 13161 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_16920 14098 13169 gene locus_tag LOCUS_16930 14098 13169 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878138.1 protein_id gnl|my_center|LOCUS_16930 14168 17224 gene locus_tag LOCUS_16940 gene ileS 14168 17224 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878137.1 protein_id gnl|my_center|LOCUS_16940 18682 17306 gene locus_tag LOCUS_16950 18682 17306 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459733.1 protein_id gnl|my_center|LOCUS_16950 18728 19024 gene locus_tag LOCUS_16960 18728 19024 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878136.1 protein_id gnl|my_center|LOCUS_16960 19026 19442 gene locus_tag LOCUS_16970 19026 19442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878135.1 protein_id gnl|my_center|LOCUS_16970 19439 20032 gene locus_tag LOCUS_16980 19439 20032 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878134.1 protein_id gnl|my_center|LOCUS_16980 20064 20549 gene locus_tag LOCUS_16990 20064 20549 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878133.1 protein_id gnl|my_center|LOCUS_16990 20546 21526 gene locus_tag LOCUS_17000 20546 21526 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878132.1 protein_id gnl|my_center|LOCUS_17000 21559 22581 gene locus_tag LOCUS_17010 21559 22581 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878131.1 protein_id gnl|my_center|LOCUS_17010 23457 22585 gene locus_tag LOCUS_17020 23457 22585 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879847.1 protein_id gnl|my_center|LOCUS_17020 23510 23998 gene locus_tag LOCUS_17030 23510 23998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879848.1 protein_id gnl|my_center|LOCUS_17030 25311 23995 gene locus_tag LOCUS_17040 25311 23995 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879849.1 protein_id gnl|my_center|LOCUS_17040 25761 26072 gene locus_tag LOCUS_17050 25761 26072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 26072 26383 gene locus_tag LOCUS_17060 26072 26383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 26380 27480 gene locus_tag LOCUS_17070 26380 27480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 27507 27779 gene locus_tag LOCUS_17080 27507 27779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 27776 28030 gene locus_tag LOCUS_17090 27776 28030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 28027 28176 gene locus_tag LOCUS_17100 28027 28176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 28166 28399 gene locus_tag LOCUS_17110 28166 28399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 28437 28706 gene locus_tag LOCUS_17120 28437 28706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 28707 29594 gene locus_tag LOCUS_17130 28707 29594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 29638 29865 gene locus_tag LOCUS_17140 29638 29865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 30193 30675 gene locus_tag LOCUS_17150 30193 30675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 30739 31074 gene locus_tag LOCUS_17160 30739 31074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 31046 31522 gene locus_tag LOCUS_17170 31046 31522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 31539 32378 gene locus_tag LOCUS_17180 31539 32378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 32375 32740 gene locus_tag LOCUS_17190 32375 32740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 32730 33671 gene locus_tag LOCUS_17200 32730 33671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 33672 35990 gene locus_tag LOCUS_17210 33672 35990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 35953 36237 gene locus_tag LOCUS_17220 35953 36237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence24 514 188 gene locus_tag LOCUS_17230 514 188 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064662.1 protein_id gnl|my_center|LOCUS_17230 1671 526 gene locus_tag LOCUS_17240 1671 526 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878477.1 protein_id gnl|my_center|LOCUS_17240 1907 3286 gene locus_tag LOCUS_17250 1907 3286 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877758.1 protein_id gnl|my_center|LOCUS_17250 4397 3264 gene locus_tag LOCUS_17260 4397 3264 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064194.1 protein_id gnl|my_center|LOCUS_17260 4927 4397 gene locus_tag LOCUS_17270 4927 4397 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877643.1 protein_id gnl|my_center|LOCUS_17270 5053 6129 gene locus_tag LOCUS_17280 5053 6129 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_17280 6129 6770 gene locus_tag LOCUS_17290 6129 6770 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320172.1 protein_id gnl|my_center|LOCUS_17290 6798 6872 gene locus_tag LOCUS_t00300 6798 6872 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7363 6911 gene locus_tag LOCUS_17300 7363 6911 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 protein_id gnl|my_center|LOCUS_17300 7518 7444 gene locus_tag LOCUS_t00310 7518 7444 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8527 7577 gene locus_tag LOCUS_17310 gene mch 8527 7577 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879428.1 protein_id gnl|my_center|LOCUS_17310 9265 8588 gene locus_tag LOCUS_17320 9265 8588 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879429.1 protein_id gnl|my_center|LOCUS_17320 10048 9305 gene locus_tag LOCUS_17330 10048 9305 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879430.1 protein_id gnl|my_center|LOCUS_17330 10324 11175 gene locus_tag LOCUS_17340 10324 11175 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064459.1 protein_id gnl|my_center|LOCUS_17340 11185 12045 gene locus_tag LOCUS_17350 11185 12045 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879265.1 protein_id gnl|my_center|LOCUS_17350 12045 12989 gene locus_tag LOCUS_17360 12045 12989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879266.1 protein_id gnl|my_center|LOCUS_17360 12989 13960 gene locus_tag LOCUS_17370 12989 13960 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879267.1 protein_id gnl|my_center|LOCUS_17370 14014 14457 gene locus_tag LOCUS_17380 14014 14457 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878603.1 protein_id gnl|my_center|LOCUS_17380 14899 14435 gene locus_tag LOCUS_17390 14899 14435 CDS product rRNA maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878602.1 protein_id gnl|my_center|LOCUS_17390 15471 14887 gene locus_tag LOCUS_17400 15471 14887 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878601.1 protein_id gnl|my_center|LOCUS_17400 16334 15468 gene locus_tag LOCUS_17410 16334 15468 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878600.1 protein_id gnl|my_center|LOCUS_17410 16676 16365 gene locus_tag LOCUS_17420 16676 16365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17420 16919 16680 gene locus_tag LOCUS_17430 16919 16680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17430 18003 16921 gene locus_tag LOCUS_17440 gene aroC 18003 16921 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878173.1 protein_id gnl|my_center|LOCUS_17440 18196 18005 gene locus_tag LOCUS_17450 18196 18005 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878172.1 protein_id gnl|my_center|LOCUS_17450 18451 18260 gene locus_tag LOCUS_17460 18451 18260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 18521 18838 gene locus_tag LOCUS_17470 18521 18838 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095248.1 protein_id gnl|my_center|LOCUS_17470 19426 18839 gene locus_tag LOCUS_17480 19426 18839 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878168.1 protein_id gnl|my_center|LOCUS_17480 20714 19494 gene locus_tag LOCUS_17490 20714 19494 CDS product DUF22 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320281.1 protein_id gnl|my_center|LOCUS_17490 20878 22092 gene locus_tag LOCUS_17500 20878 22092 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878166.1 protein_id gnl|my_center|LOCUS_17500 22097 24337 gene locus_tag LOCUS_17510 22097 24337 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878165.1 protein_id gnl|my_center|LOCUS_17510 24348 25487 gene locus_tag LOCUS_17520 gene qmoC 24348 25487 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878164.1 protein_id gnl|my_center|LOCUS_17520 25504 25779 gene locus_tag LOCUS_17530 25504 25779 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878163.1 protein_id gnl|my_center|LOCUS_17530 25833 27368 gene locus_tag LOCUS_17540 25833 27368 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878162.1 protein_id gnl|my_center|LOCUS_17540 27365 29215 gene locus_tag LOCUS_17550 27365 29215 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878161.1 protein_id gnl|my_center|LOCUS_17550 29187 29624 gene locus_tag LOCUS_17560 29187 29624 CDS product Ig-like domain repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878160.1 protein_id gnl|my_center|LOCUS_17560 30816 29635 gene locus_tag LOCUS_17570 30816 29635 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878159.1 protein_id gnl|my_center|LOCUS_17570 32093 30816 gene locus_tag LOCUS_17580 32093 30816 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878158.1 protein_id gnl|my_center|LOCUS_17580 33494 32094 gene locus_tag LOCUS_17590 33494 32094 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878157.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence25 734 150 gene locus_tag LOCUS_17600 734 150 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878689.1 protein_id gnl|my_center|LOCUS_17600 1179 721 gene locus_tag LOCUS_17610 1179 721 CDS product DUF2240 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064346.1 protein_id gnl|my_center|LOCUS_17610 2629 1181 gene locus_tag LOCUS_17620 2629 1181 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878691.1 protein_id gnl|my_center|LOCUS_17620 3709 2657 gene locus_tag LOCUS_17630 3709 2657 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878692.1 protein_id gnl|my_center|LOCUS_17630 4503 3730 gene locus_tag LOCUS_17640 gene cobB2 4503 3730 CDS product NAD-dependent protein deacylase Cob2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877626.1 protein_id gnl|my_center|LOCUS_17640 4599 5201 gene locus_tag LOCUS_17650 4599 5201 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879389.1 protein_id gnl|my_center|LOCUS_17650 6258 5206 gene locus_tag LOCUS_17660 6258 5206 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879390.1 protein_id gnl|my_center|LOCUS_17660 6341 6712 gene locus_tag LOCUS_17670 6341 6712 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879391.1 protein_id gnl|my_center|LOCUS_17670 6795 7967 gene locus_tag LOCUS_17680 gene dnaG 6795 7967 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879392.1 protein_id gnl|my_center|LOCUS_17680 8516 7980 gene locus_tag LOCUS_17690 8516 7980 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879393.1 protein_id gnl|my_center|LOCUS_17690 9186 8518 gene locus_tag LOCUS_17700 9186 8518 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879394.1 protein_id gnl|my_center|LOCUS_17700 10664 9183 gene locus_tag LOCUS_17710 gene secY 10664 9183 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319363.1 protein_id gnl|my_center|LOCUS_17710 11209 10679 gene locus_tag LOCUS_17720 11209 10679 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270492.1 protein_id gnl|my_center|LOCUS_17720 11673 11215 gene locus_tag LOCUS_17730 gene rpmD 11673 11215 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879397.1 protein_id gnl|my_center|LOCUS_17730 12274 11675 gene locus_tag LOCUS_17740 gene rpsE 12274 11675 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879398.1 protein_id gnl|my_center|LOCUS_17740 12834 12271 gene locus_tag LOCUS_17750 12834 12271 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319359.1 protein_id gnl|my_center|LOCUS_17750 13279 12839 gene locus_tag LOCUS_17760 13279 12839 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546237.1 protein_id gnl|my_center|LOCUS_17760 13674 13285 gene locus_tag LOCUS_17770 13674 13285 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879401.1 protein_id gnl|my_center|LOCUS_17770 14241 13684 gene locus_tag LOCUS_17780 14241 13684 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319356.1 protein_id gnl|my_center|LOCUS_17780 14614 14225 gene locus_tag LOCUS_17790 14614 14225 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064747.1 protein_id gnl|my_center|LOCUS_17790 14775 14620 gene locus_tag LOCUS_17800 14775 14620 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879404.1 protein_id gnl|my_center|LOCUS_17800 15317 14772 gene locus_tag LOCUS_17810 15317 14772 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879405.1 protein_id gnl|my_center|LOCUS_17810 16029 15331 gene locus_tag LOCUS_17820 16029 15331 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879406.1 protein_id gnl|my_center|LOCUS_17820 16397 16035 gene locus_tag LOCUS_17830 gene rplX 16397 16035 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879407.1 protein_id gnl|my_center|LOCUS_17830 16805 16407 gene locus_tag LOCUS_17840 gene rpl14p 16805 16407 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879408.1 protein_id gnl|my_center|LOCUS_17840 17121 16786 gene locus_tag LOCUS_17850 17121 16786 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879409.1 protein_id gnl|my_center|LOCUS_17850 17426 17118 gene locus_tag LOCUS_17860 gene rnp1 17426 17118 CDS product ribonuclease P component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879410.1 protein_id gnl|my_center|LOCUS_17860 17599 17402 gene locus_tag LOCUS_17870 gene rpmC 17599 17402 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064484.1 protein_id gnl|my_center|LOCUS_17870 18218 17529 gene locus_tag LOCUS_17880 18218 17529 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879412.1 protein_id gnl|my_center|LOCUS_17880 18679 18218 gene locus_tag LOCUS_17890 gene rplV 18679 18218 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064485.1 protein_id gnl|my_center|LOCUS_17890 19086 18685 gene locus_tag LOCUS_17900 gene rpsS 19086 18685 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879414.1 protein_id gnl|my_center|LOCUS_17900 19804 19091 gene locus_tag LOCUS_17910 19804 19091 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879415.1 protein_id gnl|my_center|LOCUS_17910 20061 19816 gene locus_tag LOCUS_17920 20061 19816 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064486.1 protein_id gnl|my_center|LOCUS_17920 20813 20055 gene locus_tag LOCUS_17930 gene rpl4p 20813 20055 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879417.1 protein_id gnl|my_center|LOCUS_17930 21811 20816 gene locus_tag LOCUS_17940 gene rpl3p 21811 20816 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_17940 22578 21808 gene locus_tag LOCUS_17950 22578 21808 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879419.1 protein_id gnl|my_center|LOCUS_17950 22735 23103 gene locus_tag LOCUS_17960 22735 23103 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879421.1 protein_id gnl|my_center|LOCUS_17960 23103 24368 gene locus_tag LOCUS_17970 23103 24368 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879422.1 protein_id gnl|my_center|LOCUS_17970 24374 26062 gene locus_tag LOCUS_17980 24374 26062 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879423.1 protein_id gnl|my_center|LOCUS_17980 26076 26780 gene locus_tag LOCUS_17990 26076 26780 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270512.1 protein_id gnl|my_center|LOCUS_17990 28170 26830 gene locus_tag LOCUS_18000 28170 26830 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868347.1 protein_id gnl|my_center|LOCUS_18000 29074 28364 gene locus_tag LOCUS_18010 29074 28364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 28974 29234 gene locus_tag LOCUS_18020 28974 29234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 29301 29456 gene locus_tag LOCUS_18030 29301 29456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 30888 30508 gene locus_tag LOCUS_18040 30888 30508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 31133 30888 gene locus_tag LOCUS_18050 31133 30888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence26 1022 114 gene locus_tag LOCUS_18060 gene trxB 1022 114 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879051.1 protein_id gnl|my_center|LOCUS_18060 1327 1512 gene locus_tag LOCUS_18070 1327 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1782 1961 gene locus_tag LOCUS_18080 1782 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2758 2534 gene locus_tag LOCUS_18090 2758 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 3501 2773 gene locus_tag LOCUS_18100 3501 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 4133 3504 gene locus_tag LOCUS_18110 4133 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 4157 4852 gene locus_tag LOCUS_18120 4157 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 5002 4856 gene locus_tag LOCUS_18130 5002 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 6666 5437 gene locus_tag LOCUS_18140 6666 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 7598 6666 gene locus_tag LOCUS_18150 gene dph2 7598 6666 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879298.1 protein_id gnl|my_center|LOCUS_18150 7648 8424 gene locus_tag LOCUS_18160 gene rio1 7648 8424 CDS product RIO-type serine/threonine-protein kinase Rio1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879299.1 protein_id gnl|my_center|LOCUS_18160 8427 8963 gene locus_tag LOCUS_18170 8427 8963 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096095.1 protein_id gnl|my_center|LOCUS_18170 8960 10945 gene locus_tag LOCUS_18180 8960 10945 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683176.1 protein_id gnl|my_center|LOCUS_18180 11204 10947 gene locus_tag LOCUS_18190 11204 10947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 11627 11322 gene locus_tag LOCUS_18200 11627 11322 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879302.1 protein_id gnl|my_center|LOCUS_18200 11644 11982 gene locus_tag LOCUS_18210 11644 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 11984 13135 gene locus_tag LOCUS_18220 11984 13135 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867675.1 protein_id gnl|my_center|LOCUS_18220 13147 13602 gene locus_tag LOCUS_18230 13147 13602 CDS product inosine monophosphate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879306.1 protein_id gnl|my_center|LOCUS_18230 13589 14122 gene locus_tag LOCUS_18240 13589 14122 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879307.1 protein_id gnl|my_center|LOCUS_18240 14217 15326 gene locus_tag LOCUS_18250 14217 15326 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064762.1 protein_id gnl|my_center|LOCUS_18250 17761 15341 gene locus_tag LOCUS_18260 17761 15341 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197030926.1 protein_id gnl|my_center|LOCUS_18260 17821 19002 gene locus_tag LOCUS_18270 gene larC 17821 19002 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879588.1 protein_id gnl|my_center|LOCUS_18270 18980 19639 gene locus_tag LOCUS_18280 gene radB 18980 19639 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320585.1 protein_id gnl|my_center|LOCUS_18280 19987 19640 gene locus_tag LOCUS_18290 gene pth2 19987 19640 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879586.1 protein_id gnl|my_center|LOCUS_18290 20275 20006 gene locus_tag LOCUS_18300 20275 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879585.1 protein_id gnl|my_center|LOCUS_18300 20520 20311 gene locus_tag LOCUS_18310 20520 20311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 21116 20598 gene locus_tag LOCUS_18320 21116 20598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 21622 21113 gene locus_tag LOCUS_18330 21622 21113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 21711 23441 gene locus_tag LOCUS_18340 21711 23441 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_18340 23438 24649 gene locus_tag LOCUS_18350 23438 24649 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879592.1 protein_id gnl|my_center|LOCUS_18350 25796 24639 gene locus_tag LOCUS_18360 25796 24639 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318704.1 protein_id gnl|my_center|LOCUS_18360 26491 26039 gene locus_tag LOCUS_18370 26491 26039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 27524 26472 gene locus_tag LOCUS_18380 27524 26472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 27776 28567 gene locus_tag LOCUS_18390 27776 28567 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274445.1 protein_id gnl|my_center|LOCUS_18390 28796 28996 gene locus_tag LOCUS_18400 28796 28996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 28993 29802 gene locus_tag LOCUS_18410 28993 29802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence27 138 620 gene locus_tag LOCUS_18420 138 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 699 3086 gene locus_tag LOCUS_18430 699 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 3124 3657 gene locus_tag LOCUS_18440 3124 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3686 4060 gene locus_tag LOCUS_18450 3686 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 4088 5056 gene locus_tag LOCUS_18460 4088 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 5068 5592 gene locus_tag LOCUS_18470 5068 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 5638 5961 gene locus_tag LOCUS_18480 gene trxA 5638 5961 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_18480 6630 6319 gene locus_tag LOCUS_18490 6630 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 7240 6965 gene locus_tag LOCUS_18500 7240 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 8436 7318 gene locus_tag LOCUS_18510 8436 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 9964 8420 gene locus_tag LOCUS_18520 9964 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 10226 9978 gene locus_tag LOCUS_18530 10226 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 11127 10486 gene locus_tag LOCUS_18540 11127 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18540 11276 11121 gene locus_tag LOCUS_18550 11276 11121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 11751 11239 gene locus_tag LOCUS_18560 11751 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 12064 12231 gene locus_tag LOCUS_18570 12064 12231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 13008 12331 gene locus_tag LOCUS_18580 13008 12331 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021381.1 protein_id gnl|my_center|LOCUS_18580 14002 12992 gene locus_tag LOCUS_18590 14002 12992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250153.1 protein_id gnl|my_center|LOCUS_18590 14475 14008 gene locus_tag LOCUS_18600 14475 14008 CDS product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250154.1 protein_id gnl|my_center|LOCUS_18600 15815 14472 gene locus_tag LOCUS_18610 15815 14472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 18058 15812 gene locus_tag LOCUS_18620 18058 15812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 18885 18187 gene locus_tag LOCUS_18630 18885 18187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 19748 18864 gene locus_tag LOCUS_18640 19748 18864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 21255 19723 gene locus_tag LOCUS_18650 21255 19723 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868685.1 protein_id gnl|my_center|LOCUS_18650 23841 21271 gene locus_tag LOCUS_18660 gene rad50 23841 21271 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846723.1 protein_id gnl|my_center|LOCUS_18660 25069 23951 gene locus_tag LOCUS_18670 25069 23951 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870840.1 protein_id gnl|my_center|LOCUS_18670 26640 25066 gene locus_tag LOCUS_18680 26640 25066 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583972.1 protein_id gnl|my_center|LOCUS_18680 27904 26624 gene locus_tag LOCUS_18690 27904 26624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 28593 27889 gene locus_tag LOCUS_18700 28593 27889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 >Feature sequence28 <1 621 gene locus_tag LOCUS_18710 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877639.1:sulfite exporter TauE/SafE family protein 1222 695 gene locus_tag LOCUS_18720 1222 695 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877637.1 protein_id gnl|my_center|LOCUS_18720 1301 2236 gene locus_tag LOCUS_18730 1301 2236 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877636.1 protein_id gnl|my_center|LOCUS_18730 2236 2643 gene locus_tag LOCUS_18740 2236 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274344.1 protein_id gnl|my_center|LOCUS_18740 3978 2644 gene locus_tag LOCUS_18750 3978 2644 CDS product DUF22 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320281.1 protein_id gnl|my_center|LOCUS_18750 5349 4030 gene locus_tag LOCUS_18760 5349 4030 CDS product DUF22 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320281.1 protein_id gnl|my_center|LOCUS_18760 5523 6596 gene locus_tag LOCUS_18770 5523 6596 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879917.1 protein_id gnl|my_center|LOCUS_18770 7078 6593 gene locus_tag LOCUS_18780 7078 6593 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879918.1 protein_id gnl|my_center|LOCUS_18780 7388 7146 gene locus_tag LOCUS_18790 7388 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064428.1 protein_id gnl|my_center|LOCUS_18790 7688 8581 gene locus_tag LOCUS_18800 7688 8581 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879129.1 protein_id gnl|my_center|LOCUS_18800 8596 9267 gene locus_tag LOCUS_18810 8596 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064429.1 protein_id gnl|my_center|LOCUS_18810 9330 10169 gene locus_tag LOCUS_18820 9330 10169 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064160.1 protein_id gnl|my_center|LOCUS_18820 10733 10143 gene locus_tag LOCUS_18830 gene tmk 10733 10143 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877575.1 protein_id gnl|my_center|LOCUS_18830 11008 10754 gene locus_tag LOCUS_18840 11008 10754 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877574.1 protein_id gnl|my_center|LOCUS_18840 11128 11538 gene locus_tag LOCUS_18850 11128 11538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877573.1 protein_id gnl|my_center|LOCUS_18850 11505 12041 gene locus_tag LOCUS_18860 11505 12041 CDS product PUA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877572.1 protein_id gnl|my_center|LOCUS_18860 12058 12333 gene locus_tag LOCUS_18870 gene rpl37A 12058 12333 CDS product 50S ribosomal protein L37Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877571.1 protein_id gnl|my_center|LOCUS_18870 12337 12477 gene locus_tag LOCUS_18880 12337 12477 CDS product DNA-directed RNA polymerase subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877570.1 protein_id gnl|my_center|LOCUS_18880 12498 12896 gene locus_tag LOCUS_18890 12498 12896 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877569.1 protein_id gnl|my_center|LOCUS_18890 12893 13906 gene locus_tag LOCUS_18900 12893 13906 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020301.1 protein_id gnl|my_center|LOCUS_18900 14235 13909 gene locus_tag LOCUS_18910 14235 13909 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878674.1 protein_id gnl|my_center|LOCUS_18910 14332 14883 gene locus_tag LOCUS_18920 14332 14883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18920 14955 15377 gene locus_tag LOCUS_18930 14955 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18930 15374 15865 gene locus_tag LOCUS_18940 15374 15865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 17393 15990 gene locus_tag LOCUS_18950 gene cobQ 17393 15990 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878835.1 protein_id gnl|my_center|LOCUS_18950 17960 17436 gene locus_tag LOCUS_18960 gene rplJ 17960 17436 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_18960 19117 17999 gene locus_tag LOCUS_18970 19117 17999 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878837.1 protein_id gnl|my_center|LOCUS_18970 20630 19119 gene locus_tag LOCUS_18980 20630 19119 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878838.1 protein_id gnl|my_center|LOCUS_18980 22147 20630 gene locus_tag LOCUS_18990 22147 20630 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878839.1 protein_id gnl|my_center|LOCUS_18990 23134 22223 gene locus_tag LOCUS_19000 23134 22223 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878947.1 protein_id gnl|my_center|LOCUS_19000 25458 23131 gene locus_tag LOCUS_19010 25458 23131 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319769.1 protein_id gnl|my_center|LOCUS_19010 25529 26452 gene locus_tag LOCUS_19020 25529 26452 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878840.1 protein_id gnl|my_center|LOCUS_19020 26483 27379 gene locus_tag LOCUS_19030 26483 27379 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878841.1 protein_id gnl|my_center|LOCUS_19030 27571 27284 gene locus_tag LOCUS_19040 27571 27284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence29 80 283 gene locus_tag LOCUS_19050 80 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 280 1713 gene locus_tag LOCUS_19060 280 1713 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879313.1 protein_id gnl|my_center|LOCUS_19060 1710 2405 gene locus_tag LOCUS_19070 1710 2405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879314.1 protein_id gnl|my_center|LOCUS_19070 2389 4719 gene locus_tag LOCUS_19080 2389 4719 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879315.1 protein_id gnl|my_center|LOCUS_19080 4921 4721 gene locus_tag LOCUS_19090 4921 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 5204 4923 gene locus_tag LOCUS_19100 5204 4923 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878830.1 protein_id gnl|my_center|LOCUS_19100 5730 5182 gene locus_tag LOCUS_19110 5730 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878829.1 protein_id gnl|my_center|LOCUS_19110 5803 6795 gene locus_tag LOCUS_19120 5803 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 protein_id gnl|my_center|LOCUS_19120 6792 7802 gene locus_tag LOCUS_19130 gene amrS 6792 7802 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878827.1 protein_id gnl|my_center|LOCUS_19130 8485 7784 gene locus_tag LOCUS_19140 8485 7784 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878826.1 protein_id gnl|my_center|LOCUS_19140 9840 8479 gene locus_tag LOCUS_19150 9840 8479 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878825.1 protein_id gnl|my_center|LOCUS_19150 9916 10551 gene locus_tag LOCUS_19160 9916 10551 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591675.1 protein_id gnl|my_center|LOCUS_19160 10544 10846 gene locus_tag LOCUS_19170 10544 10846 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879250.1 protein_id gnl|my_center|LOCUS_19170 11129 11320 gene locus_tag LOCUS_19180 11129 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 11749 11420 gene locus_tag LOCUS_19190 11749 11420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 12060 12389 gene locus_tag LOCUS_19200 12060 12389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 12349 12957 gene locus_tag LOCUS_19210 12349 12957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 13431 13844 gene locus_tag LOCUS_19220 13431 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19220 13894 14388 gene locus_tag LOCUS_19230 13894 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19230 14486 14707 gene locus_tag LOCUS_19240 14486 14707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19240 14695 15045 gene locus_tag LOCUS_19250 14695 15045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 15083 15280 gene locus_tag LOCUS_19260 15083 15280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 15295 16761 gene locus_tag LOCUS_19270 gene xylB 15295 16761 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270490.1 protein_id gnl|my_center|LOCUS_19270 16818 18047 gene locus_tag LOCUS_19280 16818 18047 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879247.1 protein_id gnl|my_center|LOCUS_19280 18123 19856 gene locus_tag LOCUS_19290 18123 19856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878412.1 protein_id gnl|my_center|LOCUS_19290 21259 19859 gene locus_tag LOCUS_19300 21259 19859 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877864.1 protein_id gnl|my_center|LOCUS_19300 22589 21237 gene locus_tag LOCUS_19310 22589 21237 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064221.1 protein_id gnl|my_center|LOCUS_19310 22745 23638 gene locus_tag LOCUS_19320 22745 23638 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079210.1 protein_id gnl|my_center|LOCUS_19320 25620 23824 gene locus_tag LOCUS_19330 25620 23824 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877847.1 protein_id gnl|my_center|LOCUS_19330 26772 25630 gene locus_tag LOCUS_19340 26772 25630 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064618.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence30 346 1950 gene locus_tag LOCUS_19350 346 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1859 2128 gene locus_tag LOCUS_19360 1859 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 3522 2248 gene locus_tag LOCUS_19370 3522 2248 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878693.1 protein_id gnl|my_center|LOCUS_19370 4108 3560 gene locus_tag LOCUS_19380 4108 3560 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878709.1 protein_id gnl|my_center|LOCUS_19380 5286 4108 gene locus_tag LOCUS_19390 5286 4108 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064350.1 protein_id gnl|my_center|LOCUS_19390 5418 6908 gene locus_tag LOCUS_19400 gene lysS 5418 6908 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878711.1 protein_id gnl|my_center|LOCUS_19400 6895 7878 gene locus_tag LOCUS_19410 6895 7878 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064351.1 protein_id gnl|my_center|LOCUS_19410 7888 8181 gene locus_tag LOCUS_19420 7888 8181 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878713.1 protein_id gnl|my_center|LOCUS_19420 8178 8939 gene locus_tag LOCUS_19430 gene uppS 8178 8939 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878714.1 protein_id gnl|my_center|LOCUS_19430 8939 10156 gene locus_tag LOCUS_19440 gene prf1 8939 10156 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878715.1 protein_id gnl|my_center|LOCUS_19440 10345 11865 gene locus_tag LOCUS_19450 10345 11865 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274408.1 protein_id gnl|my_center|LOCUS_19450 12675 11848 gene locus_tag LOCUS_19460 12675 11848 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878718.1 protein_id gnl|my_center|LOCUS_19460 13220 12672 gene locus_tag LOCUS_19470 13220 12672 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878719.1 protein_id gnl|my_center|LOCUS_19470 13321 14064 gene locus_tag LOCUS_19480 13321 14064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 14392 15150 gene locus_tag LOCUS_19490 14392 15150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 15140 15517 gene locus_tag LOCUS_19500 15140 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 15913 16662 gene locus_tag LOCUS_19510 15913 16662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 16652 16846 gene locus_tag LOCUS_19520 16652 16846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 17294 16857 gene locus_tag LOCUS_19530 17294 16857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 18018 17302 gene locus_tag LOCUS_19540 18018 17302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19540 18212 19501 gene locus_tag LOCUS_19550 18212 19501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 19508 19945 gene locus_tag LOCUS_19560 19508 19945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 19951 20592 gene locus_tag LOCUS_19570 19951 20592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 20607 21038 gene locus_tag LOCUS_19580 20607 21038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879653.1 protein_id gnl|my_center|LOCUS_19580 21219 22421 gene locus_tag LOCUS_19590 21219 22421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156029564.1 protein_id gnl|my_center|LOCUS_19590 22454 23719 gene locus_tag LOCUS_19600 22454 23719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156029564.1 protein_id gnl|my_center|LOCUS_19600 23758 24948 gene locus_tag LOCUS_19610 23758 24948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156029564.1 protein_id gnl|my_center|LOCUS_19610 25089 25343 gene locus_tag LOCUS_19620 25089 25343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 25436 25639 gene locus_tag LOCUS_19630 25436 25639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence31 1222 107 gene locus_tag LOCUS_19640 1222 107 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878822.1 protein_id gnl|my_center|LOCUS_19640 1302 2828 gene locus_tag LOCUS_19650 1302 2828 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878821.1 protein_id gnl|my_center|LOCUS_19650 4193 2817 gene locus_tag LOCUS_19660 4193 2817 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274415.1 protein_id gnl|my_center|LOCUS_19660 4354 5838 gene locus_tag LOCUS_19670 4354 5838 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878819.1 protein_id gnl|my_center|LOCUS_19670 5835 6701 gene locus_tag LOCUS_19680 5835 6701 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878818.1 protein_id gnl|my_center|LOCUS_19680 7253 6702 gene locus_tag LOCUS_19690 7253 6702 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878817.1 protein_id gnl|my_center|LOCUS_19690 7850 7278 gene locus_tag LOCUS_19700 7850 7278 CDS product eight-cysteine-cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878816.1 protein_id gnl|my_center|LOCUS_19700 9146 7956 gene locus_tag LOCUS_19710 gene thrC 9146 7956 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878813.1 protein_id gnl|my_center|LOCUS_19710 9196 10191 gene locus_tag LOCUS_19720 9196 10191 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878812.1 protein_id gnl|my_center|LOCUS_19720 10193 10846 gene locus_tag LOCUS_19730 10193 10846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878811.1 protein_id gnl|my_center|LOCUS_19730 11585 10833 gene locus_tag LOCUS_19740 11585 10833 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095636.1 protein_id gnl|my_center|LOCUS_19740 12502 11639 gene locus_tag LOCUS_19750 12502 11639 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_19750 12600 13610 gene locus_tag LOCUS_19760 12600 13610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 13615 14115 gene locus_tag LOCUS_19770 13615 14115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064284.1 protein_id gnl|my_center|LOCUS_19770 14103 14510 gene locus_tag LOCUS_19780 14103 14510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 14507 17068 gene locus_tag LOCUS_19790 14507 17068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878263.1 protein_id gnl|my_center|LOCUS_19790 17079 17744 gene locus_tag LOCUS_19800 17079 17744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095282.1 protein_id gnl|my_center|LOCUS_19800 17741 18487 gene locus_tag LOCUS_19810 17741 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 18987 18484 gene locus_tag LOCUS_19820 gene tfe 18987 18484 CDS product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878260.1 protein_id gnl|my_center|LOCUS_19820 20054 19086 gene locus_tag LOCUS_19830 20054 19086 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878259.1 protein_id gnl|my_center|LOCUS_19830 20337 21614 gene locus_tag LOCUS_19840 20337 21614 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878256.1 protein_id gnl|my_center|LOCUS_19840 21755 22726 gene locus_tag LOCUS_19850 21755 22726 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053875.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence32 455 640 gene locus_tag LOCUS_19860 455 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1198 809 gene locus_tag LOCUS_19870 1198 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 1404 1195 gene locus_tag LOCUS_19880 1404 1195 CDS product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878978.1 protein_id gnl|my_center|LOCUS_19880 1920 2273 gene locus_tag LOCUS_19890 1920 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 2742 2317 gene locus_tag LOCUS_19900 2742 2317 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979870.1 protein_id gnl|my_center|LOCUS_19900 2935 2723 gene locus_tag LOCUS_19910 2935 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 3218 3817 gene locus_tag LOCUS_19920 3218 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 3890 4276 gene locus_tag LOCUS_19930 3890 4276 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879111.1 protein_id gnl|my_center|LOCUS_19930 4273 4614 gene locus_tag LOCUS_19940 4273 4614 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879110.1 protein_id gnl|my_center|LOCUS_19940 5087 5266 gene locus_tag LOCUS_19950 5087 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 5827 5270 gene locus_tag LOCUS_19960 5827 5270 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879609.1 protein_id gnl|my_center|LOCUS_19960 6723 5851 gene locus_tag LOCUS_19970 6723 5851 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274470.1 protein_id gnl|my_center|LOCUS_19970 6897 8180 gene locus_tag LOCUS_19980 gene gatB 6897 8180 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064531.1 protein_id gnl|my_center|LOCUS_19980 8177 9142 gene locus_tag LOCUS_19990 8177 9142 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879606.1 protein_id gnl|my_center|LOCUS_19990 9142 9984 gene locus_tag LOCUS_20000 9142 9984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879605.1 protein_id gnl|my_center|LOCUS_20000 9984 11450 gene locus_tag LOCUS_20010 9984 11450 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023977.1 protein_id gnl|my_center|LOCUS_20010 11480 11788 gene locus_tag LOCUS_20020 11480 11788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879604.1 protein_id gnl|my_center|LOCUS_20020 11785 12729 gene locus_tag LOCUS_20030 11785 12729 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879603.1 protein_id gnl|my_center|LOCUS_20030 12726 13367 gene locus_tag LOCUS_20040 12726 13367 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879602.1 protein_id gnl|my_center|LOCUS_20040 13377 14048 gene locus_tag LOCUS_20050 13377 14048 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878743.1 protein_id gnl|my_center|LOCUS_20050 15298 14045 gene locus_tag LOCUS_20060 15298 14045 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064356.1 protein_id gnl|my_center|LOCUS_20060 15427 17097 gene locus_tag LOCUS_20070 gene ilvD 15427 17097 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496775.1 protein_id gnl|my_center|LOCUS_20070 18546 17338 gene locus_tag LOCUS_20080 gene tgt 18546 17338 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878982.1 protein_id gnl|my_center|LOCUS_20080 19128 18661 gene locus_tag LOCUS_20090 19128 18661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20090 19814 19242 gene locus_tag LOCUS_20100 19814 19242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20100 >Feature sequence33 305 574 gene locus_tag LOCUS_20110 gene albA 305 574 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878567.1 protein_id gnl|my_center|LOCUS_20110 591 1028 gene locus_tag LOCUS_20120 591 1028 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878568.1 protein_id gnl|my_center|LOCUS_20120 2463 988 gene locus_tag LOCUS_20130 2463 988 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878569.1 protein_id gnl|my_center|LOCUS_20130 3796 2555 gene locus_tag LOCUS_20140 3796 2555 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878570.1 protein_id gnl|my_center|LOCUS_20140 4046 5704 gene locus_tag LOCUS_20150 4046 5704 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879216.1 protein_id gnl|my_center|LOCUS_20150 5694 6194 gene locus_tag LOCUS_20160 gene ilvN 5694 6194 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879215.1 protein_id gnl|my_center|LOCUS_20160 6273 6467 gene locus_tag LOCUS_20170 6273 6467 CDS product DUF5371 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064725.1 protein_id gnl|my_center|LOCUS_20170 6496 6900 gene locus_tag LOCUS_20180 6496 6900 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064442.1 protein_id gnl|my_center|LOCUS_20180 8734 6947 gene locus_tag LOCUS_20190 8734 6947 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877778.1 protein_id gnl|my_center|LOCUS_20190 9153 10502 gene locus_tag LOCUS_20200 9153 10502 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878473.1 protein_id gnl|my_center|LOCUS_20200 10509 11810 gene locus_tag LOCUS_20210 10509 11810 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878474.1 protein_id gnl|my_center|LOCUS_20210 13293 11803 gene locus_tag LOCUS_20220 13293 11803 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296889.1 protein_id gnl|my_center|LOCUS_20220 13808 13413 gene locus_tag LOCUS_20230 13808 13413 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878976.1 protein_id gnl|my_center|LOCUS_20230 14047 13826 gene locus_tag LOCUS_20240 14047 13826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 14579 14172 gene locus_tag LOCUS_20250 14579 14172 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_20250 17289 14551 gene locus_tag LOCUS_20260 17289 14551 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270487.1 protein_id gnl|my_center|LOCUS_20260 18480 17587 gene locus_tag LOCUS_20270 18480 17587 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762696.1 protein_id gnl|my_center|LOCUS_20270 18528 19562 gene locus_tag LOCUS_20280 18528 19562 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878340.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence34 513 1301 gene locus_tag LOCUS_20290 513 1301 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_20290 1302 2045 gene locus_tag LOCUS_20300 1302 2045 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584092.1 protein_id gnl|my_center|LOCUS_20300 2077 2715 gene locus_tag LOCUS_20310 2077 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2712 3455 gene locus_tag LOCUS_20320 2712 3455 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_20320 3888 6953 gene locus_tag LOCUS_20330 3888 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 7022 8215 gene locus_tag LOCUS_20340 7022 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878445.1 protein_id gnl|my_center|LOCUS_20340 8197 9237 gene locus_tag LOCUS_20350 8197 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064310.1 protein_id gnl|my_center|LOCUS_20350 9900 9238 gene locus_tag LOCUS_20360 gene rpiA 9900 9238 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878443.1 protein_id gnl|my_center|LOCUS_20360 10663 9878 gene locus_tag LOCUS_20370 gene surE 10663 9878 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878442.1 protein_id gnl|my_center|LOCUS_20370 11007 10660 gene locus_tag LOCUS_20380 11007 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878441.1 protein_id gnl|my_center|LOCUS_20380 11080 12162 gene locus_tag LOCUS_20390 11080 12162 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878440.1 protein_id gnl|my_center|LOCUS_20390 13073 12159 gene locus_tag LOCUS_20400 gene rnz 13073 12159 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878439.1 protein_id gnl|my_center|LOCUS_20400 13393 13073 gene locus_tag LOCUS_20410 gene rpsJ 13393 13073 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878438.1 protein_id gnl|my_center|LOCUS_20410 14686 13415 gene locus_tag LOCUS_20420 gene tuf 14686 13415 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878437.1 protein_id gnl|my_center|LOCUS_20420 15475 14744 gene locus_tag LOCUS_20430 15475 14744 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878436.1 protein_id gnl|my_center|LOCUS_20430 16439 15462 gene locus_tag LOCUS_20440 16439 15462 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878435.1 protein_id gnl|my_center|LOCUS_20440 16951 16436 gene locus_tag LOCUS_20450 16951 16436 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878434.1 protein_id gnl|my_center|LOCUS_20450 17816 16944 gene locus_tag LOCUS_20460 gene ilvE 17816 16944 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_20460 19350 17839 gene locus_tag LOCUS_20470 19350 17839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence35 86 289 gene locus_tag LOCUS_20480 86 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 279 704 gene locus_tag LOCUS_20490 279 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 704 1057 gene locus_tag LOCUS_20500 704 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 1074 1658 gene locus_tag LOCUS_20510 1074 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1671 2261 gene locus_tag LOCUS_20520 1671 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3253 2279 gene locus_tag LOCUS_20530 3253 2279 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423287.1 protein_id gnl|my_center|LOCUS_20530 3566 3757 gene locus_tag LOCUS_20540 3566 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 4680 4252 gene locus_tag LOCUS_20550 4680 4252 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319975.1 protein_id gnl|my_center|LOCUS_20550 4784 5779 gene locus_tag LOCUS_20560 4784 5779 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296895.1 protein_id gnl|my_center|LOCUS_20560 5776 6768 gene locus_tag LOCUS_20570 5776 6768 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064502.1 protein_id gnl|my_center|LOCUS_20570 7730 6762 gene locus_tag LOCUS_20580 gene hemB 7730 6762 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236609709.1 protein_id gnl|my_center|LOCUS_20580 8958 7675 gene locus_tag LOCUS_20590 gene hemA 8958 7675 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879467.1 protein_id gnl|my_center|LOCUS_20590 9573 8968 gene locus_tag LOCUS_20600 9573 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 10792 9596 gene locus_tag LOCUS_20610 gene pan 10792 9596 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_20610 10901 11374 gene locus_tag LOCUS_20620 10901 11374 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064503.1 protein_id gnl|my_center|LOCUS_20620 11401 11712 gene locus_tag LOCUS_20630 gene cutA 11401 11712 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879470.1 protein_id gnl|my_center|LOCUS_20630 11712 12407 gene locus_tag LOCUS_20640 11712 12407 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064504.1 protein_id gnl|my_center|LOCUS_20640 13125 12514 gene locus_tag LOCUS_20650 13125 12514 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879472.1 protein_id gnl|my_center|LOCUS_20650 13979 13188 gene locus_tag LOCUS_20660 13979 13188 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064505.1 protein_id gnl|my_center|LOCUS_20660 14730 13972 gene locus_tag LOCUS_20670 14730 13972 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879474.1 protein_id gnl|my_center|LOCUS_20670 15665 14727 gene locus_tag LOCUS_20680 15665 14727 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064506.1 protein_id gnl|my_center|LOCUS_20680 16072 15662 gene locus_tag LOCUS_20690 16072 15662 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319965.1 protein_id gnl|my_center|LOCUS_20690 16125 17123 gene locus_tag LOCUS_20700 gene ilvC 16125 17123 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879477.1 protein_id gnl|my_center|LOCUS_20700 17733 17125 gene locus_tag LOCUS_20710 17733 17125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879478.1 protein_id gnl|my_center|LOCUS_20710 18390 17740 gene locus_tag LOCUS_20720 18390 17740 CDS product DUF6293 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879479.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence36 1234 86 gene locus_tag LOCUS_20730 1234 86 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878352.1 protein_id gnl|my_center|LOCUS_20730 2109 1231 gene locus_tag LOCUS_20740 2109 1231 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013684142.1 protein_id gnl|my_center|LOCUS_20740 2688 2116 gene locus_tag LOCUS_20750 2688 2116 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878350.1 protein_id gnl|my_center|LOCUS_20750 2805 4298 gene locus_tag LOCUS_20760 2805 4298 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_20760 4371 5516 gene locus_tag LOCUS_20770 4371 5516 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878348.1 protein_id gnl|my_center|LOCUS_20770 5569 6450 gene locus_tag LOCUS_20780 5569 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274388.1 protein_id gnl|my_center|LOCUS_20780 6740 6429 gene locus_tag LOCUS_20790 6740 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064297.1 protein_id gnl|my_center|LOCUS_20790 7294 8358 gene locus_tag LOCUS_20800 7294 8358 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877834.1 protein_id gnl|my_center|LOCUS_20800 8365 9456 gene locus_tag LOCUS_20810 8365 9456 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877835.1 protein_id gnl|my_center|LOCUS_20810 9481 11247 gene locus_tag LOCUS_20820 gene aglB1 9481 11247 CDS product dolichyl-phosphooligosaccharide-protein glycotransferase AglB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877836.1 protein_id gnl|my_center|LOCUS_20820 11291 12388 gene locus_tag LOCUS_20830 11291 12388 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868579.1 protein_id gnl|my_center|LOCUS_20830 12385 13524 gene locus_tag LOCUS_20840 12385 13524 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875977.1 protein_id gnl|my_center|LOCUS_20840 13555 14571 gene locus_tag LOCUS_20850 13555 14571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 14568 15599 gene locus_tag LOCUS_20860 14568 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 15592 16275 gene locus_tag LOCUS_20870 15592 16275 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_20870 16611 16276 gene locus_tag LOCUS_20880 16611 16276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 16880 16701 gene locus_tag LOCUS_20890 16880 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012965102.1 protein_id gnl|my_center|LOCUS_20890 17172 16852 gene locus_tag LOCUS_20900 17172 16852 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012965103.1 protein_id gnl|my_center|LOCUS_20900 18655 17267 gene locus_tag LOCUS_20910 18655 17267 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence37 338 2293 gene locus_tag LOCUS_20920 338 2293 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878495.1 protein_id gnl|my_center|LOCUS_20920 2791 2231 gene locus_tag LOCUS_20930 2791 2231 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878494.1 protein_id gnl|my_center|LOCUS_20930 2850 3854 gene locus_tag LOCUS_20940 gene radA 2850 3854 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_20940 4680 3859 gene locus_tag LOCUS_20950 4680 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064315.1 protein_id gnl|my_center|LOCUS_20950 4901 5257 gene locus_tag LOCUS_20960 4901 5257 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878558.1 protein_id gnl|my_center|LOCUS_20960 5657 5262 gene locus_tag LOCUS_20970 5657 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 5626 5874 gene locus_tag LOCUS_20980 5626 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 5871 6470 gene locus_tag LOCUS_20990 gene trmY 5871 6470 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064324.1 protein_id gnl|my_center|LOCUS_20990 6570 7211 gene locus_tag LOCUS_21000 6570 7211 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878555.1 protein_id gnl|my_center|LOCUS_21000 7223 7831 gene locus_tag LOCUS_21010 7223 7831 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042684532.1 protein_id gnl|my_center|LOCUS_21010 7870 8652 gene locus_tag LOCUS_21020 7870 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878553.1 protein_id gnl|my_center|LOCUS_21020 8687 9175 gene locus_tag LOCUS_21030 8687 9175 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878552.1 protein_id gnl|my_center|LOCUS_21030 9181 9663 gene locus_tag LOCUS_21040 9181 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042684528.1 protein_id gnl|my_center|LOCUS_21040 9676 10410 gene locus_tag LOCUS_21050 9676 10410 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546206.1 protein_id gnl|my_center|LOCUS_21050 10485 12359 gene locus_tag LOCUS_21060 10485 12359 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878549.1 protein_id gnl|my_center|LOCUS_21060 12371 14023 gene locus_tag LOCUS_21070 gene flaJ 12371 14023 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878548.1 protein_id gnl|my_center|LOCUS_21070 14036 14668 gene locus_tag LOCUS_21080 14036 14668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878547.1 protein_id gnl|my_center|LOCUS_21080 14668 15333 gene locus_tag LOCUS_21090 14668 15333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878546.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence38 1725 748 gene locus_tag LOCUS_21100 1725 748 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879855.1 protein_id gnl|my_center|LOCUS_21100 2084 1761 gene locus_tag LOCUS_21110 2084 1761 CDS product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197030934.1 protein_id gnl|my_center|LOCUS_21110 2209 2463 gene locus_tag LOCUS_21120 2209 2463 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879857.1 protein_id gnl|my_center|LOCUS_21120 2456 3007 gene locus_tag LOCUS_21130 2456 3007 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064573.1 protein_id gnl|my_center|LOCUS_21130 3022 3780 gene locus_tag LOCUS_21140 gene suhB 3022 3780 CDS product bifunctional fructose-1,6-bisphosphatase/inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879859.1 protein_id gnl|my_center|LOCUS_21140 3777 4526 gene locus_tag LOCUS_21150 gene nadK 3777 4526 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879860.1 protein_id gnl|my_center|LOCUS_21150 4822 5172 gene locus_tag LOCUS_21160 4822 5172 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064575.1 protein_id gnl|my_center|LOCUS_21160 5223 5651 gene locus_tag LOCUS_21170 5223 5651 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879865.1 protein_id gnl|my_center|LOCUS_21170 5642 5893 gene locus_tag LOCUS_21180 5642 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879866.1 protein_id gnl|my_center|LOCUS_21180 5890 6684 gene locus_tag LOCUS_21190 5890 6684 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879867.1 protein_id gnl|my_center|LOCUS_21190 6681 7532 gene locus_tag LOCUS_21200 6681 7532 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879868.1 protein_id gnl|my_center|LOCUS_21200 7533 8297 gene locus_tag LOCUS_21210 7533 8297 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879869.1 protein_id gnl|my_center|LOCUS_21210 8426 8617 gene locus_tag LOCUS_21220 8426 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 8620 8859 gene locus_tag LOCUS_21230 8620 8859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 9161 8862 gene locus_tag LOCUS_21240 9161 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064576.1 protein_id gnl|my_center|LOCUS_21240 10840 9152 gene locus_tag LOCUS_21250 gene feoB 10840 9152 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012939559.1 protein_id gnl|my_center|LOCUS_21250 11306 10857 gene locus_tag LOCUS_21260 11306 10857 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879882.1 protein_id gnl|my_center|LOCUS_21260 11523 11287 gene locus_tag LOCUS_21270 11523 11287 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879883.1 protein_id gnl|my_center|LOCUS_21270 11728 14124 gene locus_tag LOCUS_21280 gene cdhA 11728 14124 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879884.1 protein_id gnl|my_center|LOCUS_21280 14135 14662 gene locus_tag LOCUS_21290 gene cdhB 14135 14662 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879885.1 protein_id gnl|my_center|LOCUS_21290 16299 14659 gene locus_tag LOCUS_21300 16299 14659 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877773.1 protein_id gnl|my_center|LOCUS_21300 16600 16839 gene locus_tag LOCUS_21310 16600 16839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence39 236 1438 gene locus_tag LOCUS_21320 236 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 3899 1449 gene locus_tag LOCUS_21330 3899 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879610.1 protein_id gnl|my_center|LOCUS_21330 5632 4211 gene locus_tag LOCUS_21340 5632 4211 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583645.1 protein_id gnl|my_center|LOCUS_21340 6164 5712 gene locus_tag LOCUS_21350 6164 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879611.1 protein_id gnl|my_center|LOCUS_21350 6642 6175 gene locus_tag LOCUS_21360 6642 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879612.1 protein_id gnl|my_center|LOCUS_21360 7075 6647 gene locus_tag LOCUS_21370 7075 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879613.1 protein_id gnl|my_center|LOCUS_21370 7518 7081 gene locus_tag LOCUS_21380 7518 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879614.1 protein_id gnl|my_center|LOCUS_21380 8192 7743 gene locus_tag LOCUS_21390 8192 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879615.1 protein_id gnl|my_center|LOCUS_21390 9211 8189 gene locus_tag LOCUS_21400 9211 8189 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274471.1 protein_id gnl|my_center|LOCUS_21400 10096 9224 gene locus_tag LOCUS_21410 10096 9224 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183481.1 protein_id gnl|my_center|LOCUS_21410 11244 10306 gene locus_tag LOCUS_21420 11244 10306 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096256.1 protein_id gnl|my_center|LOCUS_21420 11346 11777 gene locus_tag LOCUS_21430 gene ribH 11346 11777 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879619.1 protein_id gnl|my_center|LOCUS_21430 11758 12897 gene locus_tag LOCUS_21440 11758 12897 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879620.1 protein_id gnl|my_center|LOCUS_21440 13788 13357 gene locus_tag LOCUS_21450 13788 13357 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867893.1 protein_id gnl|my_center|LOCUS_21450 14003 13773 gene locus_tag LOCUS_21460 14003 13773 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249412.1 protein_id gnl|my_center|LOCUS_21460 14619 14290 gene locus_tag LOCUS_21470 14619 14290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence40 2049 793 gene locus_tag LOCUS_21480 2049 793 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878497.1 protein_id gnl|my_center|LOCUS_21480 2210 2338 gene locus_tag LOCUS_21490 2210 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 2466 3227 gene locus_tag LOCUS_21500 2466 3227 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879137.1 protein_id gnl|my_center|LOCUS_21500 4355 3240 gene locus_tag LOCUS_21510 4355 3240 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878533.1 protein_id gnl|my_center|LOCUS_21510 7002 4339 gene locus_tag LOCUS_21520 gene rad50 7002 4339 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878532.1 protein_id gnl|my_center|LOCUS_21520 8298 7003 gene locus_tag LOCUS_21530 8298 7003 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878531.1 protein_id gnl|my_center|LOCUS_21530 9890 8295 gene locus_tag LOCUS_21540 9890 8295 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878530.1 protein_id gnl|my_center|LOCUS_21540 10555 9923 gene locus_tag LOCUS_21550 10555 9923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878503.1 protein_id gnl|my_center|LOCUS_21550 10628 11371 gene locus_tag LOCUS_21560 gene nadE 10628 11371 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878500.1 protein_id gnl|my_center|LOCUS_21560 11368 12054 gene locus_tag LOCUS_21570 11368 12054 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878499.1 protein_id gnl|my_center|LOCUS_21570 12664 12029 gene locus_tag LOCUS_21580 12664 12029 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879388.1 protein_id gnl|my_center|LOCUS_21580 <14424 12747 gene locus_tag LOCUS_21590 <14424 12747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879387.1:elongation factor EF-2 >Feature sequence41 137 670 gene locus_tag LOCUS_21600 137 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 791 1351 gene locus_tag LOCUS_21610 791 1351 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022020.1 protein_id gnl|my_center|LOCUS_21610 1532 1693 gene locus_tag LOCUS_21620 1532 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 1709 2356 gene locus_tag LOCUS_21630 1709 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 2374 2751 gene locus_tag LOCUS_21640 2374 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2773 5580 gene locus_tag LOCUS_21650 2773 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 5584 7443 gene locus_tag LOCUS_21660 5584 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 7464 7814 gene locus_tag LOCUS_21670 7464 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 7811 7990 gene locus_tag LOCUS_21680 7811 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 7987 8235 gene locus_tag LOCUS_21690 7987 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 8237 9631 gene locus_tag LOCUS_21700 8237 9631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 9632 10027 gene locus_tag LOCUS_21710 9632 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 10024 10287 gene locus_tag LOCUS_21720 10024 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 10277 11410 gene locus_tag LOCUS_21730 10277 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 11397 11768 gene locus_tag LOCUS_21740 11397 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 11758 12654 gene locus_tag LOCUS_21750 11758 12654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 12651 13178 gene locus_tag LOCUS_21760 12651 13178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence42 806 180 gene locus_tag LOCUS_21770 806 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 1939 860 gene locus_tag LOCUS_21780 1939 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2022 4052 gene locus_tag LOCUS_21790 2022 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 4782 4003 gene locus_tag LOCUS_21800 4782 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 4963 4775 gene locus_tag LOCUS_21810 4963 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 5175 4960 gene locus_tag LOCUS_21820 5175 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 7160 5238 gene locus_tag LOCUS_21830 7160 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 7511 7227 gene locus_tag LOCUS_21840 7511 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 7889 8203 gene locus_tag LOCUS_21850 7889 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 8275 9957 gene locus_tag LOCUS_21860 8275 9957 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870191.1 protein_id gnl|my_center|LOCUS_21860 10132 10350 gene locus_tag LOCUS_21870 10132 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 11508 10342 gene locus_tag LOCUS_21880 11508 10342 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135390550.1 protein_id gnl|my_center|LOCUS_21880 12758 11664 gene locus_tag LOCUS_21890 12758 11664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence43 793 1155 gene locus_tag LOCUS_21900 793 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 1223 1357 gene locus_tag LOCUS_21910 1223 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 1513 1638 gene locus_tag LOCUS_21920 1513 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1907 2584 gene locus_tag LOCUS_21930 gene rlmB 1907 2584 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879886.1 protein_id gnl|my_center|LOCUS_21930 2607 5213 gene locus_tag LOCUS_21940 2607 5213 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879887.1 protein_id gnl|my_center|LOCUS_21940 5200 6264 gene locus_tag LOCUS_21950 5200 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879888.1 protein_id gnl|my_center|LOCUS_21950 6329 6982 gene locus_tag LOCUS_21960 6329 6982 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_21960 7691 6975 gene locus_tag LOCUS_21970 7691 6975 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878178.1 protein_id gnl|my_center|LOCUS_21970 8059 7691 gene locus_tag LOCUS_21980 8059 7691 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064265.1 protein_id gnl|my_center|LOCUS_21980 8224 8628 gene locus_tag LOCUS_21990 8224 8628 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878176.1 protein_id gnl|my_center|LOCUS_21990 8752 10005 gene locus_tag LOCUS_22000 8752 10005 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878174.1 protein_id gnl|my_center|LOCUS_22000 10163 11347 gene locus_tag LOCUS_22010 10163 11347 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879085.1 protein_id gnl|my_center|LOCUS_22010 12254 11373 gene locus_tag LOCUS_22020 12254 11373 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877604.1 protein_id gnl|my_center|LOCUS_22020 <13374 12338 gene locus_tag LOCUS_22030 <13374 12338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879854.1:long-chain fatty acid--CoA ligase >Feature sequence44 738 112 gene locus_tag LOCUS_22040 738 112 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879642.1 protein_id gnl|my_center|LOCUS_22040 831 1208 gene locus_tag LOCUS_22050 831 1208 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879641.1 protein_id gnl|my_center|LOCUS_22050 1885 1343 gene locus_tag LOCUS_22060 1885 1343 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_22060 1937 2407 gene locus_tag LOCUS_22070 gene moaC 1937 2407 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879639.1 protein_id gnl|my_center|LOCUS_22070 2404 3039 gene locus_tag LOCUS_22080 2404 3039 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879638.1 protein_id gnl|my_center|LOCUS_22080 3904 3026 gene locus_tag LOCUS_22090 3904 3026 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879637.1 protein_id gnl|my_center|LOCUS_22090 4015 4602 gene locus_tag LOCUS_22100 4015 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879636.1 protein_id gnl|my_center|LOCUS_22100 4639 5697 gene locus_tag LOCUS_22110 4639 5697 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064535.1 protein_id gnl|my_center|LOCUS_22110 5771 6046 gene locus_tag LOCUS_22120 5771 6046 CDS product MJ0307 family thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319571.1 protein_id gnl|my_center|LOCUS_22120 6033 6350 gene locus_tag LOCUS_22130 gene trxA 6033 6350 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879633.1 protein_id gnl|my_center|LOCUS_22130 6347 6733 gene locus_tag LOCUS_22140 6347 6733 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012964688.1 protein_id gnl|my_center|LOCUS_22140 6693 6863 gene locus_tag LOCUS_22150 6693 6863 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012964687.1 protein_id gnl|my_center|LOCUS_22150 6975 7415 gene locus_tag LOCUS_22160 6975 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22160 7715 7407 gene locus_tag LOCUS_22170 7715 7407 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879347.1 protein_id gnl|my_center|LOCUS_22170 7820 8902 gene locus_tag LOCUS_22180 7820 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064475.1 protein_id gnl|my_center|LOCUS_22180 9115 9453 gene locus_tag LOCUS_22190 9115 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 9607 10764 gene locus_tag LOCUS_22200 gene serB 9607 10764 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064533.1 protein_id gnl|my_center|LOCUS_22200 10761 11618 gene locus_tag LOCUS_22210 10761 11618 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879628.1 protein_id gnl|my_center|LOCUS_22210 11706 12806 gene locus_tag LOCUS_22220 11706 12806 CDS product vtpJ-therm inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879175.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence45 545 141 gene locus_tag LOCUS_22230 545 141 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877967.1 protein_id gnl|my_center|LOCUS_22230 1303 542 gene locus_tag LOCUS_22240 1303 542 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877968.1 protein_id gnl|my_center|LOCUS_22240 2097 1300 gene locus_tag LOCUS_22250 2097 1300 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064238.1 protein_id gnl|my_center|LOCUS_22250 2234 3358 gene locus_tag LOCUS_22260 2234 3358 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319219.1 protein_id gnl|my_center|LOCUS_22260 3398 3586 gene locus_tag LOCUS_22270 3398 3586 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064240.1 protein_id gnl|my_center|LOCUS_22270 3586 4752 gene locus_tag LOCUS_22280 3586 4752 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064241.1 protein_id gnl|my_center|LOCUS_22280 7110 4765 gene locus_tag LOCUS_22290 gene gyrA 7110 4765 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877972.1 protein_id gnl|my_center|LOCUS_22290 7184 7257 gene locus_tag LOCUS_t00320 7184 7257 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7333 8535 gene locus_tag LOCUS_22300 7333 8535 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023694.1 protein_id gnl|my_center|LOCUS_22300 8516 9607 gene locus_tag LOCUS_22310 8516 9607 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064270.1 protein_id gnl|my_center|LOCUS_22310 9671 9949 gene locus_tag LOCUS_22320 9671 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 10141 9950 gene locus_tag LOCUS_22330 10141 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 10554 10195 gene locus_tag LOCUS_22340 10554 10195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 11207 10617 gene locus_tag LOCUS_22350 11207 10617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 11494 11204 gene locus_tag LOCUS_22360 11494 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 >Feature sequence46 <1 691 gene locus_tag LOCUS_22370 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878341.1:Trk system potassium transporter TrkA 688 2124 gene locus_tag LOCUS_22380 688 2124 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878342.1 protein_id gnl|my_center|LOCUS_22380 3337 2093 gene locus_tag LOCUS_22390 gene hisS 3337 2093 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879138.1 protein_id gnl|my_center|LOCUS_22390 3436 4164 gene locus_tag LOCUS_22400 3436 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868095.1 protein_id gnl|my_center|LOCUS_22400 4259 5146 gene locus_tag LOCUS_22410 4259 5146 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064472.1 protein_id gnl|my_center|LOCUS_22410 5130 5861 gene locus_tag LOCUS_22420 gene cbiQ 5130 5861 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879336.1 protein_id gnl|my_center|LOCUS_22420 5846 6562 gene locus_tag LOCUS_22430 5846 6562 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879335.1 protein_id gnl|my_center|LOCUS_22430 7434 6559 gene locus_tag LOCUS_22440 gene map 7434 6559 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879334.1 protein_id gnl|my_center|LOCUS_22440 8152 7472 gene locus_tag LOCUS_22450 8152 7472 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877858.1 protein_id gnl|my_center|LOCUS_22450 8928 8176 gene locus_tag LOCUS_22460 8928 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064218.1 protein_id gnl|my_center|LOCUS_22460 9488 8928 gene locus_tag LOCUS_22470 9488 8928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877860.1 protein_id gnl|my_center|LOCUS_22470 10197 9463 gene locus_tag LOCUS_22480 10197 9463 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877861.1 protein_id gnl|my_center|LOCUS_22480 10297 10467 gene locus_tag LOCUS_22490 10297 10467 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064219.1 protein_id gnl|my_center|LOCUS_22490 10460 11386 gene locus_tag LOCUS_22500 10460 11386 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319540.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence47 <1 511 gene locus_tag LOCUS_22510 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878545.1:methyl-accepting chemotaxis protein 540 1019 gene locus_tag LOCUS_22520 540 1019 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042684410.1 protein_id gnl|my_center|LOCUS_22520 1029 1856 gene locus_tag LOCUS_22530 1029 1856 CDS product CheF family chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878543.1 protein_id gnl|my_center|LOCUS_22530 1835 2206 gene locus_tag LOCUS_22540 1835 2206 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878542.1 protein_id gnl|my_center|LOCUS_22540 2209 3258 gene locus_tag LOCUS_22550 2209 3258 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878541.1 protein_id gnl|my_center|LOCUS_22550 3248 5203 gene locus_tag LOCUS_22560 3248 5203 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878540.1 protein_id gnl|my_center|LOCUS_22560 5196 5804 gene locus_tag LOCUS_22570 5196 5804 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012940758.1 protein_id gnl|my_center|LOCUS_22570 5804 6274 gene locus_tag LOCUS_22580 5804 6274 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878538.1 protein_id gnl|my_center|LOCUS_22580 6265 7068 gene locus_tag LOCUS_22590 6265 7068 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878537.1 protein_id gnl|my_center|LOCUS_22590 7575 7165 gene locus_tag LOCUS_22600 7575 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 7766 7572 gene locus_tag LOCUS_22610 7766 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 7898 8188 gene locus_tag LOCUS_22620 7898 8188 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879891.1 protein_id gnl|my_center|LOCUS_22620 8263 9279 gene locus_tag LOCUS_22630 8263 9279 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879012.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence48 <1 2256 gene locus_tag LOCUS_22640 <1 2256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878918.1:UPF0182 family protein 2359 3027 gene locus_tag LOCUS_22650 2359 3027 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022642.1 protein_id gnl|my_center|LOCUS_22650 5748 3133 gene locus_tag LOCUS_22660 5748 3133 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545920.1 protein_id gnl|my_center|LOCUS_22660 5985 7145 gene locus_tag LOCUS_22670 5985 7145 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064188.1 protein_id gnl|my_center|LOCUS_22670 9112 7196 gene locus_tag LOCUS_22680 gene acs 9112 7196 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140163.1 protein_id gnl|my_center|LOCUS_22680 9328 9576 gene locus_tag LOCUS_22690 9328 9576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 10031 9780 gene locus_tag LOCUS_22700 10031 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence49 141 1001 gene locus_tag LOCUS_22710 141 1001 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879088.1 protein_id gnl|my_center|LOCUS_22710 1028 1720 gene locus_tag LOCUS_22720 1028 1720 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318675.1 protein_id gnl|my_center|LOCUS_22720 1717 2655 gene locus_tag LOCUS_22730 1717 2655 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240222.1 protein_id gnl|my_center|LOCUS_22730 2652 3569 gene locus_tag LOCUS_22740 2652 3569 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879092.1 protein_id gnl|my_center|LOCUS_22740 3812 3582 gene locus_tag LOCUS_22750 3812 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 4133 4348 gene locus_tag LOCUS_22760 4133 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 4491 4898 gene locus_tag LOCUS_22770 4491 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 5674 4928 gene locus_tag LOCUS_22780 gene trpA 5674 4928 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879096.1 protein_id gnl|my_center|LOCUS_22780 6828 5671 gene locus_tag LOCUS_22790 gene trpB 6828 5671 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064422.1 protein_id gnl|my_center|LOCUS_22790 7414 6815 gene locus_tag LOCUS_22800 7414 6815 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879098.1 protein_id gnl|my_center|LOCUS_22800 7940 7404 gene locus_tag LOCUS_22810 7940 7404 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879099.1 protein_id gnl|my_center|LOCUS_22810 9172 7937 gene locus_tag LOCUS_22820 9172 7937 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879100.1 protein_id gnl|my_center|LOCUS_22820 10113 9142 gene locus_tag LOCUS_22830 gene trpD 10113 9142 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095983.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence50 173 751 gene locus_tag LOCUS_22840 173 751 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_22840 757 1518 gene locus_tag LOCUS_22850 757 1518 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979881.1 protein_id gnl|my_center|LOCUS_22850 3816 1558 gene locus_tag LOCUS_22860 3816 1558 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879160.1 protein_id gnl|my_center|LOCUS_22860 3978 4946 gene locus_tag LOCUS_22870 gene ala 3978 4946 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_22870 4943 5626 gene locus_tag LOCUS_22880 4943 5626 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879162.1 protein_id gnl|my_center|LOCUS_22880 5779 7149 gene locus_tag LOCUS_22890 gene sat 5779 7149 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064439.1 protein_id gnl|my_center|LOCUS_22890 7160 7507 gene locus_tag LOCUS_22900 7160 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064720.1 protein_id gnl|my_center|LOCUS_22900 7560 8012 gene locus_tag LOCUS_22910 gene aprB 7560 8012 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_22910 8023 9954 gene locus_tag LOCUS_22920 gene aprA 8023 9954 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence51 1744 725 gene locus_tag LOCUS_22930 gene narH 1744 725 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702520.1 protein_id gnl|my_center|LOCUS_22930 2445 1888 gene locus_tag LOCUS_22940 2445 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878669.1 protein_id gnl|my_center|LOCUS_22940 3663 2503 gene locus_tag LOCUS_22950 3663 2503 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878941.1 protein_id gnl|my_center|LOCUS_22950 4723 3704 gene locus_tag LOCUS_22960 4723 3704 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_22960 6046 4745 gene locus_tag LOCUS_22970 6046 4745 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064343.1 protein_id gnl|my_center|LOCUS_22970 6196 6753 gene locus_tag LOCUS_22980 6196 6753 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_22980 6857 6785 gene locus_tag LOCUS_t00330 6857 6785 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7435 6890 gene locus_tag LOCUS_22990 7435 6890 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064673.1 protein_id gnl|my_center|LOCUS_22990 8298 7432 gene locus_tag LOCUS_23000 8298 7432 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878595.1 protein_id gnl|my_center|LOCUS_23000 8856 8443 gene locus_tag LOCUS_23010 8856 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878378.1 protein_id gnl|my_center|LOCUS_23010 <10064 8937 gene locus_tag LOCUS_23020 <10064 8937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202319808.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein >Feature sequence52 16 264 gene locus_tag LOCUS_23030 16 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 270 836 gene locus_tag LOCUS_23040 270 836 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878659.1 protein_id gnl|my_center|LOCUS_23040 842 1858 gene locus_tag LOCUS_23050 842 1858 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319644.1 protein_id gnl|my_center|LOCUS_23050 1855 2160 gene locus_tag LOCUS_23060 1855 2160 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878661.1 protein_id gnl|my_center|LOCUS_23060 2151 3896 gene locus_tag LOCUS_23070 2151 3896 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878662.1 protein_id gnl|my_center|LOCUS_23070 3902 5314 gene locus_tag LOCUS_23080 3902 5314 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064680.1 protein_id gnl|my_center|LOCUS_23080 5341 5970 gene locus_tag LOCUS_23090 5341 5970 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878664.1 protein_id gnl|my_center|LOCUS_23090 6152 6781 gene locus_tag LOCUS_23100 6152 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23100 6831 7088 gene locus_tag LOCUS_23110 6831 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 7285 7995 gene locus_tag LOCUS_23120 7285 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23120 8045 8248 gene locus_tag LOCUS_23130 8045 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064417.1 protein_id gnl|my_center|LOCUS_23130 8266 8730 gene locus_tag LOCUS_23140 8266 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 8866 9093 gene locus_tag LOCUS_23150 8866 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 9191 9466 gene locus_tag LOCUS_23160 9191 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence53 308 235 gene locus_tag LOCUS_t00340 308 235 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 399 590 gene locus_tag LOCUS_23170 399 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879751.1 protein_id gnl|my_center|LOCUS_23170 593 961 gene locus_tag LOCUS_23180 593 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879752.1 protein_id gnl|my_center|LOCUS_23180 1050 2267 gene locus_tag LOCUS_23190 1050 2267 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023694.1 protein_id gnl|my_center|LOCUS_23190 2438 2253 gene locus_tag LOCUS_23200 2438 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 2571 2873 gene locus_tag LOCUS_23210 2571 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 4001 2886 gene locus_tag LOCUS_23220 gene cdc6-2 4001 2886 CDS product ORC1-type DNA replication protein Cdc6-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877207.1 protein_id gnl|my_center|LOCUS_23220 4335 4003 gene locus_tag LOCUS_23230 4335 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 4564 4340 gene locus_tag LOCUS_23240 4564 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 4716 4886 gene locus_tag LOCUS_23250 4716 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 5653 4904 gene locus_tag LOCUS_23260 5653 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 5966 6946 gene locus_tag LOCUS_23270 gene radA 5966 6946 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_23270 7334 9619 gene locus_tag LOCUS_23280 7334 9619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 >Feature sequence54 404 1630 gene locus_tag LOCUS_23290 404 1630 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879085.1 protein_id gnl|my_center|LOCUS_23290 1635 2948 gene locus_tag LOCUS_23300 1635 2948 CDS product RuBisCO large subunit C-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879084.1 protein_id gnl|my_center|LOCUS_23300 3354 3722 gene locus_tag LOCUS_23310 3354 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 3862 4302 gene locus_tag LOCUS_23320 3862 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879054.1 protein_id gnl|my_center|LOCUS_23320 4304 7780 gene locus_tag LOCUS_23330 gene smc 4304 7780 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879055.1 protein_id gnl|my_center|LOCUS_23330 7819 8487 gene locus_tag LOCUS_23340 7819 8487 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879056.1 protein_id gnl|my_center|LOCUS_23340 9119 8616 gene locus_tag LOCUS_23350 gene scpB 9119 8616 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879077.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence55 258 527 gene locus_tag LOCUS_23360 258 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878255.1 protein_id gnl|my_center|LOCUS_23360 1036 524 gene locus_tag LOCUS_23370 1036 524 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878254.1 protein_id gnl|my_center|LOCUS_23370 1826 1050 gene locus_tag LOCUS_23380 1826 1050 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878253.1 protein_id gnl|my_center|LOCUS_23380 3451 1823 gene locus_tag LOCUS_23390 3451 1823 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878252.1 protein_id gnl|my_center|LOCUS_23390 4376 3489 gene locus_tag LOCUS_23400 4376 3489 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878251.1 protein_id gnl|my_center|LOCUS_23400 4885 4430 gene locus_tag LOCUS_23410 4885 4430 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270458.1 protein_id gnl|my_center|LOCUS_23410 6047 4890 gene locus_tag LOCUS_23420 6047 4890 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877713.1 protein_id gnl|my_center|LOCUS_23420 7116 6049 gene locus_tag LOCUS_23430 7116 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064187.1 protein_id gnl|my_center|LOCUS_23430 8941 7121 gene locus_tag LOCUS_23440 8941 7121 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877711.1 protein_id gnl|my_center|LOCUS_23440 <9773 8946 gene locus_tag LOCUS_23450 <9773 8946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877710.1:acyl-CoA dehydrogenase family protein >Feature sequence56 649 155 gene locus_tag LOCUS_23460 649 155 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878235.1 protein_id gnl|my_center|LOCUS_23460 1610 627 gene locus_tag LOCUS_23470 1610 627 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064275.1 protein_id gnl|my_center|LOCUS_23470 2329 1607 gene locus_tag LOCUS_23480 gene cbiQ 2329 1607 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878233.1 protein_id gnl|my_center|LOCUS_23480 2582 2313 gene locus_tag LOCUS_23490 2582 2313 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878232.1 protein_id gnl|my_center|LOCUS_23490 3232 2579 gene locus_tag LOCUS_23500 gene cbiM 3232 2579 CDS product cobalt ECF transporter S component CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878231.1 protein_id gnl|my_center|LOCUS_23500 3368 3955 gene locus_tag LOCUS_23510 3368 3955 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878230.1 protein_id gnl|my_center|LOCUS_23510 3957 4661 gene locus_tag LOCUS_23520 3957 4661 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878229.1 protein_id gnl|my_center|LOCUS_23520 4633 5364 gene locus_tag LOCUS_23530 4633 5364 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274383.1 protein_id gnl|my_center|LOCUS_23530 5348 6700 gene locus_tag LOCUS_23540 gene cobJ 5348 6700 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878227.1 protein_id gnl|my_center|LOCUS_23540 6681 7580 gene locus_tag LOCUS_23550 6681 7580 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878226.1 protein_id gnl|my_center|LOCUS_23550 7534 8118 gene locus_tag LOCUS_23560 7534 8118 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878225.1 protein_id gnl|my_center|LOCUS_23560 8115 8498 gene locus_tag LOCUS_23570 gene cbiX 8115 8498 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878224.1 protein_id gnl|my_center|LOCUS_23570 8510 9133 gene locus_tag LOCUS_23580 8510 9133 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064273.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence57 649 1998 gene locus_tag LOCUS_23590 649 1998 CDS product RuvB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012965679.1 protein_id gnl|my_center|LOCUS_23590 2037 3209 gene locus_tag LOCUS_23600 2037 3209 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_23600 4474 3314 gene locus_tag LOCUS_23610 4474 3314 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879085.1 protein_id gnl|my_center|LOCUS_23610 5323 4553 gene locus_tag LOCUS_23620 5323 4553 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878498.1 protein_id gnl|my_center|LOCUS_23620 5535 6677 gene locus_tag LOCUS_23630 5535 6677 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868529.1 protein_id gnl|my_center|LOCUS_23630 6688 7890 gene locus_tag LOCUS_23640 6688 7890 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878467.1 protein_id gnl|my_center|LOCUS_23640 7895 8425 gene locus_tag LOCUS_23650 7895 8425 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878466.1 protein_id gnl|my_center|LOCUS_23650 8428 8892 gene locus_tag LOCUS_23660 8428 8892 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878465.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence58 <1 1209 gene locus_tag LOCUS_23670 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879805.1:radical SAM protein 1206 2117 gene locus_tag LOCUS_23680 1206 2117 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878248.1 protein_id gnl|my_center|LOCUS_23680 2857 2120 gene locus_tag LOCUS_23690 2857 2120 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878249.1 protein_id gnl|my_center|LOCUS_23690 3668 2847 gene locus_tag LOCUS_23700 gene dapF 3668 2847 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878250.1 protein_id gnl|my_center|LOCUS_23700 4271 3717 gene locus_tag LOCUS_23710 4271 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877648.1 protein_id gnl|my_center|LOCUS_23710 4415 6037 gene locus_tag LOCUS_23720 4415 6037 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877707.1 protein_id gnl|my_center|LOCUS_23720 6122 8110 gene locus_tag LOCUS_23730 6122 8110 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877708.1 protein_id gnl|my_center|LOCUS_23730 8112 8552 gene locus_tag LOCUS_23740 8112 8552 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318983.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence59 677 162 gene locus_tag LOCUS_23750 677 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 1149 1076 gene locus_tag LOCUS_t00350 1149 1076 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1241 2506 gene locus_tag LOCUS_23760 1241 2506 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878057.1 protein_id gnl|my_center|LOCUS_23760 2807 2496 gene locus_tag LOCUS_23770 2807 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878056.1 protein_id gnl|my_center|LOCUS_23770 4671 2812 gene locus_tag LOCUS_23780 4671 2812 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878055.1 protein_id gnl|my_center|LOCUS_23780 6184 4748 gene locus_tag LOCUS_23790 6184 4748 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878054.1 protein_id gnl|my_center|LOCUS_23790 6885 6190 gene locus_tag LOCUS_23800 6885 6190 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878053.1 protein_id gnl|my_center|LOCUS_23800 7247 8170 gene locus_tag LOCUS_23810 7247 8170 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878052.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence60 460 74 gene locus_tag LOCUS_23820 460 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 411 983 gene locus_tag LOCUS_23830 411 983 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064537.1 protein_id gnl|my_center|LOCUS_23830 980 1492 gene locus_tag LOCUS_23840 980 1492 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064536.1 protein_id gnl|my_center|LOCUS_23840 1602 1787 gene locus_tag LOCUS_23850 1602 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 1841 2746 gene locus_tag LOCUS_23860 1841 2746 CDS product PGF-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879648.1 protein_id gnl|my_center|LOCUS_23860 2725 2946 gene locus_tag LOCUS_23870 2725 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 2973 3512 gene locus_tag LOCUS_23880 gene thpR 2973 3512 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879646.1 protein_id gnl|my_center|LOCUS_23880 3502 4812 gene locus_tag LOCUS_23890 gene cca 3502 4812 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879645.1 protein_id gnl|my_center|LOCUS_23890 4809 5516 gene locus_tag LOCUS_23900 4809 5516 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879644.1 protein_id gnl|my_center|LOCUS_23900 5532 6026 gene locus_tag LOCUS_23910 5532 6026 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319580.1 protein_id gnl|my_center|LOCUS_23910 6276 6557 gene locus_tag LOCUS_23920 6276 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23920 6743 6898 gene locus_tag LOCUS_23930 6743 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 7753 7514 gene locus_tag LOCUS_23940 7753 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence61 437 994 gene locus_tag LOCUS_23950 437 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23950 1037 2338 gene locus_tag LOCUS_23960 1037 2338 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879167.1 protein_id gnl|my_center|LOCUS_23960 2349 2762 gene locus_tag LOCUS_23970 2349 2762 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_23970 2771 3718 gene locus_tag LOCUS_23980 2771 3718 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879169.1 protein_id gnl|my_center|LOCUS_23980 4779 3724 gene locus_tag LOCUS_23990 gene egsA 4779 3724 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879170.1 protein_id gnl|my_center|LOCUS_23990 5642 4782 gene locus_tag LOCUS_24000 gene htpX 5642 4782 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_24000 6062 5673 gene locus_tag LOCUS_24010 6062 5673 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879171.1 protein_id gnl|my_center|LOCUS_24010 6113 6850 gene locus_tag LOCUS_24020 gene cobB1 6113 6850 CDS product NAD-dependent protein deacylase Cob1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879172.1 protein_id gnl|my_center|LOCUS_24020 8072 6831 gene locus_tag LOCUS_24030 gene truD 8072 6831 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879173.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence62 75 3 gene locus_tag LOCUS_t00360 75 3 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 305 724 gene locus_tag LOCUS_24040 305 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 721 1638 gene locus_tag LOCUS_24050 721 1638 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878561.1 protein_id gnl|my_center|LOCUS_24050 3152 1635 gene locus_tag LOCUS_24060 3152 1635 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_24060 3354 3273 gene locus_tag LOCUS_t00370 3354 3273 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3564 3788 gene locus_tag LOCUS_24070 3564 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 4761 3790 gene locus_tag LOCUS_24080 4761 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 5416 4754 gene locus_tag LOCUS_24090 5416 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 6018 5446 gene locus_tag LOCUS_24100 6018 5446 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878192.1 protein_id gnl|my_center|LOCUS_24100 6509 6024 gene locus_tag LOCUS_24110 6509 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 6706 6506 gene locus_tag LOCUS_24120 6706 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 7007 7219 gene locus_tag LOCUS_24130 7007 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 7220 7633 gene locus_tag LOCUS_24140 7220 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 7596 7823 gene locus_tag LOCUS_24150 7596 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 7834 8028 gene locus_tag LOCUS_24160 7834 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence63 1933 722 gene locus_tag LOCUS_24170 1933 722 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878404.1 protein_id gnl|my_center|LOCUS_24170 2394 1930 gene locus_tag LOCUS_24180 2394 1930 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878403.1 protein_id gnl|my_center|LOCUS_24180 3269 2466 gene locus_tag LOCUS_24190 3269 2466 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878402.1 protein_id gnl|my_center|LOCUS_24190 3787 3266 gene locus_tag LOCUS_24200 gene yjjX 3787 3266 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318533.1 protein_id gnl|my_center|LOCUS_24200 4695 3784 gene locus_tag LOCUS_24210 gene endA 4695 3784 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156029509.1 protein_id gnl|my_center|LOCUS_24210 5516 4695 gene locus_tag LOCUS_24220 5516 4695 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878399.1 protein_id gnl|my_center|LOCUS_24220 5669 6646 gene locus_tag LOCUS_24230 5669 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 6715 8025 gene locus_tag LOCUS_24240 6715 8025 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877902.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence64 115 903 gene locus_tag LOCUS_24250 115 903 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_24250 1403 906 gene locus_tag LOCUS_24260 1403 906 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879257.1 protein_id gnl|my_center|LOCUS_24260 2249 1416 gene locus_tag LOCUS_24270 2249 1416 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064458.1 protein_id gnl|my_center|LOCUS_24270 2303 3142 gene locus_tag LOCUS_24280 2303 3142 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064457.1 protein_id gnl|my_center|LOCUS_24280 3182 3523 gene locus_tag LOCUS_24290 3182 3523 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064455.1 protein_id gnl|my_center|LOCUS_24290 5503 3527 gene locus_tag LOCUS_24300 gene metG 5503 3527 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878950.1 protein_id gnl|my_center|LOCUS_24300 <7140 5755 gene locus_tag LOCUS_24310 <7140 5755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878948.1:thermosome subunit beta >Feature sequence65 36 290 gene locus_tag LOCUS_24320 36 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 287 493 gene locus_tag LOCUS_24330 287 493 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878307.1 protein_id gnl|my_center|LOCUS_24330 692 1795 gene locus_tag LOCUS_24340 692 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2196 1798 gene locus_tag LOCUS_24350 2196 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 3780 2989 gene locus_tag LOCUS_24360 3780 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 4111 3773 gene locus_tag LOCUS_24370 4111 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 4228 4479 gene locus_tag LOCUS_24380 4228 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 4672 4415 gene locus_tag LOCUS_24390 4672 4415 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249916.1 protein_id gnl|my_center|LOCUS_24390 4842 4669 gene locus_tag LOCUS_24400 4842 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 5169 4876 gene locus_tag LOCUS_24410 5169 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 5648 5367 gene locus_tag LOCUS_24420 5648 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 5788 5973 gene locus_tag LOCUS_24430 5788 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 6236 5979 gene locus_tag LOCUS_24440 6236 5979 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249916.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence66 2 196 gene locus_tag LOCUS_24450 2 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 324 701 gene locus_tag LOCUS_24460 324 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 677 841 gene locus_tag LOCUS_24470 677 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 845 1186 gene locus_tag LOCUS_24480 845 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 1179 1424 gene locus_tag LOCUS_24490 1179 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 1431 2150 gene locus_tag LOCUS_24500 1431 2150 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877842.1 protein_id gnl|my_center|LOCUS_24500 2171 2440 gene locus_tag LOCUS_24510 2171 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 3417 3151 gene locus_tag LOCUS_24520 3417 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 3397 4272 gene locus_tag LOCUS_24530 3397 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 4396 4274 gene locus_tag LOCUS_24540 4396 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 4501 4800 gene locus_tag LOCUS_24550 4501 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 4828 5097 gene locus_tag LOCUS_24560 4828 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 5144 5515 gene locus_tag LOCUS_24570 5144 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 5633 6133 gene locus_tag LOCUS_24580 5633 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 6325 6128 gene locus_tag LOCUS_24590 6325 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence67 1517 162 gene locus_tag LOCUS_24600 1517 162 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061996.1 protein_id gnl|my_center|LOCUS_24600 2963 1611 gene locus_tag LOCUS_24610 2963 1611 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061996.1 protein_id gnl|my_center|LOCUS_24610 3396 3109 gene locus_tag LOCUS_24620 3396 3109 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879046.1 protein_id gnl|my_center|LOCUS_24620 3434 4075 gene locus_tag LOCUS_24630 3434 4075 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879047.1 protein_id gnl|my_center|LOCUS_24630 4943 4065 gene locus_tag LOCUS_24640 4943 4065 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879048.1 protein_id gnl|my_center|LOCUS_24640 5799 4999 gene locus_tag LOCUS_24650 5799 4999 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064409.1 protein_id gnl|my_center|LOCUS_24650 5879 6274 gene locus_tag LOCUS_24660 5879 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence68 117 1274 gene locus_tag LOCUS_24670 117 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1295 1861 gene locus_tag LOCUS_24680 1295 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2161 1892 gene locus_tag LOCUS_24690 2161 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 2371 2198 gene locus_tag LOCUS_24700 2371 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 3585 2368 gene locus_tag LOCUS_24710 3585 2368 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890088.1 protein_id gnl|my_center|LOCUS_24710 5881 3593 gene locus_tag LOCUS_24720 5881 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence69 5 2005 gene locus_tag LOCUS_24730 5 2005 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878688.1 protein_id gnl|my_center|LOCUS_24730 2984 1980 gene locus_tag LOCUS_24740 2984 1980 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878393.1 protein_id gnl|my_center|LOCUS_24740 3419 5068 gene locus_tag LOCUS_24750 gene argS 3419 5068 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878394.1 protein_id gnl|my_center|LOCUS_24750 5278 5805 gene locus_tag LOCUS_24760 5278 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence70 335 54 gene locus_tag LOCUS_24770 335 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 781 536 gene locus_tag LOCUS_24780 781 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1083 778 gene locus_tag LOCUS_24790 1083 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1682 1155 gene locus_tag LOCUS_24800 1682 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 1927 1661 gene locus_tag LOCUS_24810 1927 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 2000 2164 gene locus_tag LOCUS_24820 2000 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 4018 2195 gene locus_tag LOCUS_24830 4018 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 4399 4091 gene locus_tag LOCUS_24840 4399 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 4604 4404 gene locus_tag LOCUS_24850 4604 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 4770 4588 gene locus_tag LOCUS_24860 4770 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 5339 4983 gene locus_tag LOCUS_24870 5339 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 5871 5689 gene locus_tag LOCUS_24880 5871 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence71 215 889 gene locus_tag LOCUS_24890 215 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 4347 1270 gene locus_tag LOCUS_24900 4347 1270 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064497003.1 protein_id gnl|my_center|LOCUS_24900 4429 4617 gene locus_tag LOCUS_24910 4429 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 4900 5196 gene locus_tag LOCUS_24920 4900 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence72 155 517 gene locus_tag LOCUS_24930 155 517 CDS product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496415.1 protein_id gnl|my_center|LOCUS_24930 622 1749 gene locus_tag LOCUS_24940 622 1749 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878673.1 protein_id gnl|my_center|LOCUS_24940 2355 2011 gene locus_tag LOCUS_24950 2355 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2700 2371 gene locus_tag LOCUS_24960 2700 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 3265 2720 gene locus_tag LOCUS_24970 3265 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 3419 3231 gene locus_tag LOCUS_24980 3419 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence73 40 204 gene locus_tag LOCUS_24990 40 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 930 580 gene locus_tag LOCUS_25000 930 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 1643 933 gene locus_tag LOCUS_25010 1643 933 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_25010 1866 1705 gene locus_tag LOCUS_25020 1866 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 2195 1974 gene locus_tag LOCUS_25030 2195 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2419 2246 gene locus_tag LOCUS_25040 2419 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 4089 4598 gene locus_tag LOCUS_25050 4089 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 4613 5026 gene locus_tag LOCUS_25060 4613 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence74 934 722 gene locus_tag LOCUS_25070 934 722 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_25070 1169 1241 gene locus_tag LOCUS_t00380 1169 1241 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1653 2078 gene locus_tag LOCUS_25080 1653 2078 CDS product type IV pilin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089668700.1 protein_id gnl|my_center|LOCUS_25080 2510 2358 gene locus_tag LOCUS_25090 2510 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 2786 2616 gene locus_tag LOCUS_25100 2786 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 2955 3149 gene locus_tag LOCUS_25110 2955 3149 CDS product antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879701.1 protein_id gnl|my_center|LOCUS_25110 3134 3460 gene locus_tag LOCUS_25120 3134 3460 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878576.1 protein_id gnl|my_center|LOCUS_25120 3509 3700 gene locus_tag LOCUS_25130 3509 3700 CDS product antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878581.1 protein_id gnl|my_center|LOCUS_25130 3684 4148 gene locus_tag LOCUS_25140 3684 4148 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052747714.1 protein_id gnl|my_center|LOCUS_25140 4584 4324 gene locus_tag LOCUS_25150 4584 4324 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879831.1 protein_id gnl|my_center|LOCUS_25150 4789 4574 gene locus_tag LOCUS_25160 4789 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 >Feature sequence75 124 1059 gene locus_tag LOCUS_25170 124 1059 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_25170 1298 1071 gene locus_tag LOCUS_25180 1298 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 1740 1667 gene locus_tag LOCUS_t00390 1740 1667 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4031 1767 gene locus_tag LOCUS_25190 4031 1767 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878955.1 protein_id gnl|my_center|LOCUS_25190 4102 4419 gene locus_tag LOCUS_25200 4102 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878954.1 protein_id gnl|my_center|LOCUS_25200 4461 4533 gene locus_tag LOCUS_t00400 4461 4533 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence76 1027 1596 gene locus_tag LOCUS_25210 1027 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 1593 2423 gene locus_tag LOCUS_25220 1593 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2433 3098 gene locus_tag LOCUS_25230 2433 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 3285 3515 gene locus_tag LOCUS_25240 3285 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 >Feature sequence77 226 450 gene locus_tag LOCUS_25250 226 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 457 603 gene locus_tag LOCUS_25260 457 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 1113 1394 gene locus_tag LOCUS_25270 1113 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1394 1597 gene locus_tag LOCUS_25280 1394 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 1600 2361 gene locus_tag LOCUS_25290 1600 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 2514 3029 gene locus_tag LOCUS_25300 2514 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 3034 3198 gene locus_tag LOCUS_25310 3034 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 3195 3788 gene locus_tag LOCUS_25320 3195 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 >Feature sequence78 125 1096 gene locus_tag LOCUS_25330 125 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 1101 2858 gene locus_tag LOCUS_25340 gene shc 1101 2858 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_25340 2845 4020 gene locus_tag LOCUS_25350 2845 4020 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879080.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence79 <3882 426 gene locus_tag LOCUS_25360 <3882 426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871043.1:ATP-dependent RecD-like DNA helicase >Feature sequence80 1567 2985 gene locus_tag LOCUS_25370 1567 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 2982 3278 gene locus_tag LOCUS_25380 2982 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 3286 3438 gene locus_tag LOCUS_25390 3286 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 3428 3694 gene locus_tag LOCUS_25400 3428 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250300.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence81 <1 636 gene locus_tag LOCUS_25410 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879005.1:sulfite exporter TauE/SafE family protein 1068 652 gene locus_tag LOCUS_25420 1068 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068541849.1 protein_id gnl|my_center|LOCUS_25420 1935 1078 gene locus_tag LOCUS_25430 1935 1078 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879058.1 protein_id gnl|my_center|LOCUS_25430 2477 2058 gene locus_tag LOCUS_25440 2477 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879057.1 protein_id gnl|my_center|LOCUS_25440 3180 2569 gene locus_tag LOCUS_25450 3180 2569 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877640.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence82 317 72 gene locus_tag LOCUS_25460 317 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 1252 314 gene locus_tag LOCUS_25470 1252 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1594 1253 gene locus_tag LOCUS_25480 1594 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 2999 1581 gene locus_tag LOCUS_25490 2999 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 3202 2999 gene locus_tag LOCUS_25500 3202 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence83 <1 1176 gene locus_tag LOCUS_25510 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879805.1:radical SAM protein 1173 1697 gene locus_tag LOCUS_25520 1173 1697 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879804.1 protein_id gnl|my_center|LOCUS_25520 1697 2173 gene locus_tag LOCUS_25530 1697 2173 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879803.1 protein_id gnl|my_center|LOCUS_25530 2583 2134 gene locus_tag LOCUS_25540 2583 2134 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879802.1 protein_id gnl|my_center|LOCUS_25540 3113 2628 gene locus_tag LOCUS_25550 3113 2628 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094384.1 protein_id gnl|my_center|LOCUS_25550 3305 3123 gene locus_tag LOCUS_25560 3305 3123 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064556.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence84 530 390 gene locus_tag LOCUS_25570 530 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 878 612 gene locus_tag LOCUS_25580 878 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 968 1636 gene locus_tag LOCUS_25590 968 1636 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878003.1 protein_id gnl|my_center|LOCUS_25590 2043 1810 gene locus_tag LOCUS_25600 2043 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25600 2364 2143 gene locus_tag LOCUS_25610 2364 2143 CDS product antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868316.1 protein_id gnl|my_center|LOCUS_25610 2806 2387 gene locus_tag LOCUS_25620 2806 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 3132 2962 gene locus_tag LOCUS_25630 3132 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 3423 3163 gene locus_tag LOCUS_25640 3423 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence85 1114 767 gene locus_tag LOCUS_25650 1114 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 2534 1083 gene locus_tag LOCUS_25660 2534 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2875 2531 gene locus_tag LOCUS_25670 2875 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 3069 2875 gene locus_tag LOCUS_25680 3069 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 >Feature sequence86 1574 360 gene locus_tag LOCUS_25690 1574 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 3019 1631 gene locus_tag LOCUS_25700 3019 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 >Feature sequence87 928 206 gene locus_tag LOCUS_25710 928 206 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879761.1 protein_id gnl|my_center|LOCUS_25710 2283 922 gene locus_tag LOCUS_25720 2283 922 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878825.1 protein_id gnl|my_center|LOCUS_25720 3078 2314 gene locus_tag LOCUS_25730 3078 2314 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879760.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence88 602 1555 gene locus_tag LOCUS_25740 602 1555 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024326.1 protein_id gnl|my_center|LOCUS_25740 1722 1603 gene locus_tag LOCUS_25750 1722 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 3170 1809 gene locus_tag LOCUS_25760 3170 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence89 <1 2355 gene locus_tag LOCUS_25770 <1 2355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877688.1:molybdopterin-dependent oxidoreductase >Feature sequence90 <1 1419 gene locus_tag LOCUS_25780 <1 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202319808.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein 1604 2617 gene locus_tag LOCUS_25790 1604 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877545.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence91 86 280 gene locus_tag LOCUS_25800 86 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 290 664 gene locus_tag LOCUS_25810 290 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 685 1611 gene locus_tag LOCUS_25820 685 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 1633 2235 gene locus_tag LOCUS_25830 1633 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 <2916 2253 gene locus_tag LOCUS_25840 <2916 2253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_070105199.1:integrase >Feature sequence92 49 462 gene locus_tag LOCUS_25850 49 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 573 1559 gene locus_tag LOCUS_25860 573 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1537 1746 gene locus_tag LOCUS_25870 1537 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 1919 2212 gene locus_tag LOCUS_25880 1919 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 2684 2547 gene locus_tag LOCUS_25890 2684 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence93 91 213 gene locus_tag LOCUS_25900 91 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 264 425 gene locus_tag LOCUS_25910 264 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 406 648 gene locus_tag LOCUS_25920 406 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 653 2578 gene locus_tag LOCUS_25930 653 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930