>Feature sequence001 <1 819 gene locus_tag LOCUS_00010 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275358.1:efflux RND transporter periplasmic adaptor subunit 809 1483 gene locus_tag LOCUS_00020 809 1483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895848.1 protein_id gnl|my_center|LOCUS_00020 1470 2675 gene locus_tag LOCUS_00030 1470 2675 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_00030 2726 6691 gene locus_tag LOCUS_00040 2726 6691 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545562.1 protein_id gnl|my_center|LOCUS_00040 6688 9360 gene locus_tag LOCUS_00050 6688 9360 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546673.1 protein_id gnl|my_center|LOCUS_00050 9372 9890 gene locus_tag LOCUS_00060 9372 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 10343 9891 gene locus_tag LOCUS_00070 10343 9891 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_00070 11290 10334 gene locus_tag LOCUS_00080 11290 10334 CDS product bifunctional 3-dehydroquinate synthase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545527.1 protein_id gnl|my_center|LOCUS_00080 11411 11935 gene locus_tag LOCUS_00090 11411 11935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12783 11971 gene locus_tag LOCUS_00100 12783 11971 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_00100 13856 12780 gene locus_tag LOCUS_00110 13856 12780 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_00110 14854 13853 gene locus_tag LOCUS_00120 14854 13853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15015 15347 gene locus_tag LOCUS_00130 15015 15347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15684 15872 gene locus_tag LOCUS_00140 15684 15872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15869 16159 gene locus_tag LOCUS_00150 15869 16159 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921693.1 protein_id gnl|my_center|LOCUS_00150 16455 16724 gene locus_tag LOCUS_00160 16455 16724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 >Feature sequence002 363 3068 gene locus_tag LOCUS_00170 363 3068 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546673.1 protein_id gnl|my_center|LOCUS_00170 3034 3597 gene locus_tag LOCUS_00180 3034 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 4079 3600 gene locus_tag LOCUS_00190 4079 3600 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_00190 4989 4033 gene locus_tag LOCUS_00200 4989 4033 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_00200 5042 5482 gene locus_tag LOCUS_00210 5042 5482 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532958.1 protein_id gnl|my_center|LOCUS_00210 5479 6513 gene locus_tag LOCUS_00220 5479 6513 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583289.1 protein_id gnl|my_center|LOCUS_00220 7373 6531 gene locus_tag LOCUS_00230 7373 6531 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_00230 7751 7380 gene locus_tag LOCUS_00240 gene nifU 7751 7380 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_00240 8929 7733 gene locus_tag LOCUS_00250 8929 7733 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880446.1 protein_id gnl|my_center|LOCUS_00250 9225 8926 gene locus_tag LOCUS_00260 9225 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 9655 9212 gene locus_tag LOCUS_00270 9655 9212 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_00270 9771 11351 gene locus_tag LOCUS_00280 9771 11351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 11504 13087 gene locus_tag LOCUS_00290 11504 13087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 14127 13084 gene locus_tag LOCUS_00300 14127 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 14935 14129 gene locus_tag LOCUS_00310 14935 14129 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881445.1 protein_id gnl|my_center|LOCUS_00310 15840 14929 gene locus_tag LOCUS_00320 15840 14929 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_00320 >Feature sequence003 2187 808 gene locus_tag LOCUS_00330 2187 808 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963764.1 protein_id gnl|my_center|LOCUS_00330 3468 2248 gene locus_tag LOCUS_00340 3468 2248 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_00340 4142 3465 gene locus_tag LOCUS_00350 4142 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 5430 4189 gene locus_tag LOCUS_00360 5430 4189 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940649.1 protein_id gnl|my_center|LOCUS_00360 5831 5427 gene locus_tag LOCUS_00370 5831 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 7060 5852 gene locus_tag LOCUS_00380 7060 5852 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_00380 7149 8453 gene locus_tag LOCUS_00390 7149 8453 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_00390 10100 8457 gene locus_tag LOCUS_00400 10100 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 10612 10157 gene locus_tag LOCUS_00410 10612 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 11993 11064 gene locus_tag LOCUS_00420 11993 11064 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 protein_id gnl|my_center|LOCUS_00420 13349 12048 gene locus_tag LOCUS_00430 13349 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 13501 14520 gene locus_tag LOCUS_00440 13501 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 >Feature sequence004 752 1129 gene locus_tag LOCUS_00450 752 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 1311 1499 gene locus_tag LOCUS_00460 1311 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 1571 2317 gene locus_tag LOCUS_00470 1571 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 2965 2303 gene locus_tag LOCUS_00480 2965 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 3174 2965 gene locus_tag LOCUS_00490 3174 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 4449 3232 gene locus_tag LOCUS_00500 4449 3232 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943906.1 protein_id gnl|my_center|LOCUS_00500 4569 4853 gene locus_tag LOCUS_00510 4569 4853 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_00510 4865 5824 gene locus_tag LOCUS_00520 gene bioB 4865 5824 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546730.1 protein_id gnl|my_center|LOCUS_00520 5821 6636 gene locus_tag LOCUS_00530 5821 6636 CDS product 6-carboxyhexanoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051345777.1 protein_id gnl|my_center|LOCUS_00530 6590 7480 gene locus_tag LOCUS_00540 6590 7480 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545034.1 protein_id gnl|my_center|LOCUS_00540 7636 7836 gene locus_tag LOCUS_00550 7636 7836 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129735.1 protein_id gnl|my_center|LOCUS_00550 7955 8029 gene locus_tag LOCUS_t00010 7955 8029 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8144 9820 gene locus_tag LOCUS_00560 gene thrS 8144 9820 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_00560 9905 10321 gene locus_tag LOCUS_00570 9905 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 10416 10610 gene locus_tag LOCUS_00580 gene rpmI 10416 10610 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_00580 10634 10993 gene locus_tag LOCUS_00590 gene rplT 10634 10993 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545766.1 protein_id gnl|my_center|LOCUS_00590 10983 11999 gene locus_tag LOCUS_00600 gene pheS 10983 11999 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546774.1 protein_id gnl|my_center|LOCUS_00600 12016 14067 gene locus_tag LOCUS_00610 gene pheT 12016 14067 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545282.1 protein_id gnl|my_center|LOCUS_00610 >Feature sequence005 1108 92 gene locus_tag LOCUS_00620 gene ilvC 1108 92 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545824.1 protein_id gnl|my_center|LOCUS_00620 1602 1105 gene locus_tag LOCUS_00630 gene ilvN 1602 1105 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_00630 3388 1658 gene locus_tag LOCUS_00640 gene ilvB 3388 1658 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_00640 5075 3408 gene locus_tag LOCUS_00650 gene ilvD 5075 3408 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546643.1 protein_id gnl|my_center|LOCUS_00650 5368 5135 gene locus_tag LOCUS_00660 5368 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 5491 6864 gene locus_tag LOCUS_00670 5491 6864 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545153.1 protein_id gnl|my_center|LOCUS_00670 7712 6876 gene locus_tag LOCUS_00680 gene truA 7712 6876 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_00680 8501 7731 gene locus_tag LOCUS_00690 8501 7731 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207575.1 protein_id gnl|my_center|LOCUS_00690 8784 9023 gene locus_tag LOCUS_00700 8784 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 9013 9390 gene locus_tag LOCUS_00710 9013 9390 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770889.1 protein_id gnl|my_center|LOCUS_00710 9453 9644 gene locus_tag LOCUS_00720 9453 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 9755 11290 gene locus_tag LOCUS_00730 9755 11290 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_00730 11454 11966 gene locus_tag LOCUS_00740 11454 11966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 13018 11978 gene locus_tag LOCUS_00750 13018 11978 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546360.1 protein_id gnl|my_center|LOCUS_00750 >Feature sequence006 681 28 gene locus_tag LOCUS_00760 681 28 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942031.1 protein_id gnl|my_center|LOCUS_00760 1679 684 gene locus_tag LOCUS_00770 gene amrS 1679 684 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_00770 1920 2465 gene locus_tag LOCUS_00780 1920 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 3607 2714 gene locus_tag LOCUS_00790 gene lpxC 3607 2714 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546610.1 protein_id gnl|my_center|LOCUS_00790 5108 3714 gene locus_tag LOCUS_00800 5108 3714 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545210.1 protein_id gnl|my_center|LOCUS_00800 5237 6025 gene locus_tag LOCUS_00810 gene mtnP 5237 6025 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_00810 6121 6957 gene locus_tag LOCUS_00820 gene gspC 6121 6957 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940998.1 protein_id gnl|my_center|LOCUS_00820 6972 8927 gene locus_tag LOCUS_00830 gene gspD 6972 8927 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017090.1 protein_id gnl|my_center|LOCUS_00830 8929 10458 gene locus_tag LOCUS_00840 gene gspE 8929 10458 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_00840 10491 11666 gene locus_tag LOCUS_00850 gene gspF 10491 11666 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940995.1 protein_id gnl|my_center|LOCUS_00850 <12826 11674 gene locus_tag LOCUS_00860 <12826 11674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990661.1:CapA family protein >Feature sequence007 2167 1091 gene locus_tag LOCUS_00870 2167 1091 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104563.1 protein_id gnl|my_center|LOCUS_00870 4188 2194 gene locus_tag LOCUS_00880 4188 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00880 5305 4265 gene locus_tag LOCUS_00890 5305 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00890 6780 5302 gene locus_tag LOCUS_00900 6780 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 7543 6788 gene locus_tag LOCUS_00910 7543 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 9238 8366 gene locus_tag LOCUS_00920 gene speB 9238 8366 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_00920 9787 9239 gene locus_tag LOCUS_00930 9787 9239 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023416.1 protein_id gnl|my_center|LOCUS_00930 10774 9836 gene locus_tag LOCUS_00940 gene folD 10774 9836 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_00940 11314 10796 gene locus_tag LOCUS_00950 11314 10796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 >Feature sequence008 1686 640 gene locus_tag LOCUS_00960 1686 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 2776 1679 gene locus_tag LOCUS_00970 2776 1679 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_00970 4296 2791 gene locus_tag LOCUS_00980 4296 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 5299 4301 gene locus_tag LOCUS_00990 5299 4301 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_00990 6268 5312 gene locus_tag LOCUS_01000 6268 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 7873 6275 gene locus_tag LOCUS_01010 7873 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 9363 7870 gene locus_tag LOCUS_01020 9363 7870 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108520.1 protein_id gnl|my_center|LOCUS_01020 10285 9368 gene locus_tag LOCUS_01030 10285 9368 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875987.1 protein_id gnl|my_center|LOCUS_01030 11205 10282 gene locus_tag LOCUS_01040 11205 10282 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_01040 <12432 11279 gene locus_tag LOCUS_01050 <12432 11279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143774.1:polysaccharide biosynthesis tyrosine autokinase >Feature sequence009 1281 289 gene locus_tag LOCUS_01060 1281 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 1667 2329 gene locus_tag LOCUS_01070 1667 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 3363 4181 gene locus_tag LOCUS_01080 3363 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 4900 4178 gene locus_tag LOCUS_01090 4900 4178 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_01090 5732 5490 gene locus_tag LOCUS_01100 5732 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 6681 5755 gene locus_tag LOCUS_01110 6681 5755 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316797.1 protein_id gnl|my_center|LOCUS_01110 7247 6678 gene locus_tag LOCUS_01120 7247 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 8176 7244 gene locus_tag LOCUS_01130 8176 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 9151 8201 gene locus_tag LOCUS_01140 9151 8201 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_01140 9137 10339 gene locus_tag LOCUS_01150 gene pseC 9137 10339 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_01150 10336 11364 gene locus_tag LOCUS_01160 gene rfbB 10336 11364 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_01160 >Feature sequence010 325 164 gene locus_tag LOCUS_01170 325 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 888 328 gene locus_tag LOCUS_01180 gene folE 888 328 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545785.1 protein_id gnl|my_center|LOCUS_01180 1576 989 gene locus_tag LOCUS_01190 1576 989 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_01190 2352 1573 gene locus_tag LOCUS_01200 2352 1573 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_01200 2617 4116 gene locus_tag LOCUS_01210 2617 4116 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064509.1 protein_id gnl|my_center|LOCUS_01210 4202 4127 gene locus_tag LOCUS_t00020 4202 4127 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4331 8338 gene locus_tag LOCUS_01220 4331 8338 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545562.1 protein_id gnl|my_center|LOCUS_01220 8374 11079 gene locus_tag LOCUS_01230 8374 11079 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546673.1 protein_id gnl|my_center|LOCUS_01230 11045 11608 gene locus_tag LOCUS_01240 11045 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 12090 11611 gene locus_tag LOCUS_01250 12090 11611 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_01250 >Feature sequence011 1028 2101 gene locus_tag LOCUS_01260 1028 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 2203 3195 gene locus_tag LOCUS_01270 2203 3195 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942432.1 protein_id gnl|my_center|LOCUS_01270 3365 4069 gene locus_tag LOCUS_01280 3365 4069 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_01280 4324 5880 gene locus_tag LOCUS_01290 4324 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 5973 6344 gene locus_tag LOCUS_01300 5973 6344 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_01300 6455 7465 gene locus_tag LOCUS_01310 6455 7465 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_01310 7462 7833 gene locus_tag LOCUS_01320 7462 7833 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_01320 7929 8894 gene locus_tag LOCUS_01330 7929 8894 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943842.1 protein_id gnl|my_center|LOCUS_01330 8922 9683 gene locus_tag LOCUS_01340 8922 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 9770 10840 gene locus_tag LOCUS_01350 9770 10840 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942430.1 protein_id gnl|my_center|LOCUS_01350 11027 11806 gene locus_tag LOCUS_01360 11027 11806 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_01360 >Feature sequence012 2956 1259 gene locus_tag LOCUS_01370 2956 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 3262 2960 gene locus_tag LOCUS_01380 3262 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 3455 3291 gene locus_tag LOCUS_01390 3455 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 3756 3484 gene locus_tag LOCUS_01400 3756 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 4706 3780 gene locus_tag LOCUS_01410 4706 3780 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_01410 5105 4794 gene locus_tag LOCUS_01420 5105 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 6008 5118 gene locus_tag LOCUS_01430 gene extKL 6008 5118 CDS product multiheme c-type cytochrome ExtKL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943568.1 protein_id gnl|my_center|LOCUS_01430 6202 6402 gene locus_tag LOCUS_01440 6202 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 6404 6649 gene locus_tag LOCUS_01450 6404 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 6714 8303 gene locus_tag LOCUS_01460 6714 8303 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546525.1 protein_id gnl|my_center|LOCUS_01460 8467 9042 gene locus_tag LOCUS_01470 8467 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 9237 9899 gene locus_tag LOCUS_01480 gene ftsE 9237 9899 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544942.1 protein_id gnl|my_center|LOCUS_01480 10013 10780 gene locus_tag LOCUS_01490 10013 10780 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546092.1 protein_id gnl|my_center|LOCUS_01490 >Feature sequence013 419 1405 gene locus_tag LOCUS_01500 419 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 1497 3164 gene locus_tag LOCUS_01510 1497 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 3630 3998 gene locus_tag LOCUS_01520 3630 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 4013 5167 gene locus_tag LOCUS_01530 4013 5167 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930746.1 protein_id gnl|my_center|LOCUS_01530 5735 6823 gene locus_tag LOCUS_01540 5735 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 6830 8014 gene locus_tag LOCUS_01550 6830 8014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_01550 8958 8011 gene locus_tag LOCUS_01560 8958 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 9056 9724 gene locus_tag LOCUS_01570 9056 9724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 9963 10646 gene locus_tag LOCUS_01580 9963 10646 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_01580 10648 11004 gene locus_tag LOCUS_01590 10648 11004 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393712.1 protein_id gnl|my_center|LOCUS_01590 >Feature sequence014 <1 550 gene locus_tag LOCUS_01600 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546155.1:flagellar motor protein MotB 1668 553 gene locus_tag LOCUS_01610 1668 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 2386 1682 gene locus_tag LOCUS_01620 2386 1682 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545014.1 protein_id gnl|my_center|LOCUS_01620 3172 2423 gene locus_tag LOCUS_01630 3172 2423 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545908.1 protein_id gnl|my_center|LOCUS_01630 3770 3165 gene locus_tag LOCUS_01640 3770 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 4422 3790 gene locus_tag LOCUS_01650 4422 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 4908 4483 gene locus_tag LOCUS_01660 4908 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 6653 4932 gene locus_tag LOCUS_01670 6653 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 8413 6650 gene locus_tag LOCUS_01680 8413 6650 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044916.1 protein_id gnl|my_center|LOCUS_01680 9448 8612 gene locus_tag LOCUS_01690 9448 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 10484 9459 gene locus_tag LOCUS_01700 10484 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 >Feature sequence015 1 351 gene locus_tag LOCUS_01710 1 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 354 1472 gene locus_tag LOCUS_01720 354 1472 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_01720 2830 1484 gene locus_tag LOCUS_01730 2830 1484 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_01730 3138 3326 gene locus_tag LOCUS_01740 3138 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 4614 3463 gene locus_tag LOCUS_01750 4614 3463 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_01750 5185 4622 gene locus_tag LOCUS_01760 5185 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 5502 5768 gene locus_tag LOCUS_01770 5502 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 6093 6278 gene locus_tag LOCUS_01780 6093 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 6512 7273 gene locus_tag LOCUS_01790 6512 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 7293 8726 gene locus_tag LOCUS_01800 7293 8726 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109667839.1 protein_id gnl|my_center|LOCUS_01800 9094 8939 gene locus_tag LOCUS_01810 9094 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 >Feature sequence016 <1 3470 gene locus_tag LOCUS_01820 <1 3470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940252.1:glycosyltransferase 3807 4901 gene locus_tag LOCUS_01830 3807 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 4928 7282 gene locus_tag LOCUS_01840 4928 7282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 7282 8424 gene locus_tag LOCUS_01850 7282 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 8427 9275 gene locus_tag LOCUS_01860 8427 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 >Feature sequence017 968 1606 gene locus_tag LOCUS_01870 968 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 1609 2337 gene locus_tag LOCUS_01880 1609 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 3277 2924 gene locus_tag LOCUS_01890 3277 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 3695 4006 gene locus_tag LOCUS_01900 3695 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 4066 4293 gene locus_tag LOCUS_01910 4066 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 4370 6094 gene locus_tag LOCUS_01920 4370 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 6099 8024 gene locus_tag LOCUS_01930 6099 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 8098 10074 gene locus_tag LOCUS_01940 8098 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 >Feature sequence018 225 1061 gene locus_tag LOCUS_01950 225 1061 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545594.1 protein_id gnl|my_center|LOCUS_01950 1058 2230 gene locus_tag LOCUS_01960 1058 2230 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546435.1 protein_id gnl|my_center|LOCUS_01960 2244 3350 gene locus_tag LOCUS_01970 gene rseP 2244 3350 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_01970 3684 3403 gene locus_tag LOCUS_01980 3684 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 3880 4389 gene locus_tag LOCUS_01990 3880 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 4434 4793 gene locus_tag LOCUS_02000 4434 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 5827 4790 gene locus_tag LOCUS_02010 5827 4790 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_02010 6082 6993 gene locus_tag LOCUS_02020 6082 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 7082 8197 gene locus_tag LOCUS_02030 7082 8197 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545784.1 protein_id gnl|my_center|LOCUS_02030 >Feature sequence019 <1 2128 gene locus_tag LOCUS_02040 <1 2128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545300.1:PilC/PilY family type IV pilus protein 2252 3217 gene locus_tag LOCUS_02050 2252 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 3241 4578 gene locus_tag LOCUS_02060 3241 4578 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942701.1 protein_id gnl|my_center|LOCUS_02060 4646 4978 gene locus_tag LOCUS_02070 4646 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 6369 4981 gene locus_tag LOCUS_02080 gene asnS 6369 4981 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058304.1 protein_id gnl|my_center|LOCUS_02080 7091 6369 gene locus_tag LOCUS_02090 7091 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 8659 7094 gene locus_tag LOCUS_02100 8659 7094 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818860.1 protein_id gnl|my_center|LOCUS_02100 9393 8707 gene locus_tag LOCUS_02110 gene aat 9393 8707 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947494.1 protein_id gnl|my_center|LOCUS_02110 >Feature sequence020 1139 2188 gene locus_tag LOCUS_02120 1139 2188 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256870.1 protein_id gnl|my_center|LOCUS_02120 3365 2208 gene locus_tag LOCUS_02130 3365 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 4315 3374 gene locus_tag LOCUS_02140 4315 3374 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_02140 4409 5776 gene locus_tag LOCUS_02150 4409 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 6073 5747 gene locus_tag LOCUS_02160 6073 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 7850 6264 gene locus_tag LOCUS_02170 7850 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 <9204 8047 gene locus_tag LOCUS_02180 <9204 8047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136798312.1:glycosyltransferase >Feature sequence021 <1 1713 gene locus_tag LOCUS_02190 <1 1713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544968.1:phosphoribosylformylglycinamidine synthase 2230 1742 gene locus_tag LOCUS_02200 2230 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 4057 2645 gene locus_tag LOCUS_02210 gene atoC 4057 2645 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125283.1 protein_id gnl|my_center|LOCUS_02210 5363 4047 gene locus_tag LOCUS_02220 5363 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 5556 7007 gene locus_tag LOCUS_02230 gene purF 5556 7007 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546301.1 protein_id gnl|my_center|LOCUS_02230 7061 8521 gene locus_tag LOCUS_02240 7061 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 >Feature sequence022 610 1128 gene locus_tag LOCUS_02250 610 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 1829 1146 gene locus_tag LOCUS_02260 1829 1146 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_02260 3478 1826 gene locus_tag LOCUS_02270 3478 1826 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808106.1 protein_id gnl|my_center|LOCUS_02270 3635 3558 gene locus_tag LOCUS_t00030 3635 3558 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4052 3645 gene locus_tag LOCUS_02280 4052 3645 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546816.1 protein_id gnl|my_center|LOCUS_02280 4339 4061 gene locus_tag LOCUS_02290 4339 4061 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_02290 4530 4877 gene locus_tag LOCUS_02300 4530 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 4975 6153 gene locus_tag LOCUS_02310 4975 6153 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546563.1 protein_id gnl|my_center|LOCUS_02310 6154 6630 gene locus_tag LOCUS_02320 gene folK 6154 6630 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_02320 6797 6672 gene locus_tag LOCUS_02330 6797 6672 CDS product desulfoferrodoxin FeS4 iron-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023638.1 protein_id gnl|my_center|LOCUS_02330 7424 6810 gene locus_tag LOCUS_02340 7424 6810 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880277.1 protein_id gnl|my_center|LOCUS_02340 7816 7442 gene locus_tag LOCUS_02350 7816 7442 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870246.1 protein_id gnl|my_center|LOCUS_02350 7978 7841 gene locus_tag LOCUS_02360 7978 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 8223 8029 gene locus_tag LOCUS_02370 8223 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 8654 8220 gene locus_tag LOCUS_02380 8654 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 >Feature sequence023 418 633 gene locus_tag LOCUS_02390 418 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546403.1 protein_id gnl|my_center|LOCUS_02390 3276 625 gene locus_tag LOCUS_02400 3276 625 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546426.1 protein_id gnl|my_center|LOCUS_02400 4786 3317 gene locus_tag LOCUS_02410 gene rpoD 4786 3317 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880967.1 protein_id gnl|my_center|LOCUS_02410 5027 4803 gene locus_tag LOCUS_02420 5027 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 7003 5285 gene locus_tag LOCUS_02430 7003 5285 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943144.1 protein_id gnl|my_center|LOCUS_02430 <8888 7000 gene locus_tag LOCUS_02440 <8888 7000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044978.1:response regulator >Feature sequence024 555 352 gene locus_tag LOCUS_02450 555 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 1715 603 gene locus_tag LOCUS_02460 1715 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 3041 1827 gene locus_tag LOCUS_02470 3041 1827 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225893.1 protein_id gnl|my_center|LOCUS_02470 3505 3107 gene locus_tag LOCUS_02480 3505 3107 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_02480 3957 3502 gene locus_tag LOCUS_02490 3957 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 4280 4050 gene locus_tag LOCUS_02500 4280 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 5526 4294 gene locus_tag LOCUS_02510 gene fabF 5526 4294 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_02510 6385 5633 gene locus_tag LOCUS_02520 gene fabG 6385 5633 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_02520 7785 6724 gene locus_tag LOCUS_02530 7785 6724 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545262.1 protein_id gnl|my_center|LOCUS_02530 8553 7798 gene locus_tag LOCUS_02540 8553 7798 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546084.1 protein_id gnl|my_center|LOCUS_02540 >Feature sequence025 757 2250 gene locus_tag LOCUS_02550 757 2250 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022277.1 protein_id gnl|my_center|LOCUS_02550 3317 2268 gene locus_tag LOCUS_02560 gene rfbB 3317 2268 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771402.1 protein_id gnl|my_center|LOCUS_02560 4192 3314 gene locus_tag LOCUS_02570 gene rfbD 4192 3314 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_02570 5613 4192 gene locus_tag LOCUS_02580 5613 4192 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586529.1 protein_id gnl|my_center|LOCUS_02580 6609 5698 gene locus_tag LOCUS_02590 6609 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 <8729 6622 gene locus_tag LOCUS_02600 <8729 6622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167355190.1:PAS domain-containing protein >Feature sequence026 291 1379 gene locus_tag LOCUS_02610 gene ugpC 291 1379 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972369.1 protein_id gnl|my_center|LOCUS_02610 3519 1402 gene locus_tag LOCUS_02620 3519 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 5140 3521 gene locus_tag LOCUS_02630 5140 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 8272 5279 gene locus_tag LOCUS_02640 8272 5279 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461973.1 protein_id gnl|my_center|LOCUS_02640 >Feature sequence027 401 721 gene locus_tag LOCUS_02650 401 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 749 1123 gene locus_tag LOCUS_02660 gene queD 749 1123 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_02660 1591 1130 gene locus_tag LOCUS_02670 1591 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 2594 1650 gene locus_tag LOCUS_02680 2594 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 3212 2613 gene locus_tag LOCUS_02690 3212 2613 CDS product type IV pilus minor pilin PilX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942677.1 protein_id gnl|my_center|LOCUS_02690 4510 3254 gene locus_tag LOCUS_02700 4510 3254 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942678.1 protein_id gnl|my_center|LOCUS_02700 4941 4507 gene locus_tag LOCUS_02710 4941 4507 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942679.1 protein_id gnl|my_center|LOCUS_02710 5470 4916 gene locus_tag LOCUS_02720 5470 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 8410 5483 gene locus_tag LOCUS_02730 8410 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 >Feature sequence028 22 726 gene locus_tag LOCUS_02740 22 726 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_02740 723 2903 gene locus_tag LOCUS_02750 723 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2916 3854 gene locus_tag LOCUS_02760 2916 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 6078 3856 gene locus_tag LOCUS_02770 6078 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 7811 6348 gene locus_tag LOCUS_02780 7811 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 >Feature sequence029 <1 542 gene locus_tag LOCUS_02790 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924852.1:septal ring lytic transglycosylase RlpA family protein 862 620 gene locus_tag LOCUS_02800 862 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 2345 879 gene locus_tag LOCUS_02810 2345 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 2596 3036 gene locus_tag LOCUS_02820 2596 3036 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_02820 3049 4017 gene locus_tag LOCUS_02830 3049 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 4638 4045 gene locus_tag LOCUS_02840 4638 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 4770 5189 gene locus_tag LOCUS_02850 4770 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 5189 6691 gene locus_tag LOCUS_02860 5189 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 7140 6688 gene locus_tag LOCUS_02870 7140 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 <8151 7383 gene locus_tag LOCUS_02880 <8151 7383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943825.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence030 227 607 gene locus_tag LOCUS_02890 227 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 567 2960 gene locus_tag LOCUS_02900 gene prsT 567 2960 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_02900 2981 4342 gene locus_tag LOCUS_02910 2981 4342 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_02910 4347 5156 gene locus_tag LOCUS_02920 4347 5156 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942629.1 protein_id gnl|my_center|LOCUS_02920 5214 6770 gene locus_tag LOCUS_02930 5214 6770 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942628.1 protein_id gnl|my_center|LOCUS_02930 6767 7606 gene locus_tag LOCUS_02940 6767 7606 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942627.1 protein_id gnl|my_center|LOCUS_02940 >Feature sequence031 101 556 gene locus_tag LOCUS_02950 gene gspG 101 556 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_02950 636 1070 gene locus_tag LOCUS_02960 636 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 1051 1416 gene locus_tag LOCUS_02970 1051 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 1403 2044 gene locus_tag LOCUS_02980 1403 2044 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940991.1 protein_id gnl|my_center|LOCUS_02980 2041 2907 gene locus_tag LOCUS_02990 gene gspK 2041 2907 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121457.1 protein_id gnl|my_center|LOCUS_02990 2908 3969 gene locus_tag LOCUS_03000 2908 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 3966 4481 gene locus_tag LOCUS_03010 3966 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 4488 5291 gene locus_tag LOCUS_03020 4488 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 5413 5787 gene locus_tag LOCUS_03030 5413 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 6396 5818 gene locus_tag LOCUS_03040 6396 5818 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546460.1 protein_id gnl|my_center|LOCUS_03040 7325 6393 gene locus_tag LOCUS_03050 7325 6393 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_03050 >Feature sequence032 739 329 gene locus_tag LOCUS_03060 739 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 2318 912 gene locus_tag LOCUS_03070 2318 912 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937797.1 protein_id gnl|my_center|LOCUS_03070 3946 2321 gene locus_tag LOCUS_03080 3946 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 4453 4103 gene locus_tag LOCUS_03090 4453 4103 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546385.1 protein_id gnl|my_center|LOCUS_03090 7570 4490 gene locus_tag LOCUS_03100 7570 4490 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544939.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence033 1700 288 gene locus_tag LOCUS_03110 gene gltX 1700 288 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545418.1 protein_id gnl|my_center|LOCUS_03110 2604 1771 gene locus_tag LOCUS_03120 gene modA 2604 1771 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_03120 3551 2661 gene locus_tag LOCUS_03130 3551 2661 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881054.1 protein_id gnl|my_center|LOCUS_03130 3689 7030 gene locus_tag LOCUS_03140 3689 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 >Feature sequence034 137 955 gene locus_tag LOCUS_03150 137 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 968 1330 gene locus_tag LOCUS_03160 968 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 1334 1627 gene locus_tag LOCUS_03170 1334 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 1624 1998 gene locus_tag LOCUS_03180 1624 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 2050 2208 gene locus_tag LOCUS_03190 2050 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 2621 2839 gene locus_tag LOCUS_03200 2621 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 3319 3771 gene locus_tag LOCUS_03210 3319 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 3758 4180 gene locus_tag LOCUS_03220 3758 4180 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250426.1 protein_id gnl|my_center|LOCUS_03220 5388 4597 gene locus_tag LOCUS_03230 5388 4597 CDS product inorganic polyphosphate/ATP-NAD kinase (Poly(P)/ATP NAD kinase) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546481.1 protein_id gnl|my_center|LOCUS_03230 6467 5421 gene locus_tag LOCUS_03240 6467 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 7027 6464 gene locus_tag LOCUS_03250 7027 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 <7766 7031 gene locus_tag LOCUS_03260 <7766 7031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545436.1:excinuclease ABC subunit UvrC >Feature sequence035 591 1739 gene locus_tag LOCUS_03270 gene nirJ1 591 1739 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966081.1 protein_id gnl|my_center|LOCUS_03270 1685 2440 gene locus_tag LOCUS_03280 1685 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 2444 3517 gene locus_tag LOCUS_03290 2444 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 4793 5164 gene locus_tag LOCUS_03300 4793 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 5479 5261 gene locus_tag LOCUS_03310 5479 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 6630 7067 gene locus_tag LOCUS_03320 6630 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 <7611 7062 gene locus_tag LOCUS_03330 <7611 7062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225996815.1:glycosyltransferase family 4 protein >Feature sequence036 846 475 gene locus_tag LOCUS_03340 gene rpsL 846 475 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_03340 1748 1083 gene locus_tag LOCUS_03350 1748 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 3145 1769 gene locus_tag LOCUS_03360 3145 1769 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_03360 4038 3169 gene locus_tag LOCUS_03370 gene speB 4038 3169 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_03370 4611 4060 gene locus_tag LOCUS_03380 4611 4060 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023416.1 protein_id gnl|my_center|LOCUS_03380 4754 5377 gene locus_tag LOCUS_03390 gene hisH 4754 5377 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_03390 5433 5882 gene locus_tag LOCUS_03400 5433 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 6052 7365 gene locus_tag LOCUS_03410 6052 7365 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence037 2093 963 gene locus_tag LOCUS_03420 2093 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 3044 2256 gene locus_tag LOCUS_03430 3044 2256 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_03430 5390 3063 gene locus_tag LOCUS_03440 5390 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 6626 5439 gene locus_tag LOCUS_03450 6626 5439 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881436.1 protein_id gnl|my_center|LOCUS_03450 6892 6629 gene locus_tag LOCUS_03460 6892 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 7263 6913 gene locus_tag LOCUS_03470 7263 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 >Feature sequence038 516 1286 gene locus_tag LOCUS_03480 gene trpA 516 1286 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546593.1 protein_id gnl|my_center|LOCUS_03480 1288 2121 gene locus_tag LOCUS_03490 gene accD 1288 2121 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_03490 2123 3448 gene locus_tag LOCUS_03500 2123 3448 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544919.1 protein_id gnl|my_center|LOCUS_03500 3409 5469 gene locus_tag LOCUS_03510 3409 5469 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545799.1 protein_id gnl|my_center|LOCUS_03510 6228 5470 gene locus_tag LOCUS_03520 gene mazG 6228 5470 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_03520 6314 6886 gene locus_tag LOCUS_03530 6314 6886 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877282.1 protein_id gnl|my_center|LOCUS_03530 >Feature sequence039 1572 1497 gene locus_tag LOCUS_t00040 1572 1497 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1777 1631 gene locus_tag LOCUS_03540 1777 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 2403 1858 gene locus_tag LOCUS_03550 2403 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 2953 2660 gene locus_tag LOCUS_03560 2953 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03560 3828 2902 gene locus_tag LOCUS_03570 3828 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03570 4114 3755 gene locus_tag LOCUS_03580 4114 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 4523 4119 gene locus_tag LOCUS_03590 4523 4119 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080552.1 protein_id gnl|my_center|LOCUS_03590 4840 4520 gene locus_tag LOCUS_03600 4840 4520 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582526.1 protein_id gnl|my_center|LOCUS_03600 5943 5014 gene locus_tag LOCUS_03610 5943 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 <7415 6026 gene locus_tag LOCUS_03620 <7415 6026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228378.1:DUF1156 domain-containing protein >Feature sequence040 <1 749 gene locus_tag LOCUS_03630 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942879.1:YicC family protein 819 1079 gene locus_tag LOCUS_03640 819 1079 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545639.1 protein_id gnl|my_center|LOCUS_03640 1076 1711 gene locus_tag LOCUS_03650 gene gmk 1076 1711 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546551.1 protein_id gnl|my_center|LOCUS_03650 1737 2123 gene locus_tag LOCUS_03660 gene rpoZ 1737 2123 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545675.1 protein_id gnl|my_center|LOCUS_03660 2123 3298 gene locus_tag LOCUS_03670 gene coaBC 2123 3298 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_03670 3411 3866 gene locus_tag LOCUS_03680 gene aroQ 3411 3866 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_03680 3838 4911 gene locus_tag LOCUS_03690 gene papA 3838 4911 CDS product aminopeptidase PapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230224.1 protein_id gnl|my_center|LOCUS_03690 4972 5532 gene locus_tag LOCUS_03700 gene efp 4972 5532 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545338.1 protein_id gnl|my_center|LOCUS_03700 5532 5975 gene locus_tag LOCUS_03710 gene accB 5532 5975 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545496.1 protein_id gnl|my_center|LOCUS_03710 5972 7312 gene locus_tag LOCUS_03720 gene accC 5972 7312 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546633.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence041 1366 68 gene locus_tag LOCUS_03730 1366 68 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941684.1 protein_id gnl|my_center|LOCUS_03730 2675 1368 gene locus_tag LOCUS_03740 2675 1368 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_03740 3661 2753 gene locus_tag LOCUS_03750 3661 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_03750 3800 3973 gene locus_tag LOCUS_03760 3800 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3933 4193 gene locus_tag LOCUS_03770 3933 4193 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927120.1 protein_id gnl|my_center|LOCUS_03770 4434 5720 gene locus_tag LOCUS_03780 4434 5720 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546645.1 protein_id gnl|my_center|LOCUS_03780 5720 6352 gene locus_tag LOCUS_03790 5720 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 >Feature sequence042 1285 467 gene locus_tag LOCUS_03800 1285 467 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_03800 2737 1298 gene locus_tag LOCUS_03810 2737 1298 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 protein_id gnl|my_center|LOCUS_03810 3193 2765 gene locus_tag LOCUS_03820 3193 2765 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545771.1 protein_id gnl|my_center|LOCUS_03820 5060 3402 gene locus_tag LOCUS_03830 5060 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 5481 5080 gene locus_tag LOCUS_03840 5481 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 5697 6746 gene locus_tag LOCUS_03850 5697 6746 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545564.1 protein_id gnl|my_center|LOCUS_03850 >Feature sequence043 58 966 gene locus_tag LOCUS_03860 58 966 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461580.1 protein_id gnl|my_center|LOCUS_03860 1951 977 gene locus_tag LOCUS_03870 1951 977 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545846.1 protein_id gnl|my_center|LOCUS_03870 3272 1953 gene locus_tag LOCUS_03880 3272 1953 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_03880 3430 4557 gene locus_tag LOCUS_03890 3430 4557 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_03890 4547 5650 gene locus_tag LOCUS_03900 4547 5650 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545405.1 protein_id gnl|my_center|LOCUS_03900 5755 6771 gene locus_tag LOCUS_03910 5755 6771 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546733.1 protein_id gnl|my_center|LOCUS_03910 >Feature sequence044 <1 1205 gene locus_tag LOCUS_03920 <1 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545891.1:CCA tRNA nucleotidyltransferase 2585 1371 gene locus_tag LOCUS_03930 gene mtaB 2585 1371 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_03930 3967 2651 gene locus_tag LOCUS_03940 gene miaB 3967 2651 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545886.1 protein_id gnl|my_center|LOCUS_03940 4990 4022 gene locus_tag LOCUS_03950 4990 4022 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_03950 5562 5128 gene locus_tag LOCUS_03960 gene dtd 5562 5128 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_03960 5913 5584 gene locus_tag LOCUS_03970 5913 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 <6637 5967 gene locus_tag LOCUS_03980 <6637 5967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583024.1:GIY-YIG nuclease family protein >Feature sequence045 2272 338 gene locus_tag LOCUS_03990 2272 338 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544993.1 protein_id gnl|my_center|LOCUS_03990 3269 2256 gene locus_tag LOCUS_04000 3269 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 4189 3269 gene locus_tag LOCUS_04010 4189 3269 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880102.1 protein_id gnl|my_center|LOCUS_04010 5713 4202 gene locus_tag LOCUS_04020 gene hflX 5713 4202 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545622.1 protein_id gnl|my_center|LOCUS_04020 <6558 5900 gene locus_tag LOCUS_04030 <6558 5900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000412819.1:DNA polymerase I >Feature sequence046 1317 448 gene locus_tag LOCUS_04040 1317 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 1833 1375 gene locus_tag LOCUS_04050 1833 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 2353 1823 gene locus_tag LOCUS_04060 2353 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 2709 2356 gene locus_tag LOCUS_04070 2709 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 3005 2709 gene locus_tag LOCUS_04080 3005 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 3375 2992 gene locus_tag LOCUS_04090 3375 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 4143 3619 gene locus_tag LOCUS_04100 4143 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 4364 4140 gene locus_tag LOCUS_04110 4364 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 4683 4366 gene locus_tag LOCUS_04120 4683 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 4897 4718 gene locus_tag LOCUS_04130 4897 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 5285 5100 gene locus_tag LOCUS_04140 5285 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 5753 5415 gene locus_tag LOCUS_04150 5753 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 >Feature sequence047 2467 1094 gene locus_tag LOCUS_04160 2467 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 4221 2476 gene locus_tag LOCUS_04170 4221 2476 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545469.1 protein_id gnl|my_center|LOCUS_04170 4631 4242 gene locus_tag LOCUS_04180 4631 4242 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546608.1 protein_id gnl|my_center|LOCUS_04180 5019 4612 gene locus_tag LOCUS_04190 5019 4612 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545197.1 protein_id gnl|my_center|LOCUS_04190 5867 5046 gene locus_tag LOCUS_04200 5867 5046 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545471.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence048 2009 1809 gene locus_tag LOCUS_04210 2009 1809 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566521.1 protein_id gnl|my_center|LOCUS_04210 2267 3322 gene locus_tag LOCUS_04220 2267 3322 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_04220 3492 3800 gene locus_tag LOCUS_04230 3492 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 3782 4033 gene locus_tag LOCUS_04240 3782 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 4351 5517 gene locus_tag LOCUS_04250 4351 5517 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_04250 5881 6117 gene locus_tag LOCUS_04260 5881 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 >Feature sequence049 <1 1432 gene locus_tag LOCUS_04270 <1 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082541.1:recombinase family protein 1466 1391 gene locus_tag LOCUS_t00050 1466 1391 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence050 1321 275 gene locus_tag LOCUS_04280 gene argC 1321 275 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_04280 1832 1440 gene locus_tag LOCUS_04290 gene rpsI 1832 1440 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_04290 2281 1838 gene locus_tag LOCUS_04300 gene rplM 2281 1838 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544931.1 protein_id gnl|my_center|LOCUS_04300 2619 3605 gene locus_tag LOCUS_04310 2619 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 3615 4340 gene locus_tag LOCUS_04320 gene hisA 3615 4340 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545163.1 protein_id gnl|my_center|LOCUS_04320 4375 5208 gene locus_tag LOCUS_04330 gene hisF 4375 5208 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545004.1 protein_id gnl|my_center|LOCUS_04330 <6111 5165 gene locus_tag LOCUS_04340 <6111 5165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583848.1:DUF814 domain-containing protein >Feature sequence051 2445 418 gene locus_tag LOCUS_04350 2445 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 3746 2502 gene locus_tag LOCUS_04360 3746 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 <5973 4616 gene locus_tag LOCUS_04370 <5973 4616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964371.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence052 <1 868 gene locus_tag LOCUS_04380 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941672.1:GAF domain-containing protein 1821 865 gene locus_tag LOCUS_04390 1821 865 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_04390 2009 2479 gene locus_tag LOCUS_04400 2009 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 2987 2481 gene locus_tag LOCUS_04410 2987 2481 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943963.1 protein_id gnl|my_center|LOCUS_04410 3884 3183 gene locus_tag LOCUS_04420 gene queC 3884 3183 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545080.1 protein_id gnl|my_center|LOCUS_04420 4552 3917 gene locus_tag LOCUS_04430 gene plsY 4552 3917 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545962.1 protein_id gnl|my_center|LOCUS_04430 5070 4549 gene locus_tag LOCUS_04440 gene pgsA 5070 4549 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546842.1 protein_id gnl|my_center|LOCUS_04440 5593 5063 gene locus_tag LOCUS_04450 5593 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 >Feature sequence053 327 94 gene locus_tag LOCUS_04460 327 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 463 2115 gene locus_tag LOCUS_04470 463 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 2112 3452 gene locus_tag LOCUS_04480 2112 3452 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546410.1 protein_id gnl|my_center|LOCUS_04480 3458 3679 gene locus_tag LOCUS_04490 3458 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 3841 5340 gene locus_tag LOCUS_04500 3841 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 5383 5634 gene locus_tag LOCUS_04510 5383 5634 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080581.1 protein_id gnl|my_center|LOCUS_04510 >Feature sequence054 773 171 gene locus_tag LOCUS_04520 773 171 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_04520 3495 811 gene locus_tag LOCUS_04530 3495 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 3701 4270 gene locus_tag LOCUS_04540 3701 4270 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065212.1 protein_id gnl|my_center|LOCUS_04540 5135 4257 gene locus_tag LOCUS_04550 5135 4257 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719999.1 protein_id gnl|my_center|LOCUS_04550 5741 5244 gene locus_tag LOCUS_04560 5741 5244 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_04560 >Feature sequence055 260 1192 gene locus_tag LOCUS_04570 260 1192 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546739.1 protein_id gnl|my_center|LOCUS_04570 1479 1195 gene locus_tag LOCUS_04580 1479 1195 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_04580 1758 1934 gene locus_tag LOCUS_04590 1758 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04590 1995 2375 gene locus_tag LOCUS_04600 1995 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04600 2455 2829 gene locus_tag LOCUS_04610 2455 2829 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279208.1 protein_id gnl|my_center|LOCUS_04610 2849 4063 gene locus_tag LOCUS_04620 2849 4063 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943906.1 protein_id gnl|my_center|LOCUS_04620 4079 4210 gene locus_tag LOCUS_04630 4079 4210 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943806.1 protein_id gnl|my_center|LOCUS_04630 5713 4211 gene locus_tag LOCUS_04640 5713 4211 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064509.1 protein_id gnl|my_center|LOCUS_04640 >Feature sequence056 1189 224 gene locus_tag LOCUS_04650 gene obgE 1189 224 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545625.1 protein_id gnl|my_center|LOCUS_04650 1333 1734 gene locus_tag LOCUS_04660 1333 1734 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257448.1 protein_id gnl|my_center|LOCUS_04660 1712 2134 gene locus_tag LOCUS_04670 1712 2134 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250426.1 protein_id gnl|my_center|LOCUS_04670 2426 2166 gene locus_tag LOCUS_04680 gene rpmA 2426 2166 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545975.1 protein_id gnl|my_center|LOCUS_04680 2753 2442 gene locus_tag LOCUS_04690 gene rplU 2753 2442 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_04690 4047 2836 gene locus_tag LOCUS_04700 4047 2836 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933267.1 protein_id gnl|my_center|LOCUS_04700 4891 4298 gene locus_tag LOCUS_04710 gene hisB 4891 4298 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546516.1 protein_id gnl|my_center|LOCUS_04710 <5819 4914 gene locus_tag LOCUS_04720 <5819 4914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545615.1:histidinol-phosphate transaminase >Feature sequence057 <1 1003 gene locus_tag LOCUS_04730 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861551.1:glycine--tRNA ligase subunit beta 1117 3843 gene locus_tag LOCUS_04740 gene ppdK 1117 3843 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_04740 4440 3850 gene locus_tag LOCUS_04750 4440 3850 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence058 <1 1585 gene locus_tag LOCUS_04760 <1 1585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_166276588.1:S8 family serine peptidase 2021 1575 gene locus_tag LOCUS_04770 2021 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081148.1 protein_id gnl|my_center|LOCUS_04770 2230 2018 gene locus_tag LOCUS_04780 2230 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 2428 2625 gene locus_tag LOCUS_04790 2428 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 2640 3617 gene locus_tag LOCUS_04800 gene amrS 2640 3617 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_04800 3739 5175 gene locus_tag LOCUS_04810 gene amrB 3739 5175 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_04810 5175 5516 gene locus_tag LOCUS_04820 5175 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 >Feature sequence059 3639 2944 gene locus_tag LOCUS_04830 3639 2944 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792348.1 protein_id gnl|my_center|LOCUS_04830 4129 3785 gene locus_tag LOCUS_04840 4129 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 5028 4129 gene locus_tag LOCUS_04850 5028 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 5176 4982 gene locus_tag LOCUS_04860 5176 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 5537 5277 gene locus_tag LOCUS_04870 5537 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence060 >Feature sequence061 1922 132 gene locus_tag LOCUS_04880 gene uvrC 1922 132 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545436.1 protein_id gnl|my_center|LOCUS_04880 2102 2317 gene locus_tag LOCUS_04890 2102 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 4205 2817 gene locus_tag LOCUS_04900 4205 2817 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942788.1 protein_id gnl|my_center|LOCUS_04900 4878 4195 gene locus_tag LOCUS_04910 4878 4195 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948714.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence062 2418 469 gene locus_tag LOCUS_04920 2418 469 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546396.1 protein_id gnl|my_center|LOCUS_04920 2629 4227 gene locus_tag LOCUS_04930 2629 4227 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_04930 4251 5147 gene locus_tag LOCUS_04940 gene ispE 4251 5147 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545467.1 protein_id gnl|my_center|LOCUS_04940 5149 5223 gene locus_tag LOCUS_t00060 5149 5223 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence063 1635 1069 gene locus_tag LOCUS_04950 1635 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 1767 2249 gene locus_tag LOCUS_04960 1767 2249 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545207.1 protein_id gnl|my_center|LOCUS_04960 3291 2284 gene locus_tag LOCUS_04970 3291 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 3368 3703 gene locus_tag LOCUS_04980 gene hisI 3368 3703 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546303.1 protein_id gnl|my_center|LOCUS_04980 3700 4113 gene locus_tag LOCUS_04990 3700 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 4133 4540 gene locus_tag LOCUS_05000 4133 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence064 <1 2003 gene locus_tag LOCUS_05010 <1 2003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001032106.1:sensory box histidine kinase PhoR 2672 2022 gene locus_tag LOCUS_05020 2672 2022 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545458.1 protein_id gnl|my_center|LOCUS_05020 2894 3259 gene locus_tag LOCUS_05030 gene queF 2894 3259 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546535.1 protein_id gnl|my_center|LOCUS_05030 4064 3300 gene locus_tag LOCUS_05040 gene thiD 4064 3300 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546315.1 protein_id gnl|my_center|LOCUS_05040 4127 4651 gene locus_tag LOCUS_05050 4127 4651 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924863.1 protein_id gnl|my_center|LOCUS_05050 4648 4989 gene locus_tag LOCUS_05060 4648 4989 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546371.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence065 1274 1023 gene locus_tag LOCUS_05070 1274 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 >Feature sequence066 1312 2025 gene locus_tag LOCUS_05080 gene ccsA 1312 2025 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943928.1 protein_id gnl|my_center|LOCUS_05080 2028 2753 gene locus_tag LOCUS_05090 2028 2753 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943929.1 protein_id gnl|my_center|LOCUS_05090 2831 4462 gene locus_tag LOCUS_05100 2831 4462 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545176.1 protein_id gnl|my_center|LOCUS_05100 5403 4468 gene locus_tag LOCUS_05110 5403 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 >Feature sequence067 267 1244 gene locus_tag LOCUS_05120 267 1244 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_05120 1205 2431 gene locus_tag LOCUS_05130 1205 2431 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_05130 2565 3623 gene locus_tag LOCUS_05140 2565 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_05140 3653 4909 gene locus_tag LOCUS_05150 3653 4909 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931016.1 protein_id gnl|my_center|LOCUS_05150 <5583 4906 gene locus_tag LOCUS_05160 <5583 4906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544941.1:beta-ketoacyl-ACP synthase II >Feature sequence068 243 677 gene locus_tag LOCUS_05170 243 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 1381 680 gene locus_tag LOCUS_05180 1381 680 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546542.1 protein_id gnl|my_center|LOCUS_05180 1547 1425 gene locus_tag LOCUS_05190 1547 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 2164 2889 gene locus_tag LOCUS_05200 2164 2889 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_05200 4700 2925 gene locus_tag LOCUS_05210 4700 2925 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964293.1 protein_id gnl|my_center|LOCUS_05210 5202 4768 gene locus_tag LOCUS_05220 gene vapC26 5202 4768 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_05220 5411 5172 gene locus_tag LOCUS_05230 5411 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence069 1211 126 gene locus_tag LOCUS_05240 1211 126 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545543.1 protein_id gnl|my_center|LOCUS_05240 1308 1961 gene locus_tag LOCUS_05250 1308 1961 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_05250 1985 2707 gene locus_tag LOCUS_05260 1985 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 4048 2708 gene locus_tag LOCUS_05270 4048 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 4208 4828 gene locus_tag LOCUS_05280 gene hisH 4208 4828 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_05280 5306 4842 gene locus_tag LOCUS_05290 gene folK 5306 4842 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence070 1445 507 gene locus_tag LOCUS_05300 1445 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 1760 3022 gene locus_tag LOCUS_05310 1760 3022 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_05310 3898 4767 gene locus_tag LOCUS_05320 3898 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 >Feature sequence071 795 139 gene locus_tag LOCUS_05330 795 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 2071 782 gene locus_tag LOCUS_05340 2071 782 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_05340 3150 2182 gene locus_tag LOCUS_05350 3150 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 4535 3147 gene locus_tag LOCUS_05360 4535 3147 CDS product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671216.1 protein_id gnl|my_center|LOCUS_05360 5193 4525 gene locus_tag LOCUS_05370 5193 4525 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390614.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence072 <1 758 gene locus_tag LOCUS_05380 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545539.1:dissimilatory-type sulfite reductase subunit alpha 789 1859 gene locus_tag LOCUS_05390 gene dsrB 789 1859 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546493.1 protein_id gnl|my_center|LOCUS_05390 1998 2246 gene locus_tag LOCUS_05400 1998 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 2370 3767 gene locus_tag LOCUS_05410 gene cobB 2370 3767 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545628.1 protein_id gnl|my_center|LOCUS_05410 3772 4095 gene locus_tag LOCUS_05420 3772 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 4265 4600 gene locus_tag LOCUS_05430 4265 4600 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_05430 4712 5224 gene locus_tag LOCUS_05440 4712 5224 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546412.1 protein_id gnl|my_center|LOCUS_05440 >Feature sequence073 <1 699 gene locus_tag LOCUS_05450 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877788.1:PAS domain S-box protein 897 709 gene locus_tag LOCUS_05460 897 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 1009 2055 gene locus_tag LOCUS_05470 1009 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 2290 3309 gene locus_tag LOCUS_05480 gene hemH 2290 3309 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546394.1 protein_id gnl|my_center|LOCUS_05480 3331 4722 gene locus_tag LOCUS_05490 gene hemG 3331 4722 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545161.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence074 183 656 gene locus_tag LOCUS_05500 183 656 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545419.1 protein_id gnl|my_center|LOCUS_05500 675 1715 gene locus_tag LOCUS_05510 675 1715 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545234.1 protein_id gnl|my_center|LOCUS_05510 1862 2077 gene locus_tag LOCUS_05520 1862 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2064 2636 gene locus_tag LOCUS_05530 2064 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 2708 3022 gene locus_tag LOCUS_05540 gene clpS 2708 3022 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545154.1 protein_id gnl|my_center|LOCUS_05540 3019 5268 gene locus_tag LOCUS_05550 gene clpA 3019 5268 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546336.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence075 257 182 gene locus_tag LOCUS_t00070 257 182 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1159 383 gene locus_tag LOCUS_05560 1159 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 1543 1331 gene locus_tag LOCUS_05570 1543 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 2656 1562 gene locus_tag LOCUS_05580 2656 1562 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393790.1 protein_id gnl|my_center|LOCUS_05580 3722 2892 gene locus_tag LOCUS_05590 gene larE 3722 2892 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_05590 5214 3733 gene locus_tag LOCUS_05600 gene rng 5214 3733 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence076 342 1322 gene locus_tag LOCUS_05610 342 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 1354 1950 gene locus_tag LOCUS_05620 1354 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 1951 3873 gene locus_tag LOCUS_05630 1951 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 4027 4728 gene locus_tag LOCUS_05640 4027 4728 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence077 2277 163 gene locus_tag LOCUS_05650 2277 163 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546392.1 protein_id gnl|my_center|LOCUS_05650 4249 2417 gene locus_tag LOCUS_05660 gene glmS 4249 2417 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545099.1 protein_id gnl|my_center|LOCUS_05660 <5226 4256 gene locus_tag LOCUS_05670 <5226 4256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545497.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU >Feature sequence078 2105 1164 gene locus_tag LOCUS_05680 2105 1164 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941279.1 protein_id gnl|my_center|LOCUS_05680 3934 2177 gene locus_tag LOCUS_05690 3934 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089877.1 protein_id gnl|my_center|LOCUS_05690 4259 4468 gene locus_tag LOCUS_05700 4259 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 >Feature sequence079 1126 1902 gene locus_tag LOCUS_05710 gene mpgP 1126 1902 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228324.1 protein_id gnl|my_center|LOCUS_05710 2642 1845 gene locus_tag LOCUS_05720 gene panB 2642 1845 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545863.1 protein_id gnl|my_center|LOCUS_05720 3083 2646 gene locus_tag LOCUS_05730 3083 2646 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_05730 3933 3061 gene locus_tag LOCUS_05740 gene lgt 3933 3061 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932768.1 protein_id gnl|my_center|LOCUS_05740 5096 4215 gene locus_tag LOCUS_05750 5096 4215 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence080 496 1581 gene locus_tag LOCUS_05760 gene mqnE 496 1581 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546001.1 protein_id gnl|my_center|LOCUS_05760 1874 2917 gene locus_tag LOCUS_05770 gene mqnC 1874 2917 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545015.1 protein_id gnl|my_center|LOCUS_05770 2982 3680 gene locus_tag LOCUS_05780 2982 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3640 4047 gene locus_tag LOCUS_05790 3640 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 4515 4646 gene locus_tag LOCUS_05800 4515 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 >Feature sequence081 134 550 gene locus_tag LOCUS_05810 gene nikR 134 550 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_05810 581 1288 gene locus_tag LOCUS_05820 581 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1303 1506 gene locus_tag LOCUS_05830 1303 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879751.1 protein_id gnl|my_center|LOCUS_05830 1529 2878 gene locus_tag LOCUS_05840 1529 2878 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942701.1 protein_id gnl|my_center|LOCUS_05840 3147 2875 gene locus_tag LOCUS_05850 3147 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 3957 3187 gene locus_tag LOCUS_05860 3957 3187 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546761.1 protein_id gnl|my_center|LOCUS_05860 <5175 3986 gene locus_tag LOCUS_05870 <5175 3986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546843.1:nodulation protein NfeD >Feature sequence082 1973 864 gene locus_tag LOCUS_05880 1973 864 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942099.1 protein_id gnl|my_center|LOCUS_05880 3307 1976 gene locus_tag LOCUS_05890 3307 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3729 3304 gene locus_tag LOCUS_05900 3729 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 3820 4341 gene locus_tag LOCUS_05910 gene def 3820 4341 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_05910 >Feature sequence083 317 39 gene locus_tag LOCUS_05920 317 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 877 386 gene locus_tag LOCUS_05930 877 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 1026 829 gene locus_tag LOCUS_05940 1026 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 2323 1010 gene locus_tag LOCUS_05950 2323 1010 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137617.1 protein_id gnl|my_center|LOCUS_05950 2782 2324 gene locus_tag LOCUS_05960 gene sixA 2782 2324 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_05960 3377 2817 gene locus_tag LOCUS_05970 3377 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 3667 3389 gene locus_tag LOCUS_05980 3667 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 3944 3654 gene locus_tag LOCUS_05990 3944 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05990 4146 3931 gene locus_tag LOCUS_06000 4146 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 4547 4347 gene locus_tag LOCUS_06010 4547 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 <5127 4550 gene locus_tag LOCUS_06020 <5127 4550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546419.1:TdeIII family type II restriction endonuclease >Feature sequence084 <1 777 gene locus_tag LOCUS_06030 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545653.1:acetyl-CoA carboxylase, carboxyltransferase subunit beta 790 2118 gene locus_tag LOCUS_06040 790 2118 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544919.1 protein_id gnl|my_center|LOCUS_06040 2228 4201 gene locus_tag LOCUS_06050 2228 4201 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545799.1 protein_id gnl|my_center|LOCUS_06050 4971 4204 gene locus_tag LOCUS_06060 gene mazG 4971 4204 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence085 404 2125 gene locus_tag LOCUS_06070 404 2125 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943843.1 protein_id gnl|my_center|LOCUS_06070 2146 2874 gene locus_tag LOCUS_06080 2146 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_06080 2887 3447 gene locus_tag LOCUS_06090 2887 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 3437 4207 gene locus_tag LOCUS_06100 3437 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4211 4780 gene locus_tag LOCUS_06110 4211 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence086 2599 1604 gene locus_tag LOCUS_06120 2599 1604 CDS product DmsE family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941884.1 protein_id gnl|my_center|LOCUS_06120 2722 2650 gene locus_tag LOCUS_t00080 2722 2650 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2809 2733 gene locus_tag LOCUS_t00090 2809 2733 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2898 2823 gene locus_tag LOCUS_t00100 2898 2823 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3062 2989 gene locus_tag LOCUS_t00110 3062 2989 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3204 3128 gene locus_tag LOCUS_t00120 3204 3128 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <5035 3289 gene locus_tag LOCUS_06130 <5035 3289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941262.1:ATP-binding protein >Feature sequence087 651 178 gene locus_tag LOCUS_06140 651 178 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082498.1 protein_id gnl|my_center|LOCUS_06140 2096 708 gene locus_tag LOCUS_06150 gene tilS 2096 708 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_06150 2155 3414 gene locus_tag LOCUS_06160 gene lysA 2155 3414 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_06160 3411 4286 gene locus_tag LOCUS_06170 gene dapF 3411 4286 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546632.1 protein_id gnl|my_center|LOCUS_06170 4381 4554 gene locus_tag LOCUS_06180 4381 4554 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546012.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence088 2683 416 gene locus_tag LOCUS_06190 2683 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 3341 2928 gene locus_tag LOCUS_06200 3341 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 3874 3653 gene locus_tag LOCUS_06210 3874 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546436.1 protein_id gnl|my_center|LOCUS_06210 4316 3876 gene locus_tag LOCUS_06220 4316 3876 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence089 847 2385 gene locus_tag LOCUS_06230 847 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2463 3137 gene locus_tag LOCUS_06240 2463 3137 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545041.1 protein_id gnl|my_center|LOCUS_06240 3124 4749 gene locus_tag LOCUS_06250 3124 4749 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence090 2390 471 gene locus_tag LOCUS_06260 gene dnaK 2390 471 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_06260 3010 2396 gene locus_tag LOCUS_06270 gene grpE 3010 2396 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546170.1 protein_id gnl|my_center|LOCUS_06270 4051 3023 gene locus_tag LOCUS_06280 gene hrcA 4051 3023 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545755.1 protein_id gnl|my_center|LOCUS_06280 >Feature sequence091 480 19 gene locus_tag LOCUS_06290 gene ribE 480 19 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545200.1 protein_id gnl|my_center|LOCUS_06290 1734 496 gene locus_tag LOCUS_06300 1734 496 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_06300 2368 1727 gene locus_tag LOCUS_06310 2368 1727 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459819.1 protein_id gnl|my_center|LOCUS_06310 3088 2375 gene locus_tag LOCUS_06320 gene lepB 3088 2375 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_06320 4090 3128 gene locus_tag LOCUS_06330 4090 3128 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545468.1 protein_id gnl|my_center|LOCUS_06330 4388 4146 gene locus_tag LOCUS_06340 4388 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 4676 4410 gene locus_tag LOCUS_06350 4676 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 >Feature sequence092 2757 1999 gene locus_tag LOCUS_06360 gene larB 2757 1999 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_06360 3517 2747 gene locus_tag LOCUS_06370 gene larE 3517 2747 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_06370 4318 3776 gene locus_tag LOCUS_06380 4318 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 4804 4379 gene locus_tag LOCUS_06390 4804 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence093 1432 1986 gene locus_tag LOCUS_06400 1432 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 2426 1989 gene locus_tag LOCUS_06410 2426 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 4175 2469 gene locus_tag LOCUS_06420 4175 2469 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545510.1 protein_id gnl|my_center|LOCUS_06420 4511 4182 gene locus_tag LOCUS_06430 4511 4182 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460053.1 protein_id gnl|my_center|LOCUS_06430 4879 4574 gene locus_tag LOCUS_06440 4879 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence094 293 1126 gene locus_tag LOCUS_06450 293 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 1142 1795 gene locus_tag LOCUS_06460 1142 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 2233 1802 gene locus_tag LOCUS_06470 2233 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 2453 2202 gene locus_tag LOCUS_06480 2453 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2777 2692 gene locus_tag LOCUS_t00130 2777 2692 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3151 3531 gene locus_tag LOCUS_06490 3151 3531 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546076.1 protein_id gnl|my_center|LOCUS_06490 3572 3937 gene locus_tag LOCUS_06500 3572 3937 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545804.1 protein_id gnl|my_center|LOCUS_06500 4322 4639 gene locus_tag LOCUS_06510 4322 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence095 1522 911 gene locus_tag LOCUS_06520 1522 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 4792 3563 gene locus_tag LOCUS_06530 4792 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 >Feature sequence096 970 209 gene locus_tag LOCUS_06540 gene rsmA 970 209 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546868.1 protein_id gnl|my_center|LOCUS_06540 4132 1040 gene locus_tag LOCUS_06550 4132 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence097 279 1514 gene locus_tag LOCUS_06560 279 1514 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456721.1 protein_id gnl|my_center|LOCUS_06560 1836 3482 gene locus_tag LOCUS_06570 1836 3482 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_06570 3583 4770 gene locus_tag LOCUS_06580 3583 4770 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241993.1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence098 340 885 gene locus_tag LOCUS_06590 340 885 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_06590 948 1100 gene locus_tag LOCUS_06600 948 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 2093 1191 gene locus_tag LOCUS_06610 gene lpxC 2093 1191 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546610.1 protein_id gnl|my_center|LOCUS_06610 3616 2207 gene locus_tag LOCUS_06620 3616 2207 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393051.1 protein_id gnl|my_center|LOCUS_06620 3687 4205 gene locus_tag LOCUS_06630 3687 4205 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924863.1 protein_id gnl|my_center|LOCUS_06630 4192 4533 gene locus_tag LOCUS_06640 4192 4533 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546371.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence099 1798 1307 gene locus_tag LOCUS_06650 gene cas4 1798 1307 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460582.1 protein_id gnl|my_center|LOCUS_06650 2480 1782 gene locus_tag LOCUS_06660 gene cas5 2480 1782 CDS product CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877581.1 protein_id gnl|my_center|LOCUS_06660 3472 2468 gene locus_tag LOCUS_06670 3472 2468 CDS product DevR family CRISPR-associated autoregulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877582.1 protein_id gnl|my_center|LOCUS_06670 3784 3485 gene locus_tag LOCUS_06680 3784 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877583.1 protein_id gnl|my_center|LOCUS_06680 4604 3786 gene locus_tag LOCUS_06690 4604 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence100 1569 529 gene locus_tag LOCUS_06700 1569 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 2704 1706 gene locus_tag LOCUS_06710 2704 1706 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_06710 4124 2706 gene locus_tag LOCUS_06720 4124 2706 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence101 566 396 gene locus_tag LOCUS_06730 566 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 856 1209 gene locus_tag LOCUS_06740 856 1209 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878413.1 protein_id gnl|my_center|LOCUS_06740 2596 1337 gene locus_tag LOCUS_06750 gene gdhA 2596 1337 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_06750 2797 4407 gene locus_tag LOCUS_06760 2797 4407 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence102 129 515 gene locus_tag LOCUS_06770 129 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 499 837 gene locus_tag LOCUS_06780 499 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 963 1259 gene locus_tag LOCUS_06790 963 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06790 1252 1482 gene locus_tag LOCUS_06800 1252 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06800 1643 1888 gene locus_tag LOCUS_06810 1643 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 2482 3330 gene locus_tag LOCUS_06820 2482 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 <4551 3344 gene locus_tag LOCUS_06830 <4551 3344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405103.1:ammonium transporter >Feature sequence103 978 232 gene locus_tag LOCUS_06840 gene map 978 232 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_06840 2329 1022 gene locus_tag LOCUS_06850 gene secY 2329 1022 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_06850 2768 2331 gene locus_tag LOCUS_06860 gene rplO 2768 2331 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393918.1 protein_id gnl|my_center|LOCUS_06860 2971 2765 gene locus_tag LOCUS_06870 2971 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 3476 2949 gene locus_tag LOCUS_06880 gene rpsE 3476 2949 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545629.1 protein_id gnl|my_center|LOCUS_06880 3887 3519 gene locus_tag LOCUS_06890 gene rplR 3887 3519 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_06890 4488 3904 gene locus_tag LOCUS_06900 gene rplF 4488 3904 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence104 263 742 gene locus_tag LOCUS_06910 263 742 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_06910 2601 745 gene locus_tag LOCUS_06920 2601 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 2986 2858 gene locus_tag LOCUS_06930 2986 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 3809 3039 gene locus_tag LOCUS_06940 3809 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 3995 3825 gene locus_tag LOCUS_06950 3995 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence105 86 2764 gene locus_tag LOCUS_06960 gene acnA 86 2764 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_06960 2942 2766 gene locus_tag LOCUS_06970 2942 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 3348 2920 gene locus_tag LOCUS_06980 3348 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 3464 4417 gene locus_tag LOCUS_06990 3464 4417 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence106 659 15 gene locus_tag LOCUS_07000 gene pyrE 659 15 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546400.1 protein_id gnl|my_center|LOCUS_07000 1022 672 gene locus_tag LOCUS_07010 1022 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 1263 997 gene locus_tag LOCUS_07020 1263 997 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941004.1 protein_id gnl|my_center|LOCUS_07020 1322 2107 gene locus_tag LOCUS_07030 1322 2107 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546705.1 protein_id gnl|my_center|LOCUS_07030 2086 4176 gene locus_tag LOCUS_07040 2086 4176 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546688.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence107 1445 1029 gene locus_tag LOCUS_07050 1445 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 1980 1438 gene locus_tag LOCUS_07060 1980 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 3316 1967 gene locus_tag LOCUS_07070 3316 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545942.1 protein_id gnl|my_center|LOCUS_07070 3430 4332 gene locus_tag LOCUS_07080 gene gnd 3430 4332 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256404.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence108 1818 643 gene locus_tag LOCUS_07090 gene rlmI 1818 643 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116317.1 protein_id gnl|my_center|LOCUS_07090 2547 1876 gene locus_tag LOCUS_07100 2547 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 4218 2551 gene locus_tag LOCUS_07110 4218 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence109 149 1126 gene locus_tag LOCUS_07120 149 1126 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545468.1 protein_id gnl|my_center|LOCUS_07120 1442 1570 gene locus_tag LOCUS_07130 1442 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07130 1584 2300 gene locus_tag LOCUS_07140 gene lepB 1584 2300 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_07140 2332 2652 gene locus_tag LOCUS_07150 2332 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 2652 3287 gene locus_tag LOCUS_07160 gene ribE 2652 3287 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493929.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence110 <1 2082 gene locus_tag LOCUS_07170 <1 2082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004597391.1:Tol-Pal system beta propeller repeat protein TolB 2267 2560 gene locus_tag LOCUS_07180 2267 2560 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022117.1 protein_id gnl|my_center|LOCUS_07180 2553 2846 gene locus_tag LOCUS_07190 2553 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07190 3586 2987 gene locus_tag LOCUS_07200 3586 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 3678 4115 gene locus_tag LOCUS_07210 3678 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence111 313 1854 gene locus_tag LOCUS_07220 313 1854 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_07220 1869 2669 gene locus_tag LOCUS_07230 1869 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 2683 3228 gene locus_tag LOCUS_07240 gene cobU 2683 3228 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943640.1 protein_id gnl|my_center|LOCUS_07240 3241 4302 gene locus_tag LOCUS_07250 gene cobT 3241 4302 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545250.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence112 1282 2124 gene locus_tag LOCUS_07260 1282 2124 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_07260 2387 2932 gene locus_tag LOCUS_07270 2387 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 3171 3650 gene locus_tag LOCUS_07280 3171 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 3637 3825 gene locus_tag LOCUS_07290 3637 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 4053 4244 gene locus_tag LOCUS_07300 4053 4244 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932270.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence113 <1 731 gene locus_tag LOCUS_07310 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943319.1:4Fe-4S binding protein 893 2626 gene locus_tag LOCUS_07320 893 2626 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545979.1 protein_id gnl|my_center|LOCUS_07320 2627 2896 gene locus_tag LOCUS_07330 2627 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3062 3535 gene locus_tag LOCUS_07340 3062 3535 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939670.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence114 760 188 gene locus_tag LOCUS_07350 760 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 1117 1878 gene locus_tag LOCUS_07360 1117 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1889 2917 gene locus_tag LOCUS_07370 1889 2917 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044864.1 protein_id gnl|my_center|LOCUS_07370 2914 4281 gene locus_tag LOCUS_07380 2914 4281 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942633.1 protein_id gnl|my_center|LOCUS_07380 >Feature sequence115 <1 1301 gene locus_tag LOCUS_07390 <1 1301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942862.1:chemotaxis protein CheA 1304 2113 gene locus_tag LOCUS_07400 1304 2113 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_07400 2114 2734 gene locus_tag LOCUS_07410 2114 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence116 <1 1659 gene locus_tag LOCUS_07420 <1 1659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074055.1:diguanylate cyclase 2484 1660 gene locus_tag LOCUS_07430 gene aroE 2484 1660 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544907.1 protein_id gnl|my_center|LOCUS_07430 3754 2468 gene locus_tag LOCUS_07440 3754 2468 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545290.1 protein_id gnl|my_center|LOCUS_07440 <4297 3765 gene locus_tag LOCUS_07450 <4297 3765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545392.1:CDP-alcohol phosphatidyltransferase family protein >Feature sequence117 2431 839 gene locus_tag LOCUS_07460 2431 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 2841 2428 gene locus_tag LOCUS_07470 2841 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3628 2825 gene locus_tag LOCUS_07480 3628 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence118 1460 111 gene locus_tag LOCUS_07490 1460 111 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938056.1 protein_id gnl|my_center|LOCUS_07490 2960 1464 gene locus_tag LOCUS_07500 gene malQ 2960 1464 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880435.1 protein_id gnl|my_center|LOCUS_07500 <4293 2957 gene locus_tag LOCUS_07510 <4293 2957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257049.1:DUF3536 domain-containing protein >Feature sequence119 148 825 gene locus_tag LOCUS_07520 148 825 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_07520 838 1821 gene locus_tag LOCUS_07530 gene trpS 838 1821 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_07530 2142 2729 gene locus_tag LOCUS_07540 2142 2729 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533195.1 protein_id gnl|my_center|LOCUS_07540 4269 2713 gene locus_tag LOCUS_07550 4269 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence120 2800 263 gene locus_tag LOCUS_07560 2800 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 3345 2854 gene locus_tag LOCUS_07570 3345 2854 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence121 160 393 gene locus_tag LOCUS_07580 160 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 390 779 gene locus_tag LOCUS_07590 390 779 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958096.1 protein_id gnl|my_center|LOCUS_07590 991 1851 gene locus_tag LOCUS_07600 991 1851 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_07600 1930 2925 gene locus_tag LOCUS_07610 1930 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 4005 2935 gene locus_tag LOCUS_07620 4005 2935 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545175.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence122 549 625 gene locus_tag LOCUS_t00140 549 625 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 674 749 gene locus_tag LOCUS_t00150 674 749 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1516 2052 gene locus_tag LOCUS_07630 1516 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 2053 2349 gene locus_tag LOCUS_07640 2053 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 2415 2573 gene locus_tag LOCUS_07650 2415 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 3089 2898 gene locus_tag LOCUS_07660 3089 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 3736 3206 gene locus_tag LOCUS_07670 3736 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence123 <1 874 gene locus_tag LOCUS_07680 <1 874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545367.1:phosphoglycerate kinase 1324 881 gene locus_tag LOCUS_07690 gene smpB 1324 881 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_07690 1572 2240 gene locus_tag LOCUS_07700 1572 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 2656 2237 gene locus_tag LOCUS_07710 2656 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 2769 3071 gene locus_tag LOCUS_07720 2769 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 3019 3519 gene locus_tag LOCUS_07730 3019 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07730 3534 3872 gene locus_tag LOCUS_07740 3534 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07740 4117 3869 gene locus_tag LOCUS_07750 4117 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence124 158 1138 gene locus_tag LOCUS_07760 158 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 1135 2613 gene locus_tag LOCUS_07770 1135 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2707 2631 gene locus_tag LOCUS_t00160 2707 2631 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3830 2757 gene locus_tag LOCUS_07780 3830 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence125 96 19 gene locus_tag LOCUS_t00170 96 19 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 179 104 gene locus_tag LOCUS_t00180 179 104 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 282 902 gene locus_tag LOCUS_07790 282 902 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_07790 1372 911 gene locus_tag LOCUS_07800 1372 911 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546858.1 protein_id gnl|my_center|LOCUS_07800 2146 1388 gene locus_tag LOCUS_07810 2146 1388 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_07810 2290 2214 gene locus_tag LOCUS_t00190 2290 2214 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3910 2378 gene locus_tag LOCUS_07820 3910 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence126 947 138 gene locus_tag LOCUS_07830 947 138 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546621.1 protein_id gnl|my_center|LOCUS_07830 2260 959 gene locus_tag LOCUS_07840 gene der 2260 959 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546282.1 protein_id gnl|my_center|LOCUS_07840 2324 2947 gene locus_tag LOCUS_07850 2324 2947 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924821.1 protein_id gnl|my_center|LOCUS_07850 2994 3977 gene locus_tag LOCUS_07860 gene nadA 2994 3977 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546803.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence127 1024 359 gene locus_tag LOCUS_07870 gene modB 1024 359 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065838.1 protein_id gnl|my_center|LOCUS_07870 1804 1028 gene locus_tag LOCUS_07880 gene modA 1804 1028 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205679.1 protein_id gnl|my_center|LOCUS_07880 2384 2046 gene locus_tag LOCUS_07890 gene glnB 2384 2046 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_07890 3749 2400 gene locus_tag LOCUS_07900 3749 2400 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405103.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence128 1136 1660 gene locus_tag LOCUS_07910 1136 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1944 2630 gene locus_tag LOCUS_07920 1944 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 2667 3107 gene locus_tag LOCUS_07930 2667 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence129 3 128 gene locus_tag LOCUS_07940 3 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 151 1452 gene locus_tag LOCUS_07950 151 1452 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_07950 1464 1895 gene locus_tag LOCUS_07960 1464 1895 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_07960 1956 3098 gene locus_tag LOCUS_07970 1956 3098 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942380.1 protein_id gnl|my_center|LOCUS_07970 3177 4067 gene locus_tag LOCUS_07980 3177 4067 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence130 1041 310 gene locus_tag LOCUS_07990 1041 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 2271 2735 gene locus_tag LOCUS_08000 2271 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 2746 3705 gene locus_tag LOCUS_08010 2746 3705 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence131 <1 858 gene locus_tag LOCUS_08020 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546124.1:GTP 3',8-cyclase MoaA 881 3271 gene locus_tag LOCUS_08030 881 3271 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546735.1 protein_id gnl|my_center|LOCUS_08030 3882 3361 gene locus_tag LOCUS_08040 gene cysC 3882 3361 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963430.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence132 <1 1024 gene locus_tag LOCUS_08050 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942467.1:DNA mismatch repair protein MutS 1083 1307 gene locus_tag LOCUS_08060 1083 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 1286 1690 gene locus_tag LOCUS_08070 1286 1690 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870428.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence133 <1 2131 gene locus_tag LOCUS_08080 <1 2131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109982246.1:response regulator 2128 3492 gene locus_tag LOCUS_08090 2128 3492 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943217.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence134 293 102 gene locus_tag LOCUS_08100 293 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 1136 537 gene locus_tag LOCUS_08110 1136 537 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_08110 1559 1254 gene locus_tag LOCUS_08120 1559 1254 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_08120 1777 1556 gene locus_tag LOCUS_08130 1777 1556 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940734.1 protein_id gnl|my_center|LOCUS_08130 2010 1846 gene locus_tag LOCUS_08140 2010 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 2306 2097 gene locus_tag LOCUS_08150 2306 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 2752 2303 gene locus_tag LOCUS_08160 2752 2303 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_08160 3252 2971 gene locus_tag LOCUS_08170 3252 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3658 3245 gene locus_tag LOCUS_08180 3658 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence135 1847 234 gene locus_tag LOCUS_08190 1847 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2959 1931 gene locus_tag LOCUS_08200 2959 1931 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393378.1 protein_id gnl|my_center|LOCUS_08200 3085 3819 gene locus_tag LOCUS_08210 3085 3819 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879740.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence136 <1 598 gene locus_tag LOCUS_08220 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000592876.1:acetyl-CoA carboxylase biotin carboxylase subunit 604 1215 gene locus_tag LOCUS_08230 gene thiE 604 1215 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_08230 1402 1223 gene locus_tag LOCUS_08240 1402 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 3116 1428 gene locus_tag LOCUS_08250 3116 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 3309 3509 gene locus_tag LOCUS_08260 3309 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 3499 3933 gene locus_tag LOCUS_08270 3499 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence137 <1 1489 gene locus_tag LOCUS_08280 <1 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546240.1:ATP-binding protein 1458 1850 gene locus_tag LOCUS_08290 1458 1850 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545378.1 protein_id gnl|my_center|LOCUS_08290 1828 2787 gene locus_tag LOCUS_08300 1828 2787 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_08300 3687 2782 gene locus_tag LOCUS_08310 3687 2782 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680714.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence138 544 1332 gene locus_tag LOCUS_08320 gene phnD 544 1332 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272048.1 protein_id gnl|my_center|LOCUS_08320 1332 2747 gene locus_tag LOCUS_08330 1332 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence139 1272 640 gene locus_tag LOCUS_08340 1272 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146928.1 protein_id gnl|my_center|LOCUS_08340 2222 1305 gene locus_tag LOCUS_08350 2222 1305 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868361.1 protein_id gnl|my_center|LOCUS_08350 2510 2223 gene locus_tag LOCUS_08360 2510 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146930.1 protein_id gnl|my_center|LOCUS_08360 <3943 2497 gene locus_tag LOCUS_08370 <3943 2497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868362.1:carbon starvation protein A >Feature sequence140 70 612 gene locus_tag LOCUS_08380 gene cas4 70 612 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546197.1 protein_id gnl|my_center|LOCUS_08380 615 1184 gene locus_tag LOCUS_08390 615 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08390 1226 1606 gene locus_tag LOCUS_08400 1226 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08400 1621 1884 gene locus_tag LOCUS_08410 gene cas2 1621 1884 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013193.1 protein_id gnl|my_center|LOCUS_08410 1993 2259 gene locus_tag LOCUS_08420 1993 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2252 2893 gene locus_tag LOCUS_08430 2252 2893 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782294.1 protein_id gnl|my_center|LOCUS_08430 3123 3416 gene locus_tag LOCUS_08440 3123 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 3395 3784 gene locus_tag LOCUS_08450 3395 3784 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846392.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence141 3402 1708 gene locus_tag LOCUS_08460 gene recJ 3402 1708 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence142 715 2691 gene locus_tag LOCUS_08470 gene prsK 715 2691 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942586.1 protein_id gnl|my_center|LOCUS_08470 2775 3380 gene locus_tag LOCUS_08480 gene cysC 2775 3380 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245829.1 protein_id gnl|my_center|LOCUS_08480 <3903 3384 gene locus_tag LOCUS_08490 <3903 3384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584159.1:Crp/Fnr family transcriptional regulator >Feature sequence143 644 931 gene locus_tag LOCUS_08500 644 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1004 2749 gene locus_tag LOCUS_08510 1004 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 <3861 2833 gene locus_tag LOCUS_08520 <3861 2833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544960.1:lipopolysaccharide heptosyltransferase II >Feature sequence144 1736 696 gene locus_tag LOCUS_08530 1736 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 3496 1727 gene locus_tag LOCUS_08540 3496 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence145 1707 913 gene locus_tag LOCUS_08550 1707 913 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_08550 <3849 1721 gene locus_tag LOCUS_08560 <3849 1721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480716.1:MMPL family transporter >Feature sequence146 2101 482 gene locus_tag LOCUS_08570 gene secD 2101 482 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546364.1 protein_id gnl|my_center|LOCUS_08570 2446 2117 gene locus_tag LOCUS_08580 gene yajC 2446 2117 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939107.1 protein_id gnl|my_center|LOCUS_08580 2743 2528 gene locus_tag LOCUS_08590 gene xseB 2743 2528 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545195.1 protein_id gnl|my_center|LOCUS_08590 <3805 2736 gene locus_tag LOCUS_08600 <3805 2736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203547.1:exodeoxyribonuclease VII large subunit >Feature sequence147 1105 107 gene locus_tag LOCUS_08610 gene hemH 1105 107 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943924.1 protein_id gnl|my_center|LOCUS_08610 2443 1178 gene locus_tag LOCUS_08620 2443 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2975 2448 gene locus_tag LOCUS_08630 2975 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence148 291 824 gene locus_tag LOCUS_08640 291 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 2045 825 gene locus_tag LOCUS_08650 gene glgC 2045 825 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544940.1 protein_id gnl|my_center|LOCUS_08650 2495 2150 gene locus_tag LOCUS_tm00010 2495 2150 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3080 2886 gene locus_tag LOCUS_08660 3080 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence149 3541 1244 gene locus_tag LOCUS_08670 3541 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence150 1462 182 gene locus_tag LOCUS_08680 1462 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2002 1697 gene locus_tag LOCUS_08690 2002 1697 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392910.1 protein_id gnl|my_center|LOCUS_08690 2361 1969 gene locus_tag LOCUS_08700 2361 1969 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545820.1 protein_id gnl|my_center|LOCUS_08700 2854 3072 gene locus_tag LOCUS_08710 2854 3072 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140251.1 protein_id gnl|my_center|LOCUS_08710 3069 3362 gene locus_tag LOCUS_08720 3069 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence151 <1 680 gene locus_tag LOCUS_08730 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143858.1:mechanosensitive ion channel family protein 1766 720 gene locus_tag LOCUS_08740 gene bpsA 1766 720 CDS product N(4)-bis(aminopropyl)spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250642.1 protein_id gnl|my_center|LOCUS_08740 2791 1994 gene locus_tag LOCUS_08750 2791 1994 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880854.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08750 2998 2804 gene locus_tag LOCUS_08760 2998 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 <3753 3089 gene locus_tag LOCUS_08770 <3753 3089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545618.1:thiamine pyrophosphate-dependent enzyme >Feature sequence152 495 1256 gene locus_tag LOCUS_08780 495 1256 CDS product cytochrome C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136516188.1 protein_id gnl|my_center|LOCUS_08780 1445 2320 gene locus_tag LOCUS_08790 1445 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 2317 3429 gene locus_tag LOCUS_08800 2317 3429 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943839.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence153 465 1622 gene locus_tag LOCUS_08810 465 1622 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255987.1 protein_id gnl|my_center|LOCUS_08810 1856 2236 gene locus_tag LOCUS_08820 gene fliS 1856 2236 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943663.1 protein_id gnl|my_center|LOCUS_08820 2273 3460 gene locus_tag LOCUS_08830 2273 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence154 <1 837 gene locus_tag LOCUS_08840 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545172.1:ATP-dependent Clp protease ATP-binding subunit 1710 856 gene locus_tag LOCUS_08850 1710 856 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545088.1 protein_id gnl|my_center|LOCUS_08850 3077 1743 gene locus_tag LOCUS_08860 3077 1743 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940556.1 protein_id gnl|my_center|LOCUS_08860 3351 3106 gene locus_tag LOCUS_08870 3351 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence155 861 121 gene locus_tag LOCUS_08880 gene recO 861 121 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545948.1 protein_id gnl|my_center|LOCUS_08880 1342 890 gene locus_tag LOCUS_08890 1342 890 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545067.1 protein_id gnl|my_center|LOCUS_08890 2608 1415 gene locus_tag LOCUS_08900 2608 1415 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_08900 3576 2608 gene locus_tag LOCUS_08910 gene rfaE1 3576 2608 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence156 652 948 gene locus_tag LOCUS_08920 652 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1653 1207 gene locus_tag LOCUS_08930 1653 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 2292 1723 gene locus_tag LOCUS_08940 2292 1723 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_08940 <3729 2304 gene locus_tag LOCUS_08950 <3729 2304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546555.1:anthranilate synthase component I >Feature sequence157 2056 1316 gene locus_tag LOCUS_08960 2056 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842557.1 protein_id gnl|my_center|LOCUS_08960 <3725 2257 gene locus_tag LOCUS_08970 <3725 2257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546175.1:DNA mismatch repair endonuclease MutL >Feature sequence158 1259 255 gene locus_tag LOCUS_08980 1259 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 2687 1845 gene locus_tag LOCUS_08990 gene rfbD 2687 1845 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_08990 3694 2684 gene locus_tag LOCUS_09000 gene rfbB 3694 2684 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence159 432 659 gene locus_tag LOCUS_09010 432 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 734 1627 gene locus_tag LOCUS_09020 734 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1627 2739 gene locus_tag LOCUS_09030 1627 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence160 1830 421 gene locus_tag LOCUS_09040 1830 421 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_09040 2868 1834 gene locus_tag LOCUS_09050 2868 1834 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544929.1 protein_id gnl|my_center|LOCUS_09050 <3706 3013 gene locus_tag LOCUS_09060 <3706 3013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546080.1:GDP-mannose 4,6-dehydratase >Feature sequence161 1861 113 gene locus_tag LOCUS_09070 1861 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 3416 1878 gene locus_tag LOCUS_09080 3416 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence162 1927 1769 gene locus_tag LOCUS_09090 1927 1769 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_09090 2361 1945 gene locus_tag LOCUS_09100 2361 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 <3674 2370 gene locus_tag LOCUS_09110 <3674 2370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976109.1:carbamoyltransferase >Feature sequence163 <1 634 gene locus_tag LOCUS_09120 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942909.1:ABC transporter ATP-binding protein 666 1970 gene locus_tag LOCUS_09130 666 1970 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082160.1 protein_id gnl|my_center|LOCUS_09130 2001 2876 gene locus_tag LOCUS_09140 2001 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence164 1 89 gene locus_tag LOCUS_t00200 1 89 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 687 451 gene locus_tag LOCUS_09150 687 451 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228303.1 protein_id gnl|my_center|LOCUS_09150 929 684 gene locus_tag LOCUS_09160 929 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1290 1018 gene locus_tag LOCUS_09170 1290 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1932 1399 gene locus_tag LOCUS_09180 gene hpt 1932 1399 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546262.1 protein_id gnl|my_center|LOCUS_09180 2016 3581 gene locus_tag LOCUS_09190 2016 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence165 <1 1355 gene locus_tag LOCUS_09200 <1 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545143.1:DegQ family serine endoprotease 1374 2378 gene locus_tag LOCUS_09210 1374 2378 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919684.1 protein_id gnl|my_center|LOCUS_09210 2378 3082 gene locus_tag LOCUS_09220 gene ispD 2378 3082 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583828.1 protein_id gnl|my_center|LOCUS_09220 3097 3582 gene locus_tag LOCUS_09230 3097 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09230 >Feature sequence166 960 1325 gene locus_tag LOCUS_09240 960 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1338 1733 gene locus_tag LOCUS_09250 1338 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1756 2766 gene locus_tag LOCUS_09260 1756 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 3059 2772 gene locus_tag LOCUS_09270 3059 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence167 2540 498 gene locus_tag LOCUS_09280 gene glyS 2540 498 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861551.1 protein_id gnl|my_center|LOCUS_09280 3425 2544 gene locus_tag LOCUS_09290 gene glyQ 3425 2544 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence168 154 273 gene locus_tag LOCUS_09300 154 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 248 451 gene locus_tag LOCUS_09310 248 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 626 1138 gene locus_tag LOCUS_09320 626 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1135 1662 gene locus_tag LOCUS_09330 1135 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1830 2645 gene locus_tag LOCUS_09340 1830 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2660 3040 gene locus_tag LOCUS_09350 2660 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 3205 3606 gene locus_tag LOCUS_09360 3205 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence169 751 101 gene locus_tag LOCUS_09370 751 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2148 748 gene locus_tag LOCUS_09380 gene cobB 2148 748 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545628.1 protein_id gnl|my_center|LOCUS_09380 2421 2203 gene locus_tag LOCUS_09390 2421 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545371.1 protein_id gnl|my_center|LOCUS_09390 3561 2485 gene locus_tag LOCUS_09400 gene dsrB 3561 2485 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546493.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence170 <1 1416 gene locus_tag LOCUS_09410 <1 1416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085917.1:bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase 1758 3086 gene locus_tag LOCUS_09420 gene glnA 1758 3086 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence171 358 1575 gene locus_tag LOCUS_09430 358 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1778 3088 gene locus_tag LOCUS_09440 gene rsxC 1778 3088 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence172 2283 814 gene locus_tag LOCUS_09450 2283 814 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943517.1 protein_id gnl|my_center|LOCUS_09450 2809 2414 gene locus_tag LOCUS_09460 2809 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3280 2939 gene locus_tag LOCUS_09470 3280 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence173 2777 1047 gene locus_tag LOCUS_09480 2777 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 2906 3403 gene locus_tag LOCUS_09490 gene leuD 2906 3403 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence174 <1 589 gene locus_tag LOCUS_09500 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546492.1:glutamate 5-kinase 1660 584 gene locus_tag LOCUS_09510 1660 584 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545833.1 protein_id gnl|my_center|LOCUS_09510 1981 1694 gene locus_tag LOCUS_09520 gene gatC 1981 1694 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_09520 <3508 1988 gene locus_tag LOCUS_09530 <3508 1988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546392.1:UvrD-helicase domain-containing protein >Feature sequence175 510 1466 gene locus_tag LOCUS_09540 510 1466 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_09540 1675 1427 gene locus_tag LOCUS_09550 1675 1427 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545287.1 protein_id gnl|my_center|LOCUS_09550 2228 1704 gene locus_tag LOCUS_09560 2228 1704 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842874.1 protein_id gnl|my_center|LOCUS_09560 3226 2564 gene locus_tag LOCUS_09570 gene cybH 3226 2564 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940797.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence176 375 593 gene locus_tag LOCUS_09580 375 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 590 991 gene locus_tag LOCUS_09590 590 991 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249840.1 protein_id gnl|my_center|LOCUS_09590 2545 1013 gene locus_tag LOCUS_09600 2545 1013 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence177 473 1465 gene locus_tag LOCUS_09610 gene fliM 473 1465 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545847.1 protein_id gnl|my_center|LOCUS_09610 1470 1835 gene locus_tag LOCUS_09620 1470 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1832 2185 gene locus_tag LOCUS_09630 1832 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 2178 2888 gene locus_tag LOCUS_09640 gene fliP 2178 2888 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_09640 2885 3154 gene locus_tag LOCUS_09650 gene fliQ 2885 3154 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546140.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence178 87 248 gene locus_tag LOCUS_09660 87 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 739 1926 gene locus_tag LOCUS_09670 739 1926 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941677.1 protein_id gnl|my_center|LOCUS_09670 2287 2363 gene locus_tag LOCUS_t00210 2287 2363 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2841 2452 gene locus_tag LOCUS_09680 2841 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence179 577 912 gene locus_tag LOCUS_09690 577 912 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460053.1 protein_id gnl|my_center|LOCUS_09690 936 2636 gene locus_tag LOCUS_09700 936 2636 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545510.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence180 20 427 gene locus_tag LOCUS_09710 20 427 CDS product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944070.1 protein_id gnl|my_center|LOCUS_09710 775 1878 gene locus_tag LOCUS_09720 775 1878 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940799.1 protein_id gnl|my_center|LOCUS_09720 1926 2105 gene locus_tag LOCUS_09730 1926 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09730 >Feature sequence181 <1 1255 gene locus_tag LOCUS_09740 <1 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546399.1:DNA polymerase III subunit gamma/tau 1271 1600 gene locus_tag LOCUS_09750 1271 1600 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546807.1 protein_id gnl|my_center|LOCUS_09750 1600 2199 gene locus_tag LOCUS_09760 gene recR 1600 2199 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545737.1 protein_id gnl|my_center|LOCUS_09760 3110 2187 gene locus_tag LOCUS_09770 3110 2187 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545040.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence182 409 2046 gene locus_tag LOCUS_09780 gene ade 409 2046 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_09780 2805 2053 gene locus_tag LOCUS_09790 2805 2053 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_09790 <3428 2783 gene locus_tag LOCUS_09800 <3428 2783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256280.1:thiamine phosphate synthase >Feature sequence183 389 1921 gene locus_tag LOCUS_09810 389 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1911 2084 gene locus_tag LOCUS_09820 1911 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2620 2946 gene locus_tag LOCUS_09830 2620 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2943 3287 gene locus_tag LOCUS_09840 2943 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence184 945 412 gene locus_tag LOCUS_09850 gene fkpB 945 412 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102613.1 protein_id gnl|my_center|LOCUS_09850 1412 981 gene locus_tag LOCUS_09860 1412 981 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_09860 2591 1668 gene locus_tag LOCUS_09870 2591 1668 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_09870 3058 2561 gene locus_tag LOCUS_09880 gene leuD 3058 2561 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence185 2885 1098 gene locus_tag LOCUS_09890 2885 1098 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_09890 3165 2944 gene locus_tag LOCUS_09900 3165 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence186 1178 141 gene locus_tag LOCUS_09910 gene purM 1178 141 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545739.1 protein_id gnl|my_center|LOCUS_09910 1818 1231 gene locus_tag LOCUS_09920 1818 1231 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545226.1 protein_id gnl|my_center|LOCUS_09920 2567 1818 gene locus_tag LOCUS_09930 2567 1818 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546413.1 protein_id gnl|my_center|LOCUS_09930 <3370 2564 gene locus_tag LOCUS_09940 <3370 2564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942515.1:sensor domain-containing diguanylate cyclase >Feature sequence187 238 771 gene locus_tag LOCUS_09950 gene pyrR 238 771 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546581.1 protein_id gnl|my_center|LOCUS_09950 785 1714 gene locus_tag LOCUS_09960 785 1714 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_09960 1711 2985 gene locus_tag LOCUS_09970 1711 2985 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545202.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence188 1558 944 gene locus_tag LOCUS_09980 1558 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2359 1562 gene locus_tag LOCUS_09990 2359 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 <3335 2363 gene locus_tag LOCUS_10000 <3335 2363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064241993.1:glycosyltransferase family 4 protein >Feature sequence189 <1 1356 gene locus_tag LOCUS_10010 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003119656.1:putative selenate ABC transporter substrate-binding protein 1363 3063 gene locus_tag LOCUS_10020 1363 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence190 146 436 gene locus_tag LOCUS_10030 146 436 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_10030 433 798 gene locus_tag LOCUS_10040 433 798 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051076796.1 protein_id gnl|my_center|LOCUS_10040 1082 1008 gene locus_tag LOCUS_t00220 1082 1008 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1310 2626 gene locus_tag LOCUS_10050 1310 2626 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881132.1 protein_id gnl|my_center|LOCUS_10050 2698 2979 gene locus_tag LOCUS_10060 2698 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence191 1312 995 gene locus_tag LOCUS_10070 1312 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1488 2639 gene locus_tag LOCUS_10080 gene metK 1488 2639 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence192 1169 66 gene locus_tag LOCUS_10090 1169 66 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941360.1 protein_id gnl|my_center|LOCUS_10090 3286 1196 gene locus_tag LOCUS_10100 3286 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence193 1646 804 gene locus_tag LOCUS_10110 1646 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545016.1 protein_id gnl|my_center|LOCUS_10110 2256 1792 gene locus_tag LOCUS_10120 2256 1792 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020220.1 protein_id gnl|my_center|LOCUS_10120 <3318 2329 gene locus_tag LOCUS_10130 <3318 2329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259324.1:sulfurtransferase >Feature sequence194 460 1425 gene locus_tag LOCUS_10140 460 1425 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence195 1508 1047 gene locus_tag LOCUS_10150 1508 1047 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429665.1 protein_id gnl|my_center|LOCUS_10150 1806 1555 gene locus_tag LOCUS_10160 1806 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2077 1826 gene locus_tag LOCUS_10170 2077 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3292 2111 gene locus_tag LOCUS_10180 3292 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence196 947 177 gene locus_tag LOCUS_10190 947 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1139 2017 gene locus_tag LOCUS_10200 1139 2017 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_10200 2470 2024 gene locus_tag LOCUS_10210 2470 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 3132 2488 gene locus_tag LOCUS_10220 3132 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence197 >Feature sequence198 279 2057 gene locus_tag LOCUS_10230 279 2057 CDS product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096407.1 protein_id gnl|my_center|LOCUS_10230 3048 2185 gene locus_tag LOCUS_10240 3048 2185 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence199 204 698 gene locus_tag LOCUS_10250 204 698 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_10250 915 691 gene locus_tag LOCUS_10260 915 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1225 1013 gene locus_tag LOCUS_10270 1225 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1418 1218 gene locus_tag LOCUS_10280 1418 1218 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_10280 2248 1910 gene locus_tag LOCUS_10290 2248 1910 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_10290 2475 2233 gene locus_tag LOCUS_10300 2475 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2985 2674 gene locus_tag LOCUS_10310 2985 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence200 <1 1105 gene locus_tag LOCUS_10320 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546384.1:cysteine--tRNA ligase 2203 1118 gene locus_tag LOCUS_10330 gene ugpC 2203 1118 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228630.1 protein_id gnl|my_center|LOCUS_10330 2793 2287 gene locus_tag LOCUS_10340 2793 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence201 484 409 gene locus_tag LOCUS_t00230 484 409 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 574 501 gene locus_tag LOCUS_t00240 574 501 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 692 1315 gene locus_tag LOCUS_10350 692 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1312 2088 gene locus_tag LOCUS_10360 gene lgt 1312 2088 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545160.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence202 796 125 gene locus_tag LOCUS_10370 796 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1371 781 gene locus_tag LOCUS_10380 1371 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 <3237 1675 gene locus_tag LOCUS_10390 <3237 1675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545590.1:ABC transporter ATP-binding protein >Feature sequence203 1169 21 gene locus_tag LOCUS_10400 1169 21 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_10400 2169 1156 gene locus_tag LOCUS_10410 gene recA 2169 1156 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546028.1 protein_id gnl|my_center|LOCUS_10410 2674 2162 gene locus_tag LOCUS_10420 gene thpR 2674 2162 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_10420 3228 2710 gene locus_tag LOCUS_10430 3228 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence204 >Feature sequence205 <1 934 gene locus_tag LOCUS_10440 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545535.1:amidohydrolase family protein 1092 931 gene locus_tag LOCUS_10450 1092 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1901 1092 gene locus_tag LOCUS_10460 1901 1092 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546621.1 protein_id gnl|my_center|LOCUS_10460 <3223 1918 gene locus_tag LOCUS_10470 <3223 1918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392835.1:ribosome biogenesis GTPase Der >Feature sequence206 292 561 gene locus_tag LOCUS_10480 292 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 552 767 gene locus_tag LOCUS_10490 552 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1419 1225 gene locus_tag LOCUS_10500 1419 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2179 1532 gene locus_tag LOCUS_10510 2179 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 <3218 2145 gene locus_tag LOCUS_10520 <3218 2145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940957.1:DNA repair protein RadA >Feature sequence207 <1 581 gene locus_tag LOCUS_10530 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001361611.1:two-component system sensor histidine kinase AtoS 618 1916 gene locus_tag LOCUS_10540 618 1916 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_10540 1913 2275 gene locus_tag LOCUS_10550 1913 2275 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546385.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence208 >Feature sequence209 808 128 gene locus_tag LOCUS_10560 gene hisA 808 128 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545163.1 protein_id gnl|my_center|LOCUS_10560 2197 896 gene locus_tag LOCUS_10570 2197 896 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941684.1 protein_id gnl|my_center|LOCUS_10570 3078 2242 gene locus_tag LOCUS_10580 3078 2242 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence210 889 437 gene locus_tag LOCUS_10590 gene mraZ 889 437 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545651.1 protein_id gnl|my_center|LOCUS_10590 1122 2012 gene locus_tag LOCUS_10600 gene xerD 1122 2012 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546237.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence211 443 1381 gene locus_tag LOCUS_10610 443 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1362 2357 gene locus_tag LOCUS_10620 1362 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence212 1728 1246 gene locus_tag LOCUS_10630 1728 1246 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545311.1 protein_id gnl|my_center|LOCUS_10630 2170 1730 gene locus_tag LOCUS_10640 2170 1730 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943409.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence213 1592 1516 gene locus_tag LOCUS_t00250 1592 1516 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1670 2674 gene locus_tag LOCUS_10650 1670 2674 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868699.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence214 1147 41 gene locus_tag LOCUS_10660 1147 41 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_10660 2430 1195 gene locus_tag LOCUS_10670 2430 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence215 1971 376 gene locus_tag LOCUS_10680 1971 376 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544966.1 protein_id gnl|my_center|LOCUS_10680 2640 1975 gene locus_tag LOCUS_10690 2640 1975 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545248.1 protein_id gnl|my_center|LOCUS_10690 <3182 2619 gene locus_tag LOCUS_10700 <3182 2619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016745.1:adenosylcobinamide-GDP ribazoletransferase >Feature sequence216 1443 160 gene locus_tag LOCUS_10710 1443 160 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545614.1 protein_id gnl|my_center|LOCUS_10710 2109 1459 gene locus_tag LOCUS_10720 2109 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence217 2298 1342 gene locus_tag LOCUS_10730 2298 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2943 2311 gene locus_tag LOCUS_10740 2943 2311 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244073.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence218 228 554 gene locus_tag LOCUS_10750 228 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1839 592 gene locus_tag LOCUS_10760 1839 592 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546417.1 protein_id gnl|my_center|LOCUS_10760 <3172 1941 gene locus_tag LOCUS_10770 <3172 1941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545053.1:pitrilysin family protein >Feature sequence219 1356 7 gene locus_tag LOCUS_10780 1356 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 2708 1353 gene locus_tag LOCUS_10790 2708 1353 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence220 755 1435 gene locus_tag LOCUS_10800 755 1435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_10800 1419 2099 gene locus_tag LOCUS_10810 1419 2099 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_10810 2105 2788 gene locus_tag LOCUS_10820 2105 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2781 2924 gene locus_tag LOCUS_10830 2781 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence221 1080 586 gene locus_tag LOCUS_10840 1080 586 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_10840 1485 1144 gene locus_tag LOCUS_10850 1485 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1879 1963 gene locus_tag LOCUS_t00260 1879 1963 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2016 3056 gene locus_tag LOCUS_10860 2016 3056 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence222 627 962 gene locus_tag LOCUS_10870 627 962 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_10870 1087 1623 gene locus_tag LOCUS_10880 1087 1623 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810499.1 protein_id gnl|my_center|LOCUS_10880 1672 2715 gene locus_tag LOCUS_10890 gene dsrM 1672 2715 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393108.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence223 1833 970 gene locus_tag LOCUS_10900 1833 970 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902051.1 protein_id gnl|my_center|LOCUS_10900 <3140 1905 gene locus_tag LOCUS_10910 <3140 1905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023091.1:ATP-binding protein >Feature sequence224 202 1221 gene locus_tag LOCUS_10920 202 1221 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_10920 1347 2588 gene locus_tag LOCUS_10930 1347 2588 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence225 1778 531 gene locus_tag LOCUS_10940 gene nrfD 1778 531 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_10940 2554 1784 gene locus_tag LOCUS_10950 2554 1784 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_10950 3025 2558 gene locus_tag LOCUS_10960 3025 2558 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940746.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence226 1219 392 gene locus_tag LOCUS_10970 gene rfbD 1219 392 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_10970 2241 1216 gene locus_tag LOCUS_10980 gene rfbB 2241 1216 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_10980 2727 2284 gene locus_tag LOCUS_10990 2727 2284 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942724.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence227 <1 729 gene locus_tag LOCUS_11000 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546383.1:adenosylcobinamide-phosphate synthase CbiB 726 1808 gene locus_tag LOCUS_11010 726 1808 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545158.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence228 1037 642 gene locus_tag LOCUS_11020 1037 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942792.1 protein_id gnl|my_center|LOCUS_11020 2768 1518 gene locus_tag LOCUS_11030 2768 1518 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence229 1961 687 gene locus_tag LOCUS_11040 1961 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 2349 1996 gene locus_tag LOCUS_11050 2349 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 3109 2372 gene locus_tag LOCUS_11060 3109 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence230 1913 1725 gene locus_tag LOCUS_11070 1913 1725 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877678.1 protein_id gnl|my_center|LOCUS_11070 2933 1983 gene locus_tag LOCUS_11080 2933 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence231 1827 418 gene locus_tag LOCUS_11090 1827 418 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396790.1 protein_id gnl|my_center|LOCUS_11090 2969 1830 gene locus_tag LOCUS_11100 2969 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence232 580 251 gene locus_tag LOCUS_11110 580 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1960 704 gene locus_tag LOCUS_11120 gene dinB 1960 704 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940720.1 protein_id gnl|my_center|LOCUS_11120 2788 2186 gene locus_tag LOCUS_11130 gene lexA 2788 2186 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942262.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence233 <1 744 gene locus_tag LOCUS_11140 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876818.1:histone deacetylase family protein 1316 741 gene locus_tag LOCUS_11150 1316 741 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_11150 2168 1368 gene locus_tag LOCUS_11160 2168 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2898 2152 gene locus_tag LOCUS_11170 2898 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence234 2332 446 gene locus_tag LOCUS_11180 2332 446 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544976.1 protein_id gnl|my_center|LOCUS_11180 2602 2348 gene locus_tag LOCUS_11190 2602 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence235 1096 1992 gene locus_tag LOCUS_11200 1096 1992 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626171.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence236 493 2814 gene locus_tag LOCUS_11210 493 2814 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence237 >Feature sequence238 1409 456 gene locus_tag LOCUS_11220 gene cas1 1409 456 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546247.1 protein_id gnl|my_center|LOCUS_11220 1742 1464 gene locus_tag LOCUS_11230 gene cas2 1742 1464 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545199.1 protein_id gnl|my_center|LOCUS_11230 2095 1958 gene locus_tag LOCUS_11240 2095 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 2324 2076 gene locus_tag LOCUS_11250 2324 2076 CDS product CRISPR-associated protein Csx3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546514.1 protein_id gnl|my_center|LOCUS_11250 2421 2660 gene locus_tag LOCUS_11260 2421 2660 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546702.1 protein_id gnl|my_center|LOCUS_11260 2653 3036 gene locus_tag LOCUS_11270 2653 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence239 732 121 gene locus_tag LOCUS_11280 732 121 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_11280 1801 809 gene locus_tag LOCUS_11290 gene pdxA 1801 809 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545509.1 protein_id gnl|my_center|LOCUS_11290 2219 1812 gene locus_tag LOCUS_11300 2219 1812 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_11300 2398 2628 gene locus_tag LOCUS_11310 2398 2628 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence240 <1 566 gene locus_tag LOCUS_11320 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546582.1:ATP-binding protein 570 1931 gene locus_tag LOCUS_11330 570 1931 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_11330 2344 1928 gene locus_tag LOCUS_11340 2344 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545633.1 protein_id gnl|my_center|LOCUS_11340 <3018 2356 gene locus_tag LOCUS_11350 <3018 2356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546489.1:sulfite exporter TauE/SafE family protein >Feature sequence241 799 431 gene locus_tag LOCUS_11360 799 431 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145023062.1 protein_id gnl|my_center|LOCUS_11360 1758 1123 gene locus_tag LOCUS_11370 1758 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 2849 1773 gene locus_tag LOCUS_11380 2849 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence242 <1 596 gene locus_tag LOCUS_11390 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544924.1:ATP synthase F1 subunit gamma 670 2085 gene locus_tag LOCUS_11400 gene atpD 670 2085 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546293.1 protein_id gnl|my_center|LOCUS_11400 2124 2528 gene locus_tag LOCUS_11410 2124 2528 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545870.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence243 283 747 gene locus_tag LOCUS_11420 gene atpF 283 747 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545851.1 protein_id gnl|my_center|LOCUS_11420 749 1291 gene locus_tag LOCUS_11430 gene atpH 749 1291 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546284.1 protein_id gnl|my_center|LOCUS_11430 1331 2839 gene locus_tag LOCUS_11440 gene atpA 1331 2839 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545369.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence244 <1 1005 gene locus_tag LOCUS_11450 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546667.1:peptidoglycan DD-metalloendopeptidase family protein 1017 2330 gene locus_tag LOCUS_11460 1017 2330 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_11460 2349 2425 gene locus_tag LOCUS_t00270 2349 2425 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2481 2557 gene locus_tag LOCUS_t00280 2481 2557 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence245 322 1521 gene locus_tag LOCUS_11470 322 1521 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_11470 1931 1500 gene locus_tag LOCUS_11480 1931 1500 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_11480 2367 1918 gene locus_tag LOCUS_11490 2367 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11490 >Feature sequence246 1188 988 gene locus_tag LOCUS_11500 1188 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1364 1185 gene locus_tag LOCUS_11510 1364 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 <2987 1505 gene locus_tag LOCUS_11520 <2987 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011417689.1:4-hydroxy-3-methylbut-2-enyl diphosphate reductase >Feature sequence247 628 176 gene locus_tag LOCUS_11530 628 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 <2975 719 gene locus_tag LOCUS_11540 <2975 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028539.1:VWA domain-containing protein >Feature sequence248 897 298 gene locus_tag LOCUS_11550 897 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1429 932 gene locus_tag LOCUS_11560 1429 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence249 1292 225 gene locus_tag LOCUS_11570 gene pheA 1292 225 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_11570 1788 1411 gene locus_tag LOCUS_11580 1788 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1924 2292 gene locus_tag LOCUS_11590 1924 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 <2965 2302 gene locus_tag LOCUS_11600 <2965 2302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545277.1:dihydropteroate synthase >Feature sequence250 920 1684 gene locus_tag LOCUS_11610 920 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 2298 1681 gene locus_tag LOCUS_11620 2298 1681 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence251 2473 1163 gene locus_tag LOCUS_11630 2473 1163 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946481.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence252 1816 1424 gene locus_tag LOCUS_11640 1816 1424 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545605.1 protein_id gnl|my_center|LOCUS_11640 2063 1833 gene locus_tag LOCUS_11650 2063 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2951 2178 gene locus_tag LOCUS_11660 2951 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence253 62 817 gene locus_tag LOCUS_11670 62 817 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937943.1 protein_id gnl|my_center|LOCUS_11670 822 1538 gene locus_tag LOCUS_11680 822 1538 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840185.1 protein_id gnl|my_center|LOCUS_11680 2604 1540 gene locus_tag LOCUS_11690 2604 1540 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence254 658 1920 gene locus_tag LOCUS_11700 658 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1922 2389 gene locus_tag LOCUS_11710 1922 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence255 1960 449 gene locus_tag LOCUS_11720 1960 449 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943547.1 protein_id gnl|my_center|LOCUS_11720 2113 2598 gene locus_tag LOCUS_11730 2113 2598 CDS product DUF2155 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940716.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence256 62 313 gene locus_tag LOCUS_11740 62 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 294 971 gene locus_tag LOCUS_11750 294 971 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880279.1 protein_id gnl|my_center|LOCUS_11750 1565 1053 gene locus_tag LOCUS_11760 1565 1053 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544998.1 protein_id gnl|my_center|LOCUS_11760 <2934 1567 gene locus_tag LOCUS_11770 <2934 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263145.1:formate dehydrogenase subunit alpha >Feature sequence257 96 1892 gene locus_tag LOCUS_11780 96 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11780 1912 2142 gene locus_tag LOCUS_11790 1912 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11790 >Feature sequence258 <1 659 gene locus_tag LOCUS_11800 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086859.1:beta-ketoacyl-ACP synthase II 1789 689 gene locus_tag LOCUS_11810 1789 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_11810 <2901 1786 gene locus_tag LOCUS_11820 <2901 1786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084205626.1:pyridoxal phosphate-dependent aminotransferase family protein >Feature sequence259 <1 1206 gene locus_tag LOCUS_11830 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879268.1:long-chain fatty acid--CoA ligase 1294 2271 gene locus_tag LOCUS_11840 1294 2271 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339265.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence260 456 94 gene locus_tag LOCUS_11850 gene rplR 456 94 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_11850 1025 480 gene locus_tag LOCUS_11860 gene rplF 1025 480 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_11860 1446 1054 gene locus_tag LOCUS_11870 gene rpsH 1446 1054 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545222.1 protein_id gnl|my_center|LOCUS_11870 1641 1456 gene locus_tag LOCUS_11880 1641 1456 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583358.1 protein_id gnl|my_center|LOCUS_11880 2211 1654 gene locus_tag LOCUS_11890 gene rplE 2211 1654 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842801.1 protein_id gnl|my_center|LOCUS_11890 2531 2211 gene locus_tag LOCUS_11900 gene rplX 2531 2211 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence261 1663 1175 gene locus_tag LOCUS_11910 gene hslV 1663 1175 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546241.1 protein_id gnl|my_center|LOCUS_11910 2100 1828 gene locus_tag LOCUS_11920 2100 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11920 2728 2201 gene locus_tag LOCUS_11930 2728 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11930 >Feature sequence262 1554 727 gene locus_tag LOCUS_11940 gene kdsA 1554 727 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_11940 <2895 1561 gene locus_tag LOCUS_11950 <2895 1561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436922.1:dihydrolipoyl dehydrogenase >Feature sequence263 <1 1136 gene locus_tag LOCUS_11960 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860184.1:flippase 1200 2297 gene locus_tag LOCUS_11970 gene pseC 1200 2297 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_11970 <2894 2303 gene locus_tag LOCUS_11980 <2894 2303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114865.1:carbamoyltransferase >Feature sequence264 402 1724 gene locus_tag LOCUS_11990 402 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1801 2421 gene locus_tag LOCUS_12000 1801 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence265 524 2026 gene locus_tag LOCUS_12010 524 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2601 2029 gene locus_tag LOCUS_12020 2601 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence266 <1 1241 gene locus_tag LOCUS_12030 <1 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583948.1:DNA polymerase/3'-5' exonuclease PolX 1374 2147 gene locus_tag LOCUS_12040 1374 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2151 2546 gene locus_tag LOCUS_12050 2151 2546 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence267 441 647 gene locus_tag LOCUS_12060 441 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1166 633 gene locus_tag LOCUS_12070 1166 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2571 1144 gene locus_tag LOCUS_12080 2571 1144 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942100.1 protein_id gnl|my_center|LOCUS_12080 2857 2564 gene locus_tag LOCUS_12090 2857 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence268 280 1068 gene locus_tag LOCUS_12100 280 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1314 1496 gene locus_tag LOCUS_12110 1314 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1519 1779 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttacgagataaaggcaggatctaatgtcacggtac 1924 2475 gene locus_tag LOCUS_12120 gene clpP 1924 2475 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111455.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence269 2198 1353 gene locus_tag LOCUS_12130 2198 1353 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330362.1 protein_id gnl|my_center|LOCUS_12130 2442 2693 gene locus_tag LOCUS_12140 2442 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence270 2088 1003 gene locus_tag LOCUS_12150 2088 1003 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870574.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence271 739 401 gene locus_tag LOCUS_12160 739 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1026 1817 gene locus_tag LOCUS_12170 1026 1817 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_12170 1819 2577 gene locus_tag LOCUS_12180 1819 2577 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544975.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence272 <1 1575 gene locus_tag LOCUS_12190 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057809.1:glycoside hydrolase family 57 protein 1734 1576 gene locus_tag LOCUS_12200 1734 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2006 2082 gene locus_tag LOCUS_t00290 2006 2082 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2084 2159 gene locus_tag LOCUS_t00300 2084 2159 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2270 2345 gene locus_tag LOCUS_t00310 2270 2345 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence273 1630 266 gene locus_tag LOCUS_12210 1630 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence274 823 1605 gene locus_tag LOCUS_12220 gene mtnP 823 1605 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868192.1 protein_id gnl|my_center|LOCUS_12220 1654 2529 gene locus_tag LOCUS_12230 gene gspC 1654 2529 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940998.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence275 1063 419 gene locus_tag LOCUS_12240 1063 419 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546873.1 protein_id gnl|my_center|LOCUS_12240 1847 1083 gene locus_tag LOCUS_12250 1847 1083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626546.1 protein_id gnl|my_center|LOCUS_12250 <2826 1831 gene locus_tag LOCUS_12260 <2826 1831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883993.1:iron ABC transporter permease >Feature sequence276 305 231 gene locus_tag LOCUS_t00320 305 231 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 799 1980 gene locus_tag LOCUS_12270 799 1980 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546823.1 protein_id gnl|my_center|LOCUS_12270 1977 2687 gene locus_tag LOCUS_12280 1977 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence277 <1 1155 gene locus_tag LOCUS_12290 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546159.1:sigma-54-dependent Fis family transcriptional regulator 1386 1724 gene locus_tag LOCUS_12300 1386 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2209 1730 gene locus_tag LOCUS_12310 2209 1730 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931985.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence278 1850 264 gene locus_tag LOCUS_12320 gene cimA 1850 264 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546272.1 protein_id gnl|my_center|LOCUS_12320 2538 2167 gene locus_tag LOCUS_12330 2538 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence279 468 184 gene locus_tag LOCUS_12340 468 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1503 490 gene locus_tag LOCUS_12350 1503 490 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176672.1 protein_id gnl|my_center|LOCUS_12350 2246 2584 gene locus_tag LOCUS_12360 gene yajC 2246 2584 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545404.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence280 1489 407 gene locus_tag LOCUS_12370 gene serC 1489 407 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_12370 2083 2271 gene locus_tag LOCUS_12380 2083 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2272 2526 gene locus_tag LOCUS_12390 2272 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence281 2382 1306 gene locus_tag LOCUS_12400 gene mnmA 2382 1306 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965531.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence282 414 992 gene locus_tag LOCUS_12410 gene hisB 414 992 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546516.1 protein_id gnl|my_center|LOCUS_12410 1004 2083 gene locus_tag LOCUS_12420 1004 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2080 2340 gene locus_tag LOCUS_12430 2080 2340 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545507.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence283 312 67 gene locus_tag LOCUS_12440 312 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 611 294 gene locus_tag LOCUS_12450 611 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 <2762 631 gene locus_tag LOCUS_12460 <2762 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_204874017.1:helicase-related protein >Feature sequence284 982 2148 gene locus_tag LOCUS_12470 982 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence285 2283 1819 gene locus_tag LOCUS_12480 gene nrdR 2283 1819 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence286 388 1446 gene locus_tag LOCUS_12490 gene rlmN 388 1446 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546659.1 protein_id gnl|my_center|LOCUS_12490 2514 1459 gene locus_tag LOCUS_12500 2514 1459 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942854.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence287 >Feature sequence288 2308 1991 gene locus_tag LOCUS_12510 2308 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence289 1165 155 gene locus_tag LOCUS_12520 gene trpD 1165 155 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_12520 1362 2702 gene locus_tag LOCUS_12530 1362 2702 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461538.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence290 1019 861 gene locus_tag LOCUS_12540 1019 861 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_12540 1114 2127 gene locus_tag LOCUS_12550 1114 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence291 360 1712 gene locus_tag LOCUS_12560 360 1712 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461538.1 protein_id gnl|my_center|LOCUS_12560 1714 2604 gene locus_tag LOCUS_12570 1714 2604 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545447.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence292 >Feature sequence293 1492 1950 gene locus_tag LOCUS_12580 1492 1950 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence294 <1 2215 gene locus_tag LOCUS_12590 <1 2215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393310.1:DUF3536 domain-containing protein >Feature sequence295 289 672 gene locus_tag LOCUS_12600 289 672 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_12600 704 2554 gene locus_tag LOCUS_12610 gene nuoF 704 2554 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence296 1022 711 gene locus_tag LOCUS_12620 1022 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1360 1019 gene locus_tag LOCUS_12630 1360 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2403 1429 gene locus_tag LOCUS_12640 gene fliM 2403 1429 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545847.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence297 447 1163 gene locus_tag LOCUS_12650 447 1163 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943929.1 protein_id gnl|my_center|LOCUS_12650 <2710 1245 gene locus_tag LOCUS_12660 <2710 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546396.1:transglycosylase SLT domain-containing protein >Feature sequence298 1422 754 gene locus_tag LOCUS_12670 1422 754 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546331.1 protein_id gnl|my_center|LOCUS_12670 2444 1539 gene locus_tag LOCUS_12680 gene folD 2444 1539 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941526.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence299 1657 1043 gene locus_tag LOCUS_12690 1657 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 <2698 1703 gene locus_tag LOCUS_12700 <2698 1703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942671.1:type IV pilus secretin PilQ >Feature sequence300 <2693 1207 gene locus_tag LOCUS_12710 <2693 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028842727.1:PD-(D/E)XK nuclease family protein >Feature sequence301 >Feature sequence302 277 876 gene locus_tag LOCUS_12720 277 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1154 1705 gene locus_tag LOCUS_12730 1154 1705 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544944.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence303 200 1192 gene locus_tag LOCUS_12740 gene cas1b 200 1192 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545370.1 protein_id gnl|my_center|LOCUS_12740 1217 1480 gene locus_tag LOCUS_12750 gene cas2 1217 1480 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013193.1 protein_id gnl|my_center|LOCUS_12750 1638 2655 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attagaagcctacctatgaggaattgaaac >Feature sequence304 1503 535 gene locus_tag LOCUS_12760 gene hemB 1503 535 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence305 1284 319 gene locus_tag LOCUS_12770 1284 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence306 72 866 gene locus_tag LOCUS_12780 gene mazG 72 866 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_12780 863 1762 gene locus_tag LOCUS_12790 863 1762 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544946.1 protein_id gnl|my_center|LOCUS_12790 <2672 1779 gene locus_tag LOCUS_12800 <2672 1779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392613.1:adenosylcobinamide-phosphate synthase CbiB >Feature sequence307 >Feature sequence308 775 269 gene locus_tag LOCUS_12810 775 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 940 2364 gene locus_tag LOCUS_12820 gene purF 940 2364 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546301.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence309 2104 1490 gene locus_tag LOCUS_12830 2104 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence310 <1 1062 gene locus_tag LOCUS_12840 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546683.1:isocitrate/isopropylmalate dehydrogenase family protein 1066 2328 gene locus_tag LOCUS_12850 1066 2328 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence311 774 22 gene locus_tag LOCUS_12860 gene map 774 22 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_12860 2082 775 gene locus_tag LOCUS_12870 gene secY 2082 775 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_12870 2527 2084 gene locus_tag LOCUS_12880 gene rplO 2527 2084 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546521.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence312 2078 174 gene locus_tag LOCUS_12890 2078 174 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544993.1 protein_id gnl|my_center|LOCUS_12890 <2663 2062 gene locus_tag LOCUS_12900 <2663 2062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000831659.1:DUF58 domain-containing protein >Feature sequence313 901 368 gene locus_tag LOCUS_12910 901 368 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_12910 1959 1144 gene locus_tag LOCUS_12920 1959 1144 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052693.1 protein_id gnl|my_center|LOCUS_12920 <2660 1956 gene locus_tag LOCUS_12930 <2660 1956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228167.1:ABC transporter ATP-binding protein >Feature sequence314 <1 537 gene locus_tag LOCUS_12940 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943656.1:acyl-[ACP]--phospholipid O-acyltransferase 571 1398 gene locus_tag LOCUS_12950 571 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence315 <1 969 gene locus_tag LOCUS_12960 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546604.1:sigma-54 dependent transcriptional regulator 1427 978 gene locus_tag LOCUS_12970 gene gspG 1427 978 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_12970 2156 1476 gene locus_tag LOCUS_12980 2156 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2340 2182 gene locus_tag LOCUS_12990 2340 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence316 <1 2642 gene locus_tag LOCUS_13000 <1 2642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545089.1:alanine--tRNA ligase >Feature sequence317 1911 802 gene locus_tag LOCUS_13010 gene hisC 1911 802 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546009.1 protein_id gnl|my_center|LOCUS_13010 <2641 1919 gene locus_tag LOCUS_13020 <2641 1919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943245.1:prephenate dehydratase >Feature sequence318 <2641 1986 gene locus_tag LOCUS_13030 <2641 1986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942953.1:mechanosensitive ion channel >Feature sequence319 790 62 gene locus_tag LOCUS_13040 790 62 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938322.1 protein_id gnl|my_center|LOCUS_13040 1614 1129 gene locus_tag LOCUS_13050 1614 1129 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_13050 2055 1651 gene locus_tag LOCUS_13060 2055 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2565 2104 gene locus_tag LOCUS_13070 2565 2104 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833896.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence320 2063 1101 gene locus_tag LOCUS_13080 gene hemC 2063 1101 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_13080 <2631 2083 gene locus_tag LOCUS_13090 <2631 2083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546522.1:glutamyl-tRNA reductase >Feature sequence321 109 1134 gene locus_tag LOCUS_13100 109 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1158 2507 gene locus_tag LOCUS_13110 1158 2507 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence322 <2616 2026 gene locus_tag LOCUS_13120 <2616 2026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080686.1:glycogen synthase >Feature sequence323 165 407 gene locus_tag LOCUS_13130 165 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 448 855 gene locus_tag LOCUS_13140 448 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 927 1370 gene locus_tag LOCUS_13150 927 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1384 2343 gene locus_tag LOCUS_13160 1384 2343 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937841.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence324 58 261 gene locus_tag LOCUS_13170 58 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 258 1025 gene locus_tag LOCUS_13180 258 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1022 1426 gene locus_tag LOCUS_13190 1022 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1526 1723 gene locus_tag LOCUS_13200 1526 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence325 902 2269 gene locus_tag LOCUS_13210 902 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence326 <1 817 gene locus_tag LOCUS_13220 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948151.1:FAD:protein FMN transferase 1307 1645 gene locus_tag LOCUS_13230 1307 1645 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272275.1 protein_id gnl|my_center|LOCUS_13230 1629 2153 gene locus_tag LOCUS_13240 1629 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2128 2337 gene locus_tag LOCUS_13250 2128 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence327 410 195 gene locus_tag LOCUS_13260 410 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 698 468 gene locus_tag LOCUS_13270 698 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1219 926 gene locus_tag LOCUS_13280 1219 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1588 2040 gene locus_tag LOCUS_13290 1588 2040 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546607.1 protein_id gnl|my_center|LOCUS_13290 2015 2449 gene locus_tag LOCUS_13300 2015 2449 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545150.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence328 1632 160 gene locus_tag LOCUS_13310 1632 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 2085 1651 gene locus_tag LOCUS_13320 2085 1651 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403203.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence329 1197 280 gene locus_tag LOCUS_13330 1197 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1437 1228 gene locus_tag LOCUS_13340 1437 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence330 <1 512 gene locus_tag LOCUS_13350 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546275.1:polyamine aminopropyltransferase 1222 515 gene locus_tag LOCUS_13360 1222 515 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546880.1 protein_id gnl|my_center|LOCUS_13360 <2573 1225 gene locus_tag LOCUS_13370 <2573 1225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545258.1:succinate dehydrogenase flavoprotein subunit >Feature sequence331 <1 830 gene locus_tag LOCUS_13380 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942923.1:phosphopyruvate hydratase 836 1150 gene locus_tag LOCUS_13390 836 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1154 1522 gene locus_tag LOCUS_13400 gene queD 1154 1522 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_13400 1757 2428 gene locus_tag LOCUS_13410 1757 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence332 749 937 gene locus_tag LOCUS_13420 749 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence333 <1 946 gene locus_tag LOCUS_13430 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546866.1:ribonuclease Y 964 1740 gene locus_tag LOCUS_13440 964 1740 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545500.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence334 44 532 gene locus_tag LOCUS_13450 44 532 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546719.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence335 1370 639 gene locus_tag LOCUS_13460 1370 639 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524570.1 protein_id gnl|my_center|LOCUS_13460 <2539 1373 gene locus_tag LOCUS_13470 <2539 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878793.1:CDC48 family AAA ATPase >Feature sequence336 >Feature sequence337 <1 588 gene locus_tag LOCUS_13480 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990798.1:YncE family protein 2031 595 gene locus_tag LOCUS_13490 2031 595 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_13490 <2527 2028 gene locus_tag LOCUS_13500 <2527 2028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141135.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence338 2158 1208 gene locus_tag LOCUS_13510 2158 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence339 1951 1115 gene locus_tag LOCUS_13520 1951 1115 CDS product DUF6502 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966857.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence340 214 1503 gene locus_tag LOCUS_13530 214 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1500 2345 gene locus_tag LOCUS_13540 gene ccsB 1500 2345 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393687.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence341 405 596 gene locus_tag LOCUS_13550 405 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 597 806 gene locus_tag LOCUS_13560 597 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 898 1935 gene locus_tag LOCUS_13570 898 1935 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_13570 2028 2495 gene locus_tag LOCUS_13580 2028 2495 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020220.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence342 270 85 gene locus_tag LOCUS_13590 270 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1337 684 gene locus_tag LOCUS_13600 1337 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1492 1698 gene locus_tag LOCUS_13610 1492 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610